Immunoglobulin V regions diversify by gene conversion in DT40 cells
Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN...
-
Upload
jeffry-walton -
Category
Documents
-
view
215 -
download
0
Transcript of Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN...
![Page 1: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40.](https://reader038.fdocuments.in/reader038/viewer/2022110211/56649ef45503460f94c07f2a/html5/thumbnails/1.jpg)
killer vegetables, animal-human hybrids, other scary stuff.
Chapter 1: Epistasis for beginners
KEVIN HIOM
Galway 2010
Basic principles of DT40
![Page 2: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40.](https://reader038.fdocuments.in/reader038/viewer/2022110211/56649ef45503460f94c07f2a/html5/thumbnails/2.jpg)
DT40: A genetically tractable eukaryotic cell line
DT40
• Genetically tractable• Good model for genome stability in mammals• Complementation by human genes• Good database
versus humans
![Page 3: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40.](https://reader038.fdocuments.in/reader038/viewer/2022110211/56649ef45503460f94c07f2a/html5/thumbnails/3.jpg)
Genetically tractable DT40
All these require manipulation of the genome
Phenotypic analysis
Knocking out or mutating genes and looking at cellular function
Mapping genetic pathways
Combining mutations- epistasis
Structure/function analysis/ cell biology
Complementation, proteomics
Genetic regulation
Reporter assays
![Page 4: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40.](https://reader038.fdocuments.in/reader038/viewer/2022110211/56649ef45503460f94c07f2a/html5/thumbnails/4.jpg)
Integrate DNA
Target DNA
Alter DNA
Remove DNA
*
*
![Page 5: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40.](https://reader038.fdocuments.in/reader038/viewer/2022110211/56649ef45503460f94c07f2a/html5/thumbnails/5.jpg)
Random Integration- non homologous end joining
Targeted Integration- Homologous/Homeologous recombination
Site specific recombination
Genetic Recombination is our tool
![Page 6: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40.](https://reader038.fdocuments.in/reader038/viewer/2022110211/56649ef45503460f94c07f2a/html5/thumbnails/6.jpg)
Non Homologous End Joining-Random integration
Advantages
SimpleRelatively high frequency
Potential uncharacterised genetic effectMultiple integrationShut down of expression
Disadvantages
Ku, DNA-PKcs, LigIV,
![Page 7: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40.](https://reader038.fdocuments.in/reader038/viewer/2022110211/56649ef45503460f94c07f2a/html5/thumbnails/7.jpg)
Homologous recombination- site specific integration, gene disruption, mutation
DNA End ResectionMre11/RAD50/NBS1, CtIP, Exo1
Strand InvasionRAD51
ResolutionSlx1/4, GEN1
Branch MigrationRAD51BCDHolliday Junctions
![Page 8: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40.](https://reader038.fdocuments.in/reader038/viewer/2022110211/56649ef45503460f94c07f2a/html5/thumbnails/8.jpg)
Homologous recombination
![Page 9: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40.](https://reader038.fdocuments.in/reader038/viewer/2022110211/56649ef45503460f94c07f2a/html5/thumbnails/9.jpg)
Homologous Recombination
Advantages
Acurate/error free Introduction of multiple changes
Disdvantages
Easy to introduce errorsAberrant recombinationNeighbouring sequencesEpistasis difficult for HR genes
![Page 10: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40.](https://reader038.fdocuments.in/reader038/viewer/2022110211/56649ef45503460f94c07f2a/html5/thumbnails/10.jpg)
Site specific recombination- cre/lox
ATAACTTCGTATAGCATACATTATACGAAGTTAT
LOXP
![Page 11: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40.](https://reader038.fdocuments.in/reader038/viewer/2022110211/56649ef45503460f94c07f2a/html5/thumbnails/11.jpg)
Site specific recombination- re-using antibiotic resistance
Cre recombinase
drugr
synapsis
excision
![Page 12: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40.](https://reader038.fdocuments.in/reader038/viewer/2022110211/56649ef45503460f94c07f2a/html5/thumbnails/12.jpg)
Site specific recombination
Courtesy of the National Library of Medicine (NLM)
![Page 13: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40.](https://reader038.fdocuments.in/reader038/viewer/2022110211/56649ef45503460f94c07f2a/html5/thumbnails/13.jpg)
Understanding recombination is the key to manipulating the DT40 genome
![Page 14: Killer vegetables, animal-human hybrids, other scary stuff. Chapter 1: Epistasis for beginners KEVIN HIOM Galway 2010 Basic principles of DT40.](https://reader038.fdocuments.in/reader038/viewer/2022110211/56649ef45503460f94c07f2a/html5/thumbnails/14.jpg)
3 copies of chromosome 2
Genomes are ‘plastic’- Don’t culture for too long
Words of warning