JOURNAL OF BACTERIOLOGY, Aug. 2003, p. 4578–4584 Vol. 185, No. 150021-9193/03/$08.00�0 DOI: 10.1128/JB.185.15.4578–4584.2003Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Molecular and Functional Analysis of the lepB Gene, Encoding a Type ISignal Peptidase from Rickettsia rickettsii and Rickettsia typhi

M. Sayeedur Rahman,* Jason A. Simser, Kevin R. Macaluso, and Abdu F. AzadDepartment of Microbiology and Immunology, University of Maryland

School of Medicine, Baltimore, Maryland 21201

Received 14 March 2003/Accepted 7 May 2003

The type I signal peptidase lepB genes from Rickettsia rickettsii and Rickettsia typhi, the etiologic agents ofRocky Mountain spotted fever and murine typhus, respectively, were cloned and characterized. Sequenceanalysis of the cloned lepB genes from R. rickettsii and R. typhi shows open reading frames of 801 and 795nucleotides, respectively. Alignment analysis of the deduced amino acid sequences reveals the presence ofhighly conserved motifs that are important for the catalytic activity of bacterial type I signal peptidase. Reversetranscription-PCR and Northern blot analysis demonstrated that the lepB gene of R. rickettsii is cotranscribedin a polycistronic message with the putative nuoF (encoding NADH dehydrogenase I chain F), secF (encodingprotein export membrane protein), and rnc (encoding RNase III) genes in a secF-nuoF-lepB-rnc cluster. Thecloned lepB genes from R. rickettsii and R. typhi have been demonstrated to possess signal peptidase I activityin Escherichia coli preprotein processing in vivo by complementation assay.

The genus Rickettsia comprises several intracellular patho-gens, some of which are responsible for the most severe bac-terial diseases of humans. These include R. prowazekii, thecausative agent of epidemic typhus, R. typhi, the agent of mu-rine typhus, and R. rickettsii, the agent of Rocky Mountainspotted fever (5, 16). These gram-negative, obligate, intracel-lular bacteria are transmitted to their mammalian hosts byarthropod vectors such as ticks, fleas, and lice and grow withinthe cytoplasm of eukaryotic cells (3). Although systematic ap-proaches have revealed substantial information about the bi-ology of rickettsial growth in host cells, the lack of a geneticmanipulation system has hampered our ability to characterizethe genes involved in the pathogenesis of rickettsiae (16, 30).The molecular basis of the protein secretion mechanism in-volved in the growth and pathogenesis of these intracellularbacteria remains an important subject of research.

In bacteria, the majority of proteins that are translocatedacross membranes are synthesized as preprotein with an ami-no-terminal extension known as the signal or leader peptide.The signal peptide is involved in targeting preproteins fortranslocation via the Sec system (25). The Sec machinery con-sists of multiple proteins and provides a channel for translo-cation of newly synthesized preproteins from the cytosol acrossthe cytoplasmic membrane in bacteria (13). The homotetramerSecB, a chaperone protein, interacts with the newly synthe-sized preprotein in the cytoplasm and targets the preproteinsto the SecAYEG-translocase at the membrane interface. Fi-nally, type I signal peptidase, a membrane-bound endopepti-dase presumably located in proximity to SecYEG, cleaves theleader peptide from the preprotein, which results in the releaseof the mature protein from the membrane (22). It has been

demonstrated that inhibition of bacterial type I signal pepti-dase leads to the accumulation of preproteins and eventual celldeath (11, 14, 20, 21). Due to its essential role in bacterial cellgrowth and relative accessibility of its active site on the outerleaflet of the cytoplasmic membrane, type I signal peptidaseshave been considered as a potential target for the developmentof novel antibacterial agents (24).

New opportunities arising from the recent publication of thegenome sequences of R. prowazekii (2), R. conorii (23), andR. sibirica (GenBank accession number AABW01000001) nowenable us to select and characterize rickettsial genes of inter-est. Our interest is in characterizing the genes involved in pro-tein secretion pathways of rickettsiae in order to assess theirpotential roles in the invasion, growth, and pathogenesis ofthese obligate intracellular bacteria. In this communication, wereport the cloning and sequence analysis of the putative lepBgene that encodes type I signal peptidase from R. rickettsii andR. typhi. In addition, we provide the first detailed molecularand functional characterization of the lepB gene of R. rickettsiiand R. typhi.

MATERIALS AND METHODS

Bacterial strains. R. rickettsii strain Sheila Smith (7) and R. typhi strain AZ322Ethiopian isolate (4) were used in this study. The temperature-sensitive E. colistrain IT41 (17) was used for complementation assay.

Genomic DNA extraction. Vero cells (African green monkey kidney cells,ATCC number CRL-1573) were cultured in Dulbecco’s modified Eagle medium(DMEM) with 4.5 g of glucose per liter with glutamine (Biofluids, Inc., Rockville,Md.) supplemented with 10% fetal bovine serum (Gemini, Calabasas, Calif.).R. rickettsii and R. typhi were propagated in Vero cells as previously described(15, 26). Rickettsiae were partially purified from rickettsiae-infected (�90%)Vero cells as follows. Infected cells were harvested and mechanically ruptured byforcing them through a 27-gauge needle attached to a 10-ml syringe to releasethe intracellular bacteria. To enrich for rickettsiae, large cell fragments andintact host cells were removed by low-speed centrifugation (275 � g for 10 min).The supernatants were centrifuged at 14,000 � g for 20 min at 4°C to pellet thepartially purified rickettsiae. Genomic DNA of R. rickettsii and R. typhi wasextracted by using the Wizard genomic DNA purification kit (Promega, Madi-son, Wis.).

* Corresponding author. Mailing address: Department of Microbi-ology and Immunology, University of Maryland School of Medicine,655 West Baltimore St., BRB 13-009, Baltimore, MD 21201. Phone:(410) 706-3337. Fax: (410) 706-0282. E-mail: mrahm001@umaryland.edu.

4578

on March 5, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

Cloning of the R. rickettsii and R. typhi lepB operon. The R. rickettsii lepBoperon was amplified by PCR in two different fragments. The primers used inPCRs are shown in Table 1. The primers AZ971 (forward) and AZ974 (reverse)were used to amplify the lepB gene of R. rickettsii (first fragment). For 100 �l ofPCR, 200 ng of R. rickettsii genomic DNA was used. Thermal cycling conditionsconsisted of initial denaturation at 94°C for 2 min followed by 30 cycles at 94°Cfor 1 min, 45°C for 1 min, and 72°C for 3 min, and a final extension step at 72°Cfor 10 min was performed by using Pfu DNA polymerase (Stratagene, La Jolla,Calif.). The PCR product (1,640 bp) was purified by Strataprep PCR purificationkit (Stratagene). The purified PCR product was cloned into pPCR-Script AmpSK(�) vector (Stratagene) and was transformed into Escherichia coli TOP10cells (Invitrogen Life Technologies, Carlsbad, Calif.). The cloned lepB region ofR. rickettsii was sequenced by the dye termination method by using a model373 automated fluorescent sequencing system (Applied Biosystems, Foster City,Calif.). The second fragment containing the upstream region of the lepB genewas PCR amplified from R. rickettsii DNA by using the forward primer AZ1501and the reverse primer AZ1375. PCR amplification, cloning, and sequencing ofthe second fragment (2,978 bp) were performed by following the same conditionsas mentioned for the first fragment. The sequences of both fragments of theR. rickettsii lepB region were combined and aligned by using MacVector 6.5.3software (Genetics Computer Group, Inc., Madison, Wis.).

The R. typhi lepB gene was amplified by using the primers AZ971 (forward)and AZ974 (reverse). The PCR fragment (1,639 bp) was cloned and sequencedas described above.

The sequence of the lepB operon and deduced amino acid sequence of R. rick-ettsii and R. typhi were analyzed with MacVector 6.5.3 software. Sequence com-parisons to those available in GenBank were performed using BLAST analysis(http://www.ncbi.nlm.nih.gov).

Isolation of RNA and RT-PCR. R. rickettsii and R. typhi were purified fromVero cells (�90% infection) as described above. Total RNA from the partiallypurified rickettsiae was isolated by the use of Trizol reagent (Invitrogen LifeTechnologies) and treated with RQ1 RNase-free DNase (Promega) by followingmanufacturers’ recommendations. Reverse transcription-PCR (RT-PCR) wasperformed with 300 ng of total RNA in 50-�l reaction volumes by using Super-Script One-Step RT-PCR with Platinum Taq (Invitrogen Life Technologies).The thermal cycling conditions consisted of one cycle of 45°C for 30 min and

94°C for 2 min, followed by 35 cycles of 94°C for 30 s, 48°C for 30 s, 72°C for 2min, and a final extension step of 72°C for 10 min.

Northern analysis. The total RNA (6 �g) from R. rickettsii was subjected toNorthern analysis by using the NorthernMax kit (Ambion, Austin, Tex.). The[�-32P]dATP (Amersham Pharmacia Biotech, Piscataway, N.J.)-labeled 297-bpprobe specific to the lepB coding sequence corresponding to primers AZ1372 andAZ1534 was prepared by use of the Strip-EZ PCR probe synthesis kit (Ambion).The hybridized membrane (positively charged nylon) was exposed to KodakBiomax MS film for autoradiography.

Complementation and expression analysis of the rickettsial lepB gene. ThelepB gene of R. rickettsii or R. typhi was cloned into the SacI and EcoRI sites ofpPCR-Script Amp SK(�) vector (Stratagene) under a lac promoter by incorpo-ration of the restriction sites into the primers used to amplify the insert se-quences. The primers AZ1055 (EcoRI) and AZ1056 (SacI) were used for the clon-ing of the 1,588-bp fragment of the R. typhi lepB gene to generate the pRTlepB23plasmid. For the R. rickettsii lepB gene, the 1,592-bp fragment was amplified byAZ1262 (EcoRI) and AZ1263 (SacI) primers in order to clone and generate thepRRlepB569 plasmid. The constructed plasmids pRRlepB569 and pRTlepB23were checked by sequencing. For the complementation assay, plasmids weretransformed into E. coli strain IT41 cells and selected on a Luria broth (LB)-ampicillin (100 �g ml�1) plate incubated at 30°C for 48 h. For controls, plasmidpUC18 or pESL4 [carrying a 2,229-bp fragment of the groESL gene of R. typhiinto pPCR-Script Amp SK(�) vector; reference 26] was also transfected into E.coli strain IT41 cells. For the complementation assay by growth curve, thetransformed cells were grown in an LB-ampicillin mixture overnight at 30°C. Thecultures were diluted 100-fold into a fresh LB-ampicillin mixture and incubatedwith shaking at nonpermissive temperature of 42°C. The optical density at 600nm was recorded at 30-min intervals. For the complementation assay by CFUassay, the transformed cells were grown to mid-log phase in LB-ampicillin mix-ture at 30°C and plated onto two sets of LB-ampicillin plates. One set of plateswas incubated at 30°C and the other at 42°C. The colonies were counted after48 h of incubation to determine the percentage of growth at 42°C with respect to30°C. All experiments were performed at least three times and the standarddeviation was calculated (shown as �) by using Microsoft Excel software.

To analyze the synthesis of rickettsial signal peptidase I in E. coli strain IT41,the lepB open reading frame (ORF) of R. rickettsii was amplified by primersAZ1514 (BamHI) and AZ1515 (EcoRI) and cloned into the pTrcHisC vector(Invitrogen Life Technologies) at the BamHI and EcoRI sites. The constructedplasmid pTrcHisRR4 that contained the 804-bp ORF of lepB from R. rickettsiiwas confirmed by sequencing. The constructed plasmids pTrcHisRR4 and vectorpTrcHisC were transfected into E. coli strain IT41 cells as mentioned above.

The transformed cells were grown to mid-log phase in LB-ampicillin (100 �g/ml) medium at 30°C and then induced for protein expression by the addition of1 mM isopropyl-�-D-thiogalactopyranoside (IPTG). Cells were harvested at 4 hpostinduction and resuspended in (1/10 vol) 1� phosphate-buffered saline. Cellsuspensions were mixed with equal volumes of 2� Tris-glycine-sodium dodecylsulfate (SDS) sample buffer (Invitrogen Life Technologies) and boiled at 100°Cfor 5 min. Total cell proteins were separated on 4 to 12% Tris-glycine precast gel(Invitrogen Life Technologies) by using 1� Tris-glycine-SDS running buffer (Bio-Rad, Hercules, Calif.). The proteins were transferred to a polyvinylidene di-fluoride membrane (Invitrogen Life Technologies). The membrane was blottedwith His-Tag monoclonal antibody (Novex, Madison, Wis.) by using the Western-Breeze chromogenic immunodetection system (Invitrogen Life Technologies).

Nucleotide sequence accession numbers. The GenBank accession numbers forthe lepB operons reported in this communication are AY134668 for R. rickettsiiand AF503336 for R. typhi.

RESULTS

Cloning and sequence analysis of the rickettsial lepB gene.The lepB operon of R. rickettsii and R. typhi was cloned andsequenced as described in Materials and Methods. The DNAsequence analysis of the lepB operon revealed a putative ORFof 801 nucleotides for R. rickettsii and 795 nucleotides for R.typhi. Alignment analysis showed that the lepB DNA sequenceswere 89 to 98% identical among R. rickettsii, R. typhi, R.prowazekii (2), R. conorii (23), and R. sibirica (GenBank acces-sion number AABW01000001). The deduced amino acid se-quences of the lepB gene among the rickettsiae species showeda very high degree of identity (ranging from 89 to 98%); how-

TABLE 1. Primers used in PCR reactions

Primer Sequencea Nucleotide position

AZ971 GGGTCTGGACTTGGTACAGGTGG 138,001–138,023b

AZ974 CACTTCTTCGCCATGAGTCA 139,601–139,620b

AZ1039 CAGTTAAACAGGAGTTTGCTTC 533–554e

AZ1040 GATTCTTGAATATTCGACTTAATC 1,253–1,276e

AZ1055 CGCCATGAGTCAgAATTcTATAATC 139,588–139,612b

AZ1056 GGTACAGGaGcTcTTATTGTTATGG 138,013–138,037b

AZ1262 CTTCGCCATGAGTCAgAATTcTATA 139,591–139,615b

AZ1263 GGTAgAGctcGTATTATAGTTATGG 2,323–2,347c

AZ1287 CAGCTAAGCAAGAGTGGGGGTC 2,867–2,888c

AZ1286 CGATTTAACCTCACAGATTCAACCC 3,572–3,596c

AZ1372 GAGCCGTTTACCGTTCCAAC 2,938–2,957c

AZ1374 TGTTCTACCGTTTGGCAGTG 3,290–3,309c

AZ1375 TTGGAACGGTAAACGGCTCC 2,937–2,956c

AZ1501 CCTCAAATCCCTAAAGTATCTC 4,415–4,436d

AZ1514 GAGAggATcCAAACAGATAATAC 2,824–2,846c

AZ1515 CAAATGAaTtCATTACGCATCCGTG 3,618–3,642c

AZ1528 GCTTGGAATAGGTGAGGTGG 514–533c

AZ1529 GCAAGAAGCGAGGCGATTGG 1,448–1,467c

AZ1531 GCTTCATCTAAGGCACGCTG 1,786–1,805c

AZ1533 CCTTATTCTTTTTGGCGGTG 1,063–1,082c

AZ1534 CGTGCGTTCTATTTTTTTGTCG 3,213–3,234c

AZ1535 CCCTCTATTGCTTTCGTAAC 2,518–2,537c

AZ1556 ACTTCTTGAGATAAATCAGC 126–145c

AZ1566 TTAGCTCCAACCATGCATATTG 3,883–3,904c

AZ1568 GCTTTGTCATACTCATAAACCCAAG 833–857c

a The nucleotides modified to generate restriction sites are indicated in lowercase.

b Nucleotide sequence position numbering corresponding to the R. prowazekiigenome sequence (GenBank accession number AJ235270).

c Nucleotide sequence position numbering taken from R. rickettsii lepB operon(GenBank accession number AY134668).

d Nucleotide sequence position numbering corresponding to the R. conoriigenome sequence under GenBank accession number AE008582.

e Nucleotide sequence positions are taken from R. typhi lepB operon underGenBank accession number AF503336.

VOL. 185, 2003 R. RICKETTSII AND R. TYPHI lepB GENE 4579

on March 5, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

ever, that with the lepB of E. coli was very low (around 26%)(Fig. 1). Nevertheless, the amino acid sequence alignmentshown in Fig. 1 revealed highly conserved amino acid domains(boxes B, C, D, and E) that are considered important for thecatalytic activity of bacterial type I signal peptidase (10, 24).Box B (residues 88 to 95; E. coli signal peptidase I numbering)contains the nucleophilic Ser90 (shown in blue) and a con-served Met91 (shown in red). Box C contains residues 127 to134, and box D (residues 142 to 153) contains the general baseLys145 (shown in blue) and a conserved Arg146 (shown inred). Box E (residues 272 to 282) contains the highly conservedGly272, Asp273, Asn274, Asp280, and Arg282 (shown in red).These sequence analyses, performed with the web-basedHMMTOP program, suggested the presence of a single amino-terminal transmembrane domain for the rickettsiae (Fig. 1)compared to the two transmembrane domains in E. coli signalpeptidase I (10).

Transcriptional analysis of the rickettsial lepB gene. RT-PCR was performed to analyze rickettsial expression of thelepB gene. Amplification products (predicted from the se-quence) of 744 bp (lane 2) and 730 bp (lane 3) as shown in Fig.

2 were obtained for R. typhi and R. rickettsii, respectively,thereby confirming the expression of lepB mRNA for theserickettsia species.

Total RNA isolated from R. rickettsii was analyzed by North-ern hybridization to assess lepB transcript size (Fig. 3). Thehybridization probe specific to the lepB coding sequence de-tected three bands (4.5, 2.5, and 1.5 kb), thereby indicating thepolycistronic transcription of the R. rickettsii lepB operon. Thelower hybridization intensity of the 4.5-kb band compared tothat of the 2.5- and 1.5-kb bands could be explained by lowerstability and posttranscriptional cleavage of the polycistroni-cally transcribed message of the R. rickettsii lepB operon. How-ever, the presence of an additional promoter(s) to generatemultiple transcripts cannot be ruled out.

For further characterization of the polycistronic transcrip-tion of the R. rickettsii lepB operon, a series of RT-PCRanalyses were performed on the total RNA isolated fromR. rickettsii, which examined the putative secF (protein exportmembrane protein) and nuoF (NADH dehydrogenase I chainF) genes upstream of the lepB gene and the putative rnc gene(RNase III) downstream of lepB gene as shown in Fig. 4A. The

FIG. 1. Alignment of amino acid sequences deduced from the putative lepB gene of R. rickettsii (Rr, this work), R. typhi (Rt, this work), R. conorii(Rc, accession number AE008582), R. prowazekii (Rp, accession number AJ235270), R. sibirica (Rs, accession number AABW01000001), and thesignal peptidase I of E. coli (Ec, accession number BAA10915). Number of amino acids (a.a. #) is mentioned after the sequence of each species.The molecular weight (MW) and isoelectric point (pI) were computed by using the prediction server available at http://us.expasy.org/cgi-bin/pi_tool.html. The transmembrane domains shown in green were predicted by the HMMTOP program available at http://www.enzim.hu/hmmtop/index.html. The conserved amino acids regions (boxes B through E) are shown in boldface (black, blue, and red). Overall identity with R. rickettsii(Rr) signal peptidase I was calculated with MacVector 6.5.3 software.

4580 RAHMAN ET AL. J. BACTERIOL.

on March 5, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

expected RT-PCR products utilizing various forward and re-verse primers on the secF-nuoF-lepB-rnc gene cluster (Fig. 4A)of R. rickettsii are shown in Fig. 4B. The RT-PCR productsshown in lanes 2 to 5 and 7 (Fig. 4B) suggested the polycis-tronic transcription of the secF-nuoF-lepB-rnc gene cluster.The lower intensity of the RT-PCR product (1,894 bp) of theprimer pair AZ1533 and AZ1375 spanning the secF to lepBgenes (Fig. 4B, lane 4) supported the explanation of posttran-scriptional cleavage and instability of the polycistronically tran-scribed single mRNA of the R. rickettsii secF-nuoF-lepB genecluster. The RT-PCR product shown in lane 6 (Fig. 4B), pro-duced by using forward primer AZ1556 (165 nucleotides up-stream from the secF start codon) and reverse primer AZ1568(from the coding region of secF), indicated that the transcrip-tion start site could be located further upstream of the secF-nuoF-lepB-rnc gene cluster of R. rickettsii.

Expression and functional analysis of the rickettsial lepBgene in E. coli. The type I signal peptidase activity of therickettsial lepB gene was assayed by genetically complementingthe temperature-sensitive E. coli strain IT41. The E. coli strainIT41, which has a nonsense mutation in the lepB gene, showsnormal growth at 30°C, but the preprotein processing and cellgrowth are severely affected at 42°C (9). The strain IT41 hasbeen used to demonstrate the complementation ability ofmany gram-negative and gram-positive bacterial type I signalpeptidase genes (24).

The E. coli strain IT41 was transfected with pRRlepB569and pRTlepB23 and with the control plasmids pESL4 andpUC18. The temperature-sensitive growth was assayed as de-scribed in Materials and Methods. It is clearly observed fromthe growth curves shown in Fig. 5 that the E. coli strain IT41carrying the plasmid pRRlepB569 (carrying the 1,592-bp frag-ment of the R. rickettsii lepB gene) or pRTlepB23 (carrying the1,588-bp fragment of the R. typhi lepB gene) grew much fasterthan the E. coli strain IT41 with or without control plasmidspESL4 and pUC18 at the nonpermissive temperature of 42°C,thereby indicating functional complementation of the lepBgene from R. rickettsii or R. typhi in E. coli strain IT41. Forquantitative comparison of the growth at the nonpermissivetemperature of the transformed E. coli strain IT41, survivalwas also determined by CFU assay. Survival as measured byCFU of E. coli strain IT41 at 42°C was 0.081 � 0.017% of thatgrown at 30°C. The control plasmids pESL4 and pUC18 wereunable to improve the growth of the strain IT41 at 42°C.However, the temperature-sensitive E. coli strain IT41 carryingthe plasmid pRRlepB569 or pRTlepB23 showed a substantialincrease in the growth at 42°C by 73.37 � 22.64% or 78.68 �12.82% (compared to that at 30°C), respectively, indicating thefunctional expression of the lepB gene from R. rickettsii or R.typhi in E. coli.

The expression of rickettsial signal peptidase I (expectedsize, 31 kDa) in E. coli was too low to detect by Coomassiebrilliant blue staining of SDS-polyacrylamide gel electrophore-sis-separated proteins. Therefore, the expression of rickettsialsignal peptidase I in E. coli was investigated by cloning thecoding sequence (804-bp ORF) of the R. rickettsii lepB gene atthe BamHI and EcoRI sites of pTrcHisC vector containing anN-terminal His6 tag under the trc (trp-lac) promoter. The ex-pression of the recombinant protein was confirmed by Westernblot analysis by using a monoclonal antibody to the N-terminal

FIG. 2. Transcription analysis of the R. rickettsii and R. typhi lepBgenes. Ethidium bromide-stained 1% agarose gel in 1� TAE (Tris-acetate–EDTA) buffer. Total RNAs isolated from R. rickettsii or R.typhi cultured in Vero cells were used for RT-PCR. Lanes 1 and 2represent PCR and RT-PCR analysis, respectively, on the total RNAisolated from R. typhi (performed by using forward primer AZ1039 andreverse primer AZ1040 specific to the lepB coding region). Lanes 3 and4 represent RT-PCR and PCR analysis on the total RNA isolated fromR. rickettsii (performed by using forward primer AZ1287 and reverseprimer AZ1286 specific to the lepB coding region). The control lanes1 and 4 demonstrate the absence of DNA in the RNA samples. Gene-Ruler 100-bp DNA ladder plus (MBI-Fermentas, Hanover, Md.) wasused as a DNA size marker (lane M).

FIG. 3. Northern blot analysis of total RNA isolated from R. rick-ettsii cells cultured in Vero cells. Total RNA (6 �g) was separated ona 1% agarose gel and transferred to a positively charged nylon mem-brane. The membrane was hybridized with a radiolabeled 297-bpprobe specific to R. rickettsii lepB. Relative size of the hybridized bandswas determined by using a 0.24- to 9.5-kb RNA ladder (Invitrogen-LifeTechnologies).

VOL. 185, 2003 R. RICKETTSII AND R. TYPHI lepB GENE 4581

on March 5, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

His6 tag. A band of approximately 35 kDa was recognized for theE. coli strain IT41 carrying pTrcHisRR4 plasmid (Fig. 6, lane 1)that was not detected for control expression (Fig. 6, lanes 2 and3). Two minor bands (one around 32 kDa and another below 32kDa) in lane 1 of Fig. 6 may have resulted from the nonspecificbinding in the total proteins or an autocatalytic cleavage, whichwas previously reported for the E. coli leader peptidase and Ba-cillus subtilis SipS (29). Complementation analysis performed byusing the constructed plasmid pTrcHisRR4 showed a significantincrease in the growth of the temperature-sensitive E. coli strainIT41 at 42°C (Fig. 5) and that also assayed by CFU restored thesurvival by 94.95 � 4.45%. However, the control plasmidpTrcHisC was unable to restore the growth of the temperature-sensitive E. coli strain IT41 at the nonpermissive temperature.

DISCUSSION

In order to elucidate the mechanisms of protein secretion ofrickettsiae, we focused on the characterization of the type Isignal peptidases of R. rickettsii and R. typhi. In this communi-cation, we describe the cloning, sequence analysis, transcrip-tion, and functional expression of the putative lepB gene thatencodes type I signal peptidase of R. rickettsii and R. typhi. Theresidues of amino acids serine 90 and lysine 145 (E. coli signalpeptidase I numbering), which are considered critical for cat-alytic activity of signal peptidase I in gram-negative and gram-positive bacteria and which are thought to form a catalyticdyad (10), are found to be conserved in the putative signal

peptidase I of R. rickettsii and R. typhi. The catalytic domains(boxes B through E) found in bacterial signal peptidase I (10,24) are also shown to be conserved for the rickettsial signalpeptidase I.

Type I signal peptidases from many gram-negative bacte-ria—including E. coli and Salmonella enterica serovar Typhi-murium—have two transmembrane domains at the N terminusfor assembly of the enzyme into the membrane and a carboxy-terminal catalytic domain (19, 24). However, type I signalpeptidases from gram-positive bacteria (e.g., B. subtilis, Staph-ylococcus aureus, and Streptococcus pneumoniae) and somegram-negative bacteria (e.g., Bradyrhizobium japonicum andRhodobacter capsulatus) (6, 19, 24), including rickettsiae, aresmaller in size and have only a single transmembrane segmentat the N terminus for its assembly into the membrane. Thecarboxy terminus carrying the conserved catalytic domains(boxes B through E) is also smaller in size compared with thatof gram-negative E. coli (10, 24).

The analysis of the recently published genome sequences ofR. prowazekii (2), R. conorii (23), Rickettsia sibirica, and thelepB sequence of R. rickettsii reported in this communicationreveal that the putative genes secF (encoding protein exportmembrane protein SecF) and nuoF (encoding NADH dehy-

FIG. 4. Schematic map and RT-PCR analyses of clustered secF-nuoF-lepB-rnc genes for R. rickettsii. (A) Schematic map and scale ofthe secF-nuoF-lepB-rnc gene cluster of 3,930 bp for R. rickettsii illus-trates three putative ORFs of secF (encoding protein export mem-brane protein; nucleotide position, 290 to 1,216; green), nuoF (encod-ing NADH dehydrogenase I chain F; nucleotide position, 1,381 to 2,646;blue), lepB (encoding type I signal peptidase; nucleotide position, 2,830 to3,630; red) and partial sequence of rnc (encoding RNase III; partial 5sequence, 3,630 to 3,930; gray). Primers used in RT-PCR analysis areshown by forward and reverse arrows. (B) RT-PCR analyses of thetotal RNA isolated from R. rickettsii cells cultured in Vero cells.Ethidium bromide-stained 1% agarose gel in 1� TAE (Tris-acetate–EDTA) buffer is shown. RT-PCR products are shown: lane 1, 372 bpusing forward primer AZ1372 (lepB) and reverse primer AZ1374 (lepB);lane 2, 1,509 bp using forward primer AZ1529 (nuoF) and reverseprimer AZ1375 (lepB); lane 3, 1,475 bp using forward primer AZ1533(secF) and reverse primer AZ1535 (nuoF); lane 4, 1,894 bp using for-ward primer AZ1533 (secF) and reverse primer AZ1375 (lepB); lane 5,1,292 bp using forward primer AZ1528 (secF) and reverse primerAZ1531 (nuoF); lane 6,732 bp using forward primer AZ1556 (165nucleotides upstream from secF start codon) and AZ1568 (secF); andlane 7, 967 bp using forward primer AZ1372 (lepB) and reverse primerAZ1566 (rnc). The control PCR using the same primer sets (used forRT-PCR analysis) on the total RNA of R. rickettsii produced no de-tectable product (data not shown), indicating no DNA contaminationin the total RNA used in this analysis. The specificity of each primerpair (used for RT-PCR) to amplify the target sequence was checked(data not shown) by PCR on template DNA. GeneRuler 100-bp DNAladder plus (MBI-Fermentas) was used as a DNA size marker (lanesM).

4582 RAHMAN ET AL. J. BACTERIOL.

on March 5, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

drogenase I chain F) are located upstream of the putative lepB(encoding type I signal peptidase) gene. We also show that theputative gene rnc (encoding RNase III, partial sequence of the5 end) (Fig. 4A) is located downstream of lepB, such that thetermination codon of the signal peptidase I (lepB) gene over-laps with the initiation codon of the RNase III (rnc) gene. TheRT-PCR data presented here demonstrate that the putativegenes secF, nuoF, lepB, and rnc are transcribed polycistroni-

cally from the same promoter in R. rickettsii and that thetranscription start site is located further upstream of the poly-cistronic message of the secF-nuoF-lepB-rnc gene cluster. InNorthern analysis, the presence of the 4.5-kb band further sup-ports our explanation that the secF-nuoF-lepB-rnc gene cluster(approximate transcript size, 4.0 kb) (23) cotranscribes in asingle polycistronic message in R. rickettsii.

Although polycistronic transcripts usually encode productsinvolved in a common pathway (e.g., the trp and lac operon inE. coli), there are reports that the polycistronically transcribedlep operon (lepA and lepB genes) and lsp locus (lsp and ileSgenes) in E. coli have unrelated functions (12, 18). The puta-tive secF and lepB gene products are considered to be involvedin the same protein secretion pathway (22); however, the co-transcription of the nuoF and rnc genes of secF-nuoF-lepB-rncclustered in R. rickettsii could not be explained in terms of re-lated functions. Genome analysis of rickettsiae (1, 2, 23) re-vealed that genome reduction is an ongoing process for obli-gate intracellular parasites. It was suggested that this reductionis due to the redundancy of the parasite genes for enzymaticactivities supplied by the host cell. Therefore, intracellularparasites typically have fewer genes that code for biosyntheticfunctions than do free-living bacteria. Thus, one possible ex-planation for the coordinated expression of seemingly unre-lated genes is reduction of transcriptional control. However, itis also possible that the functions may be related by an as-yet-unknown manner for obligate intracellular parasites.

The expression of the putative lepB gene of R. rickettsii andR. typhi from a plasmid in E. coli produced active type I signalpeptidase, as demonstrated by complementation assay in thisstudy in an E. coli strain IT41 that was temperature sensitivefor preprotein processing at the nonpermissive temperature(42°C). The positive correlation between E. coli strain IT41growth and the catalytic activity of plasmid-borne signal pep-tidase I at the nonpermissive temperature has been used todemonstrate the enzymatic activity of the putative type I signalpeptidase gene from other gram-negative and gram-positive

FIG. 5. Growth curves showing the complementation in E. colistrain IT41 transfected with appropriate plasmids (as mentioned inMaterials and Methods). Cultures pregrown at 30°C were diluted 100-fold into LB-ampicillin broth (IT41 cells without plasmid were grownin absence of ampicillin) and incubated with shaking at 42°C. Thegrowth of cells in culture was monitored by optical density (OD) at 600nm.

FIG. 6. Western blot analysis of the expression of the R. rickettsii signal peptidase I in E. coli strain IT41. Total proteins from the E. coli cellscarrying pTrcHisRR4 or pTrcHisC plasmids, separated on 4 to 12% Tris-glycine precast gel, 1� Tris-glycine-SDS running buffer, transferred topolyvinylidene difluoride membrane was probed with His-Tag monoclonal antibodies by using a WesternBreeze chromogenic immunodetectionkit. Lane 1, total proteins from E. coli IT41/pTrcHisRR4; lane 2, total proteins from E. coli IT41/pTrcHisC; and lane 3, total proteins from E. coliIT41. Lane M, Bio-Rad Kaleidoscope prestained markers (carbonic anhydrase, 39.7 kDa; soybean trypsin inhibitor, 32.1 kDa).

VOL. 185, 2003 R. RICKETTSII AND R. TYPHI lepB GENE 4583

on March 5, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

bacteria (8, 9, 24, 27, 28). Our complementation data pre-sented here indicate that proteins that are processed by E. colisignal peptidase I and are essential for E. coli are also pro-cessed by the putative type I signal peptidase of R. rickettsii andR. typhi.

ACKNOWLEDGMENTS

The research presented in the manuscript was supported by fundsfrom the National Institutes of Health (R3717828). We gratefullyacknowledge the gift of E. coli strain IT41 from Ross Dalbey, Depart-ment of Chemistry, The Ohio State University, Columbus.

We are also thankful to Magda S. Beier for her assistance.

REFERENCES

1. Andersson, J. O., and S. G. E. Andersson. 1999. Genome degradation is anongoing process in Rickettsia. Mol. Biol. Evol. 16:1178–1191.

2. Andersson, S. G., A. Zomorodipour, J. O. Andersson, T. Sicheritz-Ponten,U. C. Alsmark, R. M. Podowski, A. K. Naslund, A. S. Eriksson, H. H.Winkler, and C. G. Kurland. 1998. The genome sequence of Rickettsiaprowazekii and the origin of mitochondria. Nature 396:133–140.

3. Azad, A. F., and C. B. Beard. 1998. Rickettsial pathogens and their arthropodvectors. Emerg. Infect. Dis. 4:179–186.

4. Azad, A. F., and R. Traub. 1985. Transmission of murine typhus rickettsiaeby Xenopsylla cheopis, with notes on experimental infection and effects oftemperature. Am. J. Trop. Med. Hyg. 34:555–563.

5. Azad, A. F., S. Radulovic, J. A. Higgins, B. H. Noden, and J. M. Troyer. 1997.Flea-borne rickettsioses: ecologic considerations. Emerg. Infect. Dis. 3:319–328.

6. Bairl, A., and P. Muller. 1998. A second gene for type I signal peptidase inBradyrhizobium japonicum, sipF, is located near genes involved in RNAprocessing and cell division. Mol. Gen. Genet. 260:346–356.

7. Bell, E. J., and E. G. Pickens. 1953. A toxic substance associated with therickettsias of the spotted fever group. J. Immunol. 70:461–472.

8. Black, M. T. 1993. Evidence that the catalytic activity of prokaryotic leaderpeptidase depends upon the operation of a serine-lysine catalytic dyad. J.Bacteriol. 175:4957–4961.

9. Cregg, K. M., E. I. Wilding, and M. T. Black. 1996. Molecular cloning andexpression of the spsB gene encoding an essential type I signal peptidasefrom Staphylococcus aurens. J. Bacteriol. 178:5712–5718.

10. Dalbey, R. E., M. O. Lively, S. Bron, and J. M. van Dijl. 1997. The chemistryand enzymology of the type I signal peptidases. Protein Sci. 6:1129–1138.

11. Dalbey, R. E., and W. Wickner. 1985. Leader peptidase catalyzes the releaseof exported proteins from the outer surface of the Escherichia coli plasmamembrane. J. Biol. Chem. 260:15925–15931.

12. Dibb, N. J., and P. B. Wolfe. 1986. lep operon proximal gene is not requiredfor growth or secretion by Escherichia coli. J. Bacteriol. 166:83–87.

13. Economou, A. 1999. Following the leader: bacterial protein export throughthe Sec pathway. Trends Microbiol. 7:315–320.

14. Fikes, J. D., and P. J. Bassford, Jr. 1987. Export of unprocessed precursormaltose-binding protein to the periplasm of Escherichia coli cells. J. Bacte-riol. 169:2352–2359.

15. Gaywee, J., W. Xu, S. Radulovic, M. J. Bessman, and A. F. Azad. 2002. TheRickettsia prowazekii invasion gene homolog (invA) encodes a nudix hydro-lase active on adenosine 5-pentaphospho-5-adenosine. Mol. Cell. Proteom-ics 1:179–185.

16. Hackstadt, T. 1996. The biology of rickettsiae. Infect. Agents Dis. 5:127–143.17. Inada, T., D. L. Court, K. Ito, and Y. Nakamura. 1989. Conditionally lethal

amber mutations in the leader peptidase gene of Escherichia coli. J. Bacte-riol. 171:585–587.

18. Innis, M. A., M. Tokunaga, M. E. Williams, J. M. Loranger, S. Y. Chang, S.Chang, and H. C. Wu. 1984. Nucleotide sequence of the Escherichia coliprolipoprotein signal peptidase (lsp) gene. Proc. Natl. Acad. Sci. USA 81:3708–3712.

19. Klug, G., A. Jager, C. Heck, and R. Rauhut. 1997. Identification, sequenceanalysis and expression of the lepB gene for a leader peptidase in Rhodo-bacter capsulatus. Mol. Gen. Genet. 253:666–673.

20. Koshland, D., R. T. Sauer, and D. Botstein. 1982. Diverse effects of muta-tions in the signal sequence on the secretion of �-lactamase in Salmonellatyphimurium. Cell 30:903–914.

21. Kuhn, A., and W. Wickner. 1985. Conserved residues of the leader peptideare essential for cleavage by leader peptidase. J. Biol. Chem. 260:15914–15918.

22. Mori, H., and K. Ito. 2001. The Sec protein-translocation pathway. TrendsMicrobiol. 9:494–500.

23. Ogata, H., S. Audic, P. Renesto-Audiffren, P. E. Fournier, V. Barbe, D.Samson, V. Roux, P. Cossart, J. Weissenbach, J. M. Claverie, and D. Raoult.2001. Mechanisms of evolution in Rickettsia conorii and R. prowazekii. Sci-ence 293:2093–2098.

24. Paetzel, M., R. E. Dalbey, and N. C. J. Strynadka. 2000. The structure andmechanism of bacterial type I signal peptidases—a novel antibiotic target.Pharmacol. Ther. 87:27–49.

25. Pugsley, A. P. 1993. The complete general secretory pathway in gram-neg-ative bacteria. Microbiol. Rev. 57:50–108.

26. Radulovic, S., M. S. Rahman, M. S. Beier, and A. F. Azad. 2002. Molecularand functional analysis of the Rickettsia typhi groESL operon. Gene 298:41–48.

27. Sung, M., and R. E. Dalbey. 1992. Identification of potential active-siteresidues in the Escherichia coli leader peptidase. J. Biol. Chem. 267:13154–13159.

28. Tschantz, W. R., M. Sung, V. M. Delgado-Partin, and R. E. Dalbey. 1993. Aserine and a lysine residue implicated in the catalytic mechanism of theEscherichia coli leader peptidase. J. Biol. Chem. 268:27349–27354.

29. van Roosmalen, M. L., J. D. Jongbloed, A. Kuipers, G. Venema, S. Bron, andJ. M. van Dijl. 2000. A truncated soluble Bacillus signal peptidase producedin Escherichia coli is subject to self-cleavage at its active site. J. Bacteriol.182:5765–5770.

30. Wood, D. O., and A. F. Azad. 2000. Genetic manipulation of rickettsiae: apreview. Infect. Immun. 68:6091–6093.

4584 RAHMAN ET AL. J. BACTERIOL.

on March 5, 2020 by guest

http://jb.asm.org/

Dow

nloaded from