Lab 04 - Microevolution

1

Lab 04 Microevolution: Evolution in the short term What does it mean for a population to evolve? In its simplest, evolution happens when the frequency of individuals with certain genetic traits (gene or allele frequencies) changes in a population over generations. This is often called microevolution. Each individual is born with all the genetic variety it will ever have. With very specific exceptions, this will not change, therefore: AN INDIVIDUAL CANNOT EVOLVE!

Note: individual in this case is a single member of any given species, not just a human individual. The basis for microevolution is also the cornerstone of population genetics. If this was ecology, you can think of this as the distribution and abundance of different genotypes. After the rediscovery of Mendels paper, some argued that it would not work because the dominant allele would increase in a population. Others found that no, without some force acting on it, the frequencies would remain stable. In 1908, this disagreement was introduced to a British mathematician named G.H. Hardy by his cricket buddy, Reginald Punnett (whose squares you may know). Hardy figured out that no matter what the initial genotype frequencies of a population, after 1 generation of random mating, (given no other effects), the genotype frequencies will be in the following ratio:

p2 : 2pq : q2 Where, p = frequency of allele 1 (A1) q = frequency of allele 2 (A2) p2 = frequency of individuals homozygous for A1 (=A1A1) 2pq = frequency of heterozygous individuals (=A1A2 + A2A1) q2 = frequency of individuals homozygous for A2 (=A2A2) (note p + q = 1 and p2 + 2pq + q2 = 1, since frequencies always add up to 1).

Glossary: A gene is a section of DNA that serves a specific function (like coding for a protein). An allele is a version of a gene. There can be any number of versions (differences in DNA sequence, for example) of a gene in a population, but individuals are limited to one or two per gene. A genotype refers to both copies of the gene in an individual (one from mommy and one from daddy). An individual can be homozygous if both copies are the same, or heterozygous if it has different versions (or alleles). A phenotype is the outward appearance of a genotype. What the genes do. What the thing looks like.

2

Turns out that a German Jewish physician and obstetrician-gynecologist was working on the same problem at the same time. His name was Wilhelm Weinberg (since he is German, it is pronounced Vine-berg). Actually, Weinberg presented his ideas publically before Hardy, but since genetics at the time was dominated by English-speakers, his work was mostly ignored and this concept was called Hardys law or Hardys formula for some time. We now know this as the Hardy-Weinberg Principle. It states what happens if nothing alters the genotype frequency of a focal generation (= genetic equilibrium). In another sense, given no outside influence, neither the allele frequencies (p + q = 1), nor the genotypic frequencies (p2 + 2pq + q2 = 1) in a population will change. They will remain in the above ratio. The population would thus be considered to be in Hardy-Weinberg Equilibrium (HWE). A population in HWE is not evolving. If a population is not evolving, its allele frequencies will not change between generations. Therefore p in generation 1 will equal p in generation 2. You can test this statistically by considering the first generation as the expected and the second as the observed in a Fishers exact test (something like a chi square analysis for small sample sizes). But what can throw a population out of HWE? The things that alter the allele frequencies of a population are the same things that make a population evolve. They are:

1. Mutations 2. Gene Flow 3. Individuals Mate Nonrandomly 4. Natural Selection 5. Genetic Drift (often written as small population size)

If a population is in HWE, we can assume that none of these things is happening. They are often referred to in the negative as the assumptions of Hardy-Weinberg. If these assumptions are not met, and one or more of them is/are happening, then gene frequencies will change between generations and the population will evolve. Its that simple. But what do these things mean? Well since I know you are such a fan of definitions, here are some definitions: Causes of evolution 1. MUTATION- any change in the nucleotide sequence of DNA. The ultimate source of all variation. That is, all variation in all organisms began as a mutation. Since DNA codes for proteins which control phenotype, mutations control all phenotypes in some way or another. Mutations increase variation, but since mutations are rare, only slightly.

e.g., GACTTAGCTTAAGCATAGCAGGTAGAT is changed to GACTTAGCTAAAGCATAGCAGGTAGAT

The picture to the left shows the results of a single nucleotide difference in these lizards. At first, the lizards were all brownish, but a mutation in one lineage caused one population to produce white individuals. The mutation that caused the white phenotype is actually adaptive (see below) and is higher in frequency in lizards that live on white sand.

3

2. GENE FLOW- the gain or loss of alleles in a population by the movement of individuals into or out of that population. Gene flow can increase variation in a population, but only by bringing in alleles that originally mutated elsewhere.

GENERATION 1: Population 1 Population 2

GENERATION 2: Population 1 Population 2

3. NON-RANDOM MATING- (aka assortative mating). Individuals mate according to their genotypes. Random in this case means that individuals mate with individuals of a given genotype in proportion to their frequency in the population, yknow, randomly. As an example, say A1A1 is at a frequency of 0.9. If an individual mates randomly, it has a 90% chance of mating with an individual that is A1A1. If the population mates nonrandomly, a given genotype in a population is not equally likely to mate with every other genotype in proportion to their frequency. Therefore, an individual might mate with an A1A1 individual more or less than 90%. This alters the genotypic frequencies from those expected under HWE. Organisms might not mate randomly due to limited movement (e.g., flowers across a field), or different preferences (mating because of color, dance moves, etc) or ability (cant mate because of differences in size or shape, like a greyhound and a chihuahua.)

There are two ways to mate nonrandomly: Negative Assortative mating - different genotypes more likely to mate. Increases heterozygosity (Aa) and throws off the H-W ratio. Positive Assortative mating - like mates with like (related to inbreeding). Increases homozygosity (AA or aa) and throws off the H-W ratio.

movement of individuals

4

4. NATURAL SELECTION - nonrandom rates of reproductive success caused by differences among individuals reacting with the environment. Evolution by natural selection requires:

A. Variation in traits B. Correlation between traits and reproductive success (survival x reproduction = fitness) C. Traits must be inherited (i.e., genetically-based) in order for the population to evolve

Both Charles Darwin and Alfred Russel Wallace noticed that individuals in a population are phenotypically different (= variation). These differences cause some individuals to be better at surviving and reproducing than others (= more fit, selected). If those differences are inherited, then individuals that survive and reproduce more will contribute more offspring, thus passing those selected traits on to the next generation. Contrastingly, individuals with less fit traits will contribute fewer individuals, thus reducing the number of individuals with the worse traits in the next generation. Therefore fit genotypes will increase in frequency, while unfit traits will decrease, causing the population to leave HWE.

Although both discovered this concept independently, Darwin named it natural selection and spent 20 years gathering evidence for his controversial idea. He wrote his tome on it called, On the Origin of Species by Means of Natural Selection or the Preservation of Favoured Races in the Struggle for Life. Think reading my manuals is tedious, thats just the title of his book. Since then, natural selection has been measured and tested numerous times in the wild and in field and laboratory experiments. One of the most commonly used examples is pesticide resistance. For instance, some rats had a mutation that gave them resistance to warfarin, a pesticide. The frequency of this mutation increased dramatically when the pesticide was used, but because rats with this mutation also need a diet higher in vitamin-K, they are at a disadvantage in the absence of warfarin. Therefore, when its use was stopped, the frequency of the mutation dropped again. Selection is the only thing that will cause adaptive change. All adaptations (traits that are high in frequency because they increase fitness) are due to selection. However, selection does not depend on trying. An organism cannot desire an adaptation and make it happen. An individual cant adapt. Selection acts on variation among individuals in a population that was there already. Some individuals do better, some do worse. Scientists have found plenty of variation among organisms for selection to play with. There is variation at pretty much every level: base pairs, alleles, gene copies, phenotypes. Do you remember where this variation comes from?

Natural selection is a directional process, but it does not have a goal. Traits are selected because of current environmental conditions. Bigger, faster, stronger are not always better. And if the environment changes (and most of it evolves too), then which traits are most fit will change.

5

5. GENETIC DRIFT- the fluctuation of allele frequencies due to random sampling error or chance. Not all individuals in a population will survive and reproduce and not necessarily because of any particular trait they possess. For example, if an elephant crashes through the woods for fun and accidentally steps on half a population of daisies, then half the population will not reproduce. Was this because the surviving half was elephant-resistant? No. They just happened not to be stepped on.

In another sense, drift is random sampling error. For instance, if you were to explain the alphabet to someone who did not know it by pulling 26 tiles from a Scrabble bag, would your lesson be complete? Chances are you would have multiples of some letters, like E which has 12 representative tiles, while missing others like K which is represented by only 1 tile. On the other hand, try it again and you may get a K and miss all 4 Ls. What does this mean in nature? It means that not all genes are passed on to the next generation. Which genes are not passed does not always depend on the genes themselves, as it does in selection. Genes that are randomly not passed on will decrease in frequency. Here is the genetic version; Imagine a population that is all homozygous for allele 1 (A1). One individual has a mutation, creating a new version of this gene: allele 2 (A2). This new mutation is obviously rare since there is only one copy of it. Well, assuming the mutant mates at all, there is still a high chance that this allele will not be passed on. Heres how it works:

The individual with the new mutation will be heterozygous (A1A2). Since all the other individuals of this population are homozygous for the other allele (it hasnt

appeared for them yet), this individual will be mating with an individual that is A1A1. This mating will produce offspring in the following proportions:

Female

Mal

e

A1 A2

A1 A1A1 A1A2

A1 A1A1 A1A2

Each offspring has a 50% chance of not inheriting A2. There is a 50% chance that the allele is

lost right there.

6

The fewer offspring they have, the more likely A2 will be lost. In fact, alleles that are rare in a population are more likely to get passed over than common ones, just like that K Scrabble tile. Thats just the luck of the draw. Actually, the likelihood that an allele will rise to 100% (become fixed) or drop to 0% (be lost) is equal to its proportion in the population in any given generation. Drift is a mathematical certainty in finite populations (which all populations are) therefore, some scientists hold that if a population is out of HWE, drift should be assumed to be the reason, unless there is evidence otherwise. ****The Importance of Population Size Genetic drift is related to population size: The larger the population, the less likely a certain trait is to become fixed (be found in 100% of individuals) or lost (found in 0% of individuals) simply by chance. Therefore, genetic drift has a bigger impact on small populations. For example, if the daisy population above consists of 10 individuals and 5 are killed by a footloose elephant, then 50% of all genotypes will instantly be wiped out. However, if the elephant kills 5 daisies from a population of 100, only 5% of the genotypes are lost.

Once an allele is lost, it is lost forever unless it is reinstated via mutation or gene flow. However, a new mutation will only be in a really small number of individuals and so is more likely to be lost. This is why endangered species are so sad. Their small populations mean that much of the variation they once had is gone and whats left is represented only by a small number of individuals. If any of those individuals die before reproducing, then even more traits will be lost.

If a population is infinite in size (or at least really large), then traits are not likely to become lost simply due to chance. You can see the effect of initial gene frequency (p), population size (n), and number of generations on the likelihood that a gene will go to fixation (p = 1) or be lost (p = 0) here: http://darwin.eeb.uconn.edu/simulations/jdk1.0/drift.html .

Here is an analogy: think of a drunk walking between platforms at a train station. He wobbles widely as he walks, but he is determined to get from one end of the station to the other. Which is he more likely to fall off of (1) a platform that is 10 feet wide or (2) a platform that is 40 feet wide? Does it depend on whether he starts on the edge or in the middle?

Similarly, is a gene that has an initial frequency of 0.1 (= 10% of individuals carry this gene) more or less likely to be lost than a gene with a frequency of 0.9 (= 90% of individuals carry this gene)? What happens after a gene is fixed or lost? Play with the website above. Notice what happens with the same parameters in multiple runs. Are they always the same? Contrastingly, natural selection works best on large populations. Larger populations are more likely to carry greater genetic variation. The more variation, the choosier selection can be, and the more adaptable the population; therefore larger populations can become better fit than smaller populations, which cannot react to selection as easily and are more likely to lose variation due to drift. ****

7

Ok, thats what can cause a population to evolve. In order to test it though, we measure the allele frequencies at generation 1 and compare it to generation 1+ n, using Fishers exact test or chi square to determine if the frequencies have changed significantly over time. This again, is microevolution. It looks something like this:

Karell et al. (2011) studied the microevolutionary changes in tawny owl (Strix aluco) coloration in a population of owls in Finland. This species has two color morphs: brown and grey. This plumage coloration is inherited in a classic Mendelian fashion with brown being dominant over grey. Normally, during winter, when the landscape is covered in snow, the grey morph is more fit, since it provides camouflage against the white background. However, in the last few decades, the Finnish winters have been much milder, and there has been less snow. Therefore, the brown morph has become the more fit morph, and, as a result, the frequency of brown morphs increased rapidly in their study population during the last 28 years and nationwide during the last 48 years. You can see the frequency of the brown morph rise over time due to natural selection in the graph above. When the frequency of alleles changes in a population over generations, the population gets out of HWE, and evolution happens.

These results are from a nationwide population frequency of brown individuals based on all breeding birds ringed or recaptured by amateur ringers in Finland and had their color scored as either grey or brown. Symbols are mean annual frequencies of the brown morph in 5-year periods (s.e.m.). Total sample size is given along the x axis. (Karell et al. 2011. Nature Communications. 2:208)

8

ACTIVITY!! READ THE COMPLETE INSTRUCTIONS FOR EACH EXPERIMENT BEFORE BEGINNING EACH EXPERIMENT!!! In the following simulations, we will investigate each of the assumptions of Hardy-Weinberg (except nonrandom mating) and how they affect the frequencies of traits in a population of Beadius ponius. Pretend that you are population geneticist interested in the evolution of your favorite population of Beadius ponius (the pony bead). These are small round organisms with hard shells and a complete digestive tract that are native to biology labs. They are haploid, meaning that they only have one copy of their chromosomes and can only possess one allele at a time. Therefore whatever allele they have, that is their genotype (there are no heterozygotes) and their phenotype (there are no other alleles to cover it up).

Allele = Genotype = Phenotype They are asexual and reproduce by splitting into two (binary fission). Whatever allele an individual has, it will give that same allele to its entire offspring, unless mutations occur.

Individual = one bead Trait/phenotype = color of the bead Environment = box p and q = frequency of different alleles.

Since these organisms are haploid, which is dominant is irrelevant. n = the number of individuals in the population.

You have been studying populations of this species for some time. You collect individuals each generation and separate them by phenotype and thus determine allele frequencies. You have noticed that some outside force is causing the populations genetic frequency to change. But is this enough to cause them to evolve significantly? Unless something is happening otherwise (like drift or selection), you can assume all individuals survive and reproduce equally. Assign different jobs to your group members. These jobs can rotate between experiments. Each experiment needs:

1. A game warden- this person is in charge of the individuals within the population. He/she controls their foraging location (puts them in the box), helps them reproduce (by adding more beads), and counts their survival.

2. Outside forces- 1-2 people that act as the selection, mutation, etc force

that acts on the individuals of the population.

3. An observer- this is the note taker who records and diagrams (using a line chart in the space provided below) the effects of the outside force on the population gene frequencies

9

Use the tables and charts below the procedures for your notes and to plot the results. Make sure you plot the frequency ( f ) of p, not the absolute numbers. In nature, the relative abundance of a trait is often more important than the absolute number because population sizes can vary. Frequencies are just like percents, except instead of being on a scale of 0-100, they are on a scale of 0-1. For instance, an allele possessed by 98% of individuals would be at a frequency of 0.98. USE LINES!! ***When there are only two alleles (p and q) in a population, as one increases the other decreases because p + q = 1, every time. Since we only have two alleles to follow here, and they go up and down proportionately, we only have to draw one line. Each of your graphs should look similar to the following.

Use the data sheets below to keep track of allele frequencies and for your graphs. YOU WILL NOT TURN IN YOUR RAW DATA, JUST THE GRAPHS (INCLUDED ON THE HOMEWORK SHEETS). You can use Fishers exact test or chi square analysis (see first lab manual) to test whether or not the gene frequencies changed between the first generation of testing (use this as your expected frequencies) and the last generation of testing (use this as your observed frequencies). Use the actual numbers here though, not the frequencies. Also, answer the questions in each section. You will turn this in for a grade.

p = 0.2 q = 0.8

10

A. SCENARIO 1: MUTATION In this scenario, you will follow the effects of mutation on genetic variation. To start with, you will create a monomorphic population, i.e. one with no variation.

1. Game warden creates a population with the following genetic make-up:

n = 20 p = 1.0 q = 0.0 This is Generation 1.

2. Observer records trait number and frequency below.

3. In Generation 2, the individuals reproduce and replace themselves, so n does not change.

However, one individual produced a mutant offspring, so the Outside force haphazardly replaces one of these offspring with a bead of a second color (q). This represents a mutation that happened in an individual between the first and second generations.

4. Observer records allele frequencies of this generation.

5. In Generation 3, all individuals reproduce themselves again without changing the population size. No mutations occur this generation. Observer records allele frequencies of this generation.

6. In Generation 4, all individuals reproduce themselves again without changing the population size. No mutations occur this generation. Observer records allele frequencies of this generation.

7. Record the number of individuals of each phenotype and the allele frequencies for each generation.

Generations 1 2 3 4 Phenotype: # f # f # f # f A: p

B: q

Total: 1 1 1 1

8. Plot the frequency changes over the generations in the homework section below.

11

B. SCENARIO 2: GENE FLOW Gene flow is the movement of alleles between populations. Therefore, you will need to follow allele frequency changes in two populations.

1. Game warden creates TWO populations with the following genetic make-ups:

Population 1 n = 20 p = 0.9 q = 0.1

Population 2 n = 20 p = 0.1 q = 0.9 This is Generation 1.

2. Observer records trait frequency separately for each population.

3. Before Generation 2, individuals migrated from one population to the other. Outside force moves FIVE (5) individuals of any type from each population to the other population. This is gene flow. The individuals reproduce and replace themselves without changing the population size.

4. Observer records allele frequencies of this generation separately for EACH population.

5. Repeat steps 2-4 to create Generation 3.

6. Repeat steps 2-4to create Generation 4.

9. Record the number of individuals of each phenotype and the allele frequencies for each population. Population 1 Generations

1 2 3 4 Phenotype: # f # f # f # f A: p

B: q

Total: 1 1 1 1

Population 2 Generations 1 2 3 4 Phenotype: # f # f # f # f A: p

B: q

Total: 1 1 1 1

12

NONRANDOM MATING Nonrandom mating changes genotypic frequencies rather than allelic frequencies. This means that it alters the proportion of homozygotes and heterozygotes in a population, rather than the frequency of p and q. Since our beads are haploid and asexual, we wont measure this mechanism of evolution in this population.

C. SCENARIO 3: NATURAL SELECTION In this scenario, the beads represent prey individuals and the Outside force is a selective pressure. In other words, the outside force is a Predator selecting on them. Make sure the predator is not watching where the prey go initially, but he/she can look when hunting. Only 1 predator hunts at a time, but who is the predator can change between generations.

1. Game warden creates a population of the following genetic make-up in the ENVIRONMENT (BOX) given:

n = 40 p = 0.5 q = 0.5

Place them randomly, but on top of the environment (these critters aint fossorial). Make sure that the outside force (predator) is not watching where they go. This is Generation 1.

2. Observer records allele frequencies.

3. The predator then gets the chance to hunt and eat these prey. To do so, the predator removes

TWENTY (20) individuals as fast as possible (so you might want to start with the easiest to find or capture). KEEP YOUR EYES OPEN! However, these prey take some handling time, so the predator can only pick up 1 at a time. He/she must then place it on the table outside of the environment (consider this prey individual to be dead and consumed) before moving on to the next prey individual. To recap:

o locate and remove 1 bead at a time o place it on the table o then look for another bead

4. The observer records how many of each phenotype are left in the environment.

5. The ones left then reproduce to create Generation 2. Therefore, for each bead left in the

environment, the game warden puts in 1 additional bead of the same phenotype. In other words, double the number and type of beads left in the box.

6. Observer records the number of each phenotype in this new generation.

7. Repeat steps 3-6 to create Generations 3-8.

13

8. Record the number of individuals of each phenotype and the allele frequencies for each generation. SCENARIO 3: NATURAL SELECTION Generation 1 Phenotypes . # f # removed # left # added

A p

B q

Total: 40 1 20 20 20 Generation 2 Phenotypes # f # removed # left # added

A p

B q

Generation 3 Phenotypes # f # removed # left # added A p

B q


B q


B q


B q


B q


B q

14

D. SCENARIO 4: GENETIC DRIFT In this scenario, you will simulate the effects of genetic drift. Remember that drift is very different from selection. Instead of selecting based on phenotype, you will be taking a random sample to start the next generation. Note that you will be running this scenario multiple times, each with different starting conditions. 1. Game warden creates a population of the following genetic make-up in the PAPER BAG provided.

Population 1

n = 60 p = 0.5 q = 0.5 This is Generation 1.

2. Outside force, this time acting as genetic drift (more specifically founders effect, a type of

bottleneck), removes HALF of the individuals from the bag, without looking.

3. Observer records the allele frequencies of those sampled. These individuals will start the next generation.

4. Game warden removes all the leftover individuals from the bag. Then add those sampled above plus one additional bead for every one sampled of the same phenotype. In other words, double the number and type of beads you put back in the bag. This is Generation 2.

5. Observer records the number of each phenotype in this new generation.

6. Repeat steps 2-4 to create Generations 3-8.

7. Repeat steps above, but with the following initial conditions to create Populations 2 4. Note that each population starts at a different size, but the population size does not change each generation.

Population 2 n = 12 p = 0.5 q = 0.5

Population 3

n = 20 p = 0.9 q = 0.1

Population 4

n = 20 p = 0.1 q = 0.9

15

8. Record the number of individuals of each phenotype and the allele frequencies for each generation.

GENETIC DRIFT POPULATION 1 Generation 1 Phenotypes . # f # sampled # added

A p

B q

Total: 60 1 30 30 Generation 2 Phenotypes # f # removed # added

A p

B q

Generation 3 Phenotypes # f # removed # added A p

B q


B q


B q


B q


B q


B q

Population 1 n = 60 p = 0.5 q = 0.5

16


A p

B q


A p

B q


B q


B q


B q


B q


B q


B q

Population 2 n = 12 p = 0.5 q = 0.5

17


A p

B q


A p

B q


B q


B q


B q


B q


B q


B q

Population 3 n = 20 p = 0.9 q = 0.1

18


A p

B q


A p

B q


B q


B q


B q


B q


B q


B q

Population 4 n = 20 p = 0.1 q = 0.9

19

Lab 04: Microevolution Postlab Name ______________________________ A. SCENARIO 1: MUTATION

1. Plot the frequency of p in this population.

2. Did the mutation you observed cause a lot of change in this population?

3. What did mutation do to the genetic variation in your population? Did it increase or decrease it?

4. What happens to the allele frequencies when no mutations happen?

5. Assume this is a brand new mutation found nowhere else. Other than identical spontaneous

mutation in this population (which is rare), what forces can cause the frequency of this new allele to rise in this population?

6. Why are mutations important for evolution?

Key allele phenotype p q

20

B. SCENARIO 2: GENE FLOW

7. Plot the frequency of p for each population.

8. Before there was gene flow, each population had a very common allele, what does gene flow do to the variation within each population?

9. Before there was gene flow, these populations had very different genetic make-ups. What does gene flow do to the variation between the two populations?

10. Name one adaptation (a physical trait, not a mechanism) in animals and one in plants that help genes flow between populations.


21

C. SCENARIO 3: NATURAL SELECTION 11. Plot the frequency of p for this population, including what the 9th generation would look like.

12. Describe your results in terms of the different phenotypes and their effects on fitness: a. Was an allele selected for? Was an allele selected against? Which ones?

b. Did one get lost? Did one go to fixation? Which ones?

c. Which allele had the highest fitness? What role did the environment (the background color and the predator) have to do with this?

13. Was there significant evolution due to selection in this population? If instructed, provide your x2- and p-values by comparing the initial number of individuals of each allele (frequency at generation 1 = expected frequency; as if there was no change) and the number of individuals of each allele at generation 9. Use your statistics to conclude. Show your work.

Key allele phenotype p

q

background color

22

D. SCENARIO 4: GENETIC DRIFT Plot the frequency of p for each population, including what the 9th generation would look like.

Population 1

n = 60 p = 0.5 q = 0.5

Population 2 n = 12 p = 0.5 q = 0.5

Population 3 n = 20 p = 0.9 q = 0.1

Population 4 n = 20 p = 0.1 q = 0.9

14. Population 1

15. Population 2

16. Population 3

17. Population 4

18. How does drift work? What causes a change in allele frequency due to drift?

19. How is drift different than selection?


23

20. What effect does population size have on genetic drift? This should be apparent from your results for questions 14 and 15.

21. What effect does initial allele frequency have on genetic drift? This should be apparent from your results for questions 16 and 17.

22. What effect does phenotype have on genetic drift?

The following questions are about evolution in general. 23. What happens to genetic variation after an allele is lost? What would it take to increase variation?

24. Does an allele have to be lost for evolution to occur? Why or why not?

25. Why cant an individual evolve? Refer to the definition of evolution in your answer.

Lab 04 - Microevolution

Documents

Transcript of Lab 04 - Microevolution