JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial...
Transcript of JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial...
![Page 1: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/1.jpg)
JS 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers –
Single Nucleotide PolymorphismsI. Announcements and Assignments
a. Dr. John DeHaan- Fire Debris arson expert 11/29b. Assignments- Reading and Articles
II. Mitochondrial DNAa. Biology of mitochondriab. DNA sequencing
I. Y Chromosome markers : Intro to Y chromosomes- Types of Y polymorphism
II. Single nucleotide polymorphisms (SNPs)a. Why SNPs? Intro to Single Nucleotide Polymorphisms (SNPS)b. Applications of SNPs c. Detection Technologies for Y SNPs in Forensics: Primer
Extension, Pyrosequencing, Light Cycling, Mass Specd. Bead based assays-Luminexe. Universal Arrays and Bacterial Identificationf. SNPs vs STRs or SNPs and STRs
![Page 2: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/2.jpg)
Why mtDNA SNPs?• Well characterized and studied
(population, evolutionary, medical and forensic studies)
• Uniparental maternal inheritancemissing persons
• Relatively small size (16kb) and high copy number - low quantity/quality samples (hair, bone, teeth- ancient/degraded)
• Implicated in maternally inherited diseases : diabetes, deafness, hypertrophic cardiomyopathy and myopathy
![Page 3: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/3.jpg)
Assignments and Announcements
• Announcements-– Criminalist Isha Brown Weds 9th May- CA DOJ DNA Databank– Assignments- – Butler Chapters 8-11 Inman, 16, Appendices IV&V, Inman10-11– Read Article Butler Y chromosome review article posted to the
web- Write a 500 word summary with 3Q and 3A – FOR 5 points extra credit
– Hand in assignment by weds 9th May
![Page 4: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/4.jpg)
Mitochondrial DNA regions used in forensics
• Hypervariable regions- also known as D-loop or control regions involved in the replication of mtDNA
• MtDNA is in very high copy number in every cell. There are many cells per sample and therefore many more copies than nuclear DNA that has only 1 per cell
• Most forensic laboratories utilize DNA sequencing to analyze mitochondrial DNA polymorphisms
![Page 5: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/5.jpg)
• Intro to Y chromosomes- Types of Y polymorphism
• Intro to Single Nucleotide Polymorphisms (SNPS)• Definitions• Why SNPs?• Applications of SNPs
• Detection Technologies for Y SNPs in Forensics• Primer Extension, Pyrosequencing, Light Cycling, Mass Spec• Bead based assays-Luminex
• Universal Arrays and Bacterial Identification
• SNPs vs STRs or SNPs and STRs• Either/Or• Why SNPs?
![Page 6: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/6.jpg)
Cycle sequencing : PCR in the presence of “bad” dNTPs – dideoxynucleoside
triphosphates•Synthesize DNA in the presence of some Dideoxy nucleotides without a 3-OH•Building a railroad with some tracks
that do not have connectors•End result is a complete set of fragments that
represent every base in the DNA strand•See animation
![Page 7: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/7.jpg)
Overview of the Y Chromosome(add picture of Y Chrom from Chris Tyler –Smith’s)
• Paternally inherited• Represents 2% of the human
genome• ~60 Mb in length, 2.5Mb on
tips recombine with the X• 95% of the Y is non-
recombining• Y SNP Consortium - Over
4193 SNPs on the Y chromosome http://ycc.biosci.arizona.edu/
![Page 8: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/8.jpg)
Why study the Y chromosome?• Population Genetics1
• Evolutionary and Genealogical studies2
• Molecular Ecology3
• Infertility studies4
• Forensics5
1 Kivisild et al. 2003. Am J Hum Genet Feb;72(2):313-32 Mountain JL 2002 Genome Res Nov;12(11):1766-72 SNPSTRs: empirically derived, rapidly typed, autosomal haplotypes for inference of population history and mutational processes.
2 http://www.oxfordancestors.com/3 Hellborg L et al. 2003. Mol Ecol Jan;12(1):283-91 Y chromosome conserved
anchored tagged sequences (YCATS) for the analysis of mammalian male-specific DNA
4 Kostiner, D.R. et al (1998) Male infertility: analysis of the markers and genes on the human Y chromosome. Hum. Reprod. 13, 3032-3038.
5 Lareu M, Puente J, Sobrino B, Quintans B, Brion M, Carracedo A. 2001 The use of the LightCycler for the detection of Y chromosome SNPs.Forensic Sci Int. 2001 May 15;118(2-3):163-8..Ewis AA, Lee JW, Kuroki Y, Shinka T, Nakahori Y. 2002. Yfm1, a multicopy marker specific for the Y chromosome and beneficial for forensic, population, genetic, and spermatogenesis-related studies. J Hum Genet. 47(10):523-8.
![Page 9: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/9.jpg)
YY in forensics?• Bad Boys: 98% of violent crime is committed by
men• Sexual Assault Evidence Screening: Rapid
screening of sexual assault evidence : “male specific”- so no differential
• Mixtures: Especially with very low copy male DNA in mixtures. May assist in determining single or multiple donors in difficult mixtures
• No spermatozoa: Aspermic samples: Sibille I, et al. 2002 Forensic Sci Int. 2002 Feb 18;125(2-3):212-6.
• Missing persons/Paternity: paternal lineage reference samples
![Page 10: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/10.jpg)
Polymorphisms on the Y
– Binary (biallelic) Markers• SNPs (single nucleotide polymorphisms)• YAP (Y Alu polymorphism)
– Microsatellites – STR’s• Tetranucleotide repeats such as DYS19, DYS385,
DYS388, DYS390, DYS391, etc.– Minisatellites - MSY1
![Page 11: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/11.jpg)
DefinitionsWhat is a SNP?
Single Nucleotide Polymorphisms Point mutation GAATCCTCCATCT
GAATCCACCATCTDeletion GAATCCTCCATCT
GAATCC-CCATCTInsertion GAATCCT-CCATCT
GAATCCTCCCATCT Most study Bi-allelic SNPs
GAATCCTCCATCTGAATCCACCATCT
![Page 12: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/12.jpg)
Why SNPs?• Extremely Well Studied- Used in virtually every
molecular field• Huge menu: The SNP Consortium (http://snp.cshl.org/ ) • The menu of Y SNPs includes over 4193 available Y
SNPs (Nature 2001. 409:928)• Contrast to under 100 available Y STRs (
http://www.cstl.nist.gov/biotech/strbbase)
• Multiplexing capability• “Easy” to score- on/off and Automate
![Page 13: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/13.jpg)
Nature 2001. 409:928
Le SNP Menu
![Page 14: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/14.jpg)
The Y Chromosome Consortium MapGenome Research (2002) 12: 339-348
![Page 15: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/15.jpg)
Other Applications of SNPs (aside forensics))• Medical Diagnostics
Tissue typing- HLA DQ alpha typingCystic FibrosisInflammatory panelsNeuro-psychiatric illnessesCancersChronic degenerative diseases
• Pharmacogenomics - Predictive Pharmacology• Association of genotype to drug response • Genetic population studies of patients and their responses to
treatment• Personalized Medicine
• Genetic Linkage studies- SNP Haplotyping
![Page 16: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/16.jpg)
• Detection Technologies for Y SNPs in Forensics
• Primer Extension- SNapShot- aka minisequencing. Dugan et al. 2003
• Pyrosequencing- Ballantyne, J. 2003 AAFS
• Light Cycling- Roche - Lareu M, et al. 2001 The use of the LightCycler for the detection of Y chromosome SNPs.Forensic Sci Int. 2001 May 15;118(2-3):163-8.
• Quadruopole MS- Eckenrode et al. 2003 AAFS
• Bead based assays-Luminex, Marligen Biosciences. Carlson et al 2002
![Page 17: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/17.jpg)
SNPs on the Luminex
Fluor coded beadswith allele specific oligos
PCR targets With labels
+
Y snp oligos attached to beads
Labeled PCRtargets
Beads withHybed targets
+
Butler, J. et al. 2003
![Page 18: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/18.jpg)
Bead Based Assay- Luminex 100DNA Gumballs
• Reporter fluorescence on the surface (target?) is quantified
• Internal Spectral AddressTM R:IR ratio (gumball color) identifies each of the assays (probe?)
![Page 19: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/19.jpg)
Recap of technology
1- Beads flow single file past two lasers• 633nm excites 2 dyes in beads• 532nm excites dye on target if there
3- Digital signal processor: • Collects, processes and saves the data (csv)• Records median fluorescence intensity (mfi)
633nm
532nm
2- Detectors capture:• R:IR ratio SNP probe ?• Scatter Single bead?• Reporter fluor SNP target ?
![Page 20: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/20.jpg)
Universal Arrays: Tm Bioscience
• 100 unique tags • No C: : 75% A/T + 25% G • 24-mers (six 4-bp motifs)• Isothermal (± 2°C)• Minimal cross-talk
Allele SpecificPCR primerTag
Anti-Tag
![Page 21: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/21.jpg)
Universal arrays and Primer Extension – SNP Detection Format Alternatives
• Reproducibility: Pre-coupled capture probes eliminates any conjugation variability
• Flexibility: Bead-capture/probe sets for any loci • Specificity: Primer-extension enhanced
• Multiplexing: 100 capture probes are isothermal (Tm + 2oC) for Tm Bioscience beads
![Page 22: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/22.jpg)
Primer Extension (allele specific), Tm Universal arrays and Luminex 100
Hybe Allele-SpecificTagged Primers
Tag 1G
C Tag 2
T
A
3’Wild Type
G 3’Mutant
TMultiplex PCR Products
Hybridize to BeadDetect with SA-PE
C BBSA-PE
BSA-PE
C BBSA-PE
BSA-PE
BBTag 1
GC Tag 2 B
TA
Extend in the presence ofBiotin dCTP
B
![Page 23: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/23.jpg)
Luminex SNP Applications, Kits or PublicationsLuminex SNP Applications, Kits or Publications• Bacterial IDBacterial ID Ye et al. 2001 Hum Mut. 17:305Ye et al. 2001 Hum Mut. 17:305• BiodefenseBiodefense Los Alamos National LaboratoryLos Alamos National Laboratory• Conservation GeneticsConservation Genetics UC Davis- BMLUC Davis- BML• Cystic Fibrosis TestingCystic Fibrosis Testing Dunbar et al. 2000. Clin Chem 46: 1498Dunbar et al. 2000. Clin Chem 46: 1498• ForensicsForensics Carlson et al. 2002 ISHICarlson et al. 2002 ISHI• Environmental Microb.Environmental Microb. Spiro et. Al. 2000. AEMicrobiol. 66:4258Spiro et. Al. 2000. AEMicrobiol. 66:4258• Plant Gene ExpressionPlant Gene Expression Yang et al. 2001 Genome Res. 11: 1888Yang et al. 2001 Genome Res. 11: 1888• HaplotypingHaplotyping www.polygenyx.comwww.polygenyx.com• HLA TestingHLA Testing www.onelambda.comwww.onelambda.com• Human Identity TestingHuman Identity Testing www.marligen.comwww.marligen.com• OncologyOncology www.mutlimetrix.comwww.mutlimetrix.com• Paternity testingPaternity testing www.luminexcorp.comwww.luminexcorp.com• Trichosporon sppTrichosporon spp University of Miami/www.miraibio.comUniversity of Miami/www.miraibio.com• ThrombophiliaThrombophilia www.luminexcorp.comwww.luminexcorp.com• Universal ArraysUniversal Arrays Tm BioscienceTm Bioscience• Virology AssaysVirology Assays Smith et al. 1998. Clin Chem 44:2054Smith et al. 1998. Clin Chem 44:2054
![Page 24: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/24.jpg)
Ye et al. 2001. Human Mutation 17:305Ahmadian A and J Lundeberg. 2002. A brief History of Genetic Variation Analysis. Biotechniques. 32:1122-1137. Entire Issues dedicated to SNP technology and Applications
Applications: 1- Bacterial IDApplications: 1- Bacterial ID
![Page 25: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/25.jpg)
Bacterial Identification using 16S rDNA SNPsBacterial Identification using 16S rDNA SNPsYe et al. 2001 Human Mutation.17:305-316Ye et al. 2001 Human Mutation.17:305-316
![Page 26: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/26.jpg)
ASPE vs SBCE on 16S rDNA SNPsASPE vs SBCE on 16S rDNA SNPs
G C
A C
A C
G C
ASPEASPE SBCESBCEC B BSA-PEB SA-PEC B SA-PE
Ye et al. 2001 Hum. Mut.17:305-316Ye et al. 2001 Hum. Mut.17:305-316
![Page 27: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/27.jpg)
SNPs vs STRsAdvantages Disadvantages
STRs Higher PDMultiplexes availableDatabases establishedFamiliar instrumentation
Limited abundanceStutterExtremely degraded samples
SNPs Abundance SNP ConsortiumHigh-throughput automationHighly degraded samples
Lower PD-need 50-100Mixture limitedNew instrumentationDatabases not established for forensicsValidated kits missing
![Page 28: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/28.jpg)
SNPs and STRs
• No STR results- eg 911 samples benefit from SNP typing
• SNPs utilized as a rapid screen – Used to exclude.
• SNPs as additional markers when STRs don’t provide sufficient discrimination (mass disasters where total families are lost- relatives with high numbers of shared alleles)
• SNPSTRs?
![Page 29: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/29.jpg)
Genome Res 2002 Nov;12(11):1766-72 SNPSTRs: empirically derived, rapidly typed, autosomal haplotypes for inference of population history and mutational
processes. Mountain JL, Knight A, Jobin M, Gignoux C, Miller A, Lin AA, Underhill PA. Department of Anthropological Sciences, Stanford, California 94305,
SNPs and STRs SNPSTRs: “Each such segment includes one or more single nucleotide polymorphisms (SNPs) and exactly one short tandem repeat (STR) locus”
GACTCCTCCATCTAGATAGATAGATAGATATCTGAATCCACCATCTAGATAGATAGATAGATATCT
![Page 30: JS 111 Advanced Fluorescence applications- … 111 Advanced Fluorescence applications- Mitochondrial DNA and Y chromosome markers – Single Nucleotide Polymorphisms ... 3 Hellborg](https://reader031.fdocuments.in/reader031/viewer/2022021821/5b0323917f8b9a8c688bad9a/html5/thumbnails/30.jpg)
Summary• MtDNA –Well studied, HV regions - degraded DNA
Maternal lineage reference samples missing persons databases- Dideoxysequencing detection
• Y chromosome markers - 98% of violent crime by males, useful on mixtures and sexual assault evidence, aspermic individuals and missing persons
• Why Single Nucleotide Polymorphisms (SNPS)• Well studied, Huge selection, multiplexed and automated• Primer Extension, Pyrosequencing, Light Cycling, Mass Spec,
Bead based assays-Luminex• SNPs vs STRs or SNPs and STRs
• Either/Or Why SNPs?