J. Biol. Chem. · 2004-07-19 · J. Biol. Chem. Transcriptional Regulation of the Human...

1

J. Biol. Chem.

Transcriptional Regulation of the Human ββββ-1,4-Galactosyltransferase V Gene in

Cancer Cells: Essential Role of Transcription Factor Sp1*

Takeshi Sato� and Kiyoshi Furukawa

Department of Biosignal Research, Tokyo Metropolitan Institute of Gerontology,

Itabashi-ku, Tokyo 173-0015, Japan

Running title: Transcriptional Regulation of Human ββββ-1,4-GalT V Gene

�To whom correspondence should be addressed: Department of Biosignal Research,

Tokyo Metropolitan Institute of Gerontology, Sakaecho 35-2, Itabashi-ku, Tokyo 173-0015,

Japan. Tel.: 81-3-3964-3241 ext. 3072; Fax: 81-3-3579-4776; E-mail: [email protected].

JBC Papers in Press. Published on July 19, 2004 as Manuscript M405805200

Copyright 2004 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on March 21, 2020

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

2

SUMMARY

ββββ-1,4-Galactosyltransferase (ββββ-1,4-GalT) V is a constitutively expressed enzyme

that can effectively galactosylate the GlcNAcββββ1→→→→6Man group of the highly branched

N-glycans that are characteristic of tumor cells. Upon malignant transformation of

cells, the expression of the ββββ-1,4-GalT V gene increases in accordance with the

increase in the amounts of highly branched N-glycans. Lectin blot analysis showed

that the galactosylation of highly branched N-glycans is inhibited significantly in SH-

SY5Y human neuroblastoma cells by the transfection of the anti-sense ββββ-1,4-GalT V

cDNA, indicating the biological importance of the ββββ-1,4-GalT V for the functions of

highly branched N-glycans. We cloned the 2.3-kb 5'-flanking region of the human ββββ-

1,4-GalT V gene and identified the region -116/-18 relative to the transcription start

site as that having promoter activity. The region was found to contain several

putative binding sites for transcription factors, including AP2, AP4, N-Myc, Sp1 and

USF. Electrophoretic mobility shift assay showed that Sp1 binds to nucleotide

positions -81/-69 of the promoter region. Mutations induced in the Sp1-binding site

showed that the promoter activity of the ββββ-1,4-GalT V gene is impaired completely in

cancer cells. In contrast, the promoter activity increased significantly by the

transfection of the Sp1 cDNA into A549 human lung carcinoma cells. Mithramycin A,

which inhibits the binding of Sp1 to its binding site, reduced the promoter activation

and expression of the ββββ-1,4-GalT V gene in A549 cells. These results indicate that

Sp1 plays an essential role in the transcriptional activity of the ββββ-1,4-GalT V gene in

cancer cells.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

3

INTRODUCTION

One of the most prominent transformation-associated changes in the sugar chains

of glycoproteins is an increase in the large N-glycans of cell surface glycoproteins

(reviewed in 1). This was discovered by comparing the gel filtration patterns of

glycopeptides obtained by pronase digestion of metabolically labeled normal and

malignant cell glycoproteins (2-4). Detailed structural studies of N-glycans isolated

from BHK cells and polyoma- or Rous sarcoma virus-transformed BHK cells showed

that the increase in the GlcNAcββββ1→→→→6 branch attached to the Manαααα1→→→→6Man arm of

the trimannosyl cores is the structural basis for this phenomenon (5, 6). This was

further confirmed by studies on a number of malignant cell lines transformed with

different agents (7-9).

Three transformed cell lines, MT1, MTPy and MTAg, established from mouse

NIH3T3 cells by transfection with the SV40 or polyoma virus early gene segments

(10), showed marked differences in their tumorigenic and metastatic potentials when

transplanted subcutaneously or intravenously into athymic mice. Structural analysis

of the N-glycans of these cells revealed that only about 20% of the glycoproteins from

3T3 and MT1 cells have highly branched N-glycans with the Galββββ1→→→→4GlcNAcββββ1→→→→6-

(Galββββ1→→→→4GlcNAcββββ1→→→→2)Man branch compared to 31% and 39% of the glycoproteins

from MTPy and MTAg cells, respectively, indicating a proportionality between

increased highly branched N-glycans and tumorigenic and metastatic potentials (11).

The increased expression of the highly branched N-glycans also correlates with the

tumor-forming activities of various other transformed cells (7, 9). The increased cell

surface binding of fluorescein-labeled leuko-phytohemagglutinin (L-PHA)1, which

specifically binds to highly branched N-glycans with the Galββββ1→→→→4GlcNAcββββ1→→→→6(Gal-

ββββ1→→→→4GlcNAcββββ1→→→→2)Man branch (12), was found to correlate with the metastatic

potentials of mouse mammary carcinoma cells, mouse lymphoma cells, transformed

rat fibroblasts, and human breast cancers (13, 14). Thus the results of several

studies established that an increase in highly branched N-glycans is actually related


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

4

to the in vivo tumor-forming and metastatic potentials of transformed cells.

In accordance with the structural studies, the specific activity of UDP-GlcNAc:Man

N-acetylglucosaminyltransferase (GlcNAcT) V, which synthesizes the GlcNAcββββ1→→→→6

branch, has been shown to be elevated two- to three-fold in transformed cells (15, 16).

In contrast, no significant changes in the specific activities of other glycosyl-

transferases involved in the biosynthesis of N-glycans have been observed in

transformed cells (15, 17). Since the Galββββ1→→→→4GlcNAc outer chains form the basis

for the expression of a variety of carbohydrate antigens, whether or not the gene

expression of UDP-Gal:GlcNAc ββββ-1,4-galactosyltransferases (ββββ-1,4-GalT) I-VI, most

of which are involved in the biosynthesis of N-glycans (18, 19), is changed by

malignant transformation was investigated using NIH3T3 and MTAg cells as

described above. Northern blot analysis revealed that the ββββ-1,4-GalT V transcript

increases two- to three-fold and the ββββ-1,4-GalT II transcript decreases to one-tenth

while those of other ββββ-1,4-GalTs remain constant upon malignant transformation (17).

Similar results were obtained in several human cancer cell lines (20), indicating that

the expression pattern of ββββ-1,4-GalT genes also changes upon malignant transforma-

tion of cells despite little apparent change in the enzymatic activity. Since our

preliminary study suggested that the ββββ-1,4-GalT V can effectively galactosylate the

GlcNAcββββ1→→→→6 branch, which is synthesized by GlcNAcT V (21), it is important to

elucidate the biological significance of the ββββ-1,4-GalT V, and the mechanism by which

ββββ-1,4-GalT V gene is regulated in cancer cells. For these purposes, we showed the

biological importance of the galactosylation of highly branched N-glycans by the ββββ-

1,4-GalT V, and then isolated the promoter region of the human ββββ-1,4-GalT V gene

and examined the cis-elements and trans-acting factors that regulate ββββ-1,4-GalT V

gene expression.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

5

EXPERIMENTAL PROCEDURES

Cell Cultures and Reagents SH-SY5Y human neuroblastoma cells were grown

at 37°C in a mixture of Dulbecco's modified Eagle's medium (DMEM) and Ham's F-12

medium (1:1, v/v) containing 10% fetal calf serum (FCS), 50 mg/ml kanamycin and

1.0 mg/ml glucose. A549 human lung carcinoma cells, HepG2 human hepato-

carcinoma cells, G361 human melanoma cells and SW480 human colorectal adeno-

carcinoma cells were grown in RPMI1640 or DMEM containing 10% FCS, 50 units/ml

penicillin and 50 mg/ml streptomycin. Horseradish peroxidase (HRP)-conjugated

Ricinus communis agglutinin-I (RCA-l) and L-PHA were from Seikagaku Kogyo

(Tokyo). Goat anti-human Sp1 (PEP 2) and anti-human Sp3 (D-20) antibodies were

purchased from Santa Cruz Biotechnology (Santa Cruz, CA). The Sp1-expression

vector, CMV-Sp1, was kindly provided by Dr. R. Tjian of the University of California at

Berkeley (Berkeley, CA). Mithramycin A was from Sigma-Aldrich Co. (St. Louis,

MO).

Lectin Blot Analysis of Anti-Sense ββββ-1,4-GalT V cDNA-Transfected Cells SH-

SY5Y cells (1 X 105 cells) were transfected with 2 µg of the pcDNA3.1 (Invitrogen,

Carlsbad, CA) as a control or the pcDNA3.1 containing a partial sequence of human

ββββ-1,4-GalT V cDNA (-5 to +500 relative to the initiation codon) in an anti-sense

orientation, and the FuGENE6 transfection reagent (Roche Applied Science,

Indianapolis, IN). Cells were cultured for 72 hrs, and then the plasmid-transfected

cells were selected by culturing in a medium containing geneticin (500 µg/ml G418

sulfate, Sigma-Aldrich Co.) for 2 weeks. Membrane glycoprotein samples were

prepared from the mock- and anti-sense ββββ-1,4-GalT V cDNA-transfected cells,

subjected to SDS-polyacrylamide gel electrophoresis (SDS-PAGE) using a Mini

Protean II Electrophoresis Cell (Bio-Rad, Hercules, CA), and then transferred to

polyvinylidene difluoride (PVDF) filters using a Mini Trans-Blot Electrophoretic

Transfer Cell (Bio-Rad). Western blot analysis using HRP-conjugated RCA-l and L-

PHA was performed by the method as described previously (22).


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

6

Isolation, Southern Blot Analysis and DNA Sequencing of Human Genomic DNA

Clones A human placenta λ genomic library in λFIX II (Stratagene, La Jolla, CA)

was screened using the 480-bp EcoR I-Apa I fragment of human ββββ-1,4-GalT V cDNA

(21) as a probe. The probe was random-labeled with [αααα-32P]dCTP using a "Ready to

GoTM" DNA labeling kit (Amersham Biosciences, Piscataway, NJ). Positive clones

were obtained by four-successive screenings. Phage DNAs were purified and

digested with several restriction endonucleases, separated on a 1% agarose gel, and

transferred onto a GeneScreen nylon membrane (NEN Life Science Products, Inc.,

Boston, MA). The membranes were hybridized with the biotinylated 100-bp PCR

fragment containing the initiation codon of the ββββ-1,4-GalT V gene as a probe

according to the manufacturer's instructions for the random primer biotin-labeling kit

(NEN Life Science Products, Inc.). The hybridization-positive 1.5-kb Nde I fragment

or the 1.3-kb BamH I fragment was subcloned into the Nde I site of pGEM-T Easy

vector (Promega, Madison, WI) to generate pGEM/Nde, or into the BamH I site of

pBluescript II KS vector (Stratagene) to generate pBlue/Bam. The nucleotide se-

quences of the DNA fragments were determined by the dideoxynucleotide chain ter-

mination method (23) using an Auto Read Sequencing kit (Amersham Biosciences).

To identify the putative binding sites of transcription factors, the 2-kb 5'-flanking region

of the human ββββ-1,4-GalT V gene was analyzed by the MatInspector program (24).

RNA Ligase-Mediated Rapid Amplification of the 5' cDNA End (RLM-RACE)

RLM-RACE analysis was performed to map the transcription start site using a

GeneRacer kit (Invitrogen) according to the manufacturer's instructions. In brief, the

total RNA preparation (3 µg) from SH-SY5Y cells was treated with calf intestinal

phosphatase to dephosphorylate non-mRNAs or truncated mRNAs, and then treated

with tobacco acid pyrophosphatase to remove the 5'-cap structure from the full-length

mRNAs. The GeneRacer RNA Oligo (5'-CGACUGGAGCACGAGGACACUGACAU-

GGACUGAAGGAGUAGAAA-3') was ligated to the 5'-ends of the decapped mRNAs.

Subsequently, the cDNAs were synthesized with random primers and SuperScript III

reverse transcriptase. Two antisense oligonucleotide primers corresponding to the


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

7

coding region of the ββββ-1,4-GalT V cDNA as shown in Fig. 4A were synthesized and

used for the PCR. The primary PCR was conducted using the synthesized cDNAs

as templates, the antisense gene-specific primer TS138 (5'-GGAGT-

CTTTCAGGGCAGGTATGGTT-3'; complementary to nucleotides +355/+331 relative

to the initiation codon) and the GeneRacer 5'-Primer supplied with the kit under the

conditions ((98°C, 10 sec; 65°C, 30 sec and 72°C, 1 min) x 40). The secondary PCR

was conducted using the primary PCR products as templates, the antisense gene-

specific primer TS137 (5'-TGCCGGGCGCCACATAGACGAAGTA-3'; complementary

to nucleotides +112/+88 relative to the initiation codon) and the GeneRacer 5'-Nested

Primer supplied with the kit under the conditions ((98°C, 10 sec; 65°C, 30 sec and

72°C, 1 min) x 25). The primary and secondary PCR products were subjected to

electrophoresis in a 2% agarose gel, stained with ethidium bromide (EtBr), and

visualized under a UV lamp as described previously (20). As a final product, a DNA

fragment comprising approximately 300-bp was obtained in secondary PCR, and

subsequently cloned into pGEM-T Easy vector and sequenced.

Reporter Plasmid Constructions To assay the promoter activity, a variety of the

5'-flanking regions of the ββββ-1,4-GalT V gene that differed in length were inserted into

the firefly luciferase reporter vector, pGL3-Basic (Promega), which contained no

eukaryotic promoter or enhancer element. The strategy for cloning of the fragments

of the ββββ-1,4-GalT V gene promoter into a pGL3-Basic vector was as follows, with the

numbers indicating the nucleotide positions relative to the transcription start site. 1)

pGL(-2099/+170): the 1.0-kb BamH I-Not I fragment was excised from pBlue/Bam

(Fig. 2C) and cloned into the BamH I-Not I sites of pGEM/Nde (Fig. 2B), to generate

pGEM/Nde-Not (Fig. 2D). Similarly, the 2.3-kb Sac I-Not I fragment was excised

from pGEM/Nde-Not and subcloned into the Sac I-Not I sites of the pBluescript II KS

vector, to generate pBlue/Nde-Not. The 2.3-kb Sac I-Xho I fragment was excised

from pBlue/Nde-Not and subcloned into the Sac I-Xho I sites of the pGL3-Basic vector.

In order to minimize the effect of sequences derived from the pBluescript II KS vector

or pGEM-T Easy vector, the resultant plasmids were digested with Not I and Spe I to


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

8

remove the multiple cloning sites in the vectors. The ends were blunted with T4 DNA

polymerase and then self-ligated with T4 DNA ligase. 2) pGL(-1121/+170): pGL(-

2099/+170) was digested with Kpn I and Sse8387 I. The ends were blunted and

then self-ligated. 3) pGL(-2099/-835): the Kpn I-BamH I fragment was excised from

pGL(-2099/+170) and subcloned into the Kpn I-Bgl II sites of the pGL3-Basic vector.

4) pGL(-834/+170): the BamH I-Hind III fragment was excised from pGL(-2099/+170)

and subcloned into the Bgl II-Hind III sites of the pGL3-Basic vector. 5) pGL(-

551/+170): pGL(-2099/+170) was digested with Nde I, and the ends were self-ligated.

6) pGL(-313/+170): pGL(-2099/+170) was digested with Sac I and Pst I. The ends

were blunted and then self-ligated. 7) pGL(-116/+170): pGL(-2099/+170) was

digested with Sac I and BssH II. The ends were blunted and then self-ligated. 8)

pGL(+23/+170): the Nae I-Hind III fragment was excised from pGL(-116/+170) and

then subcloned into the Sma I-Hind III sites of pGL3-Basic vector. 9) pGL(-2099/-

117): pGL(-2099/+170) was digested with BssH II and Hind III. The ends were

blunted and then self-ligated. 10) pGL(-116/+22): pGL(-116/+170) was digested with

Kpn I and Nae I and subcloned into the Kpn I-Sma I sites of the pGL3-Basic vector.

11) pGL(-116/-18) pGL(-116/+170) was digested with Sfi I and Hind III. The ends

were blunted and then self-ligated. 12) pGL(-17/+22): pGL(-116/+22) was digested

with Kpn I and Sfi I. The ends were blunted and then self-ligated. 13) pGL(-

116/+170)-Sp1 mutation 1 and pGL(-116/+170)-Sp1 mutation 2: both plasmids were

constructed using pGL(-116/+170) as a template with a GeneEditor in vitro site-

directed mutagenesis system (Promega) according to the manufacturer's instructions.

The mutations in the Sp1-binding site are indicated by underline at nucleotide

positions -81/-69 (Sp1-mutation 1, GGCCCCAATCCC and Sp1-mutation 2, GGCC-

CCGTTTCCC, instead of the wild type, GGCCCCGCCTCCC). The correct orienta-

tion and sequences of all plasmid constructs were verified by sequence analysis.

The unaltered plasmid, pGL3-Basic, was used as a promoterless control and the

plasmid, pRL-TK (Promega) containing the Renilla luciferase gene driven by the

herpes simplex virus thymidine kinase (TK) promoter, was used as a normalization


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

9

control to correct for variable transfection efficiencies. pGL3-SV40 (Promega)

contained the firefly luciferase gene driven by the SV40 promoter as a positive

control.

Transfection and Luciferase Assay One day prior to transfection, the cell lines

(1 X 105 cells each) were seeded in 35 mm tissue culture dishes. Cells were trans-

fected with 1 µg of the reporter plasmid, 0.1 µg of pRL-TK and the FuGENE6 trans-

fection reagent (Roche Applied Science). Cells were harvested 48 hrs after

transfection, lysed in 200 µl of lysis buffer, and subjected to freeze-thaw lysis. The

firefly or Renilla luciferase activity in 10 µl of cell lysate was determined with a Dual-

Luciferase Reporter Assay System (Promega) by Luminecencer PSN AB-2200

(ATTO, Tokyo). Firefly luciferase activities were normalized to Renilla luciferase ac-

tivities except in the case of CMV-Sp1, which significantly stimulated the TK promoter,

which was co-transfected. In the latter case, the firefly luciferase activities were

normalized to the protein content of each sample as previously described (25, 26).

The results show the mean values of three experiments with standard errors.

Electrophoretic Mobility Shift Assay (EMS assay) Nuclear extract was pre-

pared from SH-SY5Y cells with NE-PER Nuclear and Cytoplasmic Extraction re-

agents (Pierce, Rockford, IL), containing multiple protease inhibitors, such as benza-

midine, aprotinin, leupeptin and phenylmethylsulfonyl fluoride, according to the

manufacturer's instructions. Synthesized oligonucleotides were 3'-end-labeled with

biotin-N4-CTP and terminal deoxynucleotidyltransferase according to the instructions

for the Biotin 3'-End DNA Labeling kit (Pierce), and then the biotinylated

complementary oligonucleotides were annealed to generate the double-stranded

oligonucleotides as probes. The sequences of the upper strands of the

oligonucleotides used are listed in Table I. EMS assays were performed according

TABLE I

to the instructions for the LightShift Chemiluminescent EMS assay kit (Pierce). In


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

10

brief, the binding reaction was performed by preincubating 4 µg of nuclear extract with

50 ng of poly(dI-dC) in buffer solution containing 10 mM Tris-HCl (pH 7.5), 50 mM KCl,

5 mM MgCl2, and 1 mM dithiothreitol for 10 min at room temperature. Approximately

30-50 fmol of probe was added, and the reaction mixtures were incubated for 20 min

at room temperature. Subsequently, the samples were separated from the free

probes by electrophoresis in a 6% non-denaturing polyacrylamide gel using 45 mM

Tris-borate buffer (pH 8.5) containing 1.25 mM EDTA as a running buffer. The

samples in the gel were electrophoretically transferred to a Hybond N+ membrane

(Amersham Biosciences). To detect DNA-protein complexes, the membranes were

incubated with streptavidin-conjugated horseradish peroxidase and then visualized

with LightShift Luminol/Enhancer solution and LightShift Stable Peroxide solution

according to the manufacturer's instructions. For competition experiments, unlabel-

ed Sp1-consensus oligonucleotides were added in a 100-fold molar excess prior to

the addition of the biotinylated probes. To identify the transcription factor comprising

the DNA-protein complexes by the supershift assay, the nuclear extract was

incubated in the binding buffer for 60 min at 4°C with anti-human Sp1 antibody or

anti-human Sp3 antibody prior to the addition of the biotinylated probes.

Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Analysis Total

RNA preparations were obtained from mithramycin A-treated and -untreated A549

cells using Sepasol RNA I total RNA isolation reagent (Nacalai Tesque, Kyoto). RT-

PCR analysis was conducted using the cDNAs as templates and oligonucleotide

primers specific to the ββββ-1,4-GalT V gene. The PCR products were analyzed by

agarose gel electrophoresis as described previously (20).


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

11

RESULTS

Decreased Galactosylation of Highly Branched N-Glycans by Transfection of Anti-

Sense ββββ-1,4-GalT V cDNA into SH-SY5Y Cells To elucidate the biological

significance of the ββββ-1,4-GalT V in cancer cells, the anti-sense ββββ-1,4-GalT V cDNA

was transfected into SH-SY5Y cells. RT-PCR analysis using oligonucleotide primers

specific to the ββββ-1,4-GalT V gene showed that the expression level of the ββββ-1,4-GalT

V transcript decreases 20-30% by the transfection of the anti-sense ββββ-1,4-GalT V

cDNA into SH-SY5Y cells when compared with that of the control cells (data not

shown). Under the condition, the constant expression levels of the glyceraldehyde

3-phosphate dehydrogenase (G3PDH) gene were obtained in both cells (data not

shown). Membrane glycoprotein samples were prepared from the mock- and anti-

sense ββββ-1,4-GalT V cDNA-transfected cells. They were subjected to SDS-PAGE,

and proteins were transferred electrophoretically to PVDF filters. When the filters

were stained with Coomassie Brilliant Blue (CBB), both samples contained similar

protein components (Fig. 1-CBB). In order to examine whether or not the

FIG. 1

galactosylation changes in SH-SY5Y cells by the transfection of the anti-sense ββββ-1,4-

GalT V cDNA, lectin blot analysis was performed using HRP-conjugated RCA-I and

L-PHA. The filters were initially subjected to mild acid treatment to remove sialic

acids prior to incubation with lectins. When the filters were incubated with RCA-I,

which interacts with oligosaccharides terminating with the Galββββ1→→→→4GlcNAc group

(27), a remarkable decrease in the lectin binding was observed for 80 K-100 K, 120

K-140 K, 150 K and 200 K protein bands in the cells transfected with the anti-sense

ββββ-1,4-GalT V cDNA (lane b of Fig. 1-RCA-I) when compared to the control cells (lane

a of Fig.1-RCA-I). Similarly, a significant decrease of the binding with L-PHA, which

interacts with highly branched N-glycans with the Galββββ1→→→→4GlcNAcββββ1→→→→-6(Galββββ1→→→→4-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

12

GlcNAcββββ1→→→→2)Man branch (12), was detected in the same protein bands as described

above by the anti-sense ββββ-1,4-GalT V cDNA transfection (lane b of Fig. 1-L-PHA)

when compared to the control cells (lane a of Fig. 1-L-PHA). The lectin-reactive

bands disappeared upon treatment of the filters with N-glycanase (data not shown).

These results indicate that the ββββ-1,4-GalT V is involved in the expression of highly

branched N-glycans, and that the suppression of the ββββ-1,4-GalT V gene by the

transfection of the anti-sense cDNA decreases the galactosylation of the highly

branched N-glycans, which leads to the reduced binding to L-PHA. Similar results

were obtained in other cancer cell lines including SW480 cells (18) and A549 cells

(unpublished data). Therefore, the ββββ-1,4-GalT V is considered to be very important

in cancer cells for expressing the highly branched N-glycans which are involved in

abnormal cell growth and metastasis (11, 13).

Isolation of the 5'-Promoter Region of Human β-1,4-GalT V Gene We identified

in the GenBankTM a human genomic clone (RP5-1063B2) derived from 20q13.1-13.2

containing the human ββββ-1,4-GalT V cDNA sequence reported by us (DDBJ/Gen-

Bank/EMBL Data Bank, accession no. AB004550). The genomic sequence

completely matched the coding region, +114/+1,167, relative to the initiation codon of

the ββββ-1,4-GalT V gene reported but lacked the 5'-flanking region and the coding

region upstream from +113. To isolate the 5'-flanking region of the ββββ-1,4-GalT V

gene, a human placenta λ genomic library was screened by the plaque hybridization

method using the 480-bp fragment containing the initiation codon of the ββββ-1,4-GalT V

cDNA as a probe, and ten genomic clones were obtained. In order to identify the

genomic clones that contained the 5'-promoter region, Southern blot analysis was

performed using a 100-bp fragment containing the coding region +1/+100 relative to

the initiation codon as a probe. The hybridization-positive 1.5-kb Nde I fragment or

1.3-kb BamH I fragment was obtained and subcloned into the Nde I site of a pGEM-T

Easy vector to generate pGEM/Nde (Fig. 2B), or into the BamH I site of a pBluescript

II KS vector to generate pBlue/Bam (Fig. 2C). Nucleotide sequence analysis

showed that the BamH I fragment contained a 1.0-kb 5'-flanking region, the first exon


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

13

and intron, and the Nde I fragment contained a 1.2-kb 5'-flanking region upstream

from the BamH I site and a 0.3-kb BamH I/Nde I overlapping region (Fig. 2A).

FIG. 2

Genomic Structure of the β-1,4-GalT V Gene We also found in the GenBankTM

another human genomic clone, RP5-1041C10 from chromosome 20, containing the

coding region +57/+115 relative to the initiation codon of the ββββ-1,4-GalT V gene. The

alignment of the human ββββ-1,4-GalT V cDNA, the genomic clone reported in the

present study and two genomic clones in the GenBankTM allowed us to deduce the

exon-intron organization of the gene, which is shown in Fig. 3A. Although the human

ββββ-1,4-GalT I, II, III and IV genes consist of six exons and five introns (28-30), the

human ββββ-1,4-GalT V gene consists of nine exons and eight introns. All the exon-

intron boundaries were found to adhere to the consensus sequence (Fig. 3B). This

FIG. 3

exon-intron structure is highly conserved in mouse2. A similar genomic organization

has been observed for the human ββββ-1,4-GalT VI gene (31), which was also suggested

by a similarity between human ββββ-1,4-GalTs V and VI at the amino acid levels (32) and

by a closer position of human ββββ-1,4-GalT VI to that of human ββββ-1,4-GalT V rather to

other ββββ-1,4-GalTs in the phylogenetic tree (33).

Mapping of the Transcription Start Site To determine the position of the tran-

scription start site, RLM-RACE analysis was performed using two sets of oligonucleo-

tide primers, 5'-Primer and TS138, and 5'-Nested Primer and TS137, respectively (Fig.

4A). As shown in Fig. 4B, the primary PCR using 5'-Primer and TS138 produced a

smeared product (Fig. 4B-lane 1), while the secondary PCR using 5'-Nested Primer

and TS137 produced a 300-bp product (Fig. 4B-lane 2). The product was extracted

from the agarose gel and cloned into pGEM-T Easy vector for sequencing. The


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

14

results showed that RNA Oligo was linked to an adenine residue at nucleotide

position 188-bp upstream from the initiation codon (Fig. 4C), indicating that the

FIG. 4

transcription of the ββββ-1,4-GalT V gene starts at this position. Prolonging the

extension time in the primary and secondary PCRs did not amplify any larger PCR

products (data not shown). Therefore, the transcription start site of the ββββ-1,4-GalT V

gene in SH-SY5Y cells is located 188-bp upstream from the initiation codon. The

immediate upstream region from the transcription start site lacks canonical TATA and

CAAT boxes. However, five GC-rich sequences, including the Sp1-binding sites, are

found in the regions -82/-69, -62/-49, -56/-43, -50/-37, and -16/-3 (Fig. 5).

FIG. 5

Functional Analysis of the β-1,4-GalT V Gene Promoter To analyze the activity

of the promoter in the ββββ-1,4-GalT V gene, a construct containing the full length

promoter, pGL(-2099/+170), was constructed by inserting the 2.3-kb Nde I-Not I

genomic fragment (Fig. 2D) containing the promoter set upstream of the firefly lucifer-

ase cDNA into the pGL3-Basic vector (Fig. 6). Upon transient transfection into

FIG. 6

several cancer cell lines, pGL(-2099/+170) exhibited significant luciferase activity as

compared to that of the pGL3-Basic vector (data not shown). The luciferase assay

showed that the ββββ-1,4-GalT V gene promoter is activated mostly in SH-SY5Y cells

among the cell lines examined (Fig. 7). Therefore, SH-SY5Y cells were used to

FIG. 7


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

15

identify the promoter region of the ββββ-1,4-GalT V gene. To characterize the cis-

elements of the ββββ-1,4-GalT V gene promoter, eight additional reporter plasmids

containing the promoter in variable lengths, as shown in Fig. 6, were constructed and

transfected into SH-SY5Y cells, and the promoter activities were determined. The

results showed that pGL(-116/+170), containing the sequence downstream to

nucleotide position -116, retains relatively strong promoter activity, while the promoter

activity is significantly reduced for pGL(+23/+170), which lacks the region upstream

from nucleotide position +22, indicating the presence of important positive regulatory

elements between nucleotide positions -116 and +23. When pGL(-2099/-117) was

transfected into SH-SY5Y cells, the luciferase activity was almost at the background

level (Fig. 8), indicating that no regulatory element is included between nucleotide

FIG. 8

positions -2099 and -117. For further characterization, the region between

nucleotide positions -116 and +23 was divided into two regions by digestion with Sfi I,

and pGL(-116/-18) and pGL(-17/+22) were constructed. The luciferase assay

showed that significant promoter activity in the region between nucleotide positions -

116 and -18, which contains one putative binding site each for AP2, USF, N-Myc, and

AP4 and four putative binding sites for Sp1 as predicted by the MatInspector program,

but no activity was detected in the region between nucleotide positions -17 and +22,

which contains one putative Sp1-binding site (Figs. 9, A and B). Similar results were

FIG. 9

obtained in other cancer cell lines (data not shown). These results indicate that the

region between nucleotide positions -116 and -18 is responsible for promoter

activation in cancer cells.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

16

Identification of Transcription Factors Bound to the β-1,4-GalT V Gene Promoter

To determine the transcription factors that bind to the promoter of the ββββ-1,4-GalT V

gene, the EMS assay was conducted using three oligonucleotide probes (Fig. 9A)

covering the putative binding sites for all transcription factors found in the promoter.

Probe A (-102/-77) failed to form any complex with the nuclear extract of SH-SY5Y

cells (data not shown). In contrast, probe B (-83/-58) formed DNA-protein

complexes with nuclear extract (Fig. 10-lanes 2, 3 and 6), while no complex was

FIG. 10

formed with probe B in the absence of nuclear extract (Fig. 10-lane 1). Probe B

contains one GC box as shown in Fig. 9A. The formation of a major DNA-protein

complex was markedly reduced by incubation with the Sp1-mutation probe, which

contains mutations in the Sp1-binding site (Fig. 10-lane 4), or excess amounts of

unlabeled Sp1-consensus oligonucleotides, which contain the Sp1-binding site (Fig.

10-lane 5). Moreover, a major DNA-protein complex was detected as a supershifted

band by incubation with anti-Sp1 antibody but not anti-Sp3 antibody (Fig. 10-lane 7

and data not shown). A similar supershifted band with anti-Sp1 antibody was

observed when probe B was incubated with nuclear extracts prepared from A549 and

HepG2 cells, which express significant levels of Sp1 and Sp3 (34, 35), but no

supershifted band was detected with anti-Sp3 antibody (data not shown). Mutations

in the N-Myc- or USF-binding site did not inhibit the formation of a DNA-protein

complex with probe B (data not shown), suggesting that these two factors are not

involved in the formation of the DNA-protein complex. These results indicate that

probe B binds to Sp1. However, some of the minor bands were not shifted with anti-

Sp1 antibody, suggesting that some other transcription factors may have occupied or

hindered the Sp1-binding site of probe B. Probe C (-62/-36) formed at least three

DNA-protein complexes with nuclear extract of SH-SY5Y cells (Fig. 10-lane 8).

Since probe C contains three Sp1-binding sites, a supershift assay was performed in


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

17

the presence of anti-Sp1 antibody. However, no shift was observed (data not

shown), suggesting that Sp1 does not bind to probe C. This is also supported by the

fact that excess amounts of unlabeled Sp1-consensus oligonucleotides cannot

compete with probe C. Moreover, probes containing mutations in the Sp1-binding

sites of probe C formed DNA-protein complexes with the nuclear extracts (data not

shown), suggesting that Sp1 is not involved in the formation of DNA-protein

complexes with probe C. The transcription factors involved in the formation of DNA-

protein complexes with probe C remain to be determined.

Mutational Analysis of Sp1-Binding Site The presence of GC-rich sequences

within the 5'-flanking region is a feature of TATA-less genes, and the expression of

such genes is regulated by Sp1 (reviewed in 36 and 37). Therefore, whether or not

the most distal Sp1-binding site at nucleotide positions -81/-69 is involved in the

transcriptional activation of the promoter of the ββββ-1,4-GalT V gene was investigated.

Two different mutations were introduced into the most distal Sp1-binding site of

pGL(-116/+170) (Fig. 11A), and the luciferase activity was determined. The results

FIG. 11

showed that Sp1 fails to bind to the mutated probes as determined by EMS assay

(data not shown). When construct pGL(-116/+170), containing Sp1-mutation 1, or

pGL(-116/+170), containing Sp1 mutation 2 (see Fig. 11A), was transfected into SH-

SY5Y or A549 cells, the luciferase activities decreased more than 95% as compared

to cells transfected with the wild type plasmid (Fig. 11B), suggesting that the Sp1-

binding site at nucleotide positions -81/-69 is essential for the activity of the ββββ-1,4-

GalT V gene promoter, and that other sites for transcription factors may contribute at

most 5% to promoter activation of the ββββ-1,4-GalT V gene. Similar results were

obtained in several other cancer cell lines (data not shown). Therefore, the factors

bound to probe C are not essential for the promoter activity of the ββββ-1,4-GalT V gene

in cancer cells. These results indicate that the Sp1-binding site at nucleotide


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

18

positions -81/-69 of the ββββ-1,4-GalT V gene play an essential role in promoter activity in

cancer cells.

Activation of the Human β-1,4-GalT V Gene by Sp1 To investigate the role of

Sp1 in the promoter activation of the ββββ-1,4-GalT V gene, pGL(-116/+170) was tran-

siently co-transfected into A549 cells with CMV-Sp1. After transfection, the cells

were cultured for 48 hrs, and luciferase activity was assayed using cell extracts. The

results showed that the ectopic co-expression of Sp1 stimulates the promoter

activation of the ββββ-1,4-GalT V gene by 5.5 to 7.5-fold (Fig. 12A). Mithramycin A

FIG. 12

binds to the GC box in DNA, thereby inhibiting the binding of Sp1 to its binding site (38,

39). The treatment of A549 cells with mithramycin A resulted in reduced promoter

activity of the ββββ-1,4-GalT V gene (Fig.12B). In order to compare the expression

levels of the ββββ-1,4-GalT V gene in mithramycin A-treated and -untreated A549 cells,

RT-PCR analysis was performed using oligonucleotide primers specific to the ββββ-1,4-

GalT V gene. The results showed that the expression levels of the ββββ-1,4-GalT V

gene decrease dramatically upon treatment of A549 cells with mithramycin A as

compared to untreated cells (Fig. 12C-ββββ-1,4-GalT V), while the expression levels of

the G3PDH gene in the cells remain constant (Fig. 12C-G3PDH). These results

strongly suggest that the expression of the ββββ-1,4-GalT V gene is regulated by Sp1,

and that Sp1 plays an essential role in the promoter activation of the ββββ-1,4-GalT V

gene in cancer cells.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

19

DISCUSSION

The ββββ-1,4-GalT V gene is expressed at high levels in most human tissues (21), and

its expression increases upon malignant transformation of cells (17, 20). Since the

reduction in the expression level of the ββββ-1,4-GalT V gene in SH-SY5Y cells resulted

in the decreased galactosylation of highly branched N-glycans, the ββββ-1,4-GalT V is

considered to be involved in the expression of highly branched N-glycans, which are

involved in abnormal growth and metastasis of cancer cells (11, 13). Recently, the

transfection of the anti-sense ββββ-1,4-GalT V cDNA into some cancer cell lines has

showed the suppression of tumor development in experimental animals (manuscript

in preparation), indicating the particular importance of the ββββ-1,4-GalT V for tumor

biology. However, the mechanism by which ββββ-1,4-GalT V gene expression is

regulated remains unknown. In the present study, we cloned and characterized the

promoter region of the ββββ-1,4-GalT V gene and found that the GC-rich promoter lacks

canonical TATA and CCAAT boxes. The lack of TATA and CCAAT boxes appears

to be common to mammalian glycosyltransferase genes including human ββββ-1,2-

GlcNAcT I (40), human ββββ-1,4-GlcNAcT III (41), human αααα-2,6-sialyltransferase I (42),

mouse ββββ-1,6-GlcNAcT (43), mouse αααα-2,8-sialyltransferase II (polysialic acid synthase)

(44) and mouse glucuronyltransferase (45). In the promoter region of the ββββ-1,4-GalT

V gene, however, four Sp1-, one N-Myc-, one USF-, one AP2- and one AP4-binding

sites were identified. We have demonstrated that the promoter region of the ββββ-1,4-

GalT V gene binds to Sp1, and that mutations in the Sp1-binding site at nucleotide

positions -81/-69 significantly impairs its promoter activity. Moreover, the treatment

of A549 cells with mithramycin A, which inhibits the binding of Sp1 to its binding site

(38, 39), reduced the promoter activity. In contrast, the promoter activity increased

dramatically by transfection of the Sp1 cDNA into A549 human lung carcinoma cells.

These results indicate that Sp1 plays an essential role in regulating the promoter

activation of the ββββ-1,4-GalT V gene in cancer cells.

The Sp1 was originally identified as a transcription factor that binds to the GC box


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

20

and activates the transcription of viral and cellular genes. To date, five proteins have

been identified in the Sp family, designated Sp1, Sp2, Sp3, Sp4 and Sp5 (46 and

reviewed in 36 and 37). Sp2 does not bind to the classical Sp1 GC box but to a GT-

rich element in the promoter region of the T-cell antigen receptor Vαααα gene (47), while

Sp3, Sp4 and Sp5 bind to the same consensus DNA site with affinities similar to that

of Sp1 (46, 48-50). Sp1 and Sp3 are ubiquitously expressed, whereas Sp4 is

expressed predominantly in brain (48, 51). Sp5, whose cDNA was isolated by

screening the genes, is expressed differentially during mouse gastrulation and

exhibits a remarkably dynamic expression pattern throughout early development (46).

Although Sp1 and Sp3 can bind to the GC box (49, 52), Sp3 was originally found to

suppress Sp1-mediated activation by binding to the same site, thereby preventing

Sp1-binding and activation (49). However, whether Sp3 acts as an activator or a

suppressor of Sp1-mediated activation depends on the cellular conditions (53). The

targeted disruption of the Sp1 gene in mouse results in growth retardation and the

early death of embryos (54), indicating that Sp1 is essential for embryogenesis.

Furthermore, Sp1 can activate the transcription of a number of viral and cellular genes,

including structural proteins, metabolic enzymes, cell cycle regulators, transcription

factors, growth factors and surface receptors (reviewed in 36 and 37). Some of the

genes activated by Sp1 are closely associated with tumor angiogenesis, invasion and

metastasis such as laminin-γγγγ1 chain (55), matrix metalloproteinase-2 (56), thymidine

phosphorylase (also known as platelet-derived endothelial cell growth factor, PD-

ECGF) (57), protease-activated receptor-1 (58) and vascular endothelial growth factor

(59, 60). These reports suggest that the expression of Sp1 is essential for the

malignant phenotypes seen in cancer cells.

Abnormal Sp1-expression and activation have been observed in human hepato-

cellular carcinoma (55), gastric carcinoma (61, 62), pancreatic adenocarcinoma (60)

and mouse epidermal tumors (63). Elevated Sp1-expression has also been shown

to be correlated with malignancy and reduced survival of patients with gastric cancer

(62). Transfection with an Sp1-decoy oligodeoxynucleotide, in which the consensus


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

21

sequence for Sp1-binding is maintained, suppresses the growth and invasion of A549

cells and U251 human glioma cells, showing that an abnormal expression of Sp1 is

associated with malignant phenotypes of cancer cells (64). In human hepatocellular

carcinoma and gastric carcinoma, the expression of the ββββ-1,4-GalT V gene is

increased when compared with normal counterparts3, suggesting that the expression

of the ββββ-1,4-GalT V gene is activated by abnormal Sp1-expression in these

carcinomas. The activation of genes by Sp1 is also enhanced if multiple Sp1-binding

sites are present (65, 66). In the case of the promoter region of the ββββ-1,4-GalT V

gene, probe C, corresponding to the promoter region -62/-36, contains three Sp1-

binding sites while the EMS assay showed that Sp1 cannot bind to this probe in

experiments using nuclear extract of SH-SY5Y cells. However, probe C has the

ability to bind Sp1 because excess amounts of unlabeled probe C can fully compete

with biotinylated Sp1-consensus oligonucleotides as probes3. The reason that Sp1

cannot bind to promoter region -62/-36 when nuclear extract of SH-SY5Y cells is used

may be due to the binding of other transcription factors prior to Sp1. Under some

pathological conditions or with the aid of some other transcription factors that are

associated with Sp1, Sp1 may bind to promoter region -62/-36, and activate the

promoter of the ββββ-1,4-GalT V gene in cancer cells.

The increased amount of highly branched oligosaccharides is brought about by an

elevation in the activity of the GlcNAcT V (11, 13, 14 and reviewed in 67). The

expression of the GlcNAcT V gene has been shown to be regulated by the Ets family

of transcription factors, including Ets-1 and Ets-2 in cancer cells (68-70). Our

previous study showed that the expression level of the ββββ-1,4-GalT V gene, but not

other ββββ-1,4-GalT genes, is highly correlated with that of the GlcNAcT V gene in

several human cancer cell lines (20). Moreover, the 5'-flanking region of the human

ββββ-1,4-GalT V gene contains five Ets-1-binding sites. Therefore, it is considered that

the ββββ-1,4-GalT V gene is also regulated by Ets-1 in cancer cells. Our preliminary

study showed that the promoter activity and expression of the ββββ-1,4-GalT V gene

increase two- to four-fold, in the cells transfected with the ets-1 cDNA4. One of the


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

22

Ets-1-binding sites at nucleotide positions -76/-67 was found to overlap the Sp1-

binding site at nucleotide positions -81/-69, and Ets-1 does not bind to this site as

revealed by the EMS assay using anti-Ets-1 antibody or the Ets-1-consensus

oligonucleotides as a competitor4. However, four Ets-1-binding sites are present in

upstream and downstream positions of the promoter region of the ββββ-1,4-GalT V gene,

and they may interact with Ets-1 to regulate the gene expression. Since Sp1 and

Ets-1 have been shown to be co-precipitated by anti-Sp1 antibody and cooperatively

to regulate the gene expression of Fas ligand (71), the expression of the ββββ-1,4-GalT V

gene may be regulated by a similar mechanism. In the present study, however, we

clearly demonstrated that the ββββ-1,4-GalT V gene is regulated by Sp1 in cancer cells.

It is of interest to investigate how these two transcription factors are involved in the

expression of the ββββ-1,4-GalT V gene in cancer cells.

The transcriptional regulation of mammalian ββββ-1,4-GalT I has been well studied; the

ββββ-1,4-GalT I gene specifies two transcripts of 4.1-kb and 3.9-kb in somatic cells (72,

73). The 5'-flanking region of the mouse ββββ-1,4-GalT I gene is unusual in that three

transcription start sites are present. In mouse somatic tissues, the start site for the

4.1-kb transcript is used predominantly, and the expression from this start site is

controlled by a promoter containing multiple Sp1-binding sites (74, 75). The only

exception to this pattern is found in the mammary gland during lactation, where there

is a switch to the preferential use of the start site for the 3.9-kb transcript, and

expression from this start site is controlled by promoter regulated by lactating

mammary gland-restricted transcription factors (74, 75). Third, the most distal

transcription start site is used exclusively during the late stages of spermatogenesis

(76, 77). However, which transcription start site in the promoter region of the ββββ-1,4-

GalT I gene is used in cancer cells is unknown. Since no significant change in the

expression of the ββββ-1,4-GalT I gene is observed upon malignant transformation of

cells (17), the expression of the ββββ-1,4-GalT I gene could remain unchanged upon

malignant transformation. In the case of the ββββ-1,4-GalT II gene, the expression level

decreases dramatically upon malignant transformation (17), it would be of interest to


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

23

investigate the mechanism for the transcriptional regulation of the ββββ-1,4-GalT II gene

in cancer cells, and how the ββββ-1,4-GalTs II and V are involved in the changes in N-

glycan biosynthesis characteristic of cancer cells.

In summary, this is the first report showing the transcriptional regulation of the ββββ-

1,4-GalT V gene by Sp1 in cancer cells. By regulating the expression of Sp1 in

cancer cells, the expression of the ββββ-1,4-GalT V gene can be reduced, and

consequently the galactosylation pattern of the highly branched N-glycans

characteristic of cancer cells can be modified, which may lead to the suppression of

tumor growth and metastasis.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

24

ACKNOWLEDGMENTS

We thank Dr. Robert Tjian of the University of California at Berkeley (Berkeley, CA)

for providing us with the Sp1-expression vector, CMV-Sp1.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

25

REFERENCES

1. Kobata, A. (1984) Biology of Carbohydrates, vol. 2 (Ginsburg, V., and Robbins, P.

W., eds.), pp. 87-161, John Wiley & Sons, Inc., New York

2. Meezan, E., Wu, H. C., Black, P. H., and Robbins, P. W. (1969) Biochemistry 8,

2518-2524

3. Buck, C. A., Glick, M. C., and Warren, L. (1971) Science 172, 169-171

4. Furukawa, K., Minor, J. E., Hargaty, J., and Bhavanandan, V. P. (1986) J. Biol.

Chem. 261, 7755-7761

5. Yamashita, K., Ohkura, T., Tachibana, Y., Takasaki, S., and Kobata, A. (1984) J.

Biol. Chem. 259, 10834-10840

6. Pierce, M., and Arango, J. (1986) J. Biol. Chem. 261, 10772-10777

7. Santer, U. V., Gilbert, F., and Glick, M. C. (1984) Cancer Res. 44, 3730-3735

8. Hiraizumi, S., Takasaki, S., Shiroki, K., Kochibe, N., and Kobata, A. (1990) Arch.

Biochem. Biophys. 280, 9-19

9. Hiraizumi, S., Takasaki, S., Ohuchi, N., Harada, Y., Nose, M., Mori, S., and

Kobata, A. (1992) Jpn. J. Cancer Res. 83, 1063-1072

10. Segawa, K., and Yamaguchi, N. (1986) Virology 155, 334-344

11. Asada, M., Furukawa, K., Segawa, K., Endo, T., and Kobata, A. (1997) Cancer

Res. 57, 1073-1080

12. Cummings, R. D., and Kornfeld, S. (1982) J. Biol. Chem. 257, 11230-11234

13. Dennis, J. W., Laferte, S., Waghorne, C., Breitman, M. L., and Kerbel. R. S.

(1987) Science 236, 582-585

14. Dennis, J. W., and Laferte, S. (1989) Cancer Res. 49, 945-950

15. Yamashita, K., Tachibana, Y., Ohkura, T., and Kobata, A. (1985) J. Biol. Chem.

260, 3963-3969.

16. Arango, J., and Pierce, M. (1988) J. Cell. Biochem. 37, 225-231

17. Shirane, K., Sato, T., Segawa, K., and Furukawa, K. (1999) Biochem. Biophys.

Res. Commun. 265, 434-438


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

26

18. Guo, S., Sato, T., Shirane, K., and Furukawa, K. (2001) Glycobiology 11, 813-820

19. Sato, T., Guo, S., and Furukawa, K. (2001) Biochimie 83, 719-725

20. Sato, T., Shirane, K., Kido, M., and Furukawa, K. (2000) Biochem. Biophys. Res.

Commun. 276, 1019-1023

21. Sato, T., Furukawa, K., Bakker, H., Van den Eijnden, D. H., and Van Die, I. (1998)

Proc. Natl. Acad. Sci. USA 95, 472-477

22. Sato, T., Furukawa, K., Greenwalt, D. E., and Kobata, A. (1993) J. Biochem. 114,

890-900

23. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. USA 74,

5463-5467

24. Quandt, K., Frech, K., Karas, H., Wingender, E., and Werner, T. (1995) Nucleic

Acids Res. 23, 4878-4884

25. Halle J. P., Haus-Seuffert, P., Woltering, C., Stelzer, G., and Meisterernst, M.

(1997) Mol. Cell. Biol. 17, 4220-4229

26. Nicolas, M., Noe, V., Jensen, K. B., and Ciudad, C. J. (2001) J. Biol. Chem. 276,

22126-22132

27. Baenziger, J. U., and Fiete, D. (1979) J. Biol. Chem. 254, 9795-9799

28. Mengle-Gaw, L., McCoy-Haman, M. F., and Tiemeier, D. C. (1991) Biochem. Bio-

phys. Res. Commun. 176, 1269-1276

29. Almeida, R., Amado, M., David, L., Levery, S. B., Holmes, E., Merkx, G., Van

Kessel, A. G., Rygaard, E., Hassan, H., Bennett, E., and Clausen, H. (1997) J.

Biol. Chem. 272, 31979-31991

30. Schwientek, T., Almeida, R., Levery, S. B., Holmes, E. H., Bennett, E., and

Clausen, H. (1998) J. Biol. Chem. 273, 29331-29340

31. Fan, Y., Yu, L., Tu, Q., Gong, R., Jiang, Y., Zhang, Q., Dai, F., Chen, C., and Zhao,

S. (2002) DNA Seq. 13, 1-8

32. Furukawa, K., and Sato, T. (1999) Biochim. Biophys. Acta 1473, 54-66

33. Lo, N. W., Shaper, J. H., Pevsner, J., and Shaper, N. L. (1998) Glycobiology 8,

517-526


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

27

34. Hoppe, K. L., and Francone, O. L. (1998) J. Lipid Res. 39, 969-977

35. Rundlof, A. K., Carlsten, M., and Arner, E. S. (2001) J. Biol. Chem. 276, 30542-

30551

36. Philipsen, S., and Suske, G. (1999) Nucleic Acids Res. 27, 2991-3000

37. Suske, G. (1999) Gene 238, 291-300

38. Ray, R., Snyder, R. C., Thomas, S., Koller, C. A., and Miller, D. M. (1989) J. Clin.

Invest. 83, 2003-2007

39. Blume, S. W., Snyder, R. C., Ray, R., Thomas, S., Koller, C. A., and Miller, D. M.

(1991) J. Clin. Invest. 88, 1613-1621

40. Yip, B., Chen, S. H., Mulder, H., Hoppener, J. W., and Schachter, H. (1997)

Biochem. J. 321, 465-474

41. Kim, Y. J., Park, J. H., Kim, K. S., Chang, J. E., Ko, J. H., Kim, M. H., Chung, D. H.,

Chung, T. W., Choe, I. S., Lee, Y. C., and Kim, C. H. (1996) Gene 170, 281-283

42. Taniguchi, A., Hasegawa, Y., Higai, K., and Matsumoto, K. (2000) Glycobiology

10, 623-628

43. Chen, G. Y., Kurosawa, N., and Muramatsu, T. (2001) Gene 275, 253-259

44. Yoshida, Y., Kurosawa, N., Kanematsu, T., Kojima, N., and Tsuji, S. (1996) J. Biol.

Chem. 271, 30167-30173

45. Yamamoto, S., Oka, S., Saito-Ohara, F., Inazawa, J., and Kawasaki, T. (2002) J.

Biochem. (Tokyo) 131, 337-347

46. Harrison, S. M., Houzelstein, D., Dunwoodie, S. L., and Beddington, R. S. (2000)

Dev. Biol. 227, 358-372

47. Kingsley, C., and Winoto, A. (1992) Mol. Cell. Biol. 12, 4251-4261

48. Hagen, G., Muller, S., Beato, M., and Suske, G. (1992) Nucleic Acids Res. 20,

5519-5525

49. Hagen, G., Muller, S., Beato, M., and Suske, G. (1994) EMBO J. 13, 3843-3851

50. Majello, B., De Luca, P., Hagen, G., Suske, G., and Lania, L. (1994) Nucleic Acids

Res. 22, 4914-4921

51. Saffer, J. D., Jackson, S. P., and Annarella, M. B. (1991) Mol. Cell. Biol. 11,


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

28

2189-2199

52. Kadonaga, J. T., Carner, K. R., Masiarz, F. R., and Tjian, R. (1987) Cell 51,

1079-1090

53. Kennett, S. B., Udvadia, A. J., and Horowitz, J. M. (1997) Nucleic Acids Res. 25,

3110-3117

54. Marin, M., Karis, A., Visser, P., Grosveld, F., and Philipsen, S. (1997) Cell 89,

619-628

55. Lietard, J., Musso, O., Theret, N., L'Helgoualc'h, A., Campion, J. P., Yamada, Y.,

and Clement, B. (1997) Am. J. Pathol. 151, 1663-1672

56. Qin, H., Sun, Y., and Benveniste, E. N. (1999) J. Biol. Chem. 274, 29130-29137

57. Zhu, G. H., Lenzi, M., and Schwartz, E. L. (2002) Oncogene 21, 8477-8485

58. Tellez, C., McCarty, M., Ruiz, M., and Bar-Eli, M. (2003) J. Biol. Chem. 278,

46632-46642

59. Ryuto, M., Ono, M., Izumi, H., Yoshida, S., Weich, H. A., Kohno, K., and Kuwano,

M. (1996) J. Biol. Chem. 271, 28220-28228

60. Shi, Q., Le, X., Abbruzzese, J. L., Peng, Z., Qian, C. N., Tang, H., Xiong, Q.,

Wang, B., Li, X. C., and Xie, K. (2001) Cancer Res. 61, 4143-4154

61. Kitadai, Y., Yasui, W., Yokozaki, H., Kuniyasu, H., Haruma, K., Kajiyama, G., and

Tahara, E. (1992) Biochem. Biophys. Res. Commun. 189, 1342-1348

62. Wang, L., Wei, D., Huang, S., Peng, Z., Le, X., Wu, T. T., Yao, J., Ajani, J., and

Xie, K. (2003) Clin. Cancer Res. 9, 6371-6380

63. Kumar, A.P., and Butler, A. P. (1999) Cancer Lett. 137, 159-165

64. Ishibashi, H., Nakagawa, K., Onimaru, M., Castellanous, E. J., Kaneda, Y.,

Nakashima, Y., Shirasuna, K., and Sueishi, K. (2000) Cancer Res. 60, 6531-6536

65. Courey, A. J., Holtzman, D. A., Jackson, S. P., and Tjian, R. (1989) Cell 59, 827-

836

66. Courey, A. J., and Tjian, R. (1988) Cell 55, 887-898

67. Sato, T., Shirane, K., and Furukawa, K. (1999) Recent Res. Devel. Cancer 1,

105-114


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

29

68. Kang, R., Saito, H., Ihara, Y., Miyoshi, E., Koyama, N., Sheng, Y., and Taniguchi,

N. (1996) J. Biol. Chem. 271, 26706-26712

69. Buckhaults, P., Chen, L., Fregien, N., and Pierce, M. (1997) J. Biol. Chem. 272,

19575-19581

70. Ko, H., Miyoshi, E., Noda, K., Ekuni, A., Kang, R., Ikeda, Y., and Taniguchi, N.

(1999) J. Biol. Chem. 274, 22941-22948

71. Kavurma, M. M., Bobryshev, Y., and Khachigian, L. M. (2002) J. Biol. Chem. 277,

36244-36252

72. Shaper, N. L., Hollis, G. F., Douglas, J. G., Kirsch, I. R., and Shaper, J. H. (1988) J.

Biol. Chem. 263, 10420-10428

73. Russo, R. N., Shaper, N. L., and Shaper, J. H. (1990) J. Biol. Chem. 265, 3324-

3331

74. Harduin-Lepers, A., Shaper, J. H., and Shaper, N. L. (1993) J. Biol. Chem. 268,

14348-14359

75. Rajput, B., Shaper, N. L., and Shaper, J. H. (1996) J. Biol. Chem. 271, 5131-5142

76. Charron, M, Shaper, N. L., Rajput, B., and Shaper, J. H. (1999) Mol. Cell. Biol. 19,

5823-5832

77. Shaper, N. L., Harduin-Lepers, A., and Shaper, J. H. (1994) J. Biol. Chem. 269,

25165-25171


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

30

FOOTNOTES

* This work was supported by Grants-in-Aid for the Encouragement of Young Scien-

tists (12771428 and 14771303) to TS and for Scientific Research (09240104 and

12680708) to KF from the Ministry of Education, Science, Culture and Sports of

Japan.

The nucleotide sequence(s) reported in this paper has been submitted to the DDBJ/-

GenBankTM/EMBL Data Bank with accession number(s) AB067772.

1 The abbreviations used are: CBB, Coomassie Brilliant Blue; DMEM, Dulbecco�s

modified Eagle medium; EMS, electrophoretic mobility shift; FCS, fetal calf serum;

G3PDH, glyceraldehyde 3-phosphate dehydrogenase; HRP, horseradish peroxidase;

ββββ-1,4-GalT, ββββ-1,4-galactosyltransferase; GlcNAcT, N-acetylglucosaminyltransferase;

L-PHA, leuko-phytohemagglutinin; PD-ECGF, platelet-derived endothelial cell growth

factor; PVDF, polyvinylidene difluoride; RCA-l, Ricinus communis agglutinin-I; RLM-

RACE, RNA ligase-mediated rapid amplification of the 5' cDNA end; RT-PCR, reverse

transcription-polymerase chain reaction; SDS-PAGE, SDS-polyacrylamide gel elec-

trophoresis; TK, herpes simplex virus thymidine kinase.

2 S. Hayakawa, T. Sato, and K. Furukawa, unpublished data.

3 T. Sato and K. Furukawa, unpublished data.

4 T. Sato and K. Furukawa, manuscript in preparation.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

31

FIGURE LEGENDS

FIG. 1. Lectin blot analysis of membrane glycoproteins from SH-SY5Y cells

transfected with the mock- (a) and the anti-sense human ββββ-1,4-GalT V cDNA (b).

The filters were incubated with CBB, HRP-conjugated RCA-I or L-PHA. The three

independent experiments were conducted, and identical results were obtained.

FIG. 2. Partial restriction maps of the 5'-flanking region, the first exon and

intron of the human ββββ-1,4-GalT V gene. A, the 2.6-kb Nde I-BamH I fragment

containing the untranslated region (hatched bar), the coding region (solid bar), and

part of the first intron (dotted bar). B, the pGEM/Nde fragment. C, the pBlue/Bam

fragment. D, the pGEM/Nde-Not fragment.

FIG. 3. Genomic organization, and the exon-intron structure and splicing sites

of the human ββββ-1,4-GalT V gene. A, the exon-intron structure of the human β-1,4-

GalT V gene. Boxes represent exons, and black and white regions indicate the

coding and non-coding exons, respectively. B, the exon sequences are shown in

uppercase letters with the nucleotide positions from the initiation codon as subscripts,

and the predicted amino acid sequences in single-letter code above the nucleotide

sequences. Flanking intron sequences are shown in lowercase letters. The

sequences of all exon-intron boundaries were aligned to the best fit of the GT-AG rule.

FIG. 4. RLM-RACE analysis of the transcription start site of the human ββββ-1,4-

GalT V gene. A, schematic representation of the primers used in RLM-RACE

analysis. UTR indicates the untranslated region. B, EtBr-staining of the PCR

products on an agarose gel. The 5'-Primer and TS138 were used in the primary

PCR (lane 1), and the 5'-Nested Primer and TS137 were used in the secondary PCR

(lane 2). M, the 100-bp DNA ladder used as a molecular size marker. C, nucleotide

sequence of the PCR product. The 5'-Nested Primer and the complementary


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

32

sequence for TS137 used for the secondary PCR are underlined. The sequence of

the GeneRacer RNA Oligo linked to the β-1,4-GalT V cDNA is overlined. The arrow

indicates the transcription start site, and the initiation codon is indicated by the box.

FIG. 5. Nucleotide sequence of the 5'-flanking region, the first exon and the

partial intron of the human ββββ-1,4-GalT V gene. Numbers at the left refer to the

transcription start site, which is indicated with an arrow and taken as +1, as

determined by RLM-RACE analysis in the present study. Arrowheads indicate the

Nde I and BamH I sites. The deduced amino acid sequence of the coding region is

shown underneath using the single-letter code in bold. The boxes indicate GC

boxes as predicted by the MatInspector program.

FIG. 6. Schematic representation of the 5'-deletion constructs of the human ββββ-

1,4-GalT V gene. Various 5'-flanking regions of the β-1,4-GalT V gene varying in

length were fused to the luciferase reporter gene. The restriction enzymes used to

generate promoter deletions are indicated at the top, and the arrow indicates the

transcription start site.

FIG. 7. Relative promoter activities in a variety of cancer cells. pGL(-

2099/+170) was transiently transfected into cancer cells. Luciferase activity was

normalized to the Renilla luciferase activity of a co-transfected internal control

plasmid, pRL-TK, and is expressed as a percentage of the SV40 promoter activity in

the cancer cells. Three experiments were conducted, and representative results are

shown.

FIG. 8. Promoter activity of the serial deletion constructs of the human ββββ-1,4-

GalT V gene. SH-SY5Y cells were transiently transfected with the indicated

promoter construct as shown in FIG. 6, and the luciferase activity was determined 48

hrs after transfection. Transfection efficiency was adjusted by co-transfection with


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

33

pRL-TK, and parallel transfections with pGL3-SV40 and pGL3-Basic, used as positive

and negative control, respectively. The promoter activity of pGL3-SV40 was taken

as 100%. Three experiments were conducted, and the data are shown as the mean

values with standard errors.

FIG. 9. Identification of the essential elements within the promoter region of

the ββββ-1,4-GalT V gene. A, the nucleotide sequence of the human β-1,4-GalT V

gene promoter. B, SH-SY5Y cells were transiently transfected with the indicated

promoter construct, and the luciferase activity was determined 48 hrs after

transfection. The promoter activity of pGL(-116/+170) was taken as 100%. Three

experiments were conducted, and the data are shown as the mean values with

standard errors.

FIG. 10. Formation of DNA-protein complexes as determined by EMS assay.

Nuclear extract of SH-SY5Y cells was incubated with probe B, C or the Sp1-mutation

probe in the presence or absence of unlabeled Sp1-consensus oligonucleotides or an

antibody specific to Sp1 (lanes 1-8). The arrowhead indicates a supershifted DNA-

protein complex with anti-Sp1 antibody (lane 7). The asterisks indicate the non-

specific binding of probe B since these two bands were still observed at similar

positions when competition experiments were conducted using excess amounts of

unlabeled probe B (lanes 4 and 5). Three experiments were conducted, and repre-

sentative results are shown.

FIG. 11. Effect of the Sp1 element at nucleotide positions -81/-69 on the tran-

scriptional activity of the ββββ-1,4-GalT V gene promoter. A, mutations in the Sp1-

binding site of Sp1 mutation 1 and Sp1 mutation 2. B, SH-SY5Y or A549 cells were

transiently transfected with pGL(-116/+170) (wild type), pGL(-116/+170)-Sp1 mu-

tation 1 or pGL(-116/+170)-Sp1 mutation 2. The luciferase activity was determined

48 hrs after transfection. Transfection efficiency was adjusted by co-transfection


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

34

with pRL-TK. The promoter activity of pGL(-116/+170) was taken as 100%. Three

experiments were conducted, and the data are shown as mean values with standard

errors.

FIG. 12. Effect of the Sp1-expression on the activity of the ββββ-1,4-GalT V gene

promoter. A, A549 cells were transiently transfected with pGL(-116/+170) and

either pcDNA3.1 or CMV-Sp1. Luciferase activity was normalized to the protein

content of each sample and expressed as -fold activation relative to cells co-

transfected with pcDNA3.1. Three experiments were conducted and the results are

shown as mean values with standard errors. B, A549 cells were transiently trans-

fected with pGL(-116/+170). Mithramycin A (0.1 or 1 µM) was added to the cells 1hr

after transfection with the reporter plasmid. The cells were harvested 24 hrs after

the addition of mithramycin A and subjected to luciferase assay. The luciferase ac-

tivity was normalized to the protein content of each sample, and the promoter activity

of pGL(-116/+170) was taken as 100%. Bars represent the mean values with stan-

dard errors of the results of three experiments. C, comparison of the expression

levels of the β-1,4-GalT V gene between the mithramycin A-treated and -untreated

A549 cells. RT-PCR was carried out with total RNA (1 µg) from cells and oligo-

nucleotide primers specific to the β-1,4-GalT V and G3PDH genes. The PCR

products were visualized in a 2% agarose gel stained with EtBr. The analysis was

performed three times, and identical results were obtained each time.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

35

TABLE I

Oligonucleotides used in the EMS assay

Namea

sequence (5' to 3')b

probe A GCGACGGTGCCCGGCGGCACTGGCCC

probe B CTGGCCCCGCCTCCCGCGCGTGCGCC

probe C CGCCCCGCCTCCGCCCCCGCCGCTGC

Sp1-mutation CTGGCCCCGAATCCCGCGCGTGCGCC

Sp1-consensus CCTTGGTGGGGGCGGGGCCTAAGCTG

a Probes A, B and C are shown in FIG. 9A.

b The mutations in the Sp1-binding site in probe B are underlined.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Takeshi Sato and Kiyoshi Furukawacancer cells: Essential role of transcription factor Sp1

Transcriptional regulation of the human beta-1,4-galactosyltransferase V gene in

published online July 19, 2004J. Biol. Chem.

10.1074/jbc.M405805200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M405805200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M405805200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2004/07/19/jbc.M405805200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2004/07/19/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2004/07/19/jbc.M405805200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

J. Biol. Chem. · 2004-07-19 · J. Biol. Chem. Transcriptional Regulation of the Human...

Documents

Transcript of J. Biol. Chem. · 2004-07-19 · J. Biol. Chem. Transcriptional Regulation of the Human...