Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,
description
Transcript of Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,
![Page 1: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/1.jpg)
An unbiased adaptive sampling algorithm for the exploration of RNA mutational landscapes under evolutionary pressure
Jérôme Waldispühl, PhDSchool of Computer Science, McGill Centre for Bioinformatics,McGill University, Canada
Yann Ponty, PhDLaboratoire d’informatique (LIX),École Polytechnique, France
![Page 2: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/2.jpg)
Philippe Flajolet (1948 – 2011)
![Page 3: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/3.jpg)
RNAmutants: Algorithms to explore the RNA mutational landscape
Overview
Understanding how mutations influence RNA secondary structures AND how structures influence mutations (Waldispühl et al., PLoS Comp Bio, 2008).
![Page 4: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/4.jpg)
Sampling k-mutants
CAGUGAUUGCAGUGCGAUGC (-1.20)..((.(((((...))))))) Classic: 0 mutation
CAGUGAUUGCAGUGCGAUcC (-3.40)..(.((((((...)))))))CAGUGAUUGCAGUGCGgUGC (-0.30)((.((....)).))......CAGUGAUcGCAGUGCGAUGC (-3.10).....(((((...)))))..
RNAmutants: 1 mutation
uAGcGccgGgAGacCGgcGC (-18.00)..(((((((....)))))))CccUGgccGCAagGCcAgGg (-20.40)((((((((....))))))))CcGUGgccGCgagGCcAcGg (-19.10)((((((((....))))))))
RNAmutants: 10 mutations
Seed
Sample k mutations increasing the folding energyConsequence: it increases the C+G content
![Page 5: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/5.jpg)
Objectives
How to efficiently sample sequences at arbitrary C+G contents … without bias!
C+G Content (%)
Sam
ple
frequ
ency
Target C+G content
![Page 6: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/6.jpg)
Outline
• Background: RNAmutants in a nutshell Algorithms to sample RNA secondary structures and mutations.
• Our approach: Adaptive sampling Uniformly shifting the distribution of samples.
• Results: Evolutionary studies Insights on the evolutionary pressure stemming from an optimization of the thermodynamical stability.
![Page 7: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/7.jpg)
Outline
• Background: RNAmutants in a nutshell Algorithms to sample RNA secondary structures and mutations.
• Our approach: Adaptive sampling Uniformly shifting the distribution of samples.
• Results: Evolutionary studies Insights on the evolutionary pressure stemming from an optimization of the thermodynamical stability.
![Page 8: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/8.jpg)
RNA secondary structure
The secondary structure is the ensemble of base-pairs in the structure.
Bracket notation:((((((((…)))..((((….)))).(((…)))..)))))
![Page 9: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/9.jpg)
Loop decomposition
Stacking pairs
![Page 10: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/10.jpg)
UUUACGGCUAGC
Parameterization of the mutational landscape
UCUGAAACCCGU
UUUACGGCCAGC
Sequence ensemble Structure ensemble
CCUCAACGAAGC
UCUACGGCCAGC
UUUAAGGCCAGC
1-neighborhood(1 mutations)
![Page 11: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/11.jpg)
Classical Recursions (Zuker & Stiegler, McCaskill)
Enumerate all secondary structures
![Page 12: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/12.jpg)
RNAmutants Generalize Classical Algorithms
Enumerate all secondary structures over all mutants (Waldispuhl et al., ECCB, 2002)
![Page 13: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/13.jpg)
Our approach
Explore the complete mutation landscape. Polynomial time and space algorithm. Compute the partition function for all sequences:
Sample by backtracking the dynamic prog. tables.
RNAmutants
(Waldispuhl et al., PLoS Comp Bio, 2008)
€
Z = exp(− E(s,S)RT
)S∑
s∑
€
Z(s) = exp(β ⋅E(s,S))S
∑
RNAmutants:
Single sequence:
![Page 14: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/14.jpg)
Sampling k-mutants
CAGUGAUUGCAGUGCGAUGC (-1.20)..((.(((((...))))))) Classic: 0 mutation
CAGUGAUUGCAGUGCGAUcC (-3.40)..(.((((((...)))))))CAGUGAUUGCAGUGCGgUGC (-0.30)((.((....)).))......CAGUGAUcGCAGUGCGAUGC (-3.10).....(((((...)))))..
RNAmutants: 1 mutation
uAGcGccgGgAGacCGgcGC (-18.00)..(((((((....)))))))CccUGgccGCAagGCcAgGg (-20.40)((((((((....))))))))CcGUGgccGCgagGCcAcGg (-19.10)((((((((....))))))))
RNAmutants: 10 mutations
Seed
Sample k mutations increasing the folding energyConsequence: it increases the C+G content
![Page 15: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/15.jpg)
Outline
• Background: RNAmutants in a nutshell Algorithms to sample RNA secondary structures and mutations.
• Our approach: Adaptive sampling Uniformly shifting the distribution of samples.
• Results: Evolutionary studies Insights on the evolutionary pressure stemming from an optimization of the thermodynamical stability.
![Page 16: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/16.jpg)
UUUAAGGCUAGC
Our approach: Weighting mutations
UCUGAAACCCGU
UUUAAGGCCAGC
Sequence ensemble Structure ensemble
CCUCAACGAAGC
UAUAAGGCCAGC
UUUAGGGCCAGC
w-1
1w Z
w-1. ZC9U
1. ZU2A
w. ZA5GWeighted by
partition function value
Promote A+U content
Penalize C+G content
No change
![Page 17: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/17.jpg)
Weighting recursive equations
) × W(i,x) × W(j,y)(
× W(j,y)
€
W (i,x) =w If A,U →C,Gw−1 If C,G→ A,U1 Otherwise
⎧ ⎨ ⎪
⎩ ⎪
![Page 18: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/18.jpg)
C+G Content (%)
Effect of weighted sampling
Unweighted sampling weighted (w=1/2) weighted (w=2)
Freq
uenc
y of
sa
mpl
es
![Page 19: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/19.jpg)
Sampling pipe-line
• Keep all samples at the target C+G and reject others.• Update w at each iteration using a bisection method.• Stop when enough samples have been stored.
![Page 20: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/20.jpg)
Some features
• After rejection, the weighted schema only impact the performance, not the probability. This is unbiased.
• Partition function can be written as a polynom:
After n iterations we can to calculate all ai and inverse the polynom to compute the optimal weight w.
Remark: In practice, less interations are necessary€
Z = ai ⋅w ii= 0
n
∑
![Page 21: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/21.jpg)
Example: 40 nt., 10000 samples, 30 mutations, 70% C+G content
Cumulative distribution
![Page 22: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/22.jpg)
Outline
• Background: RNAmutants in a nutshell Algorithms to sample RNA secondary structures and mutations.
• Our approach: Adaptive sampling Uniformly shifting the distribution of samples.
• Results: Evolutionary studies Insights on the evolutionary pressure stemming from an optimization of the thermodynamical stability.
![Page 23: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/23.jpg)
20 nucleotides 40 nucleotides
Low C+G-contents favor structural diversity
Simulation at fixed G+C content from random seeds
10% 30% 50% 70% 90%
![Page 24: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/24.jpg)
Low C+G contents favor internal loop insertion
10% 30% 50% 70% 90%
Num
ber o
f Int
erna
l Loo
ps
![Page 25: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/25.jpg)
20 nucleotides 40 nucleotides
High G+C-contents reduce evolutionary accessibility
Simulation at fixed G+C content from random seeds
10% 30% 50% 70% 90%
![Page 26: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/26.jpg)
Perspectives
• More studies of Sequence-Structure maps.• Applications to RNA design.• Same techniques can be applied to other parameters (e.g. number of base pairs).• Can be generalized to multiple parameters.
![Page 27: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/27.jpg)
Acknowledgments
Ecole Polytechnique• Jean-Marc SteyaertBoston College• Peter Clote
INRIA• Philippe FlajoletMIT• Bonnie Berger• Srinivas Devadas• Mieszko Lis• Alex Levin• Charles W. O’DonnellGoogle Inc.• Behshad Behzadi
Yann PontyCNRS at LIX, École Polytechnique, France.
University of Paris 6• Olivier BodiniUniversity of Paris 11• Alain Denise
![Page 28: Jérôme Waldispühl, PhD School of Computer Science, McGill Centre for Bioinformatics,](https://reader035.fdocuments.in/reader035/viewer/2022062501/568161bc550346895dd196b7/html5/thumbnails/28.jpg)
Would you like to know more?
O. Bodini, and Y. PontyMulti-dimensional Boltzmann Sampling of Languages,Proceedings of AOFA'10, 49--64, 2010
J. Waldispühl, S. Devadas, B. Berger and P. Clote,Efficient Algorithms for Probing the RNA Mutation Landscape,Plos Computational Biology, 4(8):e1000124, 2008.
http://csb.cs.mcgill.ca/RNAmutants