Katrina Mealey, DVM, PhD DACVIM, DACVCP ABC’s of Research: Role of Serendipity, Perseverance, and...

20
Katrina Mealey, DVM, PhD DACVIM, DACVCP ABC’s of Research: Role of Serendipity, Perseverance, and Risk Pharmacogenetics of ABC Transport Proteins in Veterinary Patients

Transcript of Katrina Mealey, DVM, PhD DACVIM, DACVCP ABC’s of Research: Role of Serendipity, Perseverance, and...

Page 1: Katrina Mealey, DVM, PhD DACVIM, DACVCP ABC’s of Research: Role of Serendipity, Perseverance, and Risk Pharmacogenetics of ABC Transport Proteins in Veterinary.

Katrina Mealey, DVM, PhD

DACVIM, DACVCP

ABC’s of Research: Role of Serendipity, Perseverance, and Risk

Pharmacogenetics of ABC Transport Proteins in Veterinary Patients

Page 2: Katrina Mealey, DVM, PhD DACVIM, DACVCP ABC’s of Research: Role of Serendipity, Perseverance, and Risk Pharmacogenetics of ABC Transport Proteins in Veterinary.

ABC Drug TransportersP-glycoprotein

Page 3: Katrina Mealey, DVM, PhD DACVIM, DACVCP ABC’s of Research: Role of Serendipity, Perseverance, and Risk Pharmacogenetics of ABC Transport Proteins in Veterinary.

Serendipity (A)abcb1(-/-) knockout mouse

• Schinkel Laboratory NCI Netherlands

Mycoptes musculinus

Page 4: Katrina Mealey, DVM, PhD DACVIM, DACVCP ABC’s of Research: Role of Serendipity, Perseverance, and Risk Pharmacogenetics of ABC Transport Proteins in Veterinary.

IVERMECTIN: “White feet—don’t treat!”

Page 5: Katrina Mealey, DVM, PhD DACVIM, DACVCP ABC’s of Research: Role of Serendipity, Perseverance, and Risk Pharmacogenetics of ABC Transport Proteins in Veterinary.

Perseverance (B)

• Finish PhD-get real job– Not get ‘scooped’

• Obtain DNA from ‘ivermectin sensitive’ dogs– $

• Find a laboratory to do the research– Benchtop in a lab in a different department

• Find time to do research– Clinics/teaching

Page 6: Katrina Mealey, DVM, PhD DACVIM, DACVCP ABC’s of Research: Role of Serendipity, Perseverance, and Risk Pharmacogenetics of ABC Transport Proteins in Veterinary.

Canine ABCB1 Polymorphism

TGGTTTTTGGAAACATGACAGATAGCTTTGCAAATGCAGGAATTTCAAGAAACAAAACTTTTTGGTTTTTGGAAACATGAC----AGCTTTGCAAATGCAGGAATTTCAAGAAACAAAACTTTT

CCAGTTATAATTAATGAAAGTATTACGAACAATACACAACATTTCATCAACCATCTGGAGGACCAGTTATAATTAATGAAAGTATTACGAACAATACACAACATTTCATCAACCATCTGGAGGA

GGAAATGACCACGTATGCCTATTATTACAGTGGGATCGGTGCTGGCGTGCTGGTGGCTGCTTGGAAATGACCACGTATGCCTATTATTACAGTGGGATCGGTGCTGGCGTGCTGGTGGCTGCTT

ACATCCAGGTTTCATTCTGGTGCCTGGCAGCAGGAAGACAGATACTCAAAATTAGAAAACAAACATCCAGGTTTCATTCTGGTGCCTGGCAGCAGGAAGACAGATACTCAAAATTAGAAAACAA

TTTTTTCATGCTATCATGCGACAGGAGATTGGCTGGTTTGACGTGCATGACGTTGGGGAGCTTTTTTTCATGCAATCATGCGACAGGAGATTGGCTGGTTTGACGTGCATGACGTTGGGGAGCT

TAACACCCGGCTCACAGACGATGTCTCCAAAATCAATGAAGGAATTGGCGACAAAGTTGGAATAACACCCGGCTCACAGACGATGTCTCCAAAATCAATGAAGGAATTGGCGACAAAATTGGAA

TGTTCTTTCAATCAATAGCAACATTTTTCACCCGGTTTTATAGTGGGGGTTTACACGTGGTTTGTTCTTTCAATCAATAGCAACATTTTTCACCCGGTTTTATAGTGGGGGTTTACACGTGGTT

275

337

399

461

523

585

647

336

398

460

522

584

646

708

Page 7: Katrina Mealey, DVM, PhD DACVIM, DACVCP ABC’s of Research: Role of Serendipity, Perseverance, and Risk Pharmacogenetics of ABC Transport Proteins in Veterinary.

= ATP binding sites

OutMembrane In

= Substrate binding sites

P-glycoprotein ABCB1 gene

Page 8: Katrina Mealey, DVM, PhD DACVIM, DACVCP ABC’s of Research: Role of Serendipity, Perseverance, and Risk Pharmacogenetics of ABC Transport Proteins in Veterinary.

OutMembrane In

P-glycoprotein (Mutation)

Page 9: Katrina Mealey, DVM, PhD DACVIM, DACVCP ABC’s of Research: Role of Serendipity, Perseverance, and Risk Pharmacogenetics of ABC Transport Proteins in Veterinary.

ABCB1 (wt/wt) pre-treatment

Page 10: Katrina Mealey, DVM, PhD DACVIM, DACVCP ABC’s of Research: Role of Serendipity, Perseverance, and Risk Pharmacogenetics of ABC Transport Proteins in Veterinary.

ABCB1 (wt/wt) 0.2 mg/kg loperamide (Imodium) – 4 hours post treatment

Page 11: Katrina Mealey, DVM, PhD DACVIM, DACVCP ABC’s of Research: Role of Serendipity, Perseverance, and Risk Pharmacogenetics of ABC Transport Proteins in Veterinary.

ABCB1 (mut/mut) pre treatment

Page 12: Katrina Mealey, DVM, PhD DACVIM, DACVCP ABC’s of Research: Role of Serendipity, Perseverance, and Risk Pharmacogenetics of ABC Transport Proteins in Veterinary.

ABCB1 (mut/mut) Loperamide (Imodium)4 hours post treatment

Page 13: Katrina Mealey, DVM, PhD DACVIM, DACVCP ABC’s of Research: Role of Serendipity, Perseverance, and Risk Pharmacogenetics of ABC Transport Proteins in Veterinary.

ABCB1 (mut/mut) Loperamide (Imodium)4 hours post treatment; Naloxone

Page 14: Katrina Mealey, DVM, PhD DACVIM, DACVCP ABC’s of Research: Role of Serendipity, Perseverance, and Risk Pharmacogenetics of ABC Transport Proteins in Veterinary.

Land grant mission—bring discoveries to the public

• Pharmacogenetic Testing–No interest in licensing MDR1 test

• IDEXX• Antech

–“Not a market…”

–“Not profitable”

Page 15: Katrina Mealey, DVM, PhD DACVIM, DACVCP ABC’s of Research: Role of Serendipity, Perseverance, and Risk Pharmacogenetics of ABC Transport Proteins in Veterinary.

22 October

Preventable Ivermectin Toxicity

Page 16: Katrina Mealey, DVM, PhD DACVIM, DACVCP ABC’s of Research: Role of Serendipity, Perseverance, and Risk Pharmacogenetics of ABC Transport Proteins in Veterinary.

29 October

Page 17: Katrina Mealey, DVM, PhD DACVIM, DACVCP ABC’s of Research: Role of Serendipity, Perseverance, and Risk Pharmacogenetics of ABC Transport Proteins in Veterinary.

10 November

Page 18: Katrina Mealey, DVM, PhD DACVIM, DACVCP ABC’s of Research: Role of Serendipity, Perseverance, and Risk Pharmacogenetics of ABC Transport Proteins in Veterinary.

17 November

Page 19: Katrina Mealey, DVM, PhD DACVIM, DACVCP ABC’s of Research: Role of Serendipity, Perseverance, and Risk Pharmacogenetics of ABC Transport Proteins in Veterinary.

Risk (C)

• Licensed the patent from WSU

• WSU Service Center• 50,000+ dogs tested in U.S.• Licensed on 3 continents • And Mars!

• Patent generated funding for WSU–Service Center $3,000,000

–>$750,000 in royalties/licensing fees to Office of Commercialization

– ..to cover patent costs for YOUR discoveries