Lecture Objectives Define Terms :
description
Transcript of Lecture Objectives Define Terms :
Lecture Objectives
Define Terms:Transcription, Translation, nucleic acid, amino acid, DNA, RNA, mRNA, cDNA, “ATCG”, Gene, Genomics, Protein, Proteomics, Exon, Intron, Chromosome, Nucleus, Ribosome, Diploid, Codon, UTR.
Explain Concepts:
1) How 24,000 genes in the human genome encode more than 100,000 proteins.2) How information flows through Transcription and Translation.3) 4 points of information control in the cell.4) Explain RNA splicing with respect to Exons and Introns.5) Explain the difference between a Haploid and a Diploid Cell.
CAGGACCATGGAACTCAGCGTCCTCCTCTTCCTTGCACTCCTCACAGGACTCTTGCTACTCCTGGTTCAGCGCCACCCTAACACCCATGACCGCCTCCCACCAGGGCCCCGCCCTCTGCCCCTTTTGGGAAACCTTCTGCAGATGGATAGAAGAGGCCTACTCAAATCCTTTCTGAGGTTCCGAGAGAAATATGGGGACGTCTTCACGGTACACCTGGGACCGAGGCCCGTGGTCATGCTGTGTGGAGTAGAGGCCATACGGGAGGCCCTTGTGGACAAGGCTGAGGCCTTCTCTGGCCGGGGAAAAATCGCCATGGTCGACCCATTCTTCCGGGGATATGGTGTGATCTTTGCCAATGGAAACCGCTGGAAGGTGCTTCGGCGATTCTCTGTGACCACTATGAGGGACTTCGGGATGGGAAAGCGGAGTGTGGAGGAGCGGATTCAGGAGGAGGCTCAGTGTCTGATAGAGGAGCTTCGGAAATCCAAGGGGGCCCTCATGGACCCCACCTTCCTCTTCCAGTCCATTACCGCCAACATCATCTGCTCCATCGTCTTTGGAAAACGATTCCACTACCAAGATCAAGAGTTCCTGAAGATGCTGAACTTGTTCTACCAGACTTTTTCACTCATCAGCTCTGTATTCGGCCAGCTGTTTGAGCTCTTCTCTGGCTTCTTGAAATACTTTCCTGGGGCACACAGGCAAGTTTACAAAAACCTGCAGGAAATCAATGCTTACATTGGCCACAGTGTGGAGAAGCACCGTGAAACCCTGGACCCCAGCGCCCCCAAGGACCTCATCGACACCTACCTGCTCCACATGGAAAAAGAGAAATCCAACGCACACAGTGAATTCAGCCACCAGAACCTCAACCTCAACACGCTCTCGCTCTTCTTTGCTGGCACTGAGACCACCAGCACCACTCTCCGCTACGGCTTCCTGCTCATGCTCAAATACCCTCATGTTGCAGAGAGAGTCTACAGGGAGATTGAACAGGTGATTGGCCCACATCGCCCTCCAGAGCTTCATGACCGAGCCAAAATGCCATACACAGAGGCAGTCATCTATGAGATTCAGAGATTTTCCGACCTTCTCCCCATGGGTGTGCCCCACATTGTCACCCAACACACCAGCTTCCGAGGGTACATCATCCCCAAGGACACAGAAGTATTTCTCATCCTGAGCACTGCTCTCCATGACCCACACTA
Central Dogma of Molecular Biology:
DNA acts as a template to replicate itself
DNA is also TRANSCRIBED into RNA
RNA is TRANSLATED into Protein
Human Genome:
Diploid (2 copies of genetic material)
46 Chromosomes (total)
Gender-specific Chromosomes:XX = FemaleXY = Male
Not all cells/organisms are diploid gametes = haploid (1 copy) wheat, corn = hexaploid (6 copies)
“Chromosome” literally means “color”And “body” described by early microscopists referring to the subcellular structures that stained by some dyes.
Human Genome:
1st Sequenced (Published) in February 2001
Over 3 Billion base pairs
Estimated 35,000 genes (20% have been patented!).Genes defined as regions of the genome that encode RNAthat are translated into proteins.
Estimated >100,000 proteins from 35,000 genes (only 1.5% of the genome are “genes”)Each gene can encode multiple proteins due to “alternative splicing”.
DNA
hnRNA
mRNA
Protein
Transcription
RNA Splicing
Translation
Promoterregion
“poly-A tail”
100-300 “A”UnTranslated Regions (UTR)3’ UTR before translation start site5’ UTR after translation stop site
Steps in Transcription:
1) Double-stranded DNA (gene) is separated into single strands.
2) RNA Polymerases make exact RNA template from DNA (hnRNA).
3) Introns are spliced out of hnRNA to make mRNA.
4) Poly-A tail is added to 3’ end of mRNA.
5) mRNA moves out of nucleus to ribosome (in the cytosol) where protein translation occurs (protein from mRNA template).
Protein –
“The structural, functional and secreted stuff”“The stuff you are made of”“skin, hair, cartilage, tendons, eye color, etc.”“where genetic information is translated into function”
Made up of 20 different amino acids that each harbor different molecular characteristics (soluble, insoluble, acidic, basic, etc, etc).
Protein Dogma:
Sequence of amino acids confers specific 3D characteristics
3D characteristics correlates with function
Depiction of a protein in 3D
Protein TRANSLATION from mRNA
The genetic “bit” information to encode a specific amino acid is contained in a gene’s Codon. A Codon is a 3-base (3-nucleotide) sub-sequence that defines the amino acid to be incorporated into the protein.
All proteins start with the Codon ATG (DNA notation) or AUG (RNA), which encodes for the amino acid Methionine.
This start or “initiation” codon sets the “Reading Frame” for Translation.
Many genetic mutations involve the deletion of a single nucleotide, which causes a “Frame Shift” (aka Frame Shift Mutation), disrupting the Translational process causing a change in the amino acid composition and alters the stop codon for all amino acids “Down stream” from this type of mutation.
THEREDCAT_HSDKLSD_WASNOTHOTBUT_WKKNASDNKSAOJ.ASDNALKS_WASWET_ASDFLKSDOFIJEIJKNAWDFN_ANDMAD_WERN.JSNDFJN_YETSAD_MNSFDGPOIJD_BUTTHEFOX_SDKMFIDSJIR.JER_GOTWET_JSN.DFOIAMNJNER_ANDATEHIM.
THEREDCATWASNOTHOTBUTWASWETANDMADYETSADBUTTHEFOXGOTWETANDATEHIM
Start with a thin 2 x 4 lego block…
Add a 2 x 2 lego block…
Add a 2 x 3 lego block…
Add a 2 x 4 lego block…
4 points of molecular information control
1) Transcriptional ControlControl of which genes are “used” or “expressed” by the cell.
2) RNA Processing or SplicingEditing out of introns and sometimes key exons.
3) Translational ControlControl of the amount of protein made from mRNA.
4) Protein Activity ControlControl of how a protein’s activity.