Just For Canadian Dentists 2013-11 November December

inside: Continuing dental eduCation CalendarPublications Mail agreeMent #41073506

life+leisure

no

veM

ber

/ d

eceM

ber

201

3

where will you meet? edmonton / sacramento / galapagos / dublin / lincoln >>

+ escape to BAHAMAS Speed Week

+ a DENTIST fights poverty at home + abroad

+ the ultimate GIFT GUIDE

+ the HyBrID practice sale

win a visa gift card or $1,000 in CE gift certificates! pAGE 37

ice climb in

Albertaexplore the

Big Island

november/december 2013 Just For canadian dentists 3

Shofu Dentalfull page IFC ad FeatureS

15 climbing Canmore Via shimmering sheets of ice

28 go big in Hawaii Where the Big Island offers it all

ColuMnS

8 photo prescription Shooting on the move

12 motoring Bahamas Speed Week

14 pay it forward Pediatric dental surgeon

Dr. Geoff Smith’s poverty-fighting

work at home and abroad

26 the wealthy dentist The hybrid sale

34 the thirsty dentist Essential bar tools,

part 2—the booze

35 the hungry dentist The slow braise

36 practice management Become a bestseller

noveMber/deCeMber 2013 ContentS

dePartMentS

5 November/December mix

19 CE calendar

37 sudoku

38 small talk with Dr. Michael Zuk

Clo

Ck

WIS

E fr

oM

To

P lE

fT: D

arr

yl l

ENIu

k; B

. SlI

Gl;

Da

rryl

lEN

Iuk

dentistsJ u s t F o r c a n a d i a n

life + leisure

November/December 2013

Publisher Linh T. Huynh

editor barb Sligl

Art Direction bSS creative

contributing editor Janet Gyenes

editorial Assistant Adam Flint

contributors Timothy A. brown michael DeFreitas Dr. Holly Fong Janet Gyenes Darryl Leniuk manfred Purtzki Dr. Kelly Silverthorn roberta Staley cover photo Darryl Leniuk

Senior Account executive monique Nguyen

Account executives Lily Yu Wing-Yee Kwong

Production manager Ninh Hoang

circulation Fulfillment Shereen Hoang

ce Development Adam Flint

Sales, classifieds and Advertising In Print circulation office 200 – 896 cambie Street vancouver, bc v6b 2P6 canada Phone: 604-681-1811 Fax: 604-681-0456 email: [email protected]

Just For Canadian Dentists is published 6 times a year by Jamieson-Quinn Holdings Ltd. dba In Print Publications and distributed to canadian dentists. Publication of advertisements and any opinions expressed do not constitute endorsement or assumption of liability for any claims made. The contents of this magazine are protected by copyright. None of the contents of the magazine may be reproduced without the written permission of In Print Publications.

In Print Publications200 – 896 cambie Street vancouver, bc v6b 2P6 canada

www.justforcanadiandentists.com

Printed in canada.

want to reach us? check out our website!

cover photo Winter rush: Learning how to ice climb in Canmore, Alberta. Story on page 15.

15 28

Self-leveling

Stackable

F00Zero Flow

F03Low Flow

Shofu Dental Corporation • San Marcos, CA

SN

BFP

-051

2

FFFFFFFFFFFFFFIIIIIIIIIIINNNNNNNNAAAAAAAAAAAALLLLLLLLLLLLLLLLLLLLLLLLYYYYYYYYYYY,, AAAAAAAAAAAAAAAANNNNNNNNNNNNNN IIINNNJJJJEEEEEECCCCCCCCCCCCCCCTTTTTTTTTTTTAAAAAAAAAAAAAAAABBBBBBBBBBBBLLLLLLLLLLLLLEEEEEEEEEEEEEE HHHHHHHHHHHHHHHYYYYYYYYYYYYYBBBBBBBBBRRRRRRRIIIIIIDDDDD RRRRRREESTTORAATTIIVVEEFFFFFFFFFFFFFFFFFFFFOOOOOOOOOORRRRRRRRRRRRR AAAAAAAAAALLLLLLLLLLLLLLLLLLLLLL IIIIIIIIIIIIIIINNNNNNNNNNNNNNNNNNNNDDDDDDDDDDDDDDDDDDDDIIIIIIIIIICCCCCCCCAAAAAAATTTTTTTTIIIOOOOOOOOOOONNNNNNNNNNNNNNSSSSSSSSSSSSS

Scan here for more information on

Giomer Technology& watch the Acid

Neutralization video.

NEW SHADES!B1, B2, C2 & D2

BEAUTIFIL Flow Plus is the next step in the evolution of restorative materials, combining the delivery of a fl owable and the strength, durability, and aesthetics equal to or better than leading hybrid composites.

Visit www.shofu.com or call 800.827.4638

• Indicated in classes I, II, III, IV & V

• Physical properties rival hybrids

• Stackable & sculptable; stays put

• Self-polishing “leveling-effect”

• High radiopacity, beyond enamel

JFCandianDentists BFP 8.13.indd 1 8/14/13 4:58 PM

november/december 2013 Just For canadian dentists 54 Just For canadian dentists november/december 2013

winter rush Embrace the ice. It’s chilly, yes but it’s

also striking beauty-wise. Just think of the crystalline forms found in the

curtains of ice that are frozen waterfalls. In winter, ice climbing such slick routes only makes the scenery—and your foothold (or, rather, crampon-hold)—that much better.

Just outside Canmore in alberta, the winter onslaught means a spike in adrenaline-seeking ice climbers and a chance to discover an entirely different perspective. Waterfalls are now slick climbing walls. Game on. and, if you’re a beginner, then the rush only promises to be that much richer (see page 15).

If you want a more controlled environment, there’s the man-made climbing tower at Big White near kelowna, BC. under the patient tutelage of young-

and-very-with-it guides, you’ll scramble to the top, pretty much guaranteed. Those guides’ patient encouragement may not help win you any races, but this kind of exertion is one surefire way to partake in wonderful winter (page 5).

Most of us, though, will opt for the winter getaway plan. That is, Hawaii. This year, make it the Big Island. and make it the kohala Coast (page 28). It’s a resort paradise carved out of lava rock, and it’s an easy home base for exploration from north to south, Hawi to South Point, cowboy country to coffee plantation.

one dentist who’s making the most of his travels is Dr. Geoff Smith —from remote Newfoundland and labrador to Nyahururu in kenya. It’s travel with a purpose (page 14).

another dentist on the move is the

rather rock-star-like Dr. Michael Zuk, who recently embarked on a uk tour of beloved Beatle, John lennon. He also bought lennon’s tooth and plans to use the precious DNa within to potentially clone the genius musician (see page 38).

Strange or savvy? What do you think? and how are you making a mark in the world of dentistry or beyond? We love hearing how dentists are making a difference, at home and abroad. let us know if you have a story to share, big or small, abroad or at home.

and if you’re looking for something interesting and inspired to give to those who made your list this holiday, check out our gift guide (page 7). Bonus: while you’re out during the holiday rush, practice those photography skills by shooting on the move (page 8). Mad mall dash, anyone?

Don’t forget to enter our two contests (page 37), and tell us what you’re up to this winter—warm-weather destination or cold-temperature adventure. We want to hear from you; let us know where in the world you’re travelling, photographing, volunteering, working…stay in touch through justforcanadiandentists.com. Enjoy!

[email protected]

B. S

Lig

L

f r o m t h e e d i t o r

Providing Dental C.E. Since 1996

m i xw h a t / w h e n / w h e r e > N o v e m b e r / d e c e m b e rs t y l e | f o o d | s h o w s | f e s t i v a l s | p l a c e s | g e t a w a y s | g e a r …

stay here!

clockwise from top Beauty on the Big Island: the lounge-worthy seaside pool,

wind-swept beach and lemon-ricotta pancakes at the Four

Seasons Resort Hualālai at Historic Ka‘ūpūlehu on the Kohala

Coast, Hawaii. Story on page 28.

winter rush hot + cold

On this guest ranch on the quiet northeastern side of Hawaii’s Big Island, there’s a private pool, historic house, chicken coop, horse riding, ancient heiau and an artist enclave in the nearby town of Hawi…think bliss. >>

BIG ISLAND BLISS

B S

Lig

L

6 Just For canadian dentists november/december 2013

m i x

1 + 2 the ANGLeR He can tote the retractable Pocket Fishing Pole to watering holes worldwide, and the Ultimate Fishing Tool has everything for tackling the one that didn’t get away. $45, Pocket Fishing Pole. $24, Ultimate Fishing Tool, Restoration Hardware; rh.com

3 the RoAd-tRippeR The sojourner will enjoy ticking off the days until the next stateside adventure, inspired by beautifully rendered landmarks in the Travel America calendar. $26, Rifle Paper Co.; riflepaperco.com

4 the dANdy Even if he can’t race up the Long Island coast in Jay Gatsby style, these sterling silver Roadster cufflinks will transport him to the seaside during a delightful daydream. $605, Tiffany & Co.; tiffany.ca

5 the BiBLiophiLe Acknowledge her love for the written word. The crystallized layers of these agate book ends are as intricate as a well-woven story. From $16.99 ea., HomeSense; homesense.ca

6 the eNteRtAiNeR A must-have for every host? Toothpicks infused with essential oils (Lemon No. 11) or spirits (Single-Malt No. 16). $19.99/4 pack, Old Faithful Shop; oldfaithfulshop.com

7 the modeRNist These jewel-like glass Vitriini boxes from Finland’s Iittala are sparkling in their simplicity. From $39, Quasi Modo Modern Furniture; quasimodomodern.com

8 the mix mAsteR No bartender will balk at a bottle of artisanal spirits, such as London Dry Gin, a smooth sipper handcrafted at Vancouver’s Long Table Distillery. $49.99, BC Liquor Stores; bcliquorstores.com

9 the GoURmet Chefs and foodies alike will appreciate the bright and fruity flavours of Sicily (by way of Brooklyn) encapsulated in Frankies 457 organic extra-virgin olive oil. $29, Old Faithful Shop; oldfaithfulshop.com

10 the ANGLophiLe This trio of Tom Dixon candles recreate the essences of England. Think cro-cuses intermingled with the Thames, Indian weddings redolent of roses, and tea time with strawberry scones. $84 ea., GR Shop Canada; grshop.com

B. S

lIG

l

Cu

fflI

NkS

PH

oTo

: © T

Iffa

Ny

& C

o.; f

ISH

ING

ro

D P

Ho

To: W

WW

.rH

.Co

M /

rH

, rES

Tora

TIo

N H

arD

Wa

rE

N o v e m b e r / d e c e m b e r ice ice baby

*

mAke Like A pANioLo At pUAkeA RANch Paniolo is the Hawaiian

word for cowboy, stemming from “espanola,” used to describe the original Spanish vaquero who came to the island in the late 1800s. On Puakea Ranch, listed on the State Historic Register, you’ll be follow-ing in the footsteps (or horse trails) of four generations of paniolos and plantation workers who once lived here. There are four gorgeously restored ranch houses on this country estate in North Kohala. Our pick: Yoshi’s House with its wrap-around deck or lanai (with killer ocean views) and a stunning pool (think lava-rock beauty overlook-ing ranchland and sea and maybe even Maui; see page 5). There’s also Cowboy House, a former bunkhouse, Miles Away and James Cottage. Each property oozes char-acter with local art and Hawaiiana.

And to get in full-on paniolo mode, there’s horseback riding, of course (see one of the resident equestrian beauties on page 33). Best

thing about this hideaway: it feels remote but is still

only minutes from Hapuna Beach (listed as one of the top beaches in the world) and has wi-fi (that is, if you’ll use it…maybe just to post envy-inducing Instagram images). —B. Sligl puakearanch.com See page 28 for more on the Big Island.

get-away

m i xgift guide

hot hotel /

mUst- stAy

histor

ic hid

eawa

yholiday hot list

Get a little something for everyone on your listWritten + produced by Janet Gyenes

1

5

7

2

3

4

6

8

9

10

savour Sicily!

2013editoR’s

pick

N o v e m b e r / d e c e m b e r

give

”You’re doing great, keep going.” Arms shaking, knees

wobbly, breath winded…I’m not feeling so great, but I keep going.

I’m climbing a massive 60-foot tower of ice under the calm reassurances of Aussie guide Joe. After another few minutes or so (time seems irrelevant when you’re clinging to slick icefall with just milli-

metres of ice-axe leverage), I make it to the top to ring the bell suspended there.

It’s a serious adrenaline rush and I feel chuffed …even knowing afterward that Joe’s record is a mere 19 seconds. Gulp.

Here, at Big White Ski Resort, just over 50 km southeast of Kelowna in the Okanagan, it’s easy to feel chuffed. That morn-ing, I skied through fresh powder amidst fantastical

snowghosts. Whether slopeside

amidst the surreal snowscape or atop that man-made ice tower, the never-ending views of the Monashee Mountains just add to my winter rush. Now, if I can shave some seconds (or, rather, minutes!) off my climb here, maybe I can head out there… —B.S.

Go Big White Ski Resort; bigwhite.com

tackle a tower…of icesport

fix

just do it!

*Caught the iCe-Climbing bug? Go beyond the tower and head into the wild (winter’s frozen landscape offers myriad climbing routes) on a multi-day ice climbing course. See story on page 15.

BIG ISLAND BLISS


Shooting on the moveKilling time en route on a bus, plane or train? Look through the window and, with the help of a lens hood and polarizing filter, take some shots. top The Grenadine Islands and Caribbean are even more dramatic from the air. above left Sit at the front of the bus and use your anonymity and perch to shoot scenes just outside the front windshield, like this image in Egypt. above right Another through-the-windshield shot from a bus in Egypt.

Send your photos and questions to our

photography guru at feedback@

inprintpublications.com and your shot may be featured in a future

issue!

p h o t o p r e s c r i p t i o N m i c h a e l d e f r e i ta s

On a recent trip to Egypt I was on a tour

bus headed for one of the country’s many ruins. I grabbed an aisle seat near the front of the bus in case something photo-worthy popped up and checked with our guide that I could sneak up front periodically to shoot. Then I just watched and waited. The large windshield was like a giant portal into daily Egyptian life.

Soon after presetting my camera controls, I noticed a colourful local Egyptian bus up ahead. I moved up to the windshield as we drew closer. The back of the bus was open and one of the male passengers looked directly at me as I snapped away. I captured his intent stare framed by the colorful bus. a bit further down the road, I shot an old arab man sitting on his grass-laden donkey.

a moving vehicle is like a blind. you can shoot out, but your subjects usually don’t realize that you’re there. removing yourself from the scene lets you capture more natural-looking images than if you were on foot and your subject was aware of you.

Shooting from any moving vehicle has its challenges, but you can improve your odds with a few easy techniques. Blurred images caused by bouncing around and engine vibrations are the biggest problem when shooting from a moving vehicle. use a fast shutter speed to neutralize most vibrations and camera shake. I typically set my camera controls to shutter priority mode and select a shutter speed of 1/500 to 1/800 of a second, depending on the vehicle’s speed and vibration.

Glass windows also produce blue colour casts and reflections. (Needless to say, it’s always best to shoot through an open window where possible). The tint on most vehicle windows typically adds a blue or “cold” hue/cast to your images by blocking out the warmer colours (reds and oranges). Set your camera’s white balance control to “cloudy” to add some warmth and reduce the blue cast.

reflections are a bit trickier to eliminate, but you can reduce their effect by getting your lens as close to the window as possible.

shooting on the move

Michael DeFreitas is an award-winning photographer who’s been published in a wide variety of travel publications. With his initials, MD, he’s been

nicknamed “doc,” making his photography prescriptions apropos.

Buses, planes and trains offer an interesting photographic platform

MIC

Ha

El D

EfrE

ITa

S

Follow us on:

Stay up to date with the latest news, product announcements, special offers, articles, and more

Sign up for our newsletter – Digital Trends

Scan the QR code to register.

3Shape TRIOS® Impression-taking has never been easier

3Shape TRIOS® is the next-generation intraoral digital impression solu-tion. Easily create accurate digital impressions and send cases directly to the lab with a single click.

3Shape TRIOS®

• Spray- and powder-free for optimal accuracy and patient comfort

• Optimized Ultrafast Optical Sectioning software - now 40% faster

• Wide range of indications, including implant abutment cases

• Instant impression and occlusion validation and smart edit scan tool

• Autoclaveable tip with anti-mist heater

• Choose TRIOS Color or TRIOS Standard

TRIOS® Pod solution Use TRIOS® with your iPad, laptops, PC’s in your treatment rooms, or with the PCs integrated in your chair units.


use a lens hood when shooting through any window and position the hood against or a few millimetres away from the glass to prevent stray light from hitting the window in front of the lens. This will reduce most reflections. But remember to increase your shutter speed when doing this. your body does a pretty good job of absorbing vibrations, but when your lens or camera touches any surface of a moving vehicle, it vibrates and shakes at the same frequency as that surface, producing blurred images.

on a recent Caribbean trip I snapped some shots as we flew over the beautiful Grenadine Islands. I pressed my lens hood against the window to reduce reflections and increased my shutter speed to 1/1000 of a second to compensate for the plane’s engine vibration passing from the window to my camera.

When shooting from a moving vehicle, I get the best results when using a medium telephoto lens (70 – 150 mm range). Eliminating reflections is more difficult with wide-angles lenses (16 – 35 mm range), and long telephoto lenses (150 – 400 mm) tend to magnify vibrations and shake.

Travellers spend a lot of time on buses, trains, boats, cars and planes. use that time and these techniques to take some dynamite images.

PRO TIPS for shooting on the move > Go for the window seat. > Check flight, bus or train routes and time of day before picking a

seat. Try to get a window seat on the side away from the sun. Avoid shooting into the sun.

> Always pack a few wet wipes to clean window glass, especially on planes where people tend to rest their head against the windows.

> If you can’t get close to the window use a polarizing filter to help reduce glare and reflections off the glass.

> Wrap a dark-coloured shirt or scarf around the end of the lens when you press it to the window (it will help with reflections and vibrations).

> Light and bright clothing reflect more off windows. Try to wear darker colours.

> Make sure to turn off your flash.

geAr up Lens hoods are a great way to stop stray light or glare from hitting the front element of your lens. They also help to protect the front element and reduce distracting reflections when shooting through glass. They typically come in metal, hard plastic or rubber. rubber hoods are best for shooting through glass in a moving vehicle because they tend to absorb some of the vibration and make a neater fit when pressed against the glass. Most camera manufacturers offer plastic and rubber lens hoods ($6 – $35). Some camera stores like Henry’s offer less-expensive house-brand rubber hoods.

p h o t o p r e s c r i p t i o N [ c o n t i n u e d ]

Outrank by Rogers

full-pg ad

Ready to take it to the next level?


Is November a month you long to head south? Me too. This is when daylight hours in Canada are painfully short. The

skies are an oppressive grey but not yet generating enough snow cover for winter play. and Christmas is too far off to act as a mental-refuge buffer. So when I learned of the Bahamas Speed Week revival, scheduled for November’s final week, I rejoiced that my month was saved. The Bahamian sun—mingled with the sights, sounds and smells of classic racing cars—would surely provide November’s remedy. My wife even expressed genuine enthusiasm.

To execute a “revival,” one must reference an original. The Bahamas Speed Week ran

from 1954 to 1966. Sixty or more top sports car teams from Europe and the americas would come together in a festive season-end-ing week of racing. key Nassau ingredients were large cash prizes, brilliant sunshine and legendary parties. Winners included a who’s who of post-war racing greats: de Portago, Moss, Gurney, a.J. foyt, Penske and Donahue. The list of winning makes is equally illustrious: ferrari, Maserati, Scarab, aston Martin, lotus, Chaparral and lola.

Bahamian political winds of the mid-60s are said to have doomed the original Bahamas Speed Week. a then-new govern-ment of populist leanings did not sit easily

alongside catering to an international jet set. Nevertheless, it’s the same left-of-centre parties in government that now largely un-derwrites international organizers re-estab-lishing a racing event that attracts high-value, shoulder-season visitors. Stirling Moss was a marquee driver attraction back in the day…and contemporaneously too. Now knighted, the 83-year-young Sir Stirling still races his beautiful red 1956 oSCa (see photo).

The modern Bahamas Speed Week (revival) is centred at arawak Cay, less than a mile from the downtown Nassau cruise ship terminus. Between these two landmarks is the official host hotel, the British

Colonial, established in 1898. unlike many such vintage hotels, the Colonial is in fine fettle.

Public portions of Speed Week begin friday evening with a robust street party cel-ebrating the competition cars. The Bahamian locals appear quite adept at such events. Perhaps they are just tuning up for the world-renowned Junkanoo festival (spans Boxing day to New year’s). after the street party, the many downtown restaurants will vie for your attention. My picks for eateries here: Van Brugel’s, Café Matisse, athena Cafe, luciano’s and the Brussels Bistro.

Saturday is the fort Charlotte Hillclimb,

with timed runs from arawak Cay up the bluffs to this historic military installation. The fastest hillclimb times of the day, by some margin in fact, are the cadre of modern 125-cc Shifter karts present. (further history lesson: the first annual World karting Championship was held in Nassau in 1959!) fastest “car” on the hill is a late-model limited-edition aCr Viper—Dodge’s answer to showroom-legal race-ready cars, from Porsche and ferrari. Saturday’s fastest classic car is a multi-million-dollar 1957 ferrari 500 TrC.

Sunday is the arawak Cay Sprints, es-sentially competitive timed laps of a 1.6-mile circuit on closed public roads around arawak

Cay, including two inter-island bridges. The spectator experience is enhanced by a

capable public address system anchored by a professional radio host, bleachers at the best vantage points, pedestrian bridges and a VIP tent option. Ed Hugo

in the aCr Viper triumphed again among the modern cars with a one-minute-and-

29-seconds lap. Simon arscott in the 1966 aston Martin DB5 was fastest of the classics at one minute and 35 seconds.

The more “in the moment” readers will already be thinking…friday, Saturday, Sunday do not a “revival Week” make. Indeed, the original Speed Week boasted wheel-to-wheel racing every day for eight days. Contemporary Speed Week features social events for participants on the Wednesday and Thursday. 2012 was just the second edition of the revival, and subsequent ver-sions will hopefully trend to filling out the week with more competition. old Nassau’s backstreets mimic some of the great town-based special stages in Targa Newfoundland, so there is clearly promise for more Bahamian racing formats.

It would take a cold heart indeed not to cheer for the future success of the Bahamas Speed Week revival. I fully credit this young event in drawing on the resources available to re-establishing the Bahamas as an important stop on the international racing calendar. It’s got great history, tropical scenery, warm tropi-cal climate and a government that’s now fully on side. and the Bahamas should definitely stick with its late November date to attract us sunshine-starved Canadians.

it’s better in the BahamasHot cars + hot weather make a great mix in Nassau during the Bahamas Speed Week revival

m o t o r i N g d r . k e l ly s i lv e r t h o r N

Dr. Kelly Silverthorn is Just for Canadian Dentists’ automotive writer. He tries to keep one convertible and/or one track-day car in the family fleet.

racing legend Sir Stirling Moss in

his bright-red OSCA, just one of the sweet

rides seen at Bahamas Speed Week. For more go to bahamasspeed-

week.com.

Open Road HONDA

full-pg ad

kEll

y SI

lVEr

THo

rN

november/december 2013 Just For canadian dentists 15

t r a v e l a t h o m e


The tears on the face of the young boy’s father were ones of gratitude rather than distress. They were also a

clear — if unintended — indictment of the omnipresent poverty in native communi-ties in Newfoundland and labrador. “His kid hadn’t slept in a year due to his cavities,” says Dr. Geoff Smith, the province’s preeminent pediatric dental surgeon.

The aboriginal youngster’s rampant mouth rot was relieved thanks to operation Tooth, a program that Smith started in 2008 to chip away at the 600-strong list of pediatric dental patients—mainly Inuit

and Indian—who were waiting to fly to St. John’s for treatment at Janeway Children’s

Hospital. Smith created a self-contained practice,

filling several suitcases with dental paraphernalia, and set

out several times a year to such far-flung Newfoundland and labrador communities as Gander and Happy Valley-Goose Bay. Smith continues to spend up to eight weeks on the road travelling to rural communities to provide emergency treatment. “The thought of leaving a kid in pain — I can’t do that,”

says Smith, who won a Distinguished Service award in 2012 from the Canadian Dental association and is currently a member of the group’s Committee on Clinical and Scientific affairs.

Smith says that the poor dental hygiene has long-lasting, deleterious effects on children. “They can’t eat properly and can’t sleep properly because their teeth hurt, so they don’t do well in school,” says Smith. “you fix their teeth and their weight increases in six months to where they should be.” Dental decay, Smith adds, is largely “a disease of poverty. Eighty per cent of the

cavities are found in the lowest 20 per cent of the socioeconomic scale. Those numbers go way up in native communities,” due in large part to high-sugar diets, says Smith, who has been president of the Newfoundland and labrador Dental association and chief of dentistry for Eastern Health. In the past, one of the factors influencing poor dental health was a dearth of dentists in the rural areas of Newfoundland and labrador. To combat this, Smith helped establish a bursary program whereby dental students from across Canada receive a $25,000 bursary through the Department of Health and

Community Services Dental Bursary Program, up to a maximum of $150,000 over three years. In exchange for each bursary received, recipients must commit to one year of service in a rural or in-need area of the province. as a result, Newfoundland and labrador now has the best pediatric dentistry care in Canada, says Smith, who was the only pediatric dentist in the province for a quarter century.

Several years ago, Smith extended his outreach to include pediatric dentistry abroad. In 2011, he became a visiting instructor at the university of Haiti Dental School, based in the capital city of Port-au-Prince. In addition to arranging the export

of used dental equipment such as chairs and drills to the school, Smith lectures and gives continuing education courses on such procedures as fitting stainless steel crowns onto children’s cracked and rotting teeth—“the bread and butter of pediatric dentistry.” Thanks to Smith’s twice-annual Haiti visits, the dental school overcame its “fear of treating children” and incorporated pediatric dental care into its programming. “It’s one of the most gratifying things I have ever had happen down there,” Smith says. Interestingly, although the need for kids’ dentistry in Haiti is dire, tooth decay rates are lower than in Canada’s native communities, he says.

Smith has shifted his focus to another, similarly destitute part of the world. In 2012, he took his wife and daughter to kenya. While the latter two went on safari, Smith drove three hours north of the capital of Nairobi to a town called Nyahururu. Here, a church-run dental clinic, staffed by a solitary dental therapist named Ben Mburu, was trying to tackle an endemic of fluorosis, caused by excess fluoride in the town’s well water. Smith’s first set of patients included three girls with “horribly disfigured” teeth. Smith rebuilt the choppers with composite crowns, and the teenagers walked out smiling. Smith found that, similar to Haitian practitioners, Mburu was uncomfortable working with children. So Smith schooled him in pediatric dentistry with the help of videos, showing him the art of freezing a youngster’s mouth to prevent pain. Mburu was a quick learner, absorbing Smith’s lessons and becoming proficient at gaining the trust of his young charges. By the time Smith left, Mburu was affixing stainless steel crowns in cavity-strewn mouths. “you just have to know how to talk to a kid,” says Smith.

Smith, 61, isn’t too sure how many more years he will practice dentistry—five, perhaps 10 more? But those years will be spent doing something he loves, helping bring good health through dental care to youngsters around the world struggling in Third World conditions. “The challenge,” Smith says, “is poverty and access to care.”

pediatric dental aid from Newfoundland to kenya, this dentist is fighting poverty in the dentist’s chair

pay i t f o r w a r d r o b e r ta s ta l e y

Roberta Staley is an award-winning magazine editor and writer with experience reporting from the developing world and conflict and post-conflict zones. Staley, who specializes in medical and science

reporting, is a graduate student at Simon Fraser University and magazine instructor at Douglas College.

Co

urT

ESy

of

Dr

. GEo

ff S

MIT

HDr. geoff Smith, Newfoundland’s

preeminent pediatric dental surgeon, shares his expertise in

Kenya.


STOry + pHOTOgrApHy By DArryL LENIUk

As the temperature dips, a frozen landscape comes to life and

offers a new adrenaline rush…ice climbing. Strap on some

crampons, wield a pick and go where only winter will let you

icecapades


t r a v e l a t h o m e t r a v e l a t h o m e

Sharp shards of ice bounce off my face like broken glass on a crash-test dummy. Each swing of my ice axes sends frozen debris flying: a fist-sized chunk ricochets off my forehead;

another fragment finds its way down my neck, under three layers of clothing, and melts against my belly. I’m 20 metres up a frozen waterfall called The Junkyard, just outside Canmore, alberta, in the heart of the Canadian rockies. at the base of the icy

60-degree slope, Steve Holeczi, my guide from yamnuska Mountaineering School, controls the rope that I’m harnessed into and shouts encouragement. But I don’t want to go any higher. My forearms burn from death-gripping the two ice axes I use to pull myself up and my calves wobble uncontrollably as I struggle to secure my crampons in the icy slope.

I try to remember Holeczi’s coaching: crampons need full contact with the ice to be effective; ice axes need to be solid, like an axe in a block of wood; and body position is everything. This was the beginning of yamnuska’s introductory two-day ice climbing course. Wearing crampons made me feel like a clawed

monster from Middle Earth; the sharp spikes protruded from my feet like talons. But it’s this awkward equipment that makes the sport possible. With its roots in 19th-century mountaineering, ice climbing has evolved considerably since the days of chopping steps to climb a frozen slope. In the 1930s, laurent Grivel designed front-pointing crampons. Then in 1966, yvon Chouinard, founder of the Patagonia clothing line, developed the first ‘reverse curve’ ice picks, which enabled climbers to get purchase on vertical ice.

When I finally reach the top of the 30-metre rope, I turn around for the first time. I’m frightened at how high I’ve come and at not being able to see Holeczi over

the cauliflower-shaped slope. I call out and am reassured when I hear his reply. I lean back and take in the view: across the ice-covered Bow Valley, the snowy peaks of the western rockies glisten in the waning afternoon light. looking closely, I can see tiny white threads dangling off these mountains. More frozen waterfalls. In all, there are over 1,000 ice-climbing routes within a two-hour drive of Canmore, making this town of 12,000 one of the best places in the world for the sport. Each winter Canmore plays host to an ice climbing festival and is the scene of a vibrant ice-climbing culture.

I repel to the base of the falls, and Holeczi is waiting for me with a high-five.

“How was that!” says the lanky, bearded guide.

“felt pretty good,” I reply.“How do your hands feel?” I don’t notice

them until he asks. But then I realize they’re both hot and cold and tingly. and they hurt like hell.

“Hah! you’ve got the screaming barfies!” he says. When warm blood returns to your hands after gripping ice tools in cold weather, he explains, the effect is pain so bad you want to vomit. It’s a common side effect of ice climbing and will go away he assures me.

after a few tips on footwork, he sends me back up, but this time with only one axe. Now I’m forced to totally support myself on

my feet when I swing my axe. I tremble at first, not trusting the fang-like protrusions coming out of my boots. But I don’t slip; my feet are rock-solid. I try other movements with my crampons to give my ankles a rest and shift my weight side-to-side. I swing the axe fluidly, and feel the hold it’s meant to provide. It goes much smoother, and I’m up in half the time.

Being a beginner rock climber, I had thought of ice climbing as a more extreme version of a sport I was not very good at to begin with, and that I would be woefully underskilled to have a go at it. But almost anyone can climb ice. My biggest concern was the ice itself.

unlike rock, ice melts, cracks, breaks

clockwise from top left Guide Steve Holeczi climbing a frozen waterfall at Grotto Canyon near

Canmore. > Tools of the trade: lightweight, reverse-curve ice

axes make ice climbing possible. > Holeczi climbing a route near

Lake Louise. Unlike rock climbing, belayers always stand off to one side to avoid being hit by falling

ice. > The modern ice axe.

previous page Guide Steve Holeczi hanging out on a route near Lake Louise. this page, from left Holeczi starting a route at The Junkyard, near

Canmore. > Crampons make climbing vertical ice possible.



[email protected] • www.ContinuingEducation.NET

Continuing Dental Education Cruises

Ask about our guesttravels free program and aboutplanning a cruise meeting for

your organization

December 22, 2013 Road Map to Planning, Grafting and Restoring Complex Implant Cases9 AGD PACE Credits 9 ADA CERP Credits 7-Night Eastern Caribbean from FloridaFebruary 16, 2014 Simplified and Successful Endodontics for Dental Practitioners9 AGD PACE Credits 9 ADA CERP Credit 7-Night Eastern Caribbean from FloridaMarch 15, 2014 Comprehensive Dentistry: The Pursuit of Excellence14 AGD PACE Credits 7-Night Western Caribbean from FloridaApril 29, 2014 The Pediatric Dental Course You Wished You’d Had in Dental School14 AGD PACE Credits 12-Night D-Day Anniversary European Cruise Rome to CopenhagenJuly 5, 2014 Treatment Planning and Sequencing14 AGD PACE Credits 7-Night Alaska from SeattleAugust 8, 2014 Oral Dermatology and Oral Pathology14 AGD PACE Credits 7-Night Alaska from SeattleAugust 15, 2014 Treatment Planning in the 21st Century9 AGD PACE Credits 9 ADA CERP Credits 7-Night Alaska from SeattleOctober 4, 2014 Oral Dermatology and Oral Pathology14 AGD PACE Credits 7-Night Canada and New England Montreal to BostonOctober 19, 2014 Predictable Treatment Planning:From the Seemingly Simple to the Worn Dentition...and Everything in Between14 AGD PACE Credits 7-Night Western Caribbean from Florida

1-800-422-0711 (727-526-1571) • www.ContinuingEducation.NET

Florida Seller of Travel Reg. #14337

Checkwww.ContinuingEducation.net

for updates to our2014 schedule

winter 2013 + beyond

c eaN iNterNatioNal guide to CONTINuINg DeNTAL eDuCATION

edmonton / sacramento / galapagos / dublin / l incoln … | c a l e n d a r

It’s time to reassess the rather flat capital of Alberta…because it’s flat no longer—in terms of style that is. There’s a rather artsy and funky vibe going on here

these days; Edmonton offers a somewhat surprising foodie and fashionista fix.

First, think chic cuisine with a definite French flare. Local Franco-Albertan Giselle Courteau (who can trace her lineage back to 18th-century France!), recently opened the must-go Duchess Bake Shop 1 , touted as the best patisserie in Canada. Really. Here, patrons lounge in Louis XV sofas and chairs while sampling florentines, macarons, brioche Pétin croissants, pains aux raisins and au chocolat…

Then, on the other end of the food spectrum, there’s Tres Carnales Taqueria. It’s boho beach fare from three amigos bringing serious sustainable style to Edmonton’s dining scene (everything except the seafood is sourced within 200km). Sated with fab food, it’s time for another dose of big-city sophistication—in fashion. Edmonton is

donning some of the quintessential blue that evokes all things pomp and posh; Tiffany is opening a storefront in the West Edmonton Mall…so get ready to channel Audrey Hepburn in the Albertan prairies.

On the other side of the winding North Saskatchewan river, there’s groovy Whyte Avenue 2 , where traditional window shopping has hipster appeal at “it” shoe emporium Gravity Pope, which started right here… Who knew? And Edmonton-raised designer, Cassandra Hobbins, was a finalist in last season’s hot reality-TV show, Fashion Star.

Seems Edmonton has plenty of style to uncover. Here’s what else to discover in Edmonton this winter…

Get some visual inspiration at the Art Gallery of Alberta—inside 3 and out 4 . The structure itself is a mix of curvilinear and angular shapes with a 190-metre steel ribbon that mimics the winding North Saskatchewan River and Aurora Borealis.

Head to that river. Edmonton’s river valley network of trails, paths and parks is beloved and well-used by locals.

The icy North Saskatchewan River and snow-kissed trees are a winter oasis in the midst of the city.

Visit the pyramids. Seriously. Edmonton boasts four of its own pyramids, albeit the glass variety filled with exotic plants. Feel humid heat and heady tropical scents while snow drifts pile up just outside the Muttart Conservatory 5 .

Go back out to the river. This time strap on some nordic skis. That network of paths and parks means groomed cross-country ski trails in the winter. There’s even a Wednesday Night Social Ski with the Edmonton Nordic Ski Club.

Kick back at a local pub. Back on Whyte, after some serious shoe shopping, hang with the university crowd over a pint at the Black Dog. And make it a local Big Rock brew. Try the Big Rock Gopher Lager on tap at Black Dog—it’s one of the brewery’s newer additions to its lineup of mostly ales. Yum! —B. Sligl For more, go to edmonton.com/for-visitors.aspx.

elegant + edgy edmonton. The central-Alberta winter doesn’t stop this city from offering a surprising mix of haute + hip on the prairies—year-round. (CE events in Edmonton are highlighted in blue.)

foo

D P

Ho

To: B

. SlI

Gl;

ED

Mo

NTo

N E

CoN

oM

IC D

EVEl

oPM

ENT

CorP

ora

TIo

N (4

)

EdmOnTOnand is otherwise a whole lot less stable than granite. When I asked Holeczi about accidents, he explained that the sport has a very good safety record. “The equipment is at the point that it far exceeds what we’ll put onto it.” He told me that the ice screws used for securing ropes can hold 1,000 kg or more. Even so, there are a handful of fatalities involving ice climbing each year. Most involve avalanches. Since the best ice routes tend to form in narrow canyons and gulleys, which are also prime avalanche territory, an understanding of the backcountry is important. “The danger is in how you interpret the environment,” said Holeczi. using a qualified local guide is one of the best ways to minimize the risk.

Marc ledwedge, a public safety warden at Banff National Park, has seen several accidents involving ice climbing in the 20 years he has worked for the park. “Many beginning ice climbers are not aware of the avalanche hazard,” said ledwedge. “It’s not uncommon to see people on ice routes when they shouldn’t be.” He’s also seen many leg and ankle injuries caused by ice climbing. The gripping nature of crampons can make them dangerous in a fall. and, for this reason, learning to fall is not taught in

ice-climbing courses. you just don’t fall. The next day a fierce arctic storm

descends on the rockies. The outside air temperature is -24C, and dipping to -40C with the wind chill. from the vantage point of the Coffee Mine Cafe, in downtown Canmore, Holeczi and I watch swirling snow and blustery winds pelt those foolhardy enough to venture outside. The local radio station reports all schools are closed. Holeczi has heard it may clear this afternoon. We wait a while and then decide to make a go for it.

We drive to Grotto Canyon, another ice-climbing route just outside town. I blindly follow Holeczi through a forest of blowing snow. I’m soon breaking fresh tracks on a frozen creek in a steep-walled canyon. It’s bitterly cold but at least I’m sheltered from the wind. I pass a snow-dusted granite wall with bolts marking a summer rock-climbing route. Holeczi stops and shows me an ochre-coloured native painting. Then I notice icicles hanging off his moustache like a hoary mountaineer of old. We continue up the canyon to the Grotto waterfall we’ve come for. It covers the end of the chasm in a giant jacket of ice. like enormous steps, the falls are vertical for seven or eight

metres, level to a ledge and then another sheer pitch. It will be my first time climbing vertical ice.

The surface is wet, and I get good purchase from my crampons. Despite the cold, I move upward, slowly but methodically. I probe for good placement with my picks and stand up on my feet. I feel exhilarated; climbing ice is as exciting as skiing, less work than snowshoeing and easier than rock climbing. The clouds part and the Grotto falls shimmer in the winter sunlight. I glance across and see my shadow, axes swinging, crampons kicking, ice chunks flying. awesome.

if you go +gO Canmore is a 90-minute drive west of Calgary. DO The ice-climbing season in the Rockies runs from November through March. Yamnuska Mountaineering offers two-day introductory courses in ice climbing starting at $265 including equipment. For more info visit yamnuska.com or call 1-866-678-4164. MOre Check out Tourism Canmore at tourismcanmore.com or call 1-866-226-6673, or get the goods on other ways to get a winter rush across the province at Travel Alberta’s website travelalberta.com.

3

5

1

2

4


c e c e

new CE to be placed

ce when where topic sponsor contact websitea

nest

hesi

anov20

detroitMichigan

a Hands-on review of local anesthesiauniversity of detroit Mercy

313-494-6694 udmercy.edu

Jan 17-Feb 162014

sacramentocalifornia

iv sedation training For dentistsconscious sedation consulting

888-581-4448sedationconsult-ing.com

Feb20-232014

edmontonalberta

local anesthetic course university of alberta 780-492-4474dentistry.ualber-ta.ca

cos

met

ics/

aes

thet

ics

through 2013

Westerncanada

Focus dental education series: Part ii F.o.c.u.s. 604-922-3465 drracich.ca

dec07

MontrealQuebec

Modern concepts in restorative dentistry (special guest: dr. elliot Mechanic)

international dental institute

877-463-1281 idi.org

dec 21-Jan 052014

Hong Kong to singapore cruise

building blocks of aesthetic restorationMindware educational seminars

888-574-8288mindwaresemi-nars.com

Jan102014

lincolnnebraska

Weeth lecture 2014university of nebraska Medical center

402-472-7993 unmc.edu

Jan 23-Feb 022014

east africa safari

current concepts in Prosthodontics addiction, Methadone And The Dental Office, How To Survive Your next Medical emergency combining art & science

Kennedy seminars877-536-6736see ad Page 4

kennedyseminars.com

Feb07-222014

southern caribbean cruise

an overview of restorative dentistry Kennedy seminars877-536-6736see ad Page 4

kennedyseminars.com

Mar 08-152014

turks and caicos

Problem solvers For restorative dentistry(available Mar 07-14 or Mar 08-15)

Kennedy seminars877-536-6736see ad Page 4

kennedyseminars.com

den

tal

Mat

eria

ls

nov15-17

Minneapolis Minnesota

new Materials, technologies & laser training - Postgraduate Program in contemporary restorative dentistry: level iii

university of Minnesota 800-685-1418 dentalce.umn.edu

Mar292014

MontrealQuebec

a critical assessment of dental Materials: composites, adhesives and light curing

Mcgill university 514-398-4314mcgill.ca/den-tistry

endo

dont

ics

nov14-16

las vegasnevada

2013 Fall conference - contemporary concepts in Periradicular surgery: diagnosis and treatment

american association of endodontists

800-872-3636 aae.org

Jan172014

st. PetersburgFlorida

cutting edge endodontics: advances in instrumentation and irrigation

West coast district dental association

813-654-2500 wcdental.org

Jan 20-Feb 032014

australia & new Zealandcruise

endodontics & Medicine sea courses cruises 800-647-7327 seacourses.com

Mar152014

MontrealQuebec

the transformation of endodontics in the 21st century With dr. stephen cohen


c a l e n d a r

For: Just For Canadian Dentists Issue: Nov / Dec 2013 Fax: 604 - 681 - 0456 Attn: Advertising in Print Email: Copy sent to [email protected] Feature the following 4 departures in the ad in the dental list Mar 15 - 22 Caribbean Apr 29 - May 11 Grand Europe Jul 5 - 12 Alaska Oct 4 - 11 New England

DENTAL CE CRUISES

for current pricing & promotions 1-888-647-7327 www.seacourses.com

Canadian owned and operated providing dental CE

CARIBBEAN Mar 15 - 22

Comprehensive Dentistry

EUROPE Apr 29 - May 11

Pediatric Dentistry

ALASKA Jul 5 - 12

Treatment Planning

NEW ENGLAND Oct 4 - 11

Oral Pathology

new CE to be placed

Dental Forum in hawaii!

For details & registration, visitwww.dentsem.comor call 952.922.1707

For travel information, call Linda800.826.6644or email [email protected]

don’t miss the 34th annual

Dental Seminars & Symposia, LLC

maui february 1-8 &/OR kauai february 8-15

ce when where topic sponsor contact website

gen

eral

den

tist

ry

nov09-12

victoriabritishcolumbia

current concepts in dentistryProsthodontic success: From concept to deliveryMedical emergencies in dental PracticeOffice Oral & Maxillofacial Surgerya critical look at dental adhesives, composites & light curing

university of victoria 250-472-4747 uvcs.uvic.ca

nov10

ottawaontario

alpha omega dental Fraternity ottawa chapter launch & ce brunch

alpha omega dental society

301-738-6400 ao.org

Jan10-222014

vancouverbritishcolumbia

science & treatment Planning Pacific Implant Institute 604-868-9700pacificimplantin-stitute.com

Feb01-082014

MauiHawaii

34th annual Hawaiian dental Forumdental seminars & symposia, llc

952-922-1707see ad Page 21

dentsem.com

Feb08-152014

KauaiHawaii

34th annual Hawaiian dental Forumdental seminars & symposia, llc

952-922-1707see ad Page 21

dentsem.com

Feb15-202014

big skyMontana

alpha omega dental Fraternity toronto chapter Western ski seminar

alpha omega dental society

301-738-6400 aotoronto.org

Mar06-082014


Pacific Dental Conference bc dental association604-736-3781see ad Page 23

pdconf.com

Mar15-222014

caribbeancruise

comprehensive dentistry sea courses cruises800-647-7327see ad Page 20

seacourses.com

Mar15-302014

bangkok, chiang Mai, Krabi

thailand adventure & learn: dr. Jeffery coil, dr. chris Wyatt, dr. charles shuler

university of british columbia

604-822-6156see ad Page 24

dentistry.ubc.ca

apr03-052014

calgaryalberta

rocky Mountain rhapsody ce solutions 604-575-4570 conedgroup.com

Jun 29- Jul 72014

galapagos islands cruise

dental challenges in isolated communitiesProfessional education society

877-737-7005see ad Page 40

pestravel.com

Jul05-122014

alaskancruise

alaska For treatment Planning sea courses cruises800-647-7327see ad Page 20

seacourses.com

sep10-202014

dublin and belfastireland

dentistry & disease PreventionProfessional education society

877-737-7005see ad Page 40

pestravel.com

oct19-262014

Westerncaribbeancruise

Predictable treatment Planning: From the seemingly simple to the Worn dentition... and everything in between

continuing education,inc./university at sea

800-422-0711see ad Page 18

continuingeduca-tion.net

nov08-152014

tahiticruise

dentistry at sea / comprehensive dentiryProfessional education society

877-737-7005see ad Page 40

pestravel.com

dec 27 2014-Jan 3 2015

eastern caribbean cruise

dentistry at sea / dental Healthcare deliveryProfessional education society

877-737-7005see ad Page 40

pestravel.com

c a l e n d a r


Introducing a new systematic way to use and sterilize all your handpieces equally reducing consistent handpiece repair costs.

1-866-591-7770info@thehandpiececloset.cawww.thehandpiececloset.com

The Handpiece Closet will save your practice thousands of dollars.

Order yours today!

new CE to be placed

ce when where topic sponsor contact websiteim

plan

tolo

gy

throughMay 2014


8 sessions to implant therapy (introduction: Mondays; intermediate: thursdays; or advanced: Fridays)

renaissance dental implant institute (rdii) and dentsply implants

877-879-9660 rdiinstitute.com

nov14-17

san diegocalifornia

advanced Hard and soft tissue grafting Program With cadavers Hands-on

california implant institute 858-496-0574implanteduca-tion.net

nov15-16

MontrealQuebec

all-on-4 continuum (Modules i & ii of iv) Mcgill university 514-398-4314mcgill.ca/denden-tistry

Feb03-072014

Kea laniHawaii

all-ceramic restorations in 2014: clinical steps; From enamel To Zirconia. How To Optimize And Benefit From Current adhesive Materials, techniques For all bonding substrates; What are these drugs our dental Patients are taking?


604-822-6156see ad Page 24

dentistry.ubc.ca

Mar07-082014

MontrealQuebec

atraumatic tooth extraction and extraction socket Management With dr. ralf schuler


Jul11-132014


surgical operations & Wound Healing Pacific Implant Institute 604-868-9700pacificimplantin-stitute.com

aug01-042014

san Franciscocalifornia

controversies and innovations in implants and esthetics

interdisciplinary dental education academy

650-578-9495 ideausa.net

Med

ical

issu

es

ongoingPodcast and online based

Medical emergencies dentaledu 239-593-2178 dentaledu.tv

nov22

torontoontario

Medical Emergencies In The Dental Office And CPR Certification

sleep for dentistry 416-498-8484sleepfordentistry.com

Feb13-152014

vancouver british columbia

10 things to revitalize Your Practice, Medical emergencies in dentistry


604-822-6156see ad Page 24

dentistry.ubc.ca

occ

lusi

on

through 2013

Westerncanada

Focus dental education series: Part i F.o.c.u.s. 604-922-3465 drracich.ca

dec06

edmontonalberta

dental occlusion – it can Make or break Youedmonton and district dental association

780-642-8270 eddsonline.com

Feb19-202014

chicagoillinois

AES 59th Scientific Meeting - Occlusion: The Bigger Picture and beyond

american equilibration society

847-965-2888 aes-tmj.org

Offi

ce /

Team

Man

agem

ent ongoing

Podcast and online based

understanding and assessing risk in the treatment of Periodontal disease

dentaledu 239-593-2178 dentaledu.tv

Jan172014

new Yorknew York

Practical Infection Control For The Dental Officecolumbia university college of dental Medicine

212-305-6881 columbia.edu

Mar15-222014

Western caribbean cruise

comprehensive dentistry and the dental team: the Pursuit of excellence

continuing education,inc./university at sea

800-422-0711see ad Page 18


May02-042014

saskatoonsaskatchewan

sdta annual Professional developmentsaskatchewan dental therapists association

306-672-3699 sdta.ca

c a l e n d a rc e

new CE to be placed

c ece when where topic sponsor contact website

ora

l Pat

holo

gy apr122014

Walla WallaWashington

to biopsy or not to biopsy: interactive soft tissue oral Pathology For the dental Practitioner

university of Washington 206-543-5448 uwcde.com

oct04-112014

new englandcruise

oral dermatology & oral Pathology sea courses cruises800-647-7327see ad Page 20

seacourses.com

ora

l sur

gery

Jan10-112014

new Yorknew York

sinus lift surgery - the lateral approach: a clinical Workshop

columbia university college of dental Medicine

212-305-6881 columbia.edu

Feb10-142014

HawaiiHawaii

21st international symposium in oral and Maxillofacial surgery

university of californiasan Francisco

415-476-1323 ucsf.edu

apr25-272014


inhalation and oral sedationuniversity of british columbia

604-822-6156see ad Page 24

dentistry.ubc.ca

nov21-232014


advanced soft tissue surgery Pacific Implant Institute 604-868-9700pacificimplantin-stitute.com

ort

hodo

ntic

s

nov 29-dec 01

edmontonalberta

clinical orthodontic Procedures Module – clinical university of alberta 780-492-4474dentistry.ualber-ta.ca

Jan162014

edmontonalberta

clinical orthodontic Procedures Module – theory university of alberta 780-492-4474dentistry.ualber-ta.ca

Jan19-302014

indiatour

gummy smiles & lingual orthodontics; and esthetic implant Placement

Mindware educational seminars

888-574-8288mindwaresemi-nars.com

Feb201407-08

carlsbadcalifornia

bridging the orthodontic gap: carlsbadHenry schein dental spe-cialties group

760-448-8717 hsdsg.com

Pedi

atri

c d

enti

stry

Mar01-022014

los angelescalifornia

Management of Pediatric sedation emergencies: a simulation course

american academy of Pediatric dentistry

312-337-2169 aapd.org

Mar072014

seattleWashington

law/lewis lectureship in Pediatric dentistry university of Washington 206-543-5448 uwcde.com

apr 29-May 112014

grand europecruise

Pediatric dentistry sea courses cruises800-647-7327see ad Page 20

seacourses.com

apr 29-May 112014

italy to denmarkcruise

d-day 70th anniversary cruise conferencecontinuing education,inc./university at sea

800-422-0711see ad Page 18


Peri

odon

tics

dec05

Minneapolis Minnesota

clinical grand rounds For the dental team: lasers in Periodontal therapy

university of Minnesota 800-685-1418 dentalce.umn.edu

dec06

PittsburghPennsylvania

contemporary Periodontics university of Pittsburgh 412-648-8370 pitt.edu

dec13-14

oklahoma cityoklahoma

root coverage technique tulsa Periodontal institute 877-888-7017 tulsainstitute.com

c a l e n d a r

Pacific Dental ConferencePacific Dental Conference Vancouver, BC CanadaMarch 6-8, 2014

Meet up with your colleagues from across the country!Three days of varied and contemporary continuing education sessions are offered, covering topics relating to clinical excellence, practice excellence and personal developmentOver 130 speakers and 150 open sessions and hands-on courses to choose from, as well as the Live Dentistry Stage in the spacious Exhibit HallTwo day tradeshow with over 300 exhibiting companies

Registration and program information at...

www.pdconf.com Save money by registering before January 17th, 2014

Gary GlassmanEndodontics

John KoisAesthetics & Occlusion

Featured Speakers

John Cranham - Occlusion/TMD Sergio Kuttler - Endodontics Sonia Leziy - Periodontics Brahm Miller - Prosthodontics Ross Nash - Aesthetics Bart Johnson - PharmacologyTheresa Gonzales - Forensics Rob Roda - Endodontics Greg Psaltis - Pediatrics Brian Chanpong - Anaesthesia Elliot Mechanic - Orthodontics John Flucke - Technology

Ray PadillaTrauma Dentistry

Derek MahonyOrthodontics


c e

new CE to be placed

ce when where topic sponsor contact websitePh

arm

acol

ogy

ongoing online based Florida Board Of Pharmacy Misfills Coursenova southeastern university

800-356-0026 nova.edu

ongoing online based advances in Xylitol dentaledu.tv 239-593-2178 dentaledu.tv

apr032014

st. PaulMinnesota

dental Pharmacology university of Minnesota 800-685-1418 dentalce.umn.edu

Prac

tice

Man

agem

ent,

tec

hnol

ogy

and

Plan

ning

Jan222014

WinnipegManitoba

What Your Practice is Worth today and Why roi [email protected] ad Page 25

roicorp.com

Jan23-262014

cabo san lucasMexico

complete dental Practice rejuvenationBring Your Entire Staff For A Complete Office rejuvenation experience

dental Management secrets

403-984-0115dentalmanage-mentsecrets.com

Feb15-222014

sandalsWhitehouseJamaica

the ultimate opportunity to optimize Your Practice roi [email protected] ad Page 25

roicorp.com

Mar052014


What Your Practice is Worth today and Why roi [email protected] ad Page 25

roicorp.com

Mar28-292014

MontrealQuebec

transition Planning in dentistryinternational dental institute

877-463-1281 idi.org

May 28-Jun 042014

alaskancruise

the ultimate opportunity to optimize Your Practice roi [email protected] ad Page 25

roicorp.com

Jul05-122014

alaskancruise

dental treatment Planning and sequencingcontinuing education,inc./university at sea

800-422-0711continuingeduca-tion.net

Pros

thod

onti

cs

Jan172014

st. PetersburgFlorida

all-ceramic restorations in 2014: clinical stepsWest coast district dental association

813-654-2500 wcdental.org

Feb202014

Perrysburgohio

clinical and laboratory Management of Provisional restorations

Harbor light oral & Maxillofacial surgeons

419-517-2135oralmaxsurgeons.com

oct11-242014

Multiple citiesindia

contemporary Fixed Prosthodontics Kennedy seminars877-536-6736see ad Page 4

kennedyseminars.com

rad

iolo

gy/

imag

ing

dec16-17

lincolnnebraska

radiology For dental auxiliaryuniversity of nebraska Medical center

402-472-7993 unmc.edu

sep20-272014

Mediterranean cruise

dental imagingcontinuing education,inc./university at sea

800-422-0711see ad Page 18


Hyg

ieni

sts

a

ssis

tant

s nov16

st. PaulMinnesota

Winter dental assistants’ seminar university of Minnesota 800-685-1418 dentalce.umn.edu

nov23

stoney creekontario

How to integrate the laser into dental Hygiene Practice

rdhu 855-295-7348 rdhu.ca

For feedback, requests or to have your course featured please email [email protected]

c a l e n d a r

CONNECT WITH US: CONTINUING DENTAL EDUCATION, UNIVERSITY OF BRITISH COLUMBIA, VANCOUVER, BC, CANADA

604-822-2627 toll free 1-877-328-7744 www.dentistry.ubc.ca [email protected]

JOIN US FOR THESE FANTASTIC LEARNING OPPORTUNITIES:Travel and Learn California, Hawaii and Thailand

Ski and Learn Whistler, BC

Hands on Courses / Didactic Lectures from World Renowned Speakers in our State of the Art Clinical Facility

PROFITABLE PRACTICEDESTINATION CE

Profitable Practice’s Destination CE trips take continuingeducation out of the classroom and into a world of enjoyment and luxury. With planned trips for all types of destinations, your next continuing education session should be done with Profitable Practice.

UPCOMING CE DESTINATIONS:

Jamaica Fun & Sun at Sandals WhitehouseFebruary 15-22, 2014

Book by November 17th, 2013 to get the amazing rate of $2312 per person* for the

“Honeymoon Grand Luxe Beachfront Room” (King bed, based on double occupancy)

*airfare not included

Alaskan Cruise on the Regent Seven Seas Navigator

May 28 - June 4, 2014

Book early to get the best fares from $4699 per person (all inclusive; air from major gateway; shore excursions;

food and beverage; gratuities; transfers; pre-cruise hotel and much more). Receive a $200 shipboard credit

if booked before December 31st, 2013.

For more information about our upcoming CE seminars please contact Heather at: [email protected] or (905) 289-4145.

www.profitable-practice.comBROKERAGE

Relax.Celebrate.LearnSponsored By:


I n a typical practice transition the vendor and purchaser are at odds as to how the sale should be structured. The selling

dentist wants a tax-free share sale by getting access to the capital gains exemption, and the purchaser wants an asset purchase so that the cost base of the assets is equal to the purchase price. Many baby-boomer practices were established from scratch or with a small investment in goodwill and equipment. This means that in a typical share deal the purchaser assumes assets at a low-tax cost yielding minimal future amortization write-offs. Basically, the purchaser is forced to pay for the practice with after tax dollars. The share versus asset purchase dilemma often causes the deal to collapse unless the vendor is prepared to accept a share sale discount.

one way to bridge the gap between purchaser and vendor is the hybrid sale. Both parties get what they want: The purchaser receives the full-cost base of assets and the vendor can sell his shares tax-free.

Here’s an outline of how such a hybrid transaction can be implemented:

1. Dr. S and Mrs. S are shareholders of Dentalco. The practice assets are valued at $1.6 million. They both “crystallize” their capital gains exemption of $800,000 each by exchanging their shares in Dentalco for $1.6 million of preferred shares. a special election is filed with the Canada revenue agency in order to effect the crystallization.

2. The purchaser buys the preferred shares

of Dentalco from Dr. S and Mrs. S for $1.6 million.

3. The purchaser acquires 100% of the assets from Dentalco for cash and a $1.6 million note payable.

4. Dentalco then redeems the $1.6 million of preferred shares held by the purchaser for a note payable of $1.6 million owing to the purchaser. This note payable of $1.6 million is offset against the note payable to Dentalco for the purchase of the assets. as a result the two notes payable are cancelled out.

5. Dentalco can either invest the after tax proceeds or pay it out to Dr. S and Mrs. S. in the form of tax-free capital dividends.

the hybrid salea win-win for practice seller and buyer

Manfred Purtzki is the principal of Purtzki & Associates Chartered Accountants. You can reach him at [email protected].

t h e w e a lt h y d e N t i s t m a N f r e d p u r t z k i

Oral Health Classified Ads PRACTICES & OFFICES SECTION

00601 NOV 13 TOP RIGHT HAND PAGE

Al Heaps & Associates Inc.LOCAL KNOWLEDGE — INTERNATIONAL EXPOSURE

Al Heaps604-644-6297

[email protected]

Ruth Chatel604-220-4830

[email protected]

Henry Doyle604-724-1964

[email protected]

Practice Sales and Valuation Specialists

Toll Free: 1-866-638-6194 Fax: 1-866-545-6759 BC: 300-1055 West Hastings Street, Vancouver, BC V6E 2E9 | Alberta: 2nd Floor 11210 107th Avenue, Edmonton, Alberta T5H 0Y1

Ontario: 200-1920 Yonge Street, Toronto, Ontario M4S 3E2

We have over 55 dental practice opportunities across Canada

Please visit our website:www.HEAPSandDOYLE.com

Practices are selling for the highest value in 25 years!

Contact us for a complimentary consultation.

George Osterbauer416-312-6166

[email protected]

Palm Springs Transition Seminar and Golf TournamentTransition seminar with panel and

one-on-one discussions with transition expertsRancho Las Palmas Resort and Spa — February 7th to 9th 2014Annual Winter Clinic — Toronto, ON – November 8th, 2013

VDDS — Mid Winter Clinic — Vancouver, BC – December 6, 2013

Dental Practice Transition Seminars To be announced.Contact [email protected] for upcoming dates.

and, based on that, here’s what you need to think about and discuss:

1. The shareholders benefit from the capital gains exemption as long as the following conditions are met:

a. The shares must be held for 24 months prior to sale;

b. at the time of the sale, 90% of the assets in Dentalco must be used in the “active” business. Surplus cash, portfolio investments are considered “inactive”;

c. for the 24-month period prior to the sale, the value of the inactive assets cannot exceed the value of the active dental assets (equipment, goodwill, accounts receivable, working capital cash, etc.).

2. The purchaser receives full asset value, and is entitled to the amortization of $1.6 million of assets.

3. Many dental corporations are owned by family trusts with minor children as beneficiaries. Cra tightened the income splitting rules, effective March 11, 2011,

stating any capital gains realized by a minor will be subject to the top marginal tax bracket. Instead of getting the benefit of the exemption, the minor will receive a hefty tax bill. Therefore the crystallization of the capital gains outlined in Step 1 must be avoided. The changes in the law does not affect the minor’s ability to claim the capital gains exemption when selling the shares to an unrelated party.

you will appreciate the rather complex series of transactions involved in setting up the hybrid sale. The hybrid may be the perfect solution to bridge the gap between the seller and the buyer and can prevent the deal from collapsing. your professional advisor can help you select the appropriate tax strategies and advise you as well on Cra’s changing views regarding these types of structures.

Selling or purchasing a dental practice is the biggest business decision you likely will ever make. It’s mandatory that you consult with a pro with experience and a thorough understanding of the tax, financial, and business aspects of dental practice transitions.

t h e w e a lt h y d e N t i s t [ c o n t i n u e d ]

241539786

536781249

879624135

683947521

957312468

124865973

315478692

498256317

762193854

Puzzle by websudoku.com

sudoku 2 harder solution

solu

tion

from

s

epte

mbe

r/o

ctob

er 2

013

cont

est

283561974

619274835

754893261

527138496

931426587

846759123

368945712

175682349

492317658


sudoku 1 easier solution

solu

tion

from

pag

e 37

Bridge the gap

between purchaser and vendor with the hybrid sale. Both parties get what

they want—always a good thing!

Save up to 40% on Pre-Owned X-Ray & Cone Beam Systems

Popular models by all major manufacturers:Vatech Sirona GendexCarestream/Kodak

And more...

Planmeca Instrumentarium

All come standard with installation, shipping, warranty and training

As a returning customer I can attest to their unbeatable product quality and a top-notch customer experience. - Dr. Jeannotte (Terrace, BC)“ ”

1-888-759-4287


story + photography BARB SlIGl

Go BIGoN HAWAII’S koHALA coAST

t r a v e l t h e w o r l dt r a v e l t h e w o r l d


t r a v e l t h e w o r l d t r a v e l t h e w o r l d t r a v e l t h e w o r l d

The Big Island is, yes, big. In terms of size (the rest of the Hawaiian islands would all fit within its mass) and diversity (it has all but two of the world’s climate zones). That range—from

sugar-like beach to snow-topped mountain and churning volcanic crater—is what makes the Big Island a big must. and that range extends to all parts of island living. you can nosh on exquisite farm-to-fork fare at a high-end resort or pick up a still-warm malasada served in a paper bag from a hole-in-the-wall bakery. you can succumb to an open-air lomi lomi massage at a world-renowned spa or take a spin in a Jeep to a very-off-the-beaten-path green-sand beach. you can watch the sun go down alongside hula dancing seaside or jump off cliffs while locals fish where ancient Hawaiians once did. Star gaze or surf, golf or hike, beach it or crater it…

So, where to start? first, set up base on the kohala Coast. This once barren, lava-encrusted landscape on the island’s west side has been transformed into a resort oasis, making for some sweet and surreal hide-aways tucked amidst the piles of black rock. from here, it’s an easy day’s outing north, south and east—to lush and quiet North kohala, the remote cliffs and still-roiling chasms of kua, vibrant kona and rainy and rich Hilo and Hamakua Coast. That is, if you can tear yourself away from your west-side idyll… Here are our picks on the kohala Coast and beyond.

STAY If anything, you may have too many choices on this Gold Coast. Carved out of one of the island’s past lava flows, this string of resorts on the northwest coast began when laurance S. rockefeller

spied the perfect crescent of kaunaoa

Beach from the air and said “Every

great beach deserves a great hotel.” He went on to build the

Mauna kea Beach Hotel in

1965…and the rest is history. Today the

resort retains an exclusive elegance and the beach is listed among the top-10 uS beaches by Condé Nast Traveler. {maunakeabeachhotel.com}

a short trek along rocky shoreline, past ancient ruins and modern mansions, brings

you to the perhaps-even-more-jaw-dropping Hapuna Beach. The largest white-sand beach on the island, it’s home to the Mauna kea’s sister property, the Hapuna Beach Prince Hotel {HapunaBeachPrinceHotel.com. But here, it’s all about the beach, beloved by locals and visitors alike and a primo sunset-viewing spot and morning barefoot-jogging circuit.

on the opposite end of the kohala Coast, in the south (and only 15 minutes from the city centre and airport of kona), is the four Seasons resort Hualalai, where the seaside suites feel more like hales (Hawaiian homes) than a hotel. after a recent multi-million-dol-lar refurb, this resort is all about pampering—from the sushi bar to the spa. The beach is no Hapuna but the seaside pools and king’s Pond, stocked with tropical fish and a spotted eagle ray you can snorkel with, more than make up for it. {fourseasons.com/hualalai}

There’s an even more homey hale vibe at the lava lava Beach Club Cottages, which mesh old-school Hawaiiana cool and stylish swank. Each cottage boasts local art, a ukulele (go ahead and strum for the beach club crowd), punee (Hawaiian day bed), take-home pareo or sarong (thank you very much) and a private, lava-wall-enclosed outdoor shower. you won’t want to leave. {lavalava-beachclub.com}

PLAY Want to hang with a bonafide “beach boy”? Do the Hawaiian outrigger Canoe Paddling adventure at The fairmont orchid. you’ll meet champion Hui Holokai ambassadors (The fairmont’s water experts), who’ll teach you the basics of this quintes-sential Hawaii sport. you’ll ply the crystalline waters to in-the-know snorkel spots and maybe learn some local lingo along the way, brah. {Fairmont.com/Orchid}

There’s also SuP (stand-up paddleboarding), surfing, tennis, golf, biking (you’ll be sharing the road with Ironman trainees), snorkelling (unbelievable), diving, windsurfing, kite-surfing (which you can also simply content yourself to watch from your lava lava Beach Club perch)…take your pick.

after burning calories (in the most fun way possible), load up again at a luau. While some of these celebrations have become

overly commercialized extravaganzas that can verge on cheesy, the traditional luau is still a window on historic Hawaiian culture, and if you’ve never been to one, the sunset luau at Waikoloa Beach Marriott resort & Spa is as good a place as any—or better with its backdrop of an anaeho‘omalu Bay sunset. {WaikoloaBeachMarriott.com}

RELAX There might be nothing better than simply setting yourself up seaside back at the four Seasons’ central, adult-only pool. you can see the waves crashing onto the beach (and a lollygagging turtle or two), yet you’re sand-free on a plush lounge chair under an umbrella awaiting Evian water

spritzes and little amuse-bouche style treats. The service is such that you’ll be offered sunglasses clean-ing… Plan on wiling away an entire day from your poolside-perch.

The same might be said all along the kohala Coast, but at those lava lava Beach Club cottages, the cushy chairs on your private porch are made for sunset viewing while sipping a Mai Tai. It’s your own bungalow…on a beach! anaeho’omalu Bay’s sunsets are legendary, and made even more so with the Beach Club’s sundown hula and live-music show right on the sand. The atmosphere is so cheery, with a hum-ming crowd scattered about the sand (the Beach Club’s version of a patio), that the temptation is to get up off your personal porch and join the convivial vibe. almost…

of course, to relax is somewhat synonymous with a spa. Each resort has its own version of lomi lomi and wrap this, zen that. Mix it up by heading to yet another kohala Coast resort, the Mauna lani Spa. a day spa retreat, it’s been ranked one of the world’s best spas

by Travel + Leisure magazine. Here culture and chic mix with thatched open-air hales, natural lava saunas, a meditation pavilion and watsu pool. aloha! {MaunaLani.com}

EXPLORE The north end of the kohala Coast is king’s country. Stand below Pu`ukohola Heiau and make like legend-ary king kamehameha. This temple is a

IF YOU GO The Kohala Coast is also known as the gold

Coast…for good reason. Think golden weather +

luxe properties: kohalacoastresorts.

com

previous page Beach lounging at the Four Seasons resort Hualālai at Historic Ka‘ūpūlehu, opposite page, clockwise from top left The entrance to the Four Seasons, amidst lava rock and an endemic wiliwili tree. > Watching sunset at Hapuna Beach, consistently listed as one of the world’s best strips of sand. > The seaside pool at the Four Seasons. > One of the Fairmont Orchid’s local “beach boys.” > graffiti, Big Island style, using shells and coral along the main highway along the Kohala Coast. > Classic cocktail, the Mai Tai at Merriman’s, the godfather of farm-to-fork cuisine on the Big Island. > Makena Beach, another beach consistently on the world’s best beaches short list. > Sunset from Anaeho’omalu Bay at the Lava Lava Beach Club. > Outdoor shower at a Lava Lava Beach Club cottage. > Fresh local flowers at the Mauna Lani Spa.

t r a v e l t h e w o r l d reminder of Hawaii’s rich Polynesian past, and that tie seems even stronger knowing that kamehameha was born just north of this sacred spot. Come early morning and you might spot sharks still swimming over an an-cient submerged temple that was dedicated to the shark gods. {nps.gov/puhe}

kamehameha the Great looms large all along the kohala Coast and beyond. Mamalahoa Trail or the king’s Highway (part

of the alu kahakai National Historic Trail) cuts right through lava rock and manicured resort- and golfs-capes past scores of petroglyphs. {nps.gov/alka}

from just about anywhere on the kohala Coast you’ll catch glimpses of the twin volcanoes

of Mauna kea and Mauna loa looming in the distance. Don’t be a stranger. arrange a guided hike with Hawaii forest & Trail to venture closer, or skirt Mauna kea and go north on the kohala Waterfalls adventure to see a different Hawaiian countryside (think old sugar plantations, taro terraces, waterfalls, pools, wet-and-wild valleys) and the charm-ing town of Hawi. {Hawaii-Forest.com} or head south to a still-churning volcano (see right).

SAVOUR The Big Island is becoming known for big-name cuisine. Merriman’s Market Café has the renowned locally sourced fare of famed Chef Peter Merriman, one of the founders of Hawaii regional cuisine. It also has a tasty take on the Mai Tai. When in Hawaii… {merrimanshawaii.com} and then there’s ‘ulu ocean Grill at the four Seasons, the kohala Coast’s go-to eatery. order makai, from the ocean, for local seafood like the kona White abalone with coconut and kaffir lime. The goal is “r.S.a.—regional, Seasonal and artisanal” cuisine from more than 160 farmers and fishermen on the Big Island; 75% of the menu features local, sustainable dining. {uluoceangrill.com} of course, you can’t beat a fish taco in Hawaii. on the kohala Coast, the unassuming kohala Burger and Taco won’t disappoint. {kohalaburgerandtaco}

Whether the goal is to stay, play, relax, explore or savour, your choice is big—Big Island big.

t r a v e l t h e w o r l d+ BeyOND ON THe BIG ISLAND

The Big Island is Hawaii’s most

diverse with all but two of the world’s

climate zones. Discover more at

gohawaii.com/big-island.

21

4

5

76

3

this page, from top left Demo of cultural traditions at the pu`ukohola Heiau National Historic Site on the Kohala Coast. > The King’s Trail cuts a path through the lava rock, and was once used to transport supplies from north to south. > Must-try fish tacos at Kohala Burger and Taco.

MorE BIG ISLAND BLISS1 upCOuNTry CHIC Overlooking the west-coast sprawl of Kona, in the thick of the legendary Kona Coffee Belt, is a bit of unexpected paradise. Holualoa Inn is set on the slopes of Mount Hualalai, part coffee estate and part luxe B&B / boutique resort. you could spend all day just soaking up the high-above-it-all jungle vibe, meandering through tropical gardens redolent with torch ginger, papaya, avocado, macadamia-nut trees (crack ‘em and eat fresh on site!) 5 and some 5,100 coffee trees. There are 30 lush acres here, including pasture land…so poolside you might hear a moo or two. Inside, the inn is a polynesian retreat full of gorgeous artifacts and treasures (it was once a private estate), and just past the driveway is historic Holualoa Village’s shops, galleries and farm-to-fork eateries. holualoainn.com

2 VOLCANIC WONDer What might be the most mind-bending thing about the Big Island is the fact that it is literally churning. At the southern tip of the island is a fireworks show courtesy of pele, the Hawaiian goddess of Fire, at Hawaii Volcanoes National park. Surreal. Where else can you walk across a crusted-over lava lake? get eruption updates and trail info at nps.gov/havo.

3 MALASADAS On the northeastern end of the island, stop in the cute town of Honoka’a (once a thriving sugar plantation) for this local classic and sweet treat. As they say at Tex Drive In, “ono Kine grindz” (good local grub). texdriveinhawaii.com

4 KONA BreWINg After a day of surf and sun, it’s time for some suds at Kona Brewing Co. Try the nutty, almost-toffee-like winter seasonal Koko Brown, brewed with toasted coconut. Or go for a beer flight (along with some fish tacos), to taste the wide range of island-inspired concoctions, from Big Wave golden Ale to pipeline porter. konabrewingco.com

6 exTreMe greeN Ever seen a green sand beach? The Big Island has one of the world’s two. Half the discovery is the trek beyond South point (the southern-most part of the uS) along moonscape-like coast (hike or brave with a 4WD

Jeep) to the remote remains of this ancient cinder cone.

greensandbeachhawaii.com7 rANCH IT Go north to paniolo—that’s Hawaiian for cow-boy—paradise at puakea ranch in North Kohala. It’s also an

equestrian’s dream. See page 5. puakearanch.com


t h e t h i r s t y d e N t i s t j a N e t g y e N e s t h i r s t y c o n t .

essential bar spiritsoutfit your home bar with the key spirits that make up classic cocktails and mixed drinks

Janet Gyenes is a magazine writer and editor who likes to dally in spirits, especially when discovering something like corenwyn jenever (a gin-like Dutch spirit)—straight or in cocktails

like the “bramble.” Have a boozy idea or question? Send it to [email protected]

When I started bartending, no one muddled anything,” says ryan Boyd of Vancouver’s Metropolitan

Bartending School. “The Mojito really changed everything. once people started squishing up that mint, it opened up a whole universe.”

Boyd, a bartender for almost 20 years now and who has trained other budding

bartenders worldwide, is explaining how Mojitos ushered in

the “bar chef” trend

about a decade

ago. Today, a number of bartenders have taken the “chef” aspect to intoxicating new heights by barrel-aging spirits, creating infusions with herbs and spices and crafting their own

bitters and tinctures, but that’s what makes them pros (and why you’ll never really be able to recreate that “classic” cocktail you taste in your favourite haunt).

unless you aspire to get into mixology as a radical career change or serious past-time, leave such labour-intensive ventures to the experts. Instead, build your home bar with the booze basics, and as your stock expands, so will your cocktail reper-toire.

There are the depend-able spirits—vodka, gin,

rum and tequila—ideal for making the tried-

and-true, if slightly yawn-inducing

cocktails. you know the usual suspects: vodka and soda, gin and tonic, rum and Coke. add a splash of juice, a dash of soda

or squeeze of lime to these

booze basics and you’ve got your

Screwdriver, Gin rickey, Greyhound,

Cuba libre… While the quality

of the spirit can make a difference in a cock-tail, there’s no need to get lured by big-name brands, says Boyd. “It doesn’t mean they’re the best or that you can’t find equivalents at lower price points.” He says the

average person likely can’t tell the difference from brand to brand, especially with vodka, adding that most industry people drink ketel one, not Grey Goose, and not just

because of price point.rums and tequilas

are slightly different. The sugarcane and agave spirits, respectively, come in a range of colours from clear to amber and almost black. In general, “white rums are the least rum-y flavoured; dark rums tend to be overly syrupy, too sweet. Most of the rum companies put all their effort into their amber rums,” says Boyd, whose current go-to rum is Cruzan Single Barrel, an amber rum that gets its colour, like reposado tequila, from barrel-aging.

These spirits can sink or sing depending on how you use them. If you’re making a Mojito or Margarita for instance, it’s likely summer and you don’t want an overt spirit flavour. So don’t break out your best bottles of aged rum or tequila, only to mask their nuances with those refreshing juices and herbs—the ingre-dients you want to taste on a sweltering day. Save the high-end for sipping neat or on the rocks, and opt for a good-quality un-aged spirit instead.

and that’s another rule for the home bar-tender. Consider the season—and embrace it.

t h e h u N g r y d e N t i s t

Sometimes on busy weekends, it’s hard to make an “easy” dinner that’s special. So when I saw lamb shanks

on sale at the butchers, I knew I had dinner made. If braised in the oven, lamb shanks will cook for about 2 hours, unattended. and they’re the perfect dish when three children are demanding help with various projects. as the aromas develop and waft across the house, everyone’s appetites are whetted and homework seems to be completed sooner than later.

Braising shanks in a little liquid over low even heat will yield fork-tender meat and a ridiculously tasty sauce. Instead of the usual tomato based sauce (especially if pasta is a standby), I used dry white wine, anchovies, lemons, parsley, garlic and lots of onions, to create a mellow rich sauce. The onions melt and add body to the sauce without the

need for flour or cream. an added lemon gremolata at the end accentuates the taste of the shanks with a last-minute hit of flavour.

Serve the lamb on a bed of sautéed garlicky baby spinach with rice and steamed baby carrots and green beans for a comforting meal. Because the dish has some delicate lemony herbal flavours, it’s easy to overpower with a Shiraz. Go with 2009 d’arry’s original, an australian-Shiraz-and-Grenache-blend from old vines. It opens with a nose of berry with a slight floral hint and, on the palate, has a velvety mouth feel with tastes of berries and plums followed by a long finish of spice with a touch of chocolate. overall, this nuanced wine pairs perfectly with the lamb.

6 large lamb shanks2 tablespoons canola oil2 large onions, peeled and

thinly sliced6 cloves garlic, peeled and

smashed with the back of a knife

4 anchovy fillets packed in oil, rinsed, dried and coarsely chopped

1 teaspoon slivered lemon zest

juice of ½ lemon1 teaspoon of fresh thyme

leaves, choppedsalt and fresh ground

pepper to taste1 ½ cups of dry white wine1 ½ cups low salt chicken

brothgremolata

1 large clove of garlic, finely minced or grated

grated zest from 2 lemons⅓ cup of chopped italian

parsley leaves¼ teaspoon salt fresh ground pepper to taste

BrAISeD LAMB SHANKS WITH ONIONS AND LeMON greMOLATA (SerVeS 6)

Preheat oven to 300F. Pat lamb shanks dry with a paper towel; season with about 2 teaspoons of salt.

Heat the oil in a very large heavy bottomed flame-proof oven casserole or Dutch oven large enough to hold the shanks in a single layer without touching. When the oil is shimmering, add the lamb and brown well for about 4 – 5 minutes per side. Set aside.

Reduce heat to medium and in same pot, add more oil if needed. Add onions, garlic and ¼ teaspoon of salt. Sauté, stirring frequently until golden brown, about 6 – 7 minutes. Take care to not burn the vegetables. Stir in anchovies and white wine, scrapping off any brown bits into the wine. Increase the heat to medium-high and boil until the wine is reduced by half. Add lemon zest, juice, broth and thyme, stirring to mix. Bring to a boil. Turn off heat.

Add the lamb in a single layer. Cover the pot with aluminum foil and crimp along the edges making a tight

seal to minimize evaporation. Bake in the oven for about 2 hours until the meat is fork tender.

Transfer the meat to a serving dish and cover with plastic wrap or foil to keep warm. With a wooden spoon or spatula, scrape down sides and bottom of the pan to release all the browned bits. Strain juices into a tall measuring cup, pushing down on the solids to extract all the juice. Place the solids in a small saucepan. While waiting for the fat to rise, make the lemon gremolata by combining all the ingredients in a small serving bowl.

Skim off and discard the fat from the juices. Add the juices to the solids in the saucepan and heat to boiling. Remove from the heat and blend until smooth using a handheld blender. Pour sauce over the meat and scatter gremolata on top. Serve at once with extra gremolata on the side. Enjoy.

Don’t overpower

delicately flavoured lamb shanks; go with 2009 d’Arry’s Original, an Australian Shiraz-and-Grenache blend

from old vines.

easy does itBraising in the oven keeps your hands free for other stuff

Dr. Holly Fong is a practising speech-language pathologist with three young children who’s always trying, adapting and creating dishes.

seasonal sipping

Need a wiNter fix? ryan Boyd recommends not-too-sweet white cranberry martinis. Hosting a crowd? avoid endless shaking and pouring: mix up a pitcher.

1 cup white craNberry juice

4 ouNces vodka

2 ouNces coiNtreau

fill a cocktail shaker with ice. add cranberry juice, vodka, and Cointreau. Shake to combine well. Strain into two large martini glasses. Garnish with whole cranberries.

spirit stockryaN’s basic booze recommeNdatioNs

VoDka > ketel one

GIN > Tanqueray No. Ten or Hendrick’s

ruM > Bacardi 8 or Cruzan Single Barrel

TEquIla > Don Julio

WHISkEy > good quality Canadian rye or bourbon

CoINTrEau > Cosmopolitans, Margaritas

SWEET VErMouTH

SIMPlE SyruP

Part 2: the booze

OR how to stock your

bar

you wouldn’t order a piña colada at a fine-dining establishment in the dead of win-ter, would you? So don’t serve such drinks during the cooler months. Something like Blueberry tea (a soothing sipper com-posed of one ounce each amaretto and Grand Marnier, topped with hot orange Pekoe tea), which Boyd has resurrected as one of his favourite post-repast libations, would be much more suitable.

When it comes to gin’s juniper berry-forward flavour, there’s plenty of variation from brand to brand. Boyd says Tanqueray No. Ten is a high-quality choice that’s a solid standby, but adds, “if you want to be experimental with gin, go with Hendrick’s. Because not only is it interest-ing, it’s available everywhere.” What sets Hendrick’s apart from most other gins, in particular, are two ingredients: rose petal and cucumber. “Muddle some cucumber slices in the glass, add gin and soda ….” It’s a simple standout.

Choosing whisky (or whiskey) can get pretty complicated, but you can’t go wrong by covering the bases with a good-quality bottle of each bourbon, rye and scotch. The longer the age, typically, the better the quality, and unless you’re a pur-ist, don’t stress too much about swapping bourbon for Scotch in a pinch. That’s how new cocktails are concocted, after all.

rounding out your home bar with a couple of liqueurs can expand your cocktail range monumentally. “about 25 per cent of the drink recipes in the world will have Triple Sec in them,” says Boyd, who implores you to replace this bottom-basement orange-flavoured liqueur with Cointreau, its top-shelf orange peel-infused equivalent.

“If you want to make Manhattans and rob roys and all those Mad Men drinks, you need sweet vermouth,” he adds. (Plus the aforementioned whiskey.) Dry ver-mouth is handy if you must make a classic Martini, but it’s perfectly acceptable to skip it altogether, just like most bartenders do. add some simple syrup to your bar ba-sics (buy it or make it yourself: boil equal parts sugar and water together, let cool and store in a jar in the fridge) and you’ll be able to impress even the most finicky guests with legions of libations. Just don’t forget the garnish.

get schooled! Learn how to craft cocktails from the pros at Metropolitan Bartending School with one-day courses aimed at amateurs. metropolitanbartending.com

Have a can’t-miss cocktail? Share it with us! [email protected]{learn}

WINTer FIx: white cranberry martini.


Use this space to deliver your message to

14,500 dentists across Canada.

Call 604-681-1811 now.*your ad here!

d i v e r s i o N

Enter for a chance to win one of four prizes: 1 one of three $1,000

gift certificates to a Profitable Practice Destination CE seminar in Jamaica or Alaska, and 2 a VISA gift card.

sudokuSolve Sudoku puzzle #2 to win a $100 Visa gift card, compliments of ROI Corporation and to be entered into a draw to win one of three $1,000 CE Gift Certificates to be used towards Profitable Practice’s Destination CE—in Jamaica or Alaska!

Each Sudoku puzzle has a unique solution that can be reached logically without guessing. Fill in the grid so that every row, column and 3x3 square contains the digits 1 through 9. GOOD LUCK!

LAST ISSUE’S WINNER: Dr. Weijia Dong of Calgary, AB (VISA gift card, value $100)

8

61974

1

2

75

8

261

7

3

3

4

6

8

5

1

368

5

12

2

4

49231

5


sudo

ku1 ea

sier

sol

utio

n on

pag

e 27

62

9

7

27

4

1

6

72

6

4

5

4

7

4

7

68

3

9

7

54

4

2

73


sudo

ku2 ha

rder

sol

utio

n in

nex

t iss

ue sudoku coNtest eNtry form (solve + send in sudoku!)

Name: __________________________________________________________address: ________________________________________________________city, proviNce, postal code: _________________________________________e-mail: _________________________________________________________tel: ____________________________ fax: ____________________________

sudoku coNtest rules: 1. entry form must be accompanied with solved puzzle. only correctly solved puzzles entered into random draw. 2. Send puzzle + entry form to Just For Canadian Dentists, 200 – 896 cambie St., Vancouver, Bc, V6B 2P6 or fax 604-681-0456. entries must be received by december 15, 2013. 3. prize: $100 visa gift card compliments of roi corporation plus a chance to win 1 of 3 $1,000 ce gift certificates to be applied to dentist’s choice of profitable practice’s destination ce in jamaica (valued at $2,312) or alaska (valued at $4,699). winner will be contacted by dec. 31, 2013. 4. contest can be changed and/or cancelled without prior notice. 5. all entries become property of in print publications and roi corporation.

at your service

www.TROLLDENTAL.com/ca

TROLLBYTES = SENSOR HOLDERSTROLLBAGS = PROTEC TIVE SLEE VES FOR SENSOR OR SENSOR + HOLDER

TROLLFOIL = FRAMED AR TICULATING FOIL - RED OR BLUE FOILTROLLMOUNTS = POCKE T X-RAY MOUNTS

[email protected] a

feeling lucky?

2 contests to enter!

2

1ce gift certificate coNtest eNtry form (no sudoku necessary!)

Name: __________________________________________________________address: ________________________________________________________city, proviNce, postal code: _________________________________________________________________________________________________________e-mail: _________________________________________________________tel: ____________________________ fax: ____________________________

ce gift certificate coNtest rules: 1. contest entries will be entered into a random draw. 2. Send entry form to Just For Canadian Dentists, 200 – 896 cambie Street, Vancouver, Bc, V6B 2P6 or by fax to 604-681-0456. entries must be received by december 15, 2013. 3. prize 1 of 3 $1,000 ce gift certificates to be applied to the dentist’s choice of profitable practice’s destination ce seminar in jamaica (valued at $2,312) or alaska (valued at $4,699). winner will be contacted by december 31, 2013. 4. contest can be changed and/or cancelled without prior notice. 5. all entries become property of in print publications and roi corporation.

p r a c t i c e m a N a g e m e N t t i m o t h y b r o w N

become a bestsellerWho are today’s bestselling buyers and what do they want?

Timothy A. Brown specializes in dental practice appraisals, brokerage, consulting, locum placements, associateships and practice financing

across Canada. You can reach Timothy at [email protected].

The large majority of today’s buyers are not i-Dentists™. rather than being in dentistry solely for investment

purposes, owning and managing multiple practices, they are hands-on, full-time practitioners who are motivated by most of the same things that existed when my father roy Brown started a dental consulting business almost 40 years ago.

Today’s buyers want these basics:• To“betheirownboss.”• Havecontrolovertheirincome.• Maintaincompleteauthorityover

business and treatment decisions.

I’ve been accumulating data from buy-ers since 1974 and the “bestselling” dental practices all have certain characteristics in common:

• Ownedbyasolopractitioner.• Grossbillingsintherangeof$750,000to

$1,250,000.• Normalized(purified)operatingcash

flow* equals 40% or more of gross.• Sixtyormorehoursperweekof

preventive scheduling booked three to six weeks in advance.

• Notlocatedinthehighestrentdistricts,such as a major mall or retail/storefront (although exposure always helps).

• Donotemploylong-termassociateswho are not on a contract.

• Notinvolvedincomplicatedpartnerships, such as when a partner wishes to sell and another does not (selling a share of a practice is a very difficult task for any broker!).

*Normalized cash flow does not include “discretionary” expenses, spousal or family wages, or debts. Debt is not part of operating overhead, it is a capital cost of acquisition and generally will be eliminated over time.

The national team of associates I work with also recognizes that dentists who own practices exhibiting these characteristics experience less stress. and similar observa-tions reveal why the group dental practice dynamic can fail. Having worked in the largest-ever Canadian retail dental chain (Tridont) in the 1980s, I can predict some of today’s burgeoning dental chains’ chance of survival.

Conceptually i-Dentist™ is a great busi-ness plan if owning and managing multiple practices is the goal. However, for any individual-minded dentist (assuming he or she desires control over the style of practice, as an estimated 75% or more of Canadian dentists do), this style of dental chain will inevitably include a long-term power chal-lenge.

The practices that are more difficult to sell usually display the following character-istics:

• Employassociatesthathavelongtenureand may negatively influence patients and/or staff after sale.

• Associate(s)isnotonaproper,writtenagreement.

• Associatesthreatenthenewpracticeowner and the open market dictates that the practice will be more difficult to sell, period!

• Anytypeofarrangementwherebyspace or overhead costs are shared

with another professional complicate the transaction. Basically, human nature equals potential for future conflict.

• Long-termstaffthat’shighlypaidandnot on a proper, written employment agreement.

• Purchasersrealizethatexistingstaffisvaluable, it’s retained in most of the practices sold. However, highly paid or long-term staff can intimidate young purchasers. an established staff is very important for patient retention, but buyers with big loans, household mortgages and/or dependants are going to try to reduce expenditures to maintain profitability. The fear is that reducing wages and/or increasing hours may result in losing important members of the team.

• Over-sizedofficesorhigh-rentlocations.During slow times high rents remain the same. rent should be typically 3 – 7% of gross; if it’s higher, a buyer will be wary of that long-term risk.

• Practicesthatareover-capitalized(extravagant leaseholds and equipment) are difficult to sell because the facility is designed to accommodate more than one dentist or suit personal tastes. yes, purchasers appreciate large, ultra-modern offices with high-tech equipment, but they also don’t necessarily want to start off with the accompanying debt.

These issues have surfaced many times in the course of my business. I’ve performed calculations to support the theory that “bestselling” practices sell for the high-est amount when considering alternative practices. The owners of these practices are the happiest, most stress-free individuals. They take more holidays, enjoy the lowest-operating overhead and generally work longer in dentistry because of the rewarding work environment.

The choice is yours. Everyone has dif-ferent philosophies, but any dentist can practice like a “bestseller.”

They are hands-on, full-time practitio-ners who are motivated by most of the same things that existed when my father started a dental consulting business almost 40 years ago


My name: Michael Zuk

I live and practise in: red Deer, alberta

My training: DDS—general ortho and oral rehab (Spear)

Why I was drawn to dentistry: Interest in anatomy, art and science

My last trip: liverpool

The most exotic place I’ve travelled: Capri, Italy

The best souvenir I’ve brought back from a trip: rock star shoes—from leeds, uk

A favourite place that I keep returning to: Manzanillo, Mexico

Dream vacation: river cruise—Europe

If I could travel at any time, I’d go to: los angeles for a weekend

Favourite book: Ruthless Management

Favourite film: Terminator

Must-see TV show: Breaking Bad / 60

MINUTES

Favourite music: Come Together —The Beatles

My first job: Janitor

The gadget or gear I could not do without: iPhone

My favourite room at home: Study

My car: Tundra

My last purchase: Diamond ring for my wife

My last splurge: Celebrity teeth

My most-frequented store: Nordstrom

My closet has too many: Shoes

My fridge is always stocked with: Guinness

My medicine cabinet is always stocked with: aSa

My guilty pleasure is: Chocolate

Favourite exercise/sports activity: Weights

Favourite sport to watch: MMa

Celebrity crush: raquel

I’d want this with me if stranded on a desert island: Big knife

My secret to relaxing and relieving tension: Marketing development

A talent I wish I had: Speaking

My scariest moment: a missing child

My fondest memory: John lennon’s tooth auction win

A big challenge I’ve faced: Pulling a practice out of financial trouble

One thing I’d change about myself: Personality

The word that best describes me: Creative

I’m inspired by: Bruce lee

My biggest ego boost: Publicity

My biggest ego blow: Never mind

I’m happiest when: Giving birth to a new marketing plan

My greatest fear: Premature death

My motto is: only live once

A cause close to my heart: advocate against irresponsible cosmetic dental treatment

Something I haven’t done yet that’s on my must-do list: Clone movie script

If I wasn’t a dentist I’d be: Marketing Madman

What else should we know about you? I work as a marketing consultant for 1-800-VENEErS, High Speed Braces.org and killerToothache.com. you may have seen me on CBC Marketplace as a dental consultant investigating dentist pricing, and I was recently elected to be on the board for the alberta Dental association and College.

Off call? assorted stuff behind the scenes with John lennon’s tooth…and we may even be taking Elvis Presley’s crown on tour in the uk to raise awareness for mouth cancer.

sm

al

l t

al

k d e n t i s t s s h a r e t h e i r p i c k s , p a n s , p l e a s u r e s a n d f e a r s

Dr. MIChAel Zuk IS A MADMAn. A marketing madman, that is. Channelling some of that Don Draper mojo, he gets a rush from coming up with a winning marketing plan. He’s currently on a mission to clone John Lennon. Really. His last big splurge was winning an auction for the deceased Beatle’s tooth (and the DNA within) that has drawn the attention of major networks, newspapers and Rolling Stone magazine. It’s all part of this dentist’s rock-star vibe, whether following Lennon’s trail around Liverpool or donning some seriously rockin’ shoes. Next up: Elvis’s crown. Rock on.

PHo

ToS

Co

urT

ESy

of

Dr

. MIC

Ha

El Z

uk

What makes NSK handpieces the best? We engineer and manufacture every part in-house – we don’t just assemble parts made by someone else. And, since we control the quality going into all of our handpieces, we can trust them to deliver the reliability you need. Like the Ti-Max Z95L. It’s the most durable of the high-performance electric attachments on the market. Crafted from solid titanium, it’s extremely light in use. Plus, it’s amazingly silent with virtually no vibration – lending superior comfort to operator and patient.

It takes guts to say it’s the best,

1800 Global Parkway • Hoffman Estates, IL 60192 USA • Tel. (888) 675-1675 • www.nskdental.us/Canada

Smallest head & slimmest neck in electric attachments.**Global handpiece market as of 11/2011

but since we make the guts … we can.

Try it FREE for a week!

100%of all handpiececomponents aremanufactured in house.

Call your dealer or visit www.nskdental.us/Canada today.

NSK instruments are available from:

NSK_JUstCanadianDent_8.25x10.75.indd 1 10/14/13 4:25 PM

from top left Dr.

Michael Zuk’s rock-star impression; on TV

after buying John Lennon’s tooth; on his “UK tour,”

visiting Lennon’s childhood home; Strawberry Fields;

and his DNA pendant with a bit of that

tooth.

CME/CE Cruise & Travel SeminarsGalapagos Family AdventureHealthcare Considerations in Isolated Communities7-Night Expedition Cruise on the Galapagos LegendJune 29 - July 7, 2014

Arctic Cruise: Norway, Greenland & IcelandDental Challenges in Isolated CommunitiesVisit Oslo, Longyearbyen, Svalbard Islands, West Fjords August 7 - 21, 2014

Ireland: Explore the Emerald Isle Heritage & Healthcare in the Two IrelandsDublin, Belfast, Ashford Castle & optional Dromoland CastleSeptember 10 - 20, 2014

Tahiti & the Society IslandsTreatment Considerations in Isolated CommunitiesFree Air from Los Angeles! 5 Star Paul Gauguin CruiseNovember 8 - 15, 2014

New Year in the Caribbean Dental Needs in the CaribbeanEastern Caribbean on Royal Caribbean Oasis of the Seas December 27, 2014 - January 3, 2015

Australia & New Zealand on Celebrity Solstice Healthcare Perspectives from Down Under Sydney, Tasmania and miles of New Zealand’s coastline January 27 - February 8, 2015

Western Europe Cruise on Crystal Serenity Exploring the European Healthcare Model Lisbon to London: 6-Star All Inclusive Luxury July 12 - 25, 2015

www.pestravel.com 1-877-737-7005 [email protected]

LearnExplore

Experience

• 33 years experience

• 12-24 CME/CE credits

• Access to in-country healthcare facilities

• Tax deductible benefits

• PES Group Escorts

• Family & Friends welcome!

Why Travelwith PES?

Call to reserve your spot TODAY!

Custom Groups: Your Group, Your Program, Our Expertise! Global travel programs for your organizations, associations, educational and special interest groups.

Come See the World with Us!

Just For Canadian Dentists 2013-11 November December

Documents

Transcript of Just For Canadian Dentists 2013-11 November December