Isolation of Carbapenemase Producing Enterobacteriaceae in the Greater Toronto Area’s Sewage

Treatment Plants and Surface Waters, and their Comparison to Clinical CPE from Toronto

by

Hyunjin Christina Kim

A thesis submitted in conformity with the requirements for the degree of Master of Science

Department of Laboratory Medicine and Pathobiology University of Toronto

© Copyright by Hyunjin Christina Kim 2016

ii

Isolation of Carbapenemase Producing Enterobacteriaceae in the

Greater Toronto Area’s Sewage Treatment Plants and Surface

Waters, and their Comparison to Clinical CPE from Toronto

Hyunjin Christina Kim

Master of Science

Department of Laboratory Medicine and Pathobiology University of Toronto

2016

Abstract

The presence and significance of Carbapenemase-producing Enterobacteriaceae (CPE) in

Toronto’s water system remains elusive. We sampled sewage from 5 sewage treatment plants

and 7 surface water (SW) locations. Overall, 57/103 sewage specimens yielded 172 unique CPE

and 2/7 SW locations yielded 8 CPE. Klebsiella oxytoca was the most common organism(31.9%)

and blaKPC was the most common gene(88.4%) identified. blaKPC, blaOXA-48-like, and blaVIM genes

were more frequently detected by raw sewage PCR method than filter sweep PCR, or culture

method. In contrast, blaNDM genes were detected in approximately equal numbers of specimens

by each method. Two Enterobacter cloacae blaVIM water isolates were clonally related to human

isolates. K. oxytoca blaKPC clinical and sewage isolates were not clonally related; however, 3

sewage and 3 clinical isolates shared the same plasmid size and incompatibility group(IncFIIA).

CPE are present in Toronto’s sewage and SW, and some isolates are found in both water and

humans.

iii

Acknowledgments Firstly, I would like to thank my supervisor Dr. Allison McGeer for this amazing opportunity to

work in her lab and learn under her guidance. She has taught me and challenged to me to think

like a scientist and I am extremely grateful for her advice, encouragement, and patience

throughout my project.

I would also like to express my gratitude towards Dr. Roberto Melano and Dr. Nathalie Tijet

who have taught me many laboratory techniques at PHL and given me advice on my project as

well as career. They always welcomed me in their lab and I am very thankful to have worked

with them.

Dr. Thomas Edge and his laboratory collected all of the environmental specimens and processed

the water for this project. They also provided me with the E. coli count data and DNA

extractions. Dr. Edge has provided me with great insight in understanding Toronto’s water

system and I would like to thank him for his expertise and input to my project.

Dr. Samir Patel and Dr. Brenda Coleman were part of my supervisory committee and I would

like to thank them both for their advice on the progress of my project, feedback on my

presentation, and for their careful analysis of my thesis.

Dr. AliReza Eshaghi taught me RT-PCR and DNA extraction using NucliSENS easyMAG and I

would like to thank him for teaching me these protocols in detail.

I would also like to thank Barbara Willey for her guidance and careful analysis of my results and

thesis. She has taught me to critically analyze CPE detection methods and has also taught me

many laboratory techniques that will be essential for my scientific growth in the future.

A special thanks goes to Wallis Rudnick for her help in the statistical analysis of my project and

for her company in the office, Pierre Rahman for teaching me the laboratory techniques at Mount

Sinai, and Philipp Kohler for his work with me on the blaVIM carbapenemases. I would also like

to acknowledge TIBDN and PHL for sharing the clinical isolates used in my project.

Lastly, I would like to thank God, my parents, and Ryan for all of their support and love.

iv

Table of Contents Acknowledgments........................................................................................................................... ii

Table of Contents ........................................................................................................................... iv

List of Figures ............................................................................................................................... vii

List of Tables ............................................................................................................................... viii

List of Abbreviations ..................................................................................................................... ix

Chapter 1 Introduction .....................................................................................................................1

1.1 Antimicrobial resistance in Enterobacteriaceae ..................................................................1

1.2 Enterobacteriaceae ..............................................................................................................1

1.3 β -lactam antibiotics (Carbapenems) ...................................................................................2

1.4 Antibiotic Resistance: Carbapenem Resistant Organisms ...................................................3

1.5 Epidemiology and Classification of CPE ............................................................................5

1.5.1 Class A Carbapenemases .........................................................................................6

1.5.2 Class B (metallo-β-lactamase) .................................................................................7

1.5.3 Class D (oxacillinases) ...........................................................................................10

1.6 Water Epidemiology of CPE .............................................................................................10

1.7 Sewage Treatment Plant and Surface Water ......................................................................11

1.8 Relevance of the project.....................................................................................................12

1.9 Objectives and specific aims ..............................................................................................13

Chapter 2 Isolation of Carbapenemase Producing Enterobacteriaceae from Sewage and Surface Waters ..........................................................................................................................14

2.1 Methods..............................................................................................................................14

2.1.1 Sampling Sites (See Figure 2.1.1 for a Map of STPs in the GTA) ........................14

2.1.2 Sewage Collection from Sewage Treatment Plants ...............................................15

2.1.3 Water Collection from Surface Water Sites...........................................................16

2.1.4 Processing of Sewage and Surface Water Specimens ...........................................16

v

2.1.5 Antimicrobial Susceptibility Tests .........................................................................17

2.1.6 Matrix Associated Laser Desorption Ionization- Time of Flight (MALDI-TOF) Mass spectrometry .......................................................................................17

2.1.7 Carbapenem Inactivation Method ..........................................................................18

2.1.8 Storage of CPE isolates and Filter Sweeps ............................................................18

2.1.9 DNA extraction ......................................................................................................18

2.1.10 E. coli concentration in Water Specimens (CFU/100mL) .....................................20

2.1.11 Detection of Carbapenemase genes using Conventional Multiplex polymerase chain reaction assay (PCR) ....................................................................................20

2.1.12 Detection of Carbapenemase genes using multiplex Real-Time polymerase chain reaction assay (RT-PCR) ..............................................................................21

2.1.13 Removal of Duplicate Isolates ...............................................................................21

2.1.14 Meteorological Events ...........................................................................................22

2.1.15 Statistical Analysis .................................................................................................22

2.2 Results ................................................................................................................................23

2.2.1 Presence of CPE in the Sewage Treatment Plants (STPs) .....................................23

2.2.1.1 Comparison by STP Sites ......................................................................................23

2.2.2 E. coli counts ..........................................................................................................25

2.2.3 Meteorological Events ...........................................................................................25

2.2.4 Surface Water.........................................................................................................26

2.2.5 Comparison of Carbapenemase Detection Methods ..............................................26

Chapter 3 Relationship between Water CPE and Clinical CPE ....................................................29

3.1 Methods..............................................................................................................................29

3.1.1 Isolates Under Investigation ..................................................................................29

3.1.2 Pulse Field Gel Electrophoresis (PFGE) ................................................................30

3.1.3 Plasmid Analysis ....................................................................................................31

3.2 Results ................................................................................................................................34

vi

3.2.1 blaVIM E. cloacae ...................................................................................................34

3.2.2 blaKPC K. oxytoca ...................................................................................................34

3.2.3 Plasmid Replicon Type Determination of blaKPC K. oxytoca Isolates ...................35

Chapter 4 Discussion .....................................................................................................................37

4.1 CPE isolation from STPs ...................................................................................................37

4.1.1 Comparison of CPE from Influent vs Effluent Trunks ..........................................40

4.1.2 Other Factors contributing to CPE Presence in Water ...........................................42

4.2 Methods of Isolation ..........................................................................................................43

4.3 Comparison of Water and Clinical CPE ............................................................................46

4.4 Limitations .........................................................................................................................50

Chapter 5 Conclusion .....................................................................................................................51

References ......................................................................................................................................52

vii

List of Figures

Figures............................................................................................................................................72

Figure 1.1 β-lactam Ring ..........................................................................................................72

Figure 1.2 Structural Differences between Penicillin and Carbapenem ...................................72

Figure 2.1.1 Map of Sewage Treatment Plants (STPs) in the Greater Toronto Area (GTA) ...73

Figure 2.1.2 Surface Water Sites...............................................................................................74

Figure 2.1.3 Filter growth of Organisms ...................................................................................75

Figure 2.2.1.4 Proportion of CPE positives by STP .................................................................76

Figure 2.2.1.5 Proportion of species by STP ............................................................................77

Figure 2.2.1.6 Proportion of Carbapenemase Genes by STP ....................................................78

Figure 2.2.1.7 Proportion of CPE by Influent and Effluent Trunk ...........................................79

Figure 2.2.1.8 Distribution of Species from Influent and Effluent Trunks at Ashbridges and Humber STP ................................................................................................................80

Figure 2.2.1.9 Distribution of Genes from Influent and Effluent Trunks at Ashbridges and Humber STP.......................................................................................................................81

Figure 2.2.1.10 Summary of CPE isolated from STP ...............................................................82

Figure 2.2.2.1 Comparison of ln (E. coli counts) from Influent and Effluent Trunks based on CPE Negative and Positive Specimens .........................................................................83

Figure 2.2.5.1 Visual Representation of the 3 Carbapenemase Detection Methods .................84

Figure 2.2.5.2 Comparison of 3 Carbapenemase Detection Methods.......................................85

Figure 3.2.1 PFGE of blaVIM isolates ........................................................................................86

Figure 3.2.2.1 PFGE of K. oxytoca CPE from 2015 and 2012 Water, compared to Clinical Isolates ...............................................................................................................................87

Figure 3.2.2.1 PFGE of K. oxytoca CPE from 2015 and 2012 Water, compared to Clinical Isolates ...............................................................................................................................87

Figure 3.2.2.2 PFGE of blaGES harboring organisms from sewage specimens .........................88

Figure 3.2.2.3 PFGE of K. oxytoca CPE from 2012 .................................................................89

viii

List of Tables Tables .............................................................................................................................................90

Table 1.6.1 Antibiotic Resistant Bacteria found in Sewage......................................................90

Table 1.6.2 CPE in Surface Water ............................................................................................90

Table 1.6.3 ARG in Hospital Sewage .......................................................................................91

Table 2.1.11 CPE Multiplex Primers ........................................................................................92

Table 2.1.12 Primer and Probe specification for ABI7500 RT-PCR ........................................93

Table 2.1.13 Replicon Typing Panel .........................................................................................94

Table 2.2.1 Number of specimens and unique CPE isolates obtained from STP Influent and Effluent ........................................................................................................................95

Table 2.2.2 Dates Specimens Received ....................................................................................95

Table 2.2.1.1 CPE in Sewage Treatment Plants........................................................................96

Table 2.2.3 Temperature and Precipitation Records .................................................................97

Table 2.2.4.1 Surface Water Specimens ...................................................................................98

Table 2.2.4.2 CPE found in Surface Water ...............................................................................98

Table 2.2.5.1a Comparison of results of Culture and RT-PCR from sweeps of cultured filters ..................................................................................................................................99

Table 2.2.5.1b Comparison of results of RT-PCR from sweeps of cultured filters and PCR from raw sewage DNA extract ........................................................................................100

Table 2.2.5.1c Comparison of results of Culture and RT-PCR from raw sewage DNA extract ...............................................................................................................................101

Table 3.1.2 blaVIM E. cloacae Clinical and Water Isolates .....................................................102

Table 3.1.3 blaKPC K. oxytoca Clinical and Water Isolates .....................................................103

Table 3.2.4.2 Replicon Typing Results ...................................................................................104

ix

List of Abbreviations

bla β -lactamase gene

CIM Carbapenem Inactivation Method

CPE Carbapenemase-producing Enterobacteriaceae

CPHLN Canadian Public Health Laboratory Network

CPO Carbapenemase Producing Organisms

CRE Carbapenems resistant Enterobacteriaceae

ETP Ertapenem (10μg disk)

GES Guiana extended spectrum (Class A carbapenemase)

IMP active on imipenem (Class B carbapenemase)

Inc Incompatibility group

KPC Klebsiella pneumoniae carbapenemase (Class A carbapenemase)

MALDI-TOF MS Matrix Associated Laser Desorption Ionization- Time of Flight Mass

Spectrometry

MBL metallo-β-lactamase (Class B)

MEM Meropenem (10μg disk)

mRT-PCR Multiplex Real Time Polymerase Chain Reaction

NDM New Delhi metallo-β-lactamase (Class B carbapenemase)

OXA Oxacillinase (Class D carbapenemase)

PCR Polymerase Chain Reaction

x

PFGE Pulse Field Gel Electrophoresis

PHL Public Health Laboratories

ST Sequence Type

STP Sewage Treatment Plant

SW Surface Water

TIBDN Toronto Invasive Bacterial Diseases Network

Tn Transposon

TNT North Toronto Sewage Treatment Plant

Vf final volume

VIM Verona integron-encoded metallo-β-lactamase (Class B carbapenemase)

1

Chapter 1 Introduction

1.1 Antimicrobial resistance in Enterobacteriaceae Antibiotics have been invaluable in the management of bacterial infections. Drug resistant

organisms are bacteria that have acquired or developed resistance mechanisms to render one or

more antibiotics inactive. Analyses of 30,000 year old Beringian permafrost sediments has

shown that antibiotic resistance is not a modern phenomenon [1]. D’Costa et al. found resistance

elements, including genes encoding β-lactamases and resistance to vancomycin in these

permafrost cores indicating that these genes are ancient and occur naturally [1]. Although

antibiotic resistance genes existed before the beginning of widespread antibiotic use in the 1940s,

resistance mechanisms in Enterobacteriaceae were rarely present. Increased use of antibiotics

has exerted sufficient selective pressure on microbial organisms in humans and animals to either

acquire mobile antibiotic resistance determinants and/or to develop mutational resistance on the

chromosome. This has resulted in an evolutionary arms race between humans (to produce

antibiotics) and bacteria (to become antibiotic resistant). Bacteria are often able to

acquire/develop resistance soon after a new antimicrobial becomes available. The effective

antibiotic arsenal is shrinking and drug development has stalled, in part due to a lack of long-

term economic returns. Furthermore, global trade and international travel have contributed to the

rapid movement of antibiotic resistance genes between geographically separated human

populations. The impact of escalating resistance in the clinical setting is tremendous, increasing

costs and length of hospital stays, and contributing to morbidity and mortality rates. Antibiotic-

resistant bacteria were reportedly responsible for approximately 2 million illnesses and 23,000

deaths in the United States alone in 2013 [2]. Therefore, establishing prevalence, elucidating

mechanisms of gene transfer, and determining the epidemiology of resistance genes are critical

in order to understand the big picture as each has important consequences to global public health.

1.2 Enterobacteriaceae The family Enterobacteriaceae includes a diverse array of Gram-negative bacilli that are

ubiquitous in the environment and in the gastrointestinal tracts of humans and animals. They are

2

phylogenetically classified under the order Enterobacteriales, class Gammaproteobacteria, and

phylum Proteobacteria. According to the Bergey’s Manual of Determinative Bacteriology [3],

the key distinguishing features of this family are rod-shaped bacilli typically 1-5μm in length, a

Gram-negative stain indicating a lipopolysaccharide cell wall, a negative oxidase reaction

indicating production of peroxidase, and a positive catalase reaction indicating respiration using

oxygen. They ferment sugars (some producing gas in the process), and are facultative anaerobes,

non-spore formers. Certain members are motile, a feature enabled by peritrichous flagellae.

Enterobacteriaceae are members of the gut microbiome of humans and animals, where they

thrive without causing infection in their hosts. However, when the host’s immune system or gut

integrity is undermined and there is a breakdown of the natural physical barrier, members of this

family may escape from the gut into sterile body sites where they may become opportunistic

pathogens with the potential to cause severe infections. Common infections caused by

commensal enterobacteria include urinary tract infections (UTI), bacteremia, intra-abdominal

infections, and pneumonia. Enterobacteriaceae naturally exit the body from the gut in feces, and

are therefore ubiquitous in water and soil biomes.

There are many known genera within Enterobacteriaceae. Clinically significant opportunistic

pathogens include various species of Citrobacter, Enterobacter, Klebsiella, Escherichia,

Morganella, Proteus, and Serratia. The Salmonella, Shigella, and Yersinia spp. are not part of

the normal human gut flora and can cause diarrheal diseases when ingested with contaminated

foods or water. Other Enterobacteriaceae species not as commonly seen in the clinical setting

but present in the environment include Raoultella, Pantoea, Leclercia, Hafnia, and Kluyvera.

1.3 β -lactam antibiotics (Carbapenems) β-lactams are a class of antibiotics that interrupt peptidoglycan production in the bacterial cell

wall. In 1928, Penicillin G, the first β-lactam antibiotic, was discovered. As with all β-lactams, it

contained a four membered cyclic amide structure with a core β-lactam ring (Figure 1.1). Early

β-lactams were structurally modified to develop penicillinase-resistant penicillins,

cephalosporins, monobactams, and carbapenems. Carbapenems are the most potent β-lactam

agents against Gram-negative bacilli due to their substitution of the sulfur group from the

3

penicillin-core with a carbon atom at carbon1, and a double bond between carbon2 and carbon3

instead of a single bond (Figure 1.2) [4]. These structural modifications increase the affinity of

carbapenems for penicillin-binding proteins rendering them less vulnerable to the wide spectrum

of β-lactamases that hydrolyze other less potent β-lactam agents.

Clinical carbapenems were derived from the natural antibiotic, thienamycin, after it was

discovered to be produced by the soil organism Streptomyces cattleya in 1976 [5]. Imipenem, the

first clinically used carbapenem, became available in 1985 [5]. Meropenem, imipenem,

doripenem, and ertapenem are the carbapenems used in clinical settings. All members of

carbapenems display a bactericidal effect on susceptible Gram-positive and Gram-negative

bacteria by binding to and inactivating penicillin binding proteins (PBPs) [4]. PBPs are

peptidoglycan transpeptidases or enzymes that catalyze cross-linking of peptidoglycans during

cell-wall synthesis. Once transpeptidation has occurred, the PBP dissociates from the nascent cell

wall and continues to form new cross-links. The β-lactam rings of carbapenems covalently bind

to the active site of PBPs to prevent further interaction between the PBPs and the peptidoglycan

precursor. This covalent link renders the PBP inactive and consequently peptidoglycan synthesis

ceases, and the bacteria dies as the cell wall is destabilized.

1.4 Antibiotic Resistance: Carbapenem Resistant Organisms

Bacteria employ multiple mechanisms to resist β-lactams such as carbapenems. These resistance

mechanisms include mutations in chromosomal genes that may result in reduced or induced

expression of porin channels, efflux pumps, and chromosomal β-lactamases, or through

acquisition of mobile genetic elements from other bacteria that encode specific β-lactamases.

Often, multiple β-lactam resistance mechanisms may be present in a single organism and, in

some cases, they may work synergistically [6]. Examples of these mechanisms are elaborated

below.

i. Reduced permeability: Porins are channels in the outer membrane through which

antibiotics enter bacteria. Mutations in porin alleles by bacteria can cause porin reduction

or porin loss to inhibit β-lactam invasion into the cell. Outer membrane proteins (OMP)

are the major porins in Enterobacteriaceae [6]. Examples of these include OmpK35 and

4

OmpK36-modified K. pneumoniae, and OmpC and OmpF in E. coli and Enterobacter

spp. Organisms with these OMP variants typically possess higher MIC values than those

with conserved porins [7, 8].

ii. Increased efflux: Efflux pumps actively transport antimicrobials across the cytoplasmic

membrane and out of the cell. Thus, increased production of efflux pumps decreases the

level of antibiotics inside the cell. One study showed that overexpression of the MexAB-

OprM efflux pump played an important role in carbapenem resistance in P. aeruginosa

[9, 10]. These have yet to be identified in Enterobacteriaceae.

iii. Intrinsic β-lactamases: β-lactam antibiotics may be inactivated by β-lactamases through

enzyme-catalyzed hydrolysis of the β-lactam ring. Chromosomal β-lactamase genes such

as ampC are found in many but not all of the Enterobacteriaceae, and their inducer-

repressor regulatory genes (ampD-ampR) are induced upon β-lactam exposure to produce

ampC to aid in the hydrolysis and inactivation of the antibiotic. In certain cases, after

repeated exposures, isolates may become “de-repressed mutants” via mutational

inactivation of the ampD gene resulting in on-going high-level production of these

chromosomal β-lactamases.

iv. Acquired β-lactamases: Chromosomal β-lactamase genes from certain species of

Enterobacteriaceae including the ampC described above may be “captured” onto

plasmids and mobilized for use in a diverse range of unrelated species and genera.

Resistance genes mobilize through acquisition by conjugative plasmids or by

transformation of free DNA. Carbapenemase genes, typically carried on plasmids, are an

example of this resistance mechanism. E. coli and K. pneumoniae are the most common

Enterobacteriaceae harboring carbapenemase genes.

Of the four mechanisms mentioned above, β-lactamase production in Enterobacteriaceae is the

primary cause of β-lactam resistance [11] and the most concerning, as these successful genes can

spread and undergo structural modification to extend or expand their spectra of activity very

quickly. Under β-lactam pressure, organisms carrying β-lactamase genes will have a significant

advantage over those without, and may begin to spread as a successful epidemic clone. This

clone may then share its plasmids with other organisms, which may then undergo recombination

to move the gene into other plasmids or into chromosomes [12]. There is a vast diversity of β-

5

lactamases today, and the most worrisome are the carbapenemases. Enterobacteriaceae

producing these mobile carbapenemases are termed “Carbapenemase-producing

Enterobacteriaceae (CPE)”, distinguishing them from “Carbapenem-resistant

Enterobacteriaceae (CRE)”, which refers to Enterobacteriaceae which are phenotypically

resistant to carbapenems, by any mechanism (e.g. porin mutations, efflux pumps, or

carbapenemase production). Lastly, the term “Carbapenemase-producing organisms (CPO)” is

used when bacteria are not limited to the Enterobacteriaceae family but may also include species

such as Pseudomonas aeruginosa or Acinetobacter baumannii, or other non-fermenting Gram-

negative bacteria that may have acquired carbapenemase genes.

1.5 Epidemiology and Classification of CPE The epidemiology of each carbapenemase gene and CPE varies from country, by region, by

continent, by city, and even within large neighbourhoods characterized by different ethnic

densities [13, 14]. The number of studies reporting CPE has increased over the last 10 years [15]

and the global spread of this organism has been documented in Europe [13, 16], Asia [17],

Africa [18], and North America [15, 19]. In Europe, the European Survey on Carbapenemase-

Producing Enterobacteriaceae (EuSCAPE) project defined the epidemiological stages of

nationwide expansion of CPE to describe the spread of CPE. The scale includes: 0 (No cases

reported), 1 (Sporadic occurrence), 2a (Single Hospital Outbreak), 2b (Sporadic Hospital

Outbreak), 3 (Regional spread), 4 (Inter-regional spread), and 5 (Endemic situation) [13]. This

group showed that the CPE burden in 38 participating European countries over the years 2013 to

2015 had worsened significantly [13, 20]. In Asia, resistance rates to meropenem increased

between 2000 and 2012 [17] and a systematic review of the literature from Africa showed that

the number of CPO isolates reported between 2005 and 2013 increased [18]. In Canada, the

number and variety of CPE submitted to provincial reference laboratories had doubled every 2

years [14], with numerous outbreaks described [21, 22].

Carbapanemase enzymes hydrolytically cleave the bond between nitrogen and the carboxyl

group on the β-lactam ring (Figure 1.2 in red) [23]. Based on the sequence similarities, molecular

structures, and ability to hydrolyze carbapenems, carbapenemases are classified into Ambler

Classes A, B, and D β-lactamases. [15, 23]. Classes A and D enzymes are known as serine β-

6

lactamases as there is a serine molecule at their active site. Class B enzymes possess a zinc ion in

their active site and are therefore referred to as metallo-β-lactamases [24].

1.5.1 Class A Carbapenemases

Class A carbapenemases are enzymes that characteristically possess a serine at position 70 and a

disulfide bond between Cys69 and Cys238 of their protein structure [23]. These acquired

enzymes may be located on chromosomes (eg. IMI-1, NmcA, SME, SFC-1), or plasmids (eg.

KPC, IMI-2, and GES derivatives GES-1, GES-2, GES-4, GES-5) [23]. These enzymes are

inhibited by clavulanic acid and boronic acid, but not ethylenediaminetetraacetic acid (EDTA) or

dipicolinic acid. Plasmids encoding KPC and GES genes are Class A carbapenemases seen in the

clinical setting[11].

KPC (Klebsiella pneumoniae carbapenemase) is the most frequently seen Class A

carbapenemase in the clinical setting. 22 KPC variants have been documented to date [25, 26].

KPC-2 and KPC-3 are the most common variants identified in reports of clinical infections.

blaKPC genes have been reported to spread both by clonal dissemination of a pandemic clone

ST258 [27] and horizontal transmission of plasmids harboring the transposon Tn4401 [27, 28].

KPC genes were first identified in Klebsiella pneumoniae but have since been found in many

other Enterobacteriaceae including: E. coli, E. cloacae, E. aerogenes, C. freundii, S. enterica, S.

marcescens, and Raoultella spp., and other non-Enterobacteriaceae such as Pseudomonas and

Acinetobacter spp.

The first blaKPC carbapenemase was discovered in 1996 in North Carolina, where a K.

pneumoniae species displayed weak resistance to carbapenems [29]. Soon after, reports of blaKPC

K. pneumoniae infection became more frequent, especially in New York [30-32]. Since then,

KPC has spread globally, causing outbreaks in North America, Asia, Africa, Europe, and South

America [33]. Israel was the first to report a KPC outbreak outside the U.S. in 2006 [34]. Many

countries/regions are now in stage 5 for KPC (endemic situation) including Greece, Italy, and

eastern USA [13].

In Ontario, Canada, KPCs were first reported in April 2008 [35]. The first three Canadian KPC

cases described in the literature occurred in Ottawa, 2008; one patient received medical care in

Florida, U.S. and another travelled to New York City [36]. In 2012, Canada reported its first

7

KPC outbreak in a university-affiliated ICU [22]. Cases of KPC infections are rising and the

Canadian Public Health Laboratory Network (CPHLN) stated that the numbers of KPC cases in

the first six months of 2014 (n≈65) was greater than the total number of KPC cases in 2013

(n≈50). KPC continues to be one of the two most common CPE reported in Canada and the most

common Class A carbapenemase [14, 19].

GES (Guiana extended spectrum): There are currently 27 known GES types [25], most of

which have the ability to hydrolyze extended spectrum cephalosporins, and some of which

possess carbapenemase activity (eg. GES-2, GES-4, GES-5, GES-6, GES-13, GES-20) [23, 37].

Aside from GES-7, all blaGES variants have been found on gene cassettes on class 1 integrons

[38]. These genes are transferrable via conjugation of the plasmids harboring the integrons [39,

40]. GES has been identified in various species including K. pneumoniae, S. marcescens, E. coli,

E. cloacae, and P. aeruginosa [41].

The first GES was identified in 1998 in a K. pneumoniae isolate from an infant previously

hospitalized in French Guiana [42]. GES enzymes are less common than KPC in the clinical

setting; however, single occurrences have been reported worldwide including in Greece, France,

Portugal, South Africa, French Guiana, Brazil, Argentina, Korea, and Japan [39, 42-52].

Nosocomial outbreaks of GES are few, but there are at least two reports of GES outbreaks in the

literature: South Africa saw eight patients infected with P. aeruginosa strain expressing GES-2

[48] and South Korea saw six patients infected with K. pneumoniae strain expressing GES-5

[45]. In Canada in 2009-2010, three related P. aeruginosa strains harbouring GES-5 were

reported by the Canadian Nosocomial Infection Surveillance Program (CNISP) from two

hospitals in western Canada [53]. Since then, there have been two additional publications

documenting GES infections in Canada, with the latest report documenting the identification of

GES-5 in Enterobacteriaceae E. coli and S. marcescens [54, 55].

1.5.2 Class B (metallo-β-lactamase)

Class B carbapenemases characteristically contain at least one zinc ion in their active site. Metal

ion chelators such as ethylenediaminetetraacetic acid (EDTA) and dipicolinic acid inhibit their

activity. They are able to hydrolyze all classes of β-lactams except monobactams such as

aztreonam. Enzymes belonging to this class may be found on the chromosome (eg. BCI, BCII,

8

and L1) or on plasmids (eg. SPM-1, GIM-1, SIM-1, VIM types, IMP types, and NDM types).

IMP, VIM, and NDM genes are the most common carbapenemases seen in the clinical setting.

NDM (New Delhi metallo-β-lactamase): There are currently 16 described variants of NDM (1

to 16) differing by one or two amino acid residues [25, 56]. NDM-1 is the most common variant

identified in clinical isolates. In contrast to KPC genes dissemination, the global dissemination of

NDM genes has not been associated with an epidemic clone, and NDM genes have been

identified in many non-clonally related enterobacterial species [57]. NDM-1 has been found to

be highly transmissible by plasmids, carried by different incompatibility groups (IncA/C, F,

L/M) and self-transmissible by conjugation in the laboratory [58-60]. NDM-1 has been identified

in K. pneumoniae, E. coli, K. oxytoca, Proteus mirabilis, E. cloacae, C. freundii, Providencia

spp. A. baumannii Shigella spp., Pseudomonas spp., Stenotrophomonas spp., Aeromonas spp.

and Vibrio cholera [59, 61-64].

NDM, named after New Delhi, was first identified in a K. pneumoniae species from a Swedish

patient who received medical treatment in India in 2008 [65]. The majority of NDM infections

have been associated with travel to and hospitalization in the Indian subcontinent. These

admissions include those associated with “medical tourism”, where foreign patients travel to

India for less expensive medical treatment. NDM-1 has been identified largely in Asia with the

highest burden in India, Pakistan, and Bangladesh [66]. Hong Kong, Singapore, Thailand [67-69]

have also reported cases of NDM and some countries in Europe (ie. Denmark, Romania, and

Poland) have reached stage 4 (inter-regional spread) [13, 66]. NDM has also been reported in

Africa (ie. Algeria, Cameroon, Morocco, Kenya, Tanzania [70-74]), and Latin America (ie.

Venezuela, Brazil [75, 76]) [57, 66]. Canada identified its first NDM-1 containing isolate in 2008

[14]. Since then, the number of NDM-1 cases in Canada has been steadily rising and has become

one of two most common CPE identified in Canada [14]. In Ontario, many reports of NDM-1

infections in patients have been documented [21, 77, 78], and NDM-1 positive E. coli isolates

have been the most common CPE identified since 2013 [35, 79].

VIM (Verona integron-encoded metallo-β-lactamase): There are currently 34 known VIM

types [80]. VIM-2 is the most commonly reported MBL in the world [58]. VIMs are located as

part of a Class I integron on conjugative plasmids. They have been identified in

Enterobacteriaceae (commonly seen in E. cloacae, K. pneumoniae, C. freundii, and S.

9

marcescens), as well as Pseudomonas spp., Acinetobacter spp., and Achromobacter

xylosoxydans [81].

VIM was first isolated in a P. aeruginosa isolate from Italy in 1997 [82]. VIM type

carbapenemases are the most common MBLs found in the Mediterranean area and cases of VIM

have been reported in Asia (i.e. South Korea [83]), Africa (i.e. Nigeria, South Africa, Tunisia

[75, 84]), America (i.e. Venezuela, United States [75, 85]), and Europe [13]. According to the

results from EuSCAPE, Greece is in stage 5 (endemic) of its epidemiological stages of VIM

carbapenemase while Italy, Spain, and Hungary have reached stage 4 (inter-regional spread) for

this carbapenemase [13]. In Canada, the first report of VIM P. aeruginosa was described in

Calgary isolated from patients with P. aeruginosa infections between 2002-2004 [86]. Since

then, the first four VIM producing Enterobacteriaceae isolates were described by Tijet et al.

2013 [87], all isolates from Ontario. Following this, blaVIM CPO cases in Winnipeg have been

reported [88], and other cases have been documented by Public Health Ontario Laboratories

[79].

IMP (active on imipenem): There are 52 documented IMP types [25]. IMP variants have been

found on gene cassettes incorporated into integrons that are present on large-size plasmids [89-

91]. They are spread through horizontal gene transfer of plasmids within and between species.

blaIMP is most commonly seen in Pseudomonas and Acinetobacter spp. [81]; however, members

of the Enterobacteriaceae family including Escherichia coli, E. cloacae, Citrobacter freundii,

and S. marcescens have been reported to harbor variants of IMP such as IMP-4 and IMP-8 [91-

96].

IMP-1 was the first carbapenemase to be identified. This gene was found in Pseudomonas

aeruginosa in Japan, 1988 [97, 98]. Since then, IMP variants have been reported most commonly

in Asia (Japan, China, Taiwan, Hong Kong, and South Korea [94, 99-101]), but also in England,

Italy, Portugal, Australia, Brazil, USA, and Canada [58, 102-106]. The number of patients

colonized/infected with organisms carrying IMP genotypes in Ontario is low compared to other

carbapenemases [14, 19]. Specimens from one nosocomial outbreak of P. aeruginosa in 1997

Calgary, Canada, were found to produce IMP-7 when screened retrospectively [106].

Investigators of this study believe that the IMP-7 gene may have facilitated the successful

transmission of the organism during the outbreak [106].

10

1.5.3 Class D (oxacillinases)

There are over 400 oxacillinase gene types [25], all of which are capable of hydrolyzing oxacillin

and cloxacillin, and at least 37 of which can hydrolyze carbapenems. All oxacillinases are

encoded on a plasmid and have highly variable amino acid sequences.

OXA-type carbapenemases include enzyme subfamilies OXA-2, 23, 24/40, 48, 50, 51 (weak),

55, 58, 60, 62, which are organized based on amino acid identity [107-109]. OXA-48 is the most

prevalent OXA-type carbapenemase around the world. Within this subfamily, OXA-181, 232,

and 244 are commonly reported OXA-types. Although Class D enzymes possess weak

carbapenemase activity compared to Class A and Class B enzymes, OXA-48 genes are often

found with CTX-M-15 enzymes, which increases the organism’s degree of carbapenem

resistance. OXAs are not associated with a particular bacterial species or strain but have been

linked with transposons Tn1999 or Tn1999.2 [110] and with a particular 62.5kb plasmid [111].

OXA-48 genes have been identified in various enterobacteria, but are most commonly found in

K. pneumoniae and E. coli [15].

OXA-48 was first identified in a K. pneumoniae strain in 2003 in Turkey [112]. Currently, it is

the most wide-spread carbapenemase gene in countries of Mediterranean basin, endemic to

Turkey, and common in Croatia, Egypt, Germany, Greece, Israel, Italy, Lebanon, Libya,

Slovenia, Spain, Tunisia, Morocco, and France [13, 18, 113]. CPE containing OXA-48 have also

been reported in Africa [10], Asia [114], and North America [66, 115]. They are most often

acquired in-hospital but community-acquired cases have also been reported [116] and have also

been identified in the environment [117]. Canada has seen an increase in the number of identified

CPE isolates containing OXA-48 cases over the years, with the number of cases for OXA-48 in

the first six months of 2014 equal to the total numbers for 2013 [14], and the number of OXA-48

in 2014 (n=33) doubling in 2015 (n=65) (CPHLN, unpublished data).

1.6 Water Epidemiology of CPE Water-related infectious diseases, such as Shigella, Salmonella, and E. coli O157:H7, are a major

cause of morbidity and mortality around the world [118]. Outbreaks of infections caused by V.

cholerae in 1854, London, killed 127 people within just three days [119]. In Canada,

11

contamination of the Walkerton water supply with E. coli O157:H7 and other pathogens caused

an outbreak in 2000, killing seven people [120, 121]. These examples demonstrate the significant

role of water in harboring and spreading bacteria, subsequently affecting public health. However,

most members of the Enterobacteriaceae family do not cause either diarrheal or waterborne

illnesses.

Anthropogenic changes of increased antibiotic production, antibiotic use in agriculture/

livestock/ aquaculture to promote growth, and antibiotic use in clinics to treat human infections

have contributed to the increasing levels of antibiotic resistant organisms in the water

environment [122-126]. Antimicrobial resistant organisms are not eliminated by the sewage

treatment processes and, consequently, high concentrations of these have been found in effluent

water from sewage treatment plants [127-130]. The sewage system can act as a reservoir for

bacterial DNA exchange and provide selective pressure for bacterial evolution [131]. Ferreira da

Silva et al. and Szczepanowski et al. demonstrated this by comparing the level of antibiotic

resistance genes between influent and effluent sewage. They found that the treated effluent had

higher resistance profiles for certain antibiotics than sewage influent, suggesting that antibiotic

resistance genes were being selected for in the sewage system [132, 133]. Currently, the

interplay between CPE in the water environment and human infection is unknown. Many studies

have identified resistant organisms and CPE in sewage (Table 1.6.1), surface water (Table 1.6.2),

and effluents of hospital sewage (Table 1.6.3). Walsh et al. (2011) has hypothesized that surface

water and tap water may act as CPE reservoirs, possibly exposing travelers who visit CPE-

endemic countries to these organisms [61]. However, there has been no conclusive evidence

regarding the contribution of water CPE to human infection.

1.7 Sewage Treatment Plant and Surface Water In sewage treatment plants, sewage flowing into the plant (influent) undergoes primary

(mechanical) treatment which removes all solids from the sewage, then goes through secondary

and biological treatment to remove biodegradable organic matter, pathogenic bacteria, and

nutrients which would support the growth of unwanted algae [134]. The final treatment step also

includes UV radiation or chlorination to prevent unwanted substances from reaching the lakes

and rivers into which effluent flows. Although the sewage treatment plants are very efficient in

12

maintaining safe water for release, they are not foolproof. Even highly functioning sewage

treatment plants do not eliminate all bacteria and, can release large quantities of bacteria into the

environment [128-130, 135, 136].

The Greater Toronto Area (GTA) is the largest metropolitan city in Canada, and the 9th largest

urban agglomeration in North America. It is comprised of the city of Toronto and the four

regions surrounding it: Durham, Halton, Peel, and York. In Ontario, more than 67 municipalities

have combined sewer systems [137] where pipes carry both storm water and raw sewage to

sewage treatment plants. This combined sewer system often impacts the water quality in the Don

and Humber Rivers and Lake Ontario as heavy rainfall causes sewer overflow, resulting in

untreated overflow discharging directly into the rivers and lakes. The untreated water includes

pathogens, industrial wastes (eg. paint, metals, and radioactive waste), and street contaminants

[138, 139] which will contaminate the beaches, fish, shellfish, and downstream drinking water

sources [138]. These contamination events can also have an impact on public health as people

interact with the water for recreational uses, or through food cultivated using contaminated water

[120, 138, 140].

1.8 Relevance of the project

CPE are particularly important antibiotic resistant pathogens because infections with

Enterobacteriaceae are common, because CPE are evolving rapidly, and because there are no

adequate treatment options for many strains.

The case fatality rates for CPE infections have been reported to be as high as 75% [141]. People

who become colonized with CPE are themselves at risk of developing infections and may spread

the organism to others. Because colonization can persist for prolonged periods [142], these risks

are enhanced. Since CPE was first identified in Ontario in 2008, there has been a gradual

increase in the number and diversity of CPE isolates reported [35, 143]. The first few cases of

CPE were associated with travel to a CPE-endemic country. However, most CPE now occur in

patients who have no travel history [TIBDN, unpublished results]. The identification of CPE in

food [144], animals [145, 146], and water sources around the world has raised concerns that CPE

may have spread into the community, and that water may be a reservoir of increasing

importance. Investigation of CPE in Toronto’s water environment is one component of

understanding the epidemiology of this increasingly important form of resistance in Canada.

13

1.9 Objectives and specific aims Based on previous studies [143], it was hypothesized that carbapenemase genes and

carbapenemase producing Enterobacteriaceae would be identified in raw sewage, final discharge

from sewage treatment plants, and the surface water in the GTA. We also hypothesized that there

would be an epidemiological relationship between environmental and clinical CPE isolates.

The specific aims of this project were:

1. To identify CPE isolates from influent and effluent trunks of sewage treatment

plants, and surface water in Toronto and Peel region. This aim was to describe the

CPE species and genes present in Toronto’s waste water system, and in surface water.

2. To compare different methods of CPE detection, including culture, filter sweep

PCR, and raw sewage PCR methods. This aim was intended to support future studies to

isolate and identify CPE from water sources more efficiently.

3. To determine whether the same clones or plasmids are found in both water and

clinical isolates of CPE. This aim was to determine the relatedness of water and clinical

isolates.

14

Chapter 2 Isolation of Carbapenemase Producing Enterobacteriaceae from

Sewage and Surface Waters

2

2.1 Methods

For the purpose of this thesis, specimens are defined as water samples (either sewage or surface)

collected from one location on a particular date. An isolates is defined as a pure strain of bacteria

extracted from mixed culture growth.

2.1.1 Sampling Sites (See Figure 2.1.1 for a Map of STPs in the GTA)

Four sewage treatment plants (STP) process the sewage in the City of Toronto (Figure 2.1.1).

i. Ashbridges Bay treatment plant, the largest of the four, serves 1,524,000 people

bounded by Steeles Ave on the north, Humber River STP on the west, Highland Creek

STP on the east, and lakeshore on the south. This treatment plant has four influent and

one effluent trunks [134].

ii. Humber River treatment plant is Toronto’s second largest STP, processing sewage

outflow from 651,000 people residing in Etobicoke, a portion the west end of North

York, York, and Toronto [147].

iii. Highland Creek treatment plant processes sewage outflow from 450,000 residents

living in the East (Scarborough).

iv. North Toronto treatment plant (TNT), the smallest plant of the four, serves a

population of 55,000 living in North Toronto, Leaside, and Forest Hill. The sewage

exceeding North Toronto STP capacity is diverted to Ashbridges Bay STP.

Apart from Ashbridges Bay, the other STPs have a single influent and effluent trunk.

Two sewage treatment plants process the sewage in Peel region.

15

i. Lakeview (Peel) treatment center treats water coming from approximately 800,000

people residing in Bolton, and eastern part of Brampton and Mississauga. This STP has

one influent and one effluent trunk.

ii. Lorne Park water treatment facility serves the western region of Peel.

Lakeview and Lorne Park STPs share a water main, which allows water coming from Lorne Park

STP to flow into Peel STP, and vice versa.

Surface water sampling sites used by Environment and Climate Change Canada during the

period of this study (See Figure 2.1.2 for a Map of SW sites in the GTA) include:

i. 5 locations along the Humber River (Jane, Pine Grove, Albion, Clarence, Old Mill)

ii. A stormwater outfall discharging into the lower Humber River (i.e. where the river

empties into Lake Ontario (Riverside)

iii. A Sunnyside beach area proximate to the mouth of the Humber River (SSI-C )

The sewage and surface water specimens used for this study were routinely collected for other

projects by Environment and Climate Change Canada, and were kindly shared by Environment

and Climate Change Canada for this study. Only Lakeview (Peel) STP was sampled from the

region of Peel.

2.1.2 Sewage Collection from Sewage Treatment Plants

Sewage specimens were collected in autoclaved 500mL polypropylene bottles. Influent sewage

at Toronto STP was collected immediately after removal of large items such as bushes, plastic

bags, and garbage (“grit” removal); while influent sewage at the Peel STP was collected pre-grit

removal. All effluent sewage was collected after the de-chlorination step just as it left the plant

[148]. The water specimens were placed on ice and transported to the laboratory within six hours

of collection for same day processing.

16

2.1.3 Water Collection from Surface Water Sites

500mL polypropylene bottles were directly inserted into the surface water and filled. The water

specimens were kept on ice and transported to the laboratory within six hours of collection for

same day processing.

2.1.4 Processing of Sewage and Surface Water Specimens

The filtration of raw water specimens onto filter paper was conducted in Dr. Thomas Edge’s

laboratory at Environment and Climate Change Canada. Each water specimen was processed at

two volumes. 0.1mL and 0.01mL of influent and 10mL of effluent and surface water were

diluted in sterile water to a total volume of 100mL before filtration, while 100mL of effluent and

300mL surface water was directly filtered through without dilution. Using sterile tweezers, a

0.45µm pore size membrane filter (Fisher Scientific) was placed onto a Millipore vacuum

filtration system apparatus. The filter was then placed directly onto MacConkey-3-agar

containing 0.125ug/mL meropenem and 12 mg/L cefsulodin (Oxoid Ltd, Canada) and

transported from Environment Canada to Mount Sinai Hospital. The plates were incubated

aerobically for 18-20 hours at 37°C.

Organisms which grew on the selective agar were subject to oxidase testing (Pro-Lab

Diagnostics) to exclude oxidase-positive organisms such as Pseudomonas and Aeromonas

species. This was performed by picking one colony per morphotype using a sterile toothpick and

placing it onto a filter paper (WhatmanTM) containing oxidase reagent (Pro-Lab Diagnostics). If

there was not enough growth on the filter plate to perform oxidase test, the organisms were

streaked onto a new MacConkey-3-agar containing 0.125ug/mL meropenem and 12mg/L

cefsulodin plate and incubated overnight under the same conditions as above. Organisms that

were difficult to categorize using the oxidase test (e.g. lactose fermenters because of their

intrinsic colour) were sub-cultured onto Mueller-Hinton agar, incubated overnight under the

same conditions as above, then subject to an oxidase test. Each oxidase-negative morphotype

was streaked onto a new MacConkey w/o salt agar plate (Oxoid Ltd, Canada) with a 10µg

ertapenem disk (Oxoid Ltd, Canada) placed on the plate to maintain selective pressure.

17

2.1.5 Antimicrobial Susceptibility Tests

Once pure cultures were isolated, 0.5 McFarland standards (equivalent to 1-2 x 108 CFU/mL for

E. coli [149] were prepared by inoculating a 1μL loop of several colonies in 3mL sterile saline.

The turbidity of these suspensions was adjusted to a 0.5 McFarland using a colorimeter

(bioMérieux VITEK V1210). A sterile cotton swab was dipped into the suspension and

uniformly streaked across a Mueller Hinton agar plate. A single 10µg meropenem disk (Oxoid

Ltd, Canada) was placed onto the lawn and the plate incubated aerobically for 18-20 hours at

35°C. Carbapenemase susceptibility was evaluated by measuring the inhibition zones around the

disk using a ruler and recording the zone diameters to the nearest millimeter. The European

Committee on Antimicrobial Susceptibility Testing (EUCAST) breakpoints for carbapenemase

disks inhibiting Enterobacteriaceae is <22mm; however, since OXA-48 genes may confer low

MICs, isolates with a disc diameter of <28mm were further investigated in this study.

Organisms with reduced susceptibility (meropenem zone of <28mm) were further tested using

ROSCO Diagnostica’s KPC/MBL and OXA-48 Confirmation Kit. 0.5 McFarland standards were

made as described earlier and streaked onto Mueller Hinton agar. Five inhibition disks in this kit:

meropenem + cloxacillin (MRPCX), meropenem + boronic acid (MRPBO), meropenem +

dipicolinic acid (MRPDP), meropenem (MRP10), and temocillin (TEMOC) were placed onto the

lawn using sterile tweezers and placed to avoid overlapping zones and interference between the

inhibitory disks. The plates were incubated aerobically for 18-20 hours at 35°C. The inhibition

zones around the five disks were measured (as described above) and interpreted according to the

KPC/MBL and OXA-48 Confirmation Kit Insert. A difference of ≥5mm between MRP10 zone

and any one of the MRPBO, MRPDP, and MRPCX disks, as well as the absence of a zone

around the TEMOC disk was recorded as per manufacturer’s instructions. Based on these

phenotypic results, the carbapenemase class was deduced [150].

2.1.6 Matrix Associated Laser Desorption Ionization- Time of Flight (MALDI-TOF) Mass spectrometry

To identify organisms to the species level, MALDI-TOF MS (bioMérieux VITEK-MS) was

performed on all pure cultures with reduced susceptibility to meropenem (<28mm). Organisms

were picked from either MacConkey w/o salt agar or Mueller Hinton agar using a 1μL plastic

loop and streaked onto the MALDI-TOF slide to create an even layer of bacteria. 1μL of

18

VITEK® MS CHCA matrix was placed on top of the bacterial sample and allowed to dry before

loading the slide into the VITEK-MS machine. The results were interpreted by Myla® software

(bioMérieux) and recorded to the species level.

2.1.7 Carbapenem Inactivation Method

All organisms with reduced susceptibility to meropenem, phenotypically carbapenemase

positive by ROSCO’s KPC/MBL and OXA-48 Confirmation Kit, and identified as

Enterobacteriaceae by the VITEK-MS, were further tested for carbapenemase production by the

carbapenem inactivation method (CIM). This phenotypic test was performed to confirm the

ROSCO kit results and to further decrease the number of isolates tested by PCR. 10μL of pure

culture was suspended into a microtube containing 400μL of sterile distilled water. One 10µg

meropenem disk (Oxoid Ltd, Canada) was immersed in the suspension, which was then

incubated aerobically for 2 hours at 35°C. The disks were then placed onto a Mueller Hinton

agar plate that was evenly streaked with a 0.5 McFarland Standard of E.coli ATCC 259822.

Appropriate positive (K. pneumoniae ATCC 1705) and negative (K. pneumoniae ATCC 1706)

controls were prepared for each set of CIM tests. The plates were incubated aerobically for 18-20

hours at 35°C. The zones were measured using a ruler in mm and interpreted as positive (=6mm)

or negative (>6mm) for presence of carbapenemases.

2.1.8 Storage of CPE isolates and Filter Sweeps

Isolates that 1) had a <28mm zone size around the MEM disk, 2) produced a carbapenemase

based on KPC/MBL and OXA-48 Confirmation Kit, 3) were classified as an Enterobacteriaceae

by MALDI-TOF MS, and 4) were CIM positive, were stored in 1mL Microbank™ Broth Blue

(Pro-Lab Diagnostics) and frozen in -80°C until further use. Filter sweeps of all growth on the

sewage and surface water membrane filters was collected using a sterile cotton swab and stored

frozen in 1mL Microbank™ Broth Blue at -80°C until further use.

2.1.9 DNA extraction

Three methods of DNA extraction were used for different purposes in this study.

19

2.1.9.1 Rapid DNA Boiling Method

The rapid DNA boiling method was performed for each presumptive CPE to determine their

carbapenemase gene as described by Tijet et al. [151]. A 1μL loop of bacteria was picked from 5

colonies on a purity plate and was suspended in a 100μL of lysis buffer containing 1%

TritonX100, 0.5% Tween, 10mM Tris pH 8.0, and 1mM EDTA. The cell suspension was

vortexed then heated at 100°C for 10 minutes. The suspension was centrifuged at 15,000rpm for

3 minutes. The supernatant was transferred into a new sterile 1.5mL tube and stored at -20°C

until use. Positive control for successful DNA extraction was performed using 16S rRNA gene

detection (16s rRNA-F: AGGAGGTGATCCAACCGCA, 16s rRNA-R:

AACTGGAGGAAGGTGGGGAT). PCR reaction mixture of 16S rRNA included: 10μL of

REDTaq ReadyMix (Sigma), 7μL of water, 1μL of 10μM forward primer, 1μL of 10μM reverse

primer, and 1μL of DNA (nuclease free water used for negative control). The PCR cycle is as

follows: initial denaturation at 94°C for 10 min; followed by 30 cycles of 94°C for 40 sec, 60°C

for 40 sec, and 72°C for 30 sec; and a final elongation step at 72°C for 7 min. PCR products

were run on a 1% agarose gel containing 1:105 (v:v %) EtBR in 1x TAE buffer, at 110V for 30

minutes. GeneRuler 1kb Plus DNA ladder (Fermentas. ThermoFisher Scientific, USA) was used

as a size marker. The PCR products were stored at 4°C. The gels were visualized using UV light.

2.1.9.2 NucliSENS easyMag® (bioMérieux) DNA extraction

The NucliSENS easyMag® (bioMérieux) DNA extraction method was used to extract DNA

[250] from Amies transport swabs of filter sweeps. The swab contents were mixed with 1mL

PBS solution and vortexed at maximum speed until the mixture was homogenous. 200μL of this

suspension was placed into the 2mL NucliSENS easyMag® lysis buffer (bioMérieux ref

200292). The solution was vortexed until the mixture was homogenous, and was allowed to lyse

for 10 minutes. To ensure collection of total content, the tubes were centrifuged at 1500 rpm for

2 minutes. The entire lysis solution was transferred using a sterile transfer pipette into the

easyMag® cartridge and mixed with 100μL of easyMag® Magnetic Silica (bioMérieux ref

280133). The input on easyMag Software v2.1 was as follows: Protocol- Generic 2.0.1; Sample

type- other; Sample volume- 250 μL; Elution volume: 50μL, Type of lysis- lysed. The

suspension underwent lysis and binding, washing, elution via heat, and final purification in the

easyMag machine and the final DNA eluate was transferred to and stored in a microfuge tube at -

20°C until use. The buffers used by the NucliSENS easyMag® machine were Wash Buffer 1

20

(bioMérieux ref 280130), Wash Buffer 2 (bioMérieux ref 280131), and Wash Buffer 3

(bioMérieux ref 280132).

2.1.9.3 Direct DNA extraction from Sewage and Surface Water

DNA extraction directly from the sewage and surface water specimens were conducted by Dr.

Thomas Edge and his laboratory at Environment Canada [148]. 50mL of influent sewage or

100mL of effluent sewage or 300mL of surface water were filtered through 0.45µm pore size,

47mm diameter, membrane filter (Fisher Scientific). Filters were frozen at -80°C for one week or

less, and then prepared for DNA extraction. The frozen filters were folded and placed into

Powerbead tubes and DNA was extracted using Powersoil™ DNA Isolation Kits (MO BIO

Laboratories, Inc., Carlsbad, CA, USA) according to manufacturer’s instructions. Controls

(extraction blanks) were included with every batch.

2.1.10 E. coli concentration in Water Specimens (CFU/100mL)

E. coli counts (CFU/100mL) were counted and reported by Dr. Edge at Environment Canada

[148]. Sewage and surface water specimens were filtered on 0.45µm pore size, 47mm diameter,

membrane filters (Fisher Scientific) through the same Millipore vacuum filtration system

apparatus. A range of dilutions was filtered according to American Public Health Association,

1999 [152]. Filters then were incubated on differential coliform (DC) media with cefsulodin, at

44.5˚C for 22 hours and E. coli colonies counted. Controls (filtration blanks) were included with

every batch.

2.1.11 Detection of Carbapenemase genes using Conventional Multiplex polymerase chain reaction assay (PCR)

PCR screening for six of the most common carbapenemase genes: blaGES, blaKPC, blaIMP, blaOXA-

48-like, blaNDM-1, and blaVIM, was performed on all phenotypically positive CPE isolates. Two

multiplex reaction mixtures, multiplexes 5 (MM5) and 6 (MM6) were prepared according to

Dallenne et al. (2010) [249] (Table 2.1.11). The reaction mixtures had final volume (Vf)=20μL

containing 10μL of REDTaq ReadyMix (Sigma), 3μL of nuclease free water, 1μL of each 10mM

primer pair, and 1μL of DNA (water used for negative control). MM 5 and MM6 were run under

these conditions: initial denaturation at 94°C for 10 min; followed by 30 cycles of 94°C for 40

sec, 57°C (MM5) or 60°C (MM6) for 40 sec, and 72°C for 60 sec; and a final elongation step at

21

72°C for 7 min. PCR products, positive control, and negative (nuclease free water) controls were

separated on a 1% agarose gel and visualized using UV light as described in section 3.8.1. The

PCR products were stored at 4°C.

2.1.12 Detection of Carbapenemase genes using multiplex Real-Time polymerase chain reaction assay (RT-PCR)

RT-PCR screening was performed for genes blaGES, blaKPC, blaOXA-48-like, blaNDM, blaVIM, and 16s

rRNA, for DNA extracted using the NucliSENS easyMag® (bioMérieux) extraction method and

Powersoil™ DNA Isolation Kits (MO BIO Laboratories, Inc., Carlsbad, CA, USA). The

multiplex panel for blaKPC, blaNDM, and 16s rRNA genes was adopted from Centres for Disease

Control and Prevention (CDC) procedure “Multiplex Real-Time PCR Detection of Klebsiella

pneumoniae Carbapenemase (KPC) and New Delhi metallo-β-lactamase (NDM-1)” [153]. The

multiplex panel for blaGES, blaVIM, and blaOXA-48-like was adopted from Public Health Ontario

Standard Operation Procedure, “Confirmation of carbapenemase producing Enterobacteriaceae

using multiplex Real-Time PCR” (SOP- C-ID-177-001) [154], with a cycle threshold of 38 Ct.

Two multiplex panel reaction mixtures (Table 2.1.12) were prepared at Vf=20μL containing

10μL Qiagen QuantiTect® Mastermix, 1μL of 10mM primer F/R mix for each multiplex set

(Invitrogen), 1μL of 2.5μM probe (Integrated DNA Technologies), 4μL DNA (nuclease free

H2O for negative control), and nuclease free H2O to complete the volume Vf=20 μL. The

cycling procedure comprises: enzyme activation at 95°C for 15 min; followed by denaturation

and anneal/extension at 40 cycles of 94°C for 15 sec, and 60°C for 60 sec. The RT-PCR was

conducted on Applied Biosystems 7500 Fast Real-Time PCR System and analyzed using 7500

software v2.0.5.

2.1.13 Removal of Duplicate Isolates

Because two different concentrations of sewage were sampled on each date, and multiple

colonies from each filter were subbed, more than one isolate of the same organism could be

obtained from the same specimen on any one sampling date.

We therefore compared isolates that were obtained on the same date from the same specimen. If

two isolates of the same species and carbapenemase gene had MEM10 disk zones within 3mm of

each other, and zone diameters in the ROSCO Diagnostica’s KPC/MBL and OXA-48

22

Confirmation Kit were all within 3 mm, then the isolates were considered duplicates and one was

selected for further investigations.

To investigate the variability in isolates defined above as duplicates, we performed PFGE on all

46 CPE K. oxytoca identified from the first four sampling dates. Overall we identified a total of

15 different clones (<75% similarity by Dice coefficient) among these 46 isolates. There were 12

groups of K. oxytoca isolates (7 with 2 isolates, 2 each with 3 and 4 isolates, and one with 5

isolates) which were defined by our criteria as being the same. Of these 12 groups, isolates in

one group of 2 were different clones by PFGE and isolates in one group of 4 comprised 3

different clones. Two of the three clones that would have been missed by removal of duplicates

using our definition were identified in other samples from the same STP on other dates.

2.1.14 Meteorological Events

The average temperature and total precipitation observed at Toronto City Centre Airport was

collected from Environment Canada [155]. Because sewage specimens were collected on the

morning of the collection date, temperature and total rainfall for the day prior to the date of

specimen collection were used for analysis.

2.1.15 Statistical Analysis

Data was analyzed using SAS software version 9.3 for PC (SAS Institute, Cary, North Carolina).

Two-sided P values ≤ 0.05 were considered statistically significant. Fisher’s exact test (2x2) and

Fisher-Freeman-Halton Test (R x C contingency tables) were used to assess the significance of

differences between CPE proportion from STPs. The Benjamini and Hochberg procedure, with a

false discovery rate <0.05 was used to correct for multiple comparisons made between STPs.

Differences in medians were compared using the Wilcoxon rank sum test. Cohen’s kappa test

(GraphPad Software, La Jolla California USA, www.graphpad.com) was used to measure

agreement of carbapenemase presence between the PCR results from culture, filter sweep PCR,

and raw sewage PCR methods.

23

2.2 Results

2.2.1 Presence of CPE in the Sewage Treatment Plants (STPs)

Between June 2015 and February 2016, 103 specimens were received from five STPs (Table

2.2.1). Specimens were collected on 10 different days during this period (Table 2.2.2). Of these

specimens, 60 (58%) were influent while 43 (41%) were effluent. Overall, 58 (56.3%) specimens

yielded CPE from which 315 CPE isolates (pure colonies harboring a carbapenemase gene) were

collected yielding 172 unique isolates after removal of duplicate isolates (see Methods Section

2.1.13).

The 172 CPE comprised isolates from seven species. K. oxytoca n= 55 (31.9%) was the most

common, followed by K. pneumoniae n=27 (15.7%), C. freundii n= 25 (14.5%), E. cloacae n=

23 (13.4%), Raoultella spp. n= 21 (12.2%), E. coli n= 19 (11.1%), and K. intermedia n= 2

(1.2%) (Table 2.2.1.1).

Five of six carbapenemase genes of interest were identified from the water specimens. blaKPC n=

152 (88.4%) was the most common followed by blaNDM n= 11 (6.4%), blaGES n= 4 (2.3%) and

blaOXA-48-like n= 4 (2.3%), blaVIM n= 1 (0.6%). No blaIMP (0%) was found (Table 2.2.1.1).

The blaNDM carbapenemase gene was identified in E. coli (n=10) and K. pneumoniae (n=1) but

was not found in K. oxytoca, C. freundii, E. cloacae, Raoultella spp, or Kluyvera spp. in this

study. Among all CPE isolates, 10 of 19 E. coli isolates contained the blaNDM gene as compared

to 1 of 153 among other species (p<0.0001). blaOXA-48-like was also found in E. coli (3/19) and K.

pneumoniae (1/27) but not among other species (p=0.001) (see Table 2.2.1.1).

2.2.1.1 Comparison by STP Sites

The numbers of isolates identified at each site are listed in Table 2.2.1. The proportion of

specimens yielding CPE differed in the different STPs (P<0.0001). Ashbridges and Humber had

a high proportion of specimens that yielded CPE (33/39 (85%) and 15/20 (75%), respectively).

The percentage of specimens yielding CPE from Peel (36%), Highland (25%) and TNT (6%)

was significantly lower when compared individually with Ashbridges (P<0.00025) and Humber

(P<0.02) STP (See Figure 2.2.1.4).

24

The distribution of species in CPE found in each treatment plant is displayed in Figure 2.2.1.5.

There was no significant difference in the proportion of specimens yielding C. freundii, E.

clocae, K. intermedia, K. oxytoca, K. pneumoniae, and Raoultella spp. between the STPs

(P>0.05). In contrast, E. coli comprised a lower proportion of CPE in Ashbridges Bay as

compared to other STPs (P=0.0009). Upon closer investigation, the difference in E. coli occurred

between Ashbridges and TNT (P=0.046).

Analysis of the carbapenemase genes demonstrated that there was a significantly higher

proportion of isolates yielding blaKPC CPE from Ashbridges STP compared to Humber

(P=0.026), Highland (P=0.003), and TNT (P=0.018) STPs. Humber STP also had a higher

proportion of blaKPC positive specimens compared to Highland STP (P=0.04). Furthermore,

Highland STP had a higher proportion of specimens yielding blaGES compared to Ashbridges

(P=0.02) and Humber (P=0.02). Lastly, there was no difference in the proportion of blaVIM and

blaOXA-48-like between the five STPs (P>0.05) when corrected for multiple comparisons. Figure

2.2.1.6 shows the proportion of genes identified at each site.

2.2.1.2 Differences between Influent vs Effluent trunks

We compared the proportion of CPE positive specimens coming from influent and effluent

trunks to account for the differences in filtered volume. All CPE positive specimens at Peel STP

were obtained from the influent trunk (5/7 influent vs 0/7 effluent, P=0.021). In other STPs, there

was no statistically significant difference in the proportion of specimens yielding CPE between

influent and effluent trunk specimens (P=1.0). The proportion of specimens yielding CPE were:

Ashbridges (86% influent vs 82% effluent), Humber (70% influent vs 80% effluent), Highland

(33% influent vs 17% effluent), and TNT (0% influent vs 11% effluent) (Figure 2.2.1.7).

To understand the difference between the distribution of species among CPE-positive isolates

between influent and effluent trunks, the two sites with the highest numbers of CPE-positive

isolates (Ashbridges Bay and Humber STPs) were compared. The distribution of each species

found from each trunk is shown in Figure 2.2.1.8. There were no significant differences between

the proportions of various species obtained from each trunk of the same site.

Similar analysis looking at the distribution of genotypes between influent and effluent trunks at

Ashbridges and Humber STPs was performed (See Figure 2.2.1.9). The proportion of blaKPC

25

gene between the influent and effluent trunks at both Ashbridges and Humber STP were not

statistically different. The carbapenemases coming into the sewage trunk was similar in

proportion to the carbapenemases leaving the trunk. In Humber STP, the sample size was smaller

and there was no difference in blaNDM, blaOXA-48-like genes between the influent and effluent

trunks.

A summary of all isolates obtained from the STP in this study is shown in Figure 2.2.1.10

2.2.2 E. coli counts

Each water specimen in this study was concurrently tested for E. coli concentration as a standard

water quality indicator. The E. coli concentration (CFU/100mL) was higher among specimens

yielding CPE compared with other specimens (P=0.005).

E. coli counts were compared between influent and effluent sewage specimens. The median E.

coli counts were higher in influent (2,600,000 CFU/100mL) compared to effluent specimens

(123 CFU/100mL) (P<0.0001). The concentration of E. coli was significantly higher in

specimens yielding CPE for both effluent (p=0.04), and influent specimens (p= 0.06) (See figure

2.2.2.1).

The E. coli counts from influent and effluent trunks were compared between the STPs separately.

There was no significant difference between E. coli concentrations in influent specimens coming

from different STPs (P>0.05) and in effluent specimens coming from different STPs (P>0.05).

2.2.3 Meteorological Events

Linear regression analysis comparing temperature (°C) and proportion of specimens yielding

CPE isolates by date showed that there was no significant relationship between the two variables

(R2= 0.1, see Table 2.2.3).

Three out of 10 days from which sewage specimens were taken had >0mm total precipitation on

the day prior to sewage collection (Table 2.2.3). Due to the small sample size, dates with >0mm

26

total precipitation were grouped into ‘wet’ events while dates with 0mm total precipitation were

grouped into ‘dry’ events. 17/27 (63%) of specimens were positive for CPE on days after rain

events, compared to 40/76 (53%) specimens positive for CPE after dry days (P=0.38).

2.2.4 Surface Water

18 surface water specimens were taken from 7 locations in the same watershed on 3 different

dates between July 2015 and August 2015 (See Table 2.2.4.1). The 18 specimens include: 15

from the Humber river (Albion (n=3), Clarence (n=3), Jane (n=3), Old Mill (n=3), Pine Grove

(n=3)), 1 beach (SSI-C (n=1)), and 1 stormwater (Riverside (n=2)). Eight unique CPE isolates

were identified from 2 (11%) samples.

Six different species were present: E. gergoviae (n=2), Raoultella spp. (2), C. koseri (1), E.

cloacae (1), C. freundii (1), and K. oxytoca (1). All isolates contained blaKPC except one E.

cloacae isolate which contained blaVIM.

CPE were identified from two sites on two separate sampling dates: Old Mill (on July 20, 2015)

and Albion (on Aug 4, 2015) (See Table 2.2.4.2). There was no significant difference in E. coli

concentrations in surface water between CPE positive (median=880 +/-310 CFU/mL) and

negative (median=370, range 61-191000 CFU/mL) specimens (P=0.45, Wilcoxon Rank Sum

test).

2.2.5 Comparison of Carbapenemase Detection Methods

We assessed three different methods for the detection of carbapenemase genes in water. The

methods are summarized below and in Figure 2.2.5.1.

Culture method: 10ul and 100μLof influent sewage and 10ml 100mL of effluent sewage were

filtered using an 0.45μm filter (See Section 2.1.4). The filters were then placed on MacConkey-

3-agar containing 0.125μg/mL meropenem and 12mg/L cefsulodin, and incubated overnight at

37°C. Single colonies were screened to identify CPE (see section 2.1.4).

27

Filter sweep PCR method: 100μL of influent sewage and 100mL of effluent sewage filtered

using an 0.45μm filter; filter placed on MacConkey-3-agar containing 0.125μg/mL meropenem

and 12mg/L cefsulodin, and incubated overnight at 37°C. A cotton swab used to collect all

isolates growing on the filter and NucliSENS EasyMag used to extract DNA from this swab;

carbapenemase genes were detected by RT-PCR (see Sections 2.1.9.2 and 2.1.12).

Raw sewage PCR method: 50mL of influent sewage and 100mL of effluent sewage were

filtered using an 0.45μm filter; DNA was extracted directly from the filter using Powersoil DNA

isolation kit, and carbapenemase genes detected by RT-PCR (see Sections 2.1.9.3 and 2.1.12).

2.2.5.1 Specimen Selection and Results

All sewage specimens collected before February 18th, 2016 which yielded CPE by culture (n=51)

were included in this study. 21 specimens from which CPE was not identified and which were

collected before February 18th, 2016 were randomly selected using a random number generator

[156].

Among the 72 specimens tested using both the culture method and the filter sweep PCR method,

agreement varied from good blaKPC (Kappa=0.76) and blaNDM (Kappa=0.80), to poor for blaOXA-

48-like (Kappa=0.12), blaGES (Kappa=0.04) and blaVIM (Kappa=0.03). As shown in Table 2.2.5.1a,

the carbapenemase positive specimens by the culture method were almost always positive by

filter sweep PCR method; however, for blaGES, blaOXA-48-like, and blaVIM, many specimens were

positive by filter sweep PCR method but negative by culture method.

For blaKPC, 64 specimens matched (both were positive or negative by culture and filter sweep

PCR method), 2 were positive by culture method while negative by filter sweep PCR method,

and 6 were positive by filter sweep PCR method and negative by culture method (Table

2.2.5.1a). For blaNDM, 62 specimens were negative and 7 were positive by both culture and filter

sweep PCR method. One specimen was positive by the culture method and negative by filter

sweep PCR method, while 2 specimens were positive by filter sweep PCR method and negative

by culture method. For blaGES (n=5), blaOXA-48-like (n=3), and blaVIM (n=1), all specimens that

were positive by the culture method were also positive by filter sweep PCR method; however, a

substantial number of specimens were positive by filter sweep PCR method (73.6%, 37.5%, and

47.2% respectively) but negative by culture method.

28

When the filter sweep PCR method was compared with raw sewage PCR method, the raw

sewage PCR method was more likely to be positive for all carbapenemases, except for blaNDM.

blaKPC had 51/72 match, 1 positive by filter sweep PCR but negative by raw sewage PCR

method, and 20 specimens negative by filter sweep PCR method and positive by raw sewage

PCR method. blaGES, blaOXA-48-like, and blaVIM also had similar trends as shown in (Table

2.2.5.1b). blaNDM had 58 matches (2 positive by both filter sweep and raw sewage PCR method,

56 negative by both methods), 7 specimens positive by filter sweep PCR and negative by raw

sewage PCR method, and 7 specimens negative by filter sweep PCR and positive by raw sewage

PCR method.

Compared to the culture method, the raw sewage PCR method was more likely to identify

carbapenemase genes for all genes except blaNDM. (Table 2.2.5.1c). For blaGES, blaOXA-48-like, and

blaVIM, none of the specimens were positive by culture method while negative by the raw sewage

PCR method. blaKPC had 1/72 specimens which was positive by culture method while negative

by the raw sewage PCR method. For blaNDM, 6 specimens were positive by culture method while

negative by the raw sewage PCR method, while 7 other specimens were positive by raw sewage

PCR and negative by culture method.

The proportion of specimens in which carbapenemase genes were detected for each method is

shown in Figure 2.2.5.2. There was no significant difference in the detection of carbapenemases

by the three methods between the influent and effluent trunks.

As a validation of differences between PCR and culture, 8 specimens, positive for blaVIM by

filter sweep PCR method but negative by culture method, were thawed and re-cultured as

described in section 2.1.4. No blaVIM CPE was isolated.

29

Chapter 3 Relationship between Water CPE and Clinical CPE

3

3.1 Methods

3.1.1 Isolates Under Investigation

Select clinical and environmental isolates were compared by PFGE and replicon typing. In this

study, we elected to compare water and clinical isolates of Enterobacter cloacae containing

blaVIM, and Klebsiella oxytoca containing blaKPC and blaGES.

PFGE analysis

The clinical isolates included: 13 blaVIM E. cloacae and 4 blaKPC K. oxytoca, representing all

human isolates of blaVIM E. cloacae and K. oxytoca identified between 2007 and 2015 in

population based surveillance performed by the Toronto Invasive Bacterial Disease Network

(TIBDN). TIBDN performs population-based surveillance in metropolitan Toronto and Peel

Region for selected bacterial and viral infections including CPE by collecting the isolates, as

well as the epidemiological and clinical data to understand risk factors and improve prevention,

diagnosis, and treatment associated with the pathogen of interest [157]. Date and site of isolation,

sex, age, carbapenemase gene, organism ID, hospital/laboratory name, and Public Health

Laboratory numbers of each isolate were collected. Information relating to the clinical isolates in

this study can be found in Table 3.1.2 and Table 3.1.3.

All K. oxytoca collected between June and August 2015 from STP and SW and all blaVIM-

producing E. cloacae water isolates were subjected to PFGE. In addition, 10 blaKPC K. oxytoca

CPE isolates obtained from sewage specimens at the same STPs in 2012 were included for PFGE

comparison with our 2015 CPE isolates.

Replicon Typing

Based on the PFGE patterns of all 2015 and 2012 water isolates, and four clinical Klebsiella

oxytoca, 26 distantly related isolates (defined by <65% similarity by PFGE and <85% similarity

for the KOXY15-A clone (KOXY15-A clone is discussed in section 3.2.2)) were selected for

30

plasmid typing analysis. 26 K. oxytoca: sixteen from 2015 water, six from 2012 water, and all

four clinical isolates, were selected. Of the sixteen K. oxytoca 2015 isolates, one was

carbapenemase negative but meropenem resistant (H2O2015ID-35 negative control) while all

others were blaKPC positive.

3.1.2 Pulse Field Gel Electrophoresis (PFGE)

PFGE is a method which allows the determination of relatedness between two or more organisms

based on their chromosomal DNA.

PFGE was performed according to the Mount Sinai Microbiology Laboratory Manual: Infection

Control Pulse Field Gel Electrophoresis (Policy # MI\IC\PF\v17). The isolates were incubated

overnight in 10mL of BHI broth shaking in 37°C walk-in incubator. The broth was then

transferred to a microtube and centrifuged at 14,000rpm for 1 minute to pellet. The pellet was re-

suspended in 1mL of SE buffer (75mM NaCl, 25mM EDTA, pH 7.5), adjusted to 20%

transmittance suspension using a colorimeter (BioMerieux Inc., Marcy L’Etoile, France), and

vortexed to allow homogenous mixture. 1% Seakem Gold (SKG) agarose in sterile deionized

H2O (SDH2O) was prepared and mixed in a 1:1 volume with the bacterial suspension and

allowed to solidify in plug molds (Bio-Rad) at 4°C. Once solidified, the plugs were immersed in

PK solution for removal of interfering proteins on a dry shaker at 55°C for 3 hours. The plugs

were then washed in individual green cassettes with 50mL of pre-warmed SDH2O 3 times. The

plugs were then submerged (in green cassettes) into Gram-negative wash buffer overnight at

55°C. Once washed, the plugs were transferred to a 6-well storage plate and stored at 4°C until

use.

Half of the plug was digested with Fast Digest (FD) XbaI (Vf=200μL containing 20μL FD

buffer, 5μL FD XbaI (ThermoFisher Scientific), 175μL ddH2O) on a shaking water bath for 3

hours at 37°C. Salmonella branderup H9812 was digested in the same way and used as a DNA

ladder.

200mL of 1% SKG agarose gels were prepared in fresh 0.5xTBE. Once digested, the restricted

plugs and standards were positioned to the edge of the comb and fixed to the comb by placing a

few drops of 1% SKG agarose. The plugs were solidified into the 1% SKG agarose gel and

31

refrigerated at 4°C for 10 minutes. The gel was run on CHEF-DR II instrument (Bio-Rad) at

12°C at 6V/cm, initial time= 5sec; Final time= 35sec, run time=20 hours; angle= 120°. After the

run was completed, the gel was stained in EtBr solution 0.5μg/mL for 30 minutes followed by 2x

30 min washes with de-ionized water. The gel was visualized under UV light and PFGE bands

were analyzed using BioNumerics (version 5.10) software. Strain relatedness was determined

using Dice Coefficient with <75% interpreted as unrelated.

3.1.3 Plasmid Analysis

3.1.3.1 Replicon Type PCR

We screened fror the presence of plasmids from eighteen of the most common incompatibility

groups by PCR-based replicon typing: IncFIC, IncA/C, IncW, IncFIA, IncFIB, IncK/B, IncHI1,

IncN, IncHI2, IncL/M, IncI1, IncX, IncFrep, IncY, IncP, IncB/O, IncT, and IncFIIA. Five

multiplex PCR panels were prepared based on Carattoli et al. (2005) [158] and Johnson et al.

(2007) [159] (See Table 2.1.12). PCR reaction mixtures for multiplexes 1, 2, 4, and 5 were

prepared to Vf=20μL containing 10μL of REDTaq ReadyMix (Sigma), 1μL of each 10mM

primer pair, 1μL of DNA, and water to complete Vf. Multiplex 3 was prepared to Vf=30μL

containing 15μL of REDTaq ReadyMix (Sigma), 1μL of each 10mM primer pair, 1.5μL of

DNA, and water to complete Vf. The amplification cycle was as follows: initial denaturation at

94°C for 5 min; 30 cycles of 94°C for 30 sec, 60°C for 30 sec (50°C for multiplex 4), and 72°C

for 30 sec; and a final elongation step at 72°C for 5 min. The PCR products were run on 1%

agarose gel in 1xTAE buffer containing 1:105 (v:v %) EtBR, at 110V for 30 minutes. GeneRuler

1kb Plus DNA ladder (Fermentas) was used as a size marker. The PCR products were stored at

4°C. Positive and negative controls were included in every run. The gels were visualized using

UV light.

3.1.3.2 Restriction Digest of genomic DNA and Southern Blotting

Cells were imbedded in agarose plugs (Plug Molds, Bio-Rad, ref #1703713) according to

procedures described by Public Health Laboratories SOP-C-PF-040-003. This was done by

creating a cell suspension in 1mL of TE2 pH 8.0 (TE2: 10mL 1M Tris-HCl pH8, 2mL 0.5 EDTA

pH8, diluted to 1L of ddH2O) with a turbidity of 0.6 (Siemens Microscan Turbidity meter). The

32

cell suspension was mixed 1:1 volume with Seakem Gold (Lonza) agarose plug agar recipe

(23.75mL TE2, 0.25g SKG agarose, 1.25mL 20% SDS) and 2.5% Proteinase K (New England

BioLabs Inc). Plugs were made by casting the agarose into plug molds (Bio-Rad) and allowed to

solidify. Once hardened, the plugs were pushed into bijou bottles containing 5μLof Proteinase K

(New England BioLabs Inc) and 1mL of Enteric Lysis Buffer (3.05g Tris, 9.3g EDTA, 5g N-

Lauroylsarcosine sodium salt in water then adjusted to pH8.0 to make Vf=500mL. The bijou

bottle was placed in a 55°C shaking water bath (Thermo Scientific model SWB25) for 2 hours

(speed=45) to allow lysis of cells and digestion of nucleases. The plugs were then put into

individual green cassettes and washed at 50°C (speed=60) first with water for 10 minutes (2

times), then with TE2 buffer for 30 minutes (4 times). After washing, the plugs were stored in

1mL of TE2 buffer in 4°C.

For each run, 1/3 of the plug was digested in 200μL of 1x S1 nuclease solution (20% 5x S1

nuclease Reaction Buffer (Thermo Scientific), 80% nuclease free H2O, 1μL (100 units) of S1

nuclease (ThermoFisher)), in a bijou bottle for 2 hours at 37°C shaking water bath speed of 45.

After 2 hours of incubation, the S1 mixture was removed and 100μL of ice-cold ES stop buffer

(ES=1% sarkosyl in 0.5 EDTA) was added and the bottle placed on ice for 15 min. The ladder,

Salmonella ser Branderup H9812 strain, was digested in 5μL of XbaI restriction enzyme (New

England BioLabs Inc) in 150μL of 0.66% BSA and 10% NEBuffer 4 (New England BioLabs

Inc) for 24 hours at 37°C speed=45. The plugs were placed and secured onto the comb by a few

drops of agarose and solidified into the 1% SKG agarose gel prepared in 150mL of 0.5x TBE

buffer. The gel was run on CHEF Mapper System (Bio-Rad) on multi-block program: Block 1

Angle 53 Initial 5s, Final 25s, 6 hrs; Block 2: Initial 30s, Final 45s, 12hrs at an angle of 60 at

14°C at 6.0 V/cm. Once the run was completed, the gel was stained in EtBr (0.5μg/ml) for 30

minutes and was visualized using UV light.

The gel was depurinated in 0.25M HCl for 15 min, washed 2 times with ddH2O, denatured in

0.5M NaOH for 30 minutes, washed 2 times with ddH2O, then neutralized with 0.5M Tris pH

7.5/1.5M NaCl for 30 minutes.

The DNA was transferred from the gel onto positively charged nylon membrane (Roche) by

vacuum blotting (Bio-Rad model 785 Vacuum Blotter) at 5Hg for 90 minutes. 1μL of positive

controls (PCR products) were placed onto the membrane and DNA was cross-linked to the

33

membrane for 1 minute at maximum intensity using a UV Cross Linker (Fisher Scientific FB-

UVXL-1000). The membrane was stored dry at 4°C until use.

Prehybridization solution containing 6% blocking reagent (Roche Diagnostics), 0.1% sarkosyl,

10% SDS, and 1.25xSSC was added to the membrane in a hybridization bottle and placed in a

rotating hybridization-oven (UVP Laboratory HB1000 Hybridizer) for 6 hours at 65°C. Probes

for KPC, IncFrep, IncN, IncHI2, and IncFIIA were produced using PCR DIG Probe Synthesis

Kit (Roche Diagnostics). The PCR cycle for the probe included: initial denaturation at 95°C for 2

min; 35 cycles of 95°C for 30 sec, 55°C for 30 sec (50°C for IncFrep), and 72°C for 40 sec; and

a final elongation step at 72°C for 7 min. Once the probes were synthesized, they were checked

for size and intensity on a 1% agarose gel as mentioned above. Hybridization of the membrane

was done by adding 12μL of the probe in 6mL of prehybridization solution and placed in the

hybridization-oven overnight at 55°C. Following this, the membrane was washed and blocked

with blocking reagent (Roche Diagnostics) for 30 minutes. Anti-Digoxigenin-AP antibody

(Roche Diagnostics) was added in 1:10000 dilutions with buffer 2 (1.33g Blocking Reagent in

200mL of buffer 1 (5% 2M Tris pH7.5, 3% 5M NaCl, 92% ddH2O)) and allowed to incubate at

room temperature for 30 minutes on slow shake. The membrane was then washed with buffer 1

2x15 minutes and equilibrated in buffer 3 (5% 2M Tris pH9.5, 2% 5M NaCl, 93% ddH2O) for 5

minutes. The membrane was labelled with CDP-star (Roche Diagnostics) solution (1:100

dilution of CDP star solution: Buffer 3) and exposed on Amersham Hyperfilm ECL (GE

Healthcare Life Sciences) for 1, 2, and 5 minutes. The band was considered positive based on

good intensity band; size was determined by comparing the band with the DNA ladder.

34

3.2 Results

3.2.1 blaVIM E. cloacae

PFGE of blaVIM positive E. cloacae water (n=2) and clinical isolates (n=13) were performed to

assess their relationship (See Table 3.1.2 for isolate details). There were three different patterns

by PFGE (Figure 3.2.1).

i) Pattern A: Surface Water #7 (obtained from Humber River, Albion Site (Figure 2.1.2)) is

74.7% related (Dice coefficient) to 6 clinical isolates coming from 4 patients. These

isolates were collected in 2011 and 2012, and were identified at 3 different hospitals.

ii) Pattern B: H2O2015ID-122 is related to 6 other clinical isolates coming from 4 different

patients. The clinical isolates were all linked to Hospital D and were collected between

2014 and 2015. Patient #5 was positive on admission to Hospital F in late Feb 2014, and

had been at hospital D in early Feb 2014.

iii) Pattern C: Patient #9 was unrelated to the two clusters and was positive for both blaOXA-1

and blaVIM. This patient had a travel and hospitalization history in Split, Croatia during a

time when Split was experiencing a blaVIM-outbreak [160].

3.2.2 blaKPC K. oxytoca

For clarity, the PFGE results are shown only for unique CPE isolates. The K. oxytoca PFGE

analysis included: 27 isolates from STP between June to August 2015, ten 2012 sewage isolates,

and four clinical isolates (See Table 3.1.3). The PFGE data showed that the clinical isolates were

unrelated to each other and were also unrelated to the water isolates (See Figure 3.2.2.1).

Furthermore, no clonal relationships were observed between: 2015 H2O CPEs from different

STPs, CPEs within Humber STP in 2015 alone, and between CPEs collected in 2012 and 2015.

Within the K. oxytoca isolates from Ashbridges Bay STP however, 9/21 isolates were related by

>76.8% similarity and these isolates were grouped as KOXY15-A (highlighted in blue in Figure

3.2.2.1). These isolates within this clone came from both influent and effluent trunks and were

obtained from three different sampling dates.

35

Five blaGES harboring K. oxytocas (three from 2012 and two from 2015) were compared (Figure

3.2.2.2). There appeared to be no relationship between the 2012 and 2015 K. oxytoca isolates

tested in this study. However, within the 2012 isolates, two isolates (H2O2012-#7 and #8) which

were obtained on two different dates and from different trunks at Ashbridges Bay STP were

97.3% similar to each other. There also appeared to be a clonal relationship between blaKPC K.

oxytoca isolates obtained from 2012 (Figure 3.2.2.3). H2O2012-#3 and #10 came from different

sewage trunks (influent vs effluent) and were identical. Finally, H2O2012-#2 and #9 which were

isolated from specimens from two different STPs (#2 from Ashbridges Bay and #9 from TNT)

and carried different carbapenemase genes (blaKPC and blaGES, respectively), were similar.

3.2.3 Plasmid Replicon Type Determination of blaKPC K. oxytoca Isolates

The comparison of clinical and water blaKPC K. oxytoca using PFGE concluded that these

isolates appeared to be clonally unrelated. Therefore, plasmid analysis was performed to assess

the possibility of a relationship between the two groups by plasmid dissemination.

3.2.3.1 Replicon Type Results

3 of 4 clinical isolates obtained in 2015 (ClinKoxyKPC-#1, ClinKoxyKPC-#3, and

ClinKoxyKPC-#4) harbored the blaKPC on IncFIIA while the 2012 (ClinKoxyKPC-#2) clinical

isolate harbored the blaKPC gene on IncN. The size of the clinical isolate plasmids were:

ClinKoxyKPC-#1=78kB, ClinKoxyKPC-#2=55kB, ClinKoxyKPC-#3=60kB, and

ClinKoxyKPC-#4=55kB.

All 22 water isolates were probed for the blaKPC gene, IncFIIA, and IncN replicon types. The

signals on bands were matched for similarity based on the size of the band and replicon type

(Table 3.2.4.2). Of the 22 water isolates, 18 gave a signal, for IncN alone (n=4), IncFIIA alone

(n=8), or both replicon types (n=6). 4 isolates were negative for both IncN and IncFIIA

incompatibility groups. Of the 18 isolates that were positive for at least one replicon type, 1 was

the negative control, 13 harbored the blaKPC gene on these plasmids, and the other 4 did not

harbor the blaKPC gene on their respective IncN or IncFIIA based on the band size.

36

Within the 13 water isolates that harbored the blaKPC on the replicon types of interest, 5/13 had

the blaKPC gene on both IncN and IncFIIA replicon types. 3/13 harbored the blaKPC gene on IncN

(blaKPC/IncN), while 5/13 harbored the gene on IncFIIA (blaKPC/IncFIIA). Isolates within the

KOXY15-A cluster all harbored the blaKPC gene on a ~70kB IncN plasmid. The plasmid size for

water IncN ranged from 70kB to 175kB and did not resemble the clinical ClinKoxyKPC-#2

55kB band; hence, ClinKoxyKPC-#2 appears to be unrelated by plasmid dissemination to the

water isolates tested.

The band sizes of 10 IncFIIA positive isolates ranged from 70 to 175kB. Four of the 10 IncFIIA

positive isolates contained the blaKPC gene corresponding to a band size of ~104kB. Two isolates

(H2O2015-ID#26 and H2O2015-ID#138) had blaKPC/IncFIIA band size of 78kB corresponding

to clinical isolate ClinKoxyKPC-#1. The other clinical cases ClinKoxyKPC-#3 and

ClinKoxyKPC-#4 resembled a 2012 isolate (H2O2012-#3 ~55kB) and their plasmids may be

related to each other.

37

Chapter 4 Discussion

4

4.1 CPE isolation from STPs The spread of carbapenemases in clinically relevant organisms is a global health threat, as

carbapenems are important antibiotics of last resort. The main purpose of this investigation was

to determine the prevalence of CPE in surface water and raw and treated sewage in the GTA.

The secondary aim was to determine the relationship between environmental CPE and clinical

CPE isolates in Toronto.

The frequency at which we detected CPE from the STPs was alarming; 172 distinct CPEs were

identified between June 2015 and February 2016 from five sewage treatment plants in 103

specimens across the GTA, and eight unique CPEs were found from only 18 surface water

specimens.

The five STPs differed in the proportion of specimens yielding CPE and in the gene and species

distribution of CPE. Specimens obtained from the Ashbridges Bay STP, the largest STP in this

investigation, were significantly more likely to yield CPE than specimens obtained from TNT,

Highland Creek, and Lakeview (Peel) STPs. A possible explanation for this difference may lie in

the number of hospitals each STP serves. Hospital effluents have been seen to release high levels

of CPE in their effluent water [135, 161-166]. Based on the location of hospital and the area each

STP serves, Ashbridges Bay STP serves approximately 15–19 hospitals (teaching, and general).

In contrast, Humber (n~2), Highland Creek (n~3), TNT (n~1), and Peel (n~4) process fewer

hospital effluents. This may explain the higher proportion of CPE positive specimens found at

Ashbridges Bay; however, to provide a conclusive causal link, the presence of CPE in hospital

effluent water will need to be assessed and correlated with CPE data from sewage.

The population from which the STP receives its influent water, as well as the weather at those

specific locations may affect CPE survival in those sewage treatment plants. Edge et al. (2013),

investigating waterborne-pathogen events at three drinking water treatment plants with similar

treatment processes, concluded that the waterborne-pathogens differed between the three sites

38

due to influences from river runoff or STP effluent outfalls affecting source water [148].

Similarly, the source of sewage at a STP may present different influences in the prevalence of

CPE. The likelihood of detecting CPE from a STP would be higher from a STP serving a larger

population. Ashbridges STP treats water coming from a human population of 1,524,000

compared to 800,000 at Peel, 651,000 at Humber, 450,000 at Highland, and 55,000 at TNT. In

our results, the prevalence of CPEs was highest in Ashbridges STP, which serves the largest

population.

Another source of sewage influencing CPE prevalence may be wildlife and domesticated

animals. CPE have been isolated from fecal samples of companion dogs and cats [145, 146], as

well as livestock pigs [167, 168]. Based on a survey conducted in 2008, there were 8,510,021

cats and 6,070,783 dogs in 13, 576, 855 households in Canada [169]. Limited pet census data

restricts our understanding of the number of animals being served by the individual STPs.

However, inferring based on the number of households in Toronto (1,047,880) versus Peel

(402,935) [170, 171], we can conclude that contribution of animal feces to the STPs studied may

influence CPE presence in each STP differently.

The most prevalent species identified from our study was K. oxytoca (32% of 172 unique

isolates). As the name KPC (Klebsiella pneumoniae carbapenemase) suggests, K. pneumoniae is

usually the most common host of the blaKPC gene. Therefore, it was interesting to find that blaKPC

harboring Klebsiella oxytoca (32%) was the most common CPE identified in Toronto’s sewage

system (K. pneumoniae was half as common at 16%). The predominance of this carbapenemase-

harbouring species may be specific to Toronto’s STPs as it was not seen in other studies. Koh et

al. (2015) found carbapenemase producing Enterobacter and Aeromonas spp. to be the most

prevalent species in their hospital effluent sewage in Singapore [163]. C. freundii and E. cloacae

were the only two CPE found in the hospital sewage in Chengdu, China [172] and in India, E.

coli and K. pneumoniae were the most common Enterobacteriaceae isolated from sewage

seepage [61]. A study looking for CPE in U.S. Rivers found Enterobacter species to be the most

predominant type [173]. Podschun et al. (2001) [174] and Bagley (1985) [175] investigated the

incidence of Klebsiella species in surface waters of Germany and sewage, drinking water, and

surface waters in the U.S. respectively. They found that K. pneumoniae was more common than

K. oxytoca in the areas they tested. Therefore, the success of K. oxytoca CPE in Toronto’s

sewage environment may be specific to the GTA. A possible reason for the abundance of K.

39

oxytoca may be the successful colonization of the sewage system by particular K. oxytoca

strains. In this study, a single clone of K. oxytoca predominated; it is possible that this clone is

particularly successful in colonizing in biofilms in sewage. Lowe et al. (2012) reported a Toronto

hospital outbreak of an ESBL producing K. oxytoca sustained by persistence in sink drain

biofilm [176], supporting the hypothesis that K. oxytoca strains in Toronto may have an affinity

for water or biofilm.

Amongst the six carbapenemase genes tested in our culture study, blaKPC was the most common

(88.4%). The easy identification of organisms that frequently harbor blaKPC and the early

introduction of blaKPC in Toronto may explain this abundance. One limitation to this study was

human bias in the organism selection from the filter. blaKPC is commonly associated with

Klebsiella spp [177, 178], which have a distinct mucoid lactose fermenting phenotype making

them easily identifiable as an Enterobacteriaceae. This easy recognition of Klebsiella spp. might

have favored the isolation of these organisms and subsequently, the genes commonly associated

with them. Additionally, the history of carbapenemases in Canada may play a role in the

abundance of blaKPC in the STPs. Between 2008 and 2011, more blaKPC clinical infections were

reported to CPHLN than any other carbapenemase gene. Reports by Public Health Ontario also

showed that blaKPC was the first carbapenemase gene to be introduced in Ontario (Apr 2008).

The early introduction may have increased exposure of the STPs to this gene, resulting in their

more common identification.

Aquatic ecosystems may be an important reservoir of CPE. We identified eight unique CPE

isolates from two of eleven surface water specimens. A recent study identified blaGES, blaKPC,

blaNDM, blaOXA-48-like, and blaVIM, genes in the surface water of a northern Manitoba First Nation

Community in Canada [179]. Various carbapenemase genes in the environment may be much

more widespread than previously anticipated. Surface water may act as a reservoir by harboring

carbapenemase genes in uncommon human pathogenic species such as Aeromonas, and

Raoultella spp. Poirel et al. and Potron et al. postulated that these organisms may act as

intermediate carbapenemase reservoirs for more clinically relevant Enterobacteriaceae [113,

117]. These intermediate carbapenemase reservoirs may be widespread in both sewage and

surface waters.

40

Many studies have isolated CPEs from rivers and lakes [61, 117, 173, 180-183]. The authors of

these studies suggested that water sampling may be as clinically important in understanding CPE

epidemiology as human sampling. This idea is further supported by studies conducted by Potron

et al. and Walsh et al. where they found the same carbapenemase genes from their water sources

as were seen in their clinical settings (blaOXA-48-like in Morocco [117] and blaNDM-1 in India [61]).

In our study, the blaVIM containing E. cloacae isolate identified from surface water was related

by PFGE to clinical isolates of blaVIM containing E. cloacae. Thus, surface water may be an

important CPE reservoir. More study is needed to understand the role of surface water in CPE

dissemination.

Another relationship requiring further investigation is the link between carbapenemase genotypes

and exposure to persons colonized with CPE in the community. Although not statistically

significant, there was a high proportion of blaNDM containing organisms from Humber and Peel

STPs which serve the west end of Toronto and Peel region. These are areas of the GTA with a

high population of recent South Asian immigrants, and likely more frequent travel to and from

blaNDM-1 endemic countries. More sampling and correlation between neighbourhoods and CPE

from STPs serving those neighbourhoods will be required.

4.1.1 Comparison of CPE from Influent vs Effluent Trunks

To understand the effect of the treatment process on CPE persistence, CPE isolates coming from

influent and effluent water were compared. When influent and effluent trunks were compared

within each sewage treatment plant, only Peel STP showed a significant difference in the

proportion of specimens yielding CPE between the two trunks. In Peel STP, all CPE isolates

were isolated from the influent trunk.

To assess the possible causes for the difference between the STPs, the sewage treatment

processes between Peel and Ashbridges Bay STP were compared and found to be similar,

involving the same chemicals and procedures [134, 184]. Furthermore, the E. coli counts

between Peel and other STPs were not significantly different when the trunks were compared

separately. Therefore, the sewage treatment process was unlikely to be the cause of the

differences seen between influent and effluent trunks at Peel STP. One potential difference might

41

be that the composition of biofilms vary between STPs. Bacterial biofilms are universally present

in sewage systems and industrial aquatic systems [185-188]. Different biofilm composition in

different plants, or different duration of exposure to CPE might explain the differences. Studies

involving biofilm presence at Ashbridges Bay and Peel STP, as well as longitudinal studies

following biofilm changes at STPs may further our knowledge around CPE survival in and

dissemination from STPs.

We also identified the same K. oxytoca clones surviving the sewage treatment process. Isolates

H2O2012-3 and H2O2012-10 (blaKPC K. oxytoca) were isolated from the influent and effluent

trunks of Ashbridges STP in 2012 and isolates H2O2015ID-7 and H2O2015ID-165 (along with

many other pairs) were isolated from influent and effluent trunks of Ashbridges STP in 2015.

The blaKPC harboring K. oxytoca clone KOXY15-A was also found in two different influent

trunks of Ashbridges STP and isolated from their effluent water on three different dates. The

ability for these CPE to survive the treatment process may be attributed to its growth on biofilms.

However, some reports have suggested that the sewage treatment process itself increases

bacterial tolerance to harsh chemicals and that STPs may act as ‘hotspots’ for resistant bacteria

and genetic exchange [127, 189-192].

The presence of β-lactam antibiotics in the sewage may play a role in the selection of resistant

organisms in the treatment process. Bengtsson-Palme et al. set out to understand whether

presence of antibiotics and co-selective agents in the STPs in Sweden could increase resistance

genes [193]. They found that two antibiotics, ciprofloxacin and tetracycline, which were in high

enough concentrations to select for resistance, did not directly select for resistance genes in the

STPs. Further, Watkinson et al. found that higher levels of β-lactams were present in the hospital

effluent and sewage influent waters compared to 8 other classes of antibiotics. However, β-

lactams were not concerning as the highly reactive β-lactam rings, caused by ring strain and less

resonance stabilization, made them readily degraded by hydrolytic cleavage [194], and was

below detection limits in effluent water [195]. Hence, factors outside of selection by antibiotics

for CPE may be present in the sewage treatment process.

One stage of the secondary treatment process involves aeration of the water to allow

microorganisms to break down organic matter and reduce the level of nutrients before the water

is released into the environment. Bengtsson-Palme et al.found that the abundance of blaOXA-48

42

genes increased ~10.8 fold in waste activated sludge (post-aeration tank) compared to primary

sludge (pre-aeration tank) [193]. Luo et al. also found increases in blaNDM-1 genes in waste

activated sludge compared to primary sludge in STPs in China [196]. Therefore, it may be

possible that this aeration step allows enrichment of our organism of interest in the sewage

system. This may help increase the chances of CPE survival in the final treatment step where

chlorine is used to kill more than 99% of harmful bacteria [197]. The probability of CPE

escaping the final treatment step would be higher if concentrations of CPE were enriched

through aeration during the sewage treatment process.

Finally, one study has proposed that the chlorine treatment itself may selectively facilitate

growth of organisms with resistance genes [198]. They hypothesized that a chlorine-induced

efflux pump expression may help resistant bacteria survive assault by antibiotics present in the

environment better than those without resistance genes [198]. As mentioned earlier, the level of

β-lactams in the effluent sewage was low [195]; however, if this hypothesis is true, it may help

explain the selection of CPE which usually harbor multiple resistance genes [15].

We saw no differences in the proportion of CPE between influent and effluent sewage in 4 of 5

STPs. Elucidating the possible selective factors in the sewage treatment process will be

necessary to understand CPE in the environment.

4.1.2 Other Factors contributing to CPE Presence in Water

We also analyzed other factors contributing to the CPE yield in the water environment including

E. coli concentration, temperature, and precipitation. E. coli count was a good predictor of CPE

presence in the sewage. Higher E. coli counts correlated with a larger proportion of specimens

yielding CPE positives in both influent and effluent samples separately. Since E. coli

concentration is indicative of the fecal pollution load present in water, there would be a greater

likelihood of finding our organism of interest in a specimen with high bacterial concentration

than in a specimen with small amount of DNA.

Changes in temperature and precipitation were not found to be significantly associated with CPE

yield in this study; however, other studies have shown that climate change impacts the quality of

drinking water and the sewage treatment process [199, 200]. Climate change is a major concern

43

around the world and is likely to affect bacterial growth in the Canadian environment [138]. A

U.S. study by Curriero et al. (2001) found that, between 1948 and 1994, >50% of waterborne

disease outbreaks followed large rainfall events [200]. Similarly, Auld et al. (2001) reported that

excess rainfall was one of the contributing factors leading to the Walkerton outbreak [201].

Payment et al. (2000) also correlated STP water temperature with the risk of Giardia parasite

infections in a community [202]. Temperature and precipitation play a role in bacterial survival

and success [140, 203, 204]. In this study, there were only ten sampling dates and three rain

events so the statistical power to make comparisons was low. Further studies on contamination

of surface water following rain events are necessary, especially since the combined sewer system

in the GTA increases the risk of human exposure to contaminated surface waters.

From this study, we can conclude that high E. coli count may help predict CPE presence in

sewage. Thus, laboratories interested in isolating CPE from their water sources can perform a

preliminary E. coli count on their water specimens to increase their chances of isolating CPE.

Further investigation of CPE success determined by climate factors can also help establish the

conditions for high CPE yield in STP and SW specimens for future studies.

4.2 Methods of Isolation In this study, it was hypothesized that specimens yielding carbapenemases would be better

detected by PCR methods compared to culture. Indeed, a higher proportion of specimens were

positive for blaKPC, blaGES, blaOXA-48-like, and blaVIM genes by the raw sewage PCR method than

by the filter sweep PCR method. There were also more positives detected by the filter sweep

PCR method than detected by the culture method (KPC, GES, OXA-48-like, VIM positives:

detection by raw sewage PCR method > filter sweep PCR method > culture method). The

majority of specimens in disagreement were positive by filter sweep PCR method positive and

negative by culture method, and positive by raw sewage PCR method and negative by the culture

method. Thus, many organisms producing blaKPC, blaGES, blaOXA-48-like, and blaVIM

carbapenemases were not detected by our culture method, which underestimated the reservoir of

carbapenemases in water. Studies comparing CPE and carbapenemase detection methods from

rectal swabs also concluded that nucleic acid amplification techniques (NAAT), including RT-

PCR and hybridization assays, were superior to culture-based methods in terms of sensitivity,

44

specificity, and faster turn-around time [205-207]. This is because culture methods require higher

CFU/mL of CPE than direct PCR methods for detection [205].

The higher number of specimens yielding positive results by the raw sewage and filter sweep

PCR method compared to culture method may also be due to the detection of non-

Enterobacteriaceae CPOs (eg. Pseudomonas spp. positive for blaVIM [208], Aeromonas spp.

positive for blaVIM [209], and Acinetobacter spp. positive for blaKPC [210], blaNDM [211], or

blaVIM [212]). RT-PCR of raw sewage PCR method and filter sweep PCR method is important to

understand the overall picture of carbapenemase contamination in the water sources; but our

organisms of interest, the Enterobacteriaceae family, may not harbor them.

It is also important to note that the primers used for blaGES RT-PCR were not specific to

carbapenemase GES types (GES-2, GES-4, GES-5, GES-6, GES-13, and GES-20). The

detection of other non-carbapenemase GES types by these primers explains the large discrepancy

seen by our 66/72 specimens which were positive by raw sewage PCR but negative by culture

method; and by 53/72 specimens which were positive for blaGES by filter sweep PCR but

negative by culture. Given this, the results for blaGES were inconclusive and we cannot predict

whether the culture method underestimates the presence of blaGES carbapenemases in the water

specimens.

In contrast to the other four genes where the raw sewage PCR method yielded the highest

proportion of positives, the blaNDM results were different; approximately the same number of

positive specimens were identified from culture and filter sweep PCR method and from raw

sewage PCR method. Only 8 specimens were positive by culture and, of those 8, filter sweep

PCR captured more blaNDM genes than raw sewage PCR (7 vs 2). Both culture and filter sweep

PCR method involved growth on the same media (MacConkey #3 with 0.125mg/mL meropenem

and 12mg/L cefsulodin agar) and the results had ‘very good’ agreement as to the presence of

carbapenemases while raw sewage PCR and culture had ‘poor’ agreement.

Similar number of blaNDM positive specimens in culture vs NAAT may suggest the need for

increasing blaNDM copy numbers via an enrichment step to meet the limit of detection for the RT-

PCR assay. In our data, all of the blaNDM positives from raw sewage PCR method had Ct values

>35, indicating low levels of the target nucleic acid [213]. Lower copy numbers of blaNDM

45

amidst the mix of other DNA may not be detected without enrichment via culturing on selective

media.

Different selective agars have different sensitivities and specificities for each CPE class so the

choice of agar is very important for enrichment of specific CPEs and their carbapenemase genes

[129, 136-141]. Viau et al. showed that some commercially available CPE isolation media were

more sensitive to Class A carbapenemases (eg. Supercarba agar), while others were more

sensitive to Class D carbapenemases (eg. chromID OXA-48) [128]. Good selective agars can

optimize detection by decreasing competition and increasing the copy number of organisms of

interest [128].

Our media contained crystal violet which inhibited the growth of Gram-positive bacteria, a low

level of meropenem which decreased the amount of carbapenemase susceptible organisms

including ESBLs, and 12 mg/L cefsulodin which selectively inhibited P. aeruginosa. These

selective factors allowed enrichment of CPE, including those carrying the blaNDM gene,

increasing copy number, and allowing detection by the filter sweep PCR but not by raw sewage

PCR method.

The blaNDM gene is also most commonly harbored by Enterobacteriaceae, and rarely found in P.

aeruginosa [214]. Other MBLs such as blaIMP and blaVIM, as well as Class A blaKPC and blaGES

are frequently carried by P. aeruginosa [41, 81, 215]. Since P. aeruginosa carrying blaKPC and

blaVIM was selectively excluded from culture, this would have decreased the number of

specimens positive for these genes from raw sewage PCR to culture. Conversely, inhibition of P.

aeruginosa may have led to increased detection of blaNDM-positive specimens in culture due to

lower bacterial burden, possibly explaining the similarities between blaNDM detected by culture

and by raw sewage PCR.

The amount of sewage filtered also differed between the three methods. For influent specimens,

100μL of sewage was filtered for culture and filter sweep PCR while 50mL of sewage was

filtered for raw sewage PCR method (see Figure 2.2.5.1). In contrast, 100mL of effluent sewage

was filtered for all three methods.

To understand the effect of volume differences for influent between the three methods for

influent specimens, we compared carbapenemase detection results between influent and effluent

46

specimens separately (Figure 2.2.5.2). The proportion of specimens positive for carbapenemase

detection was comparable between influent and effluent specimens for the three methods and for

all genes. This suggests that the volume of sewage filtered does not affect detection of genes or

CPE; however, other factors must also be considered. For example, growth on media can

increase bacterial concentration to levels that are comparable to the bacterial concentrations in a

high volume of sewage. The final concentrations of DNA extracted from filter sweep and raw

sewage will affect the amount of DNA available for carbapenemase detection. If the DNA

concentrations extracted from filter sweep and raw sewage were similar, it may further explain

the similar proportions of blaNDM detection from filter sweep and raw sewage PCR methods.

However, as blaNDM positives for filter sweep PCR and raw sewage PCR method were in

different specimens, other determining factors such as growth on selective agar, presence of

other organisms, and differences in sensitivity of each method, may help explain why the volume

of sewage filtered did not affect results.

Investigators differ in the selection of an acceptable upper limit for the cycle threshold in PCR

reactions. Since carbapenemase genes may be present in low copy numbers in water, we used a

38Ct cycle threshold cut-off in our primary analysis. When the data were re-analyzed with a

30Ct threshold, the number of raw DNA and filter sweep DNA PCR negative specimens for both

culture positive and negative specimens increased. As a result, the level of agreement did not

change significantly for the six carbapenemases.

4.3 Comparison of Water and Clinical CPE The consequences of CPE in the water environment remain unknown. In addition to person-to-

person transmission, there is evidence that inanimate objects such as duodenoscopes [216],

mattresses [217], and environmental sources such as sink drains [176, 218-220] can act as

reservoirs for CPE. CPE can also persist over long periods, especially in hospital settings [218-

223]. Clonal links between CPE isolated from hospital environmental sources and patients have

been reported. Our results showed a clonal link between human infection and water isolates for

blaVIM E. cloacae CPE as demonstrated by PFGE.

47

Clone A comprised of one surface water isolate (obtained in 2015) and four clinical isolates

(obtained in 2011 and 2012) from three different hospitals within the western region of the GTA.

There may have been a transmission event for two of the four clinical isolates from the same

hospital, but no common link between these and the other two isolates was apparent based on our

limited clinical data. Furthermore, there was no geographical or temporal link between the

clinical and surface water isolate. Clone B consisted of one sewage isolate and four patients from

Hospital D. These four clinical cases were linked to a single room in which the shower drain was

culture positive for the same CPE clone. However, the origin of isolates for both clones A and B

remain unknown. It is possible that an unidentified index patient travelled to a blaVIM-endemic

country and introduced this CPE clone to Toronto. It is also possible that undetected blaVIM

producing P. aeruginosa are an on-going reservoir. Pattern C was introduced from a patient with

a travel history to Croatia around the time when an outbreak was in progress there [160].

Currently, the patients with blaVIM clones A and B are believed to have acquired their CPE from

the environment as they did not report travel history outside of Canada and had only received

healthcare treatment in Canada. Similar reports of autochthonous blaVIM acquisition have been

reported for the blaVIM-4 subtype in Kuwait [224] and within the Arabian Peninsula [225].

Further studies are needed to identify the source of autochthonous blaVIM acquisition.

In contrast to the blaVIM E. cloacae, blaKPC K. oxytoca from the sewage were not clonally related

by PFGE to the clinical isolates. As plasmids play a vital role in carbapenemase gene transfer

and subsequent dissemination between bacteria [226], the K. oxytoca plasmids harboring the

blaKPC gene were investigated. Bacterial plasmids are classified based on their incompatibility

groups (also referred to as replicon type). Plasmids within the same incompatibility group share

one or more plasmid replication elements which destabilizes the plasmids during conjugation.

Thus, plasmids with the same incompatibility group cannot be passed stably down a cell line

[226, 227]. Certain incompatibility groups are more successful in disseminating resistance genes

than others. The blaKPC gene has been found to be carried on plasmids of various incompatibility

groups including: IncFII, FIA, I2, A/C, N, X, R, P, U, W, L/M and ColE [27, 228-235].

However, Canadian studies have found that certain incompatibility groups are more commonly

associated with clinical blaKPC cases. Tijet et al. (2014) performed molecular characterization of

blaKPC harboring Enterobacteriaceae collected between 2008 and 2011 in Toronto and found

48

these genes resided on incompatibility groups IncFIIA, N, I2, Frep and A/C [151]. Haraoui et al.

(2013) found IncN, P&L/M, and N&A/C harboring blaKPC plasmids during a Montreal outbreak

[236]. The four K. oxytoca clinical isolates in our study harbored plasmids of IncFIIA and IncN

incompatibility groups which had been the most common replicon types found by both Toronto

and Montreal studies. Sewage blaKPC K. oxytoca harbored either none, one (FIIA or N), or both

(FIIA&N) of these incompatibility groups. However, amongst those with plasmids of one or both

incompatibility groups, four did not harbor the blaKPC gene. blaKPC genes can be harbored on

different incompatibility groups. Copies of this gene can also be present in different

incompatibility groups as evidenced by detection of five isolates that were positive for blaKPC in

both IncN and IncFIIA. The presence of blaKPC genes on different incompatibility groups, and its

common association with the highly promiscuous Tn4401 transposon, is one of the many reasons

why blaKPC genes are a cause for worry. Multiple transposition events have allowed this gene to

be detected in various incompatibility groups [237]. These transposition events, along with

recombination events across different species, introduce opportunities for genetic variation and

may be the reason for its successful mobilization in Enterobacteriaceae [238].

In the present study, clinical K.oxytoca blaKPC isolate #2 (referred to as ClinKoxyKPC-#2,

isolated in 2012), was the only clinical isolate to harbor the blaKPC gene on a 55kb IncN plasmid.

The blaKPC/IncN water isolates had a higher molecular weight plasmid (>70kb) than the clinical

isolate ClinKoxyKPC-#2. However, Tijet et al. (2014) found blaKPC/IncN plasmids in K.

pneumoniae clinical isolates with sizes ranging between 50 to 70 kb, which is comparable to the

70kb water isolates in this study [151].

Clinical K.oxytoca blaKPC isolates (ClinKoxyKPC-#1, #3, and #4) harbored blaKPC/IncFIIA

plasmids that appeared by molecular weight analysis to be unrelated to eight water K. oxytoca

isolates containing blaKPC/IncFIIA plasmids of sizes 70kb, and 100 to 175kb. Similar to

blaKPC/IncN results, Tijet et al. (2014) found blaKPC/IncFIIA plasmid sizes between 80 to 190kb

in K. pneumoniae clinical CPE, which are comparable to the water isolates carrying

blaKPC/IncFIIA plasmid. Thus, clinical and water isolates of other species (i.e. K. pneumoniae, C.

freundii, E. coli, E. cloacae, K. intermedia, and Raoultella spp), may harbor plasmids that are

comparable to those in this study. Indeed, reports of blaKPC plasmid transfer between different

Gram-negative species have been documented [22, 239]. Comprehensive investigation to fully

49

elucidate plasmid dissemination patterns will require detection of IncFIIA and IncN plasmid

types in other species harboring blaKPC from water and clinical isolates.

There appeared to be two different relationships between K. oxytoca blaKPC clinical and water

isolates based on IncFIIA incompatibility group and size. ClinKoxyKPC-#3, ClinKoxyKPC-#4,

and H2O2012-#3 shared a ~55-60 kB band size while ClinKoxyKPC-#1, H2O2015-#26, and

#138 had ~78kB band size. These findings suggest horizontal transfer of carbapenemase genes

between K. oxytocas with unrelated PFGE patterns, as previously seen in E. coli [240] and K.

pneumoniae [241]. However, S1 nuclease PFGE and southern blotting only interprets the size

and incompatibility group; hence, without determining plasmid sequences, these relationships

cannot be confirmed. Future phenotypic tests could include digesting the various plasmids with

multiple restriction endonucleases, such as BglII, SmaI, and EcoRV, and comparing their plasmid

restriction patterns or transforming the plasmid into susceptible E. coli and performing antibiotic

susceptibility tests to confirm the relatedness of the plasmids. Genotypic tests should include

typing the blaKPC to confirm that both groups carry the same gene variant or sequencing the

plasmid as this will immediately elucidate type and plasmid relationship.

Although the results from plasmid analysis between clinical and water blaKPC K. oxytoca are

inconclusive, these results open up possibilities for future studies. The epidemiology and

prevalence of incompatibility groups in the water remains unknown. K. oxytocas in the sewage

system may act as a blaKPC reservoir for other clinically relevant organisms such as K.

pneumoniae. Also, the success of blaKPC in sewage may be attributed to promiscuous transposon

such as Tn4401 disseminating between various plasmids of completely unrelated incompatibility

groups. Elucidating the persistent presence of a sewage reservoir by a successful carbapenemase

carrying plasmid, transposon, or by persistent epidemic clones will be important in the

understanding of continued presence of CPE in the STP.

The clonal and plasmid relationship between clinical and water CPE is worrying. These findings

may call for investigation into the risk factors in working with contaminated environments such

as sewage or living close to contaminated habitats. Korzeniewska et al. found 3 to 458 CFU/m3

of Enterobacteriaceae in the air coming from sewage and surface water [242], as well as

aerosolized antibiotic resistant E. coli from hospital and municipal sewage [136]. Our findings

50

highlight the potential risk for underdeveloped regions such as Kinshasa, Congo [243] and First

Nations communities in Canada [179], where contaminated surface waters may be used for

drinking and cleaning purposes. Now that the presence of CPE and a link between environmental

and clinical infections have been found, we must understand if transmission can occur, how it

will occur, and what steps will need to be implemented to prevent further dissemination. Early

environmental CPE screening was a necessary step to interrupt CPE spread.

4.4 Limitations

As mentioned before, the use of the breakpoint of 38 Ct in our analysis of RT-PCR data may

have resulted in false-positives. This limitation points to the need for further optimization of

DNA concentration for carbapenemase detection studies and breakpoints to determine which

samples are true-positives.

There is also human bias in the selection of organisms from filters. As the potential CPE were

selected from a filter of confluent bacterial growth, it is possible that CPE were missed during

the initial selection process. There was also bias in the types of organisms selected as I sought

lactose fermenters during the initial selection process over non-lactose fermenters. This may

account for the differences between culture and RT-PCR results as carbapenemase producing

non-Enterobacteriaceae and non-lactose fermenters may have been missed in the culture

process.

51

Chapter 5 Conclusion

In conclusion, our study showed that carbapenemase-producing Enterobacteriaceae (CPE) are

present in the influent and effluent water of sewage treatment plants (STP) and surface water in

the GTA. The blaKPC gene was widely distributed in the STPs and K. oxytoca was the most

common species isolated in this study. Understanding the epidemiology of the most commonly

identified carbapenemase gene and CPE may help predict and prevent the spread of these and

other antibiotic resistant organisms in the water environment. Longitudinal studies looking for

changing carbapenemase types in the water will be necessary to expand our understanding of

CPE presence in the water.

We sought to identify factors affecting CPE occurrence in the water. We were unable to detect a

relationship between CPE yield and precipitation or temperature; however, as there were only a

few rain events, our power to detect an effect was limited. Overall, E. coli concentrations were

positively correlated with CPE presence in the sewage. These findings can be utilized in the

future to improve efficiency in CPE detection in water specimens.

We assessed various carbapenemase gene detection methods and showed that raw sewage PCR

method was the most sensitive for the detection of blaKPC, blaOXA-48-like, and blaVIM in the sewage.

Conversely, all three methods had similar sensitivities for detecting blaNDM carbapenemases in

sewage. Depending on the organism as well as the gene of interest, various methods can be

employed to predict CPE and carbapenemase presence in the water.

Relationships between water and clinical isolates exist. The identification of a clonal blaVIM E.

cloacae link and a possible blaKPC K. oxytoca plasmid link between water and clinical isolates

may have serious public health implications. The role of environmental CPE in human infections

is still unknown and thus, it is vital that we investigate these links further. Sequencing these

isolates will be necessary to create links and understand whether sewer system and aquatic

ecosystem can act as a reservoir of clinically relevant CPE. If left unchecked, the spread of CPE

has the potential to revert us back to the pre-antibiotic era. Hence, greater efforts are needed to

understand the significance of CPE in the environment and prevent these organisms from further

spread.

52

References 1. D'Costa VM, King CE, Kalan L, et al. Antibiotic resistance is ancient. Nature 2011; 477:457-61.

2. Centers for Disease Control and Prevention. Antibiotic Resistance Threats in the United States, 2013. Available at: http://www.cdc.gov/drugresistance/threat-report-2013/. Accessed June 2016.

3. Bergey’s Manual of Determinative Bacteriology. Identification Flow Charts. Available at: http://mysite.science.uottawa.ca/jbasso/microlab/IDFlowcharts.pdf. Accessed on April 2016.

4. Zhanel GG, Wiebe R, Dilay L, et al. Comparative review of the carbapenems. Drugs 2007; 67:1027-52.

5. Papp-Wallace KM, Endimiani A, Taracila MA, Bonomo RA. Carbapenems: past, present, and future. Antimicrobial agents and chemotherapy 2011; 55:4943-60.

6. Blair JM, Webber MA, Baylay AJ, Ogbolu DO, Piddock LJ. Molecular mechanisms of antibiotic resistance. Nature reviews Microbiology 2015; 13:42-51.

7. Wozniak A, Villagra NA, Undabarrena A, et al. Porin alterations present in non-carbapenemase-producing Enterobacteriaceae with high and intermediate levels of carbapenem resistance in Chile. Journal of medical microbiology 2012; 61:1270-9.

8. Novais A, Rodrigues C, Branquinho R, et al. Spread of an OmpK36-modified ST15 Klebsiella pneumoniae variant during an outbreak involving multiple carbapenem-resistant Enterobacteriaceae species and clones. European journal of clinical microbiology & infectious diseases : official publication of the European Society of Clinical Microbiology 2012; 31:3057-63.

9. Pan YP, Xu YH, Wang ZX, Fang YP, Shen JL. Overexpression of MexAB-OprM efflux pump in carbapenem-resistant Pseudomonas aeruginosa. Archives of microbiology 2016.

10. Poole K. Efflux-mediated antimicrobial resistance. The Journal of antimicrobial chemotherapy 2005; 56:20-51.

11. Mathers A. Mobilization of Carbapenemase-Mediated Resistance in Enterobacteriaceae. Microbiology spectrum 2016; 4.

12. Iredell J, Brown J, Tagg K. Antibiotic resistance in Enterobacteriaceae: mechanisms and clinical implications. Bmj 2016; 352:h6420.

13. Albiger B, Glasner C, Struelens MJ, Grundmann H, Monnet DL, European Survey of Carbapenemase-Producing Enterobacteriaceae working g. Carbapenemase-producing Enterobacteriaceae in Europe: assessment by national experts from 38 countries, May 2015. Euro surveillance : bulletin Europeen sur les maladies transmissibles = European communicable disease bulletin 2015; 20.

53

14. Public Health Agency of Canada. Canadian Public Health Laboratory Network (CPHLN) Voluntary Reporting of Carbapenemase-Producing Enterobacteriaceae (CPE) 2014. Available at: http://www.researchid.com/pdf/Antimicrobial%20Resistance/Mulvey_CPE%20CPHLN%202008-2014%20Public.pdf . Accessed April 2016.

15. Nordmann P, Naas T, Poirel L. Global spread of Carbapenemase-producing Enterobacteriaceae. Emerging infectious diseases 2011; 17:1791-8.

16. Canton R, Akova M, Carmeli Y, et al. Rapid evolution and spread of carbapenemases among Enterobacteriaceae in Europe. Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases 2012; 18:413-31.

17. Xu Y, Gu B, Huang M, et al. Epidemiology of carbapenem resistant Enterobacteriaceae (CRE) during 2000-2012 in Asia. Journal of thoracic disease 2015; 7:376-85.

18. Manenzhe RI, Zar HJ, Nicol MP, Kaba M. The spread of carbapenemase-producing bacteria in Africa: a systematic review. The Journal of antimicrobial chemotherapy 2015; 70:23-40.

19. Mataseje LF, Abdesselam K, Vachon J, et al. Carbapenem-Producing Enterobacteriaceae in Canada: Results from the Canadian Nosocomial Infection Surveillance Program, 2010-2014. Antimicrobial agents and chemotherapy 2016.

20. Glasner C, Albiger B, Buist G, et al. Carbapenemase-producing Enterobacteriaceae in Europe: a survey among national experts from 39 countries, February 2013. Euro surveillance : bulletin Europeen sur les maladies transmissibles = European communicable disease bulletin 2013; 18.

21. Borgia S, Lastovetska O, Richardson D, et al. Outbreak of carbapenem-resistant enterobacteriaceae containing blaNDM-1, Ontario, Canada. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America 2012; 55:e109-17.

22. Leung V, Loo VG, Frenette C, et al. First Canadian outbreak of Enterobacteriaceae-expressing Klebsiella pneumoniae carbapenemase type 3. The Canadian journal of infectious diseases & medical microbiology = Journal canadien des maladies infectieuses et de la microbiologie medicale / AMMI Canada 2012; 23:117-20.

23. Queenan AM, Bush K. Carbapenemases: the versatile beta-lactamases. Clinical microbiology reviews 2007; 20:440-58, table of contents.

24. Thomson KS, Smith Moland E. Version 2000: the new beta-lactamases of Gram-negative bacteria at the dawn of the new millennium. Microbes and infection / Institut Pasteur 2000; 2:1225-35.

25. Lahey Clinic. ß-Lactamase Classification and Amino Acid Sequences for TEM, SHV and OXA Extended-Spectrum and Inhibitor Resistant Enzymes. Available at: http://www.lahey.org/studies/other.asp. Accessed on August 2016.

54

26. Mehta SC, Rice K, Palzkill T. Natural Variants of the KPC-2 Carbapenemase have Evolved Increased Catalytic Efficiency for Ceftazidime Hydrolysis at the Cost of Enzyme Stability. PLoS pathogens 2015; 11:e1004949.

27. Chen L, Mathema B, Chavda KD, DeLeo FR, Bonomo RA, Kreiswirth BN. Carbapenemase-producing Klebsiella pneumoniae: molecular and genetic decoding. Trends in microbiology 2014; 22:686-96.

28. Pecora ND, Li N, Allard M, et al. Genomically Informed Surveillance for Carbapenem-Resistant Enterobacteriaceae in a Health Care System. mBio 2015; 6:e01030.

29. Yigit H, Queenan AM, Anderson GJ, et al. Novel carbapenem-hydrolyzing beta-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae. Antimicrobial agents and chemotherapy 2001; 45:1151-61.

30. Bradford PA, Bratu S, Urban C, et al. Emergence of carbapenem-resistant Klebsiella species possessing the class A carbapenem-hydrolyzing KPC-2 and inhibitor-resistant TEM-30 beta-lactamases in New York City. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America 2004; 39:55-60.

31. Bratu S, Landman D, Haag R, et al. Rapid spread of carbapenem-resistant Klebsiella pneumoniae in New York City: a new threat to our antibiotic armamentarium. Archives of internal medicine 2005; 165:1430-5.

32. Moland ES, Black JA, Ourada J, Reisbig MD, Hanson ND, Thomson KS. Occurrence of newer beta-lactamases in Klebsiella pneumoniae isolates from 24 U.S. hospitals. Antimicrobial agents and chemotherapy 2002; 46:3837-42.

33. Nordmann P, Cuzon G, Naas T. The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. The Lancet Infectious diseases 2009; 9:228-36.

34. Leavitt A, Navon-Venezia S, Chmelnitsky I, Schwaber MJ, Carmeli Y. Emergence of KPC-2 and KPC-3 in carbapenem-resistant Klebsiella pneumoniae strains in an Israeli hospital. Antimicrobial agents and chemotherapy 2007; 51:3026-9.

35. Public Health Ontario Laboratories. January to June 2015 Carbapenemase-Producing Enterobacteriaceae (CPE) Surveillance Report: Surveillance Period January to June 2015. Available at: https://www.publichealthontario.ca/en/DataAndAnalytics/Documents/Carbapenemase_Producing_Enterobacteriaceae_(CPE)_Surveillance_Report_September_2015.pdf. Accessed on January 2016.

36. Goldfarb D, Harvey SB, Jessamine K, Jessamine P, Toye B, Desjardins M. Detection of plasmid-mediated KPC-producing Klebsiella pneumoniae in Ottawa, Canada: evidence of intrahospital transmission. Journal of clinical microbiology 2009; 47:1920-2.

37. Castanheira M, Costello SE, Woosley LN, Deshpande LM, Davies TA, Jones RN. Evaluation of clonality and carbapenem resistance mechanisms among Acinetobacter baumannii-Acinetobacter calcoaceticus complex and Enterobacteriaceae isolates collected in European and

55

Mediterranean countries and detection of two novel beta-lactamases, GES-22 and VIM-35. Antimicrobial agents and chemotherapy 2014; 58:7358-66.

38. Galani I, Souli M, Koratzanis E, Chryssouli Z, Giamarellou H. Molecular characterization of an Escherichia coli clinical isolate that produces both metallo-beta-lactamase VIM-2 and extended-spectrum beta-lactamase GES-7: identification of the In8 integron carrying the blaVIM-2 gene. The Journal of antimicrobial chemotherapy 2006; 58:432-3.

39. Duarte A, Boavida F, Grosso F, et al. Outbreak of GES-1 beta-lactamase-producing multidrug-resistant Klebsiella pneumoniae in a university hospital in Lisbon, Portugal. Antimicrobial agents and chemotherapy 2003; 47:1481-2.

40. Poirel L, Weldhagen GF, Naas T, De Champs C, Dove MG, Nordmann P. GES-2, a class A beta-lactamase from Pseudomonas aeruginosa with increased hydrolysis of imipenem. Antimicrobial agents and chemotherapy 2001; 45:2598-603.

41. Walther-Rasmussen J, Hoiby N. Class A carbapenemases. The Journal of antimicrobial chemotherapy 2007; 60:470-82.

42. Poirel L, Le Thomas I, Naas T, Karim A, Nordmann P. Biochemical sequence analyses of GES-1, a novel class A extended-spectrum beta-lactamase, and the class 1 integron In52 from Klebsiella pneumoniae. Antimicrobial agents and chemotherapy 2000; 44:622-32.

43. Castanheira M, Mendes RE, Walsh TR, Gales AC, Jones RN. Emergence of the extended-spectrum beta-lactamase GES-1 in a Pseudomonas aeruginosa strain from Brazil: report from the SENTRY antimicrobial surveillance program. Antimicrobial agents and chemotherapy 2004; 48:2344-5.

44. Correia M, Boavida F, Grosso F, et al. Molecular characterization of a new class 3 integron in Klebsiella pneumoniae. Antimicrobial agents and chemotherapy 2003; 47:2838-43.

45. Jeong SH, Bae IK, Kim D, et al. First outbreak of Klebsiella pneumoniae clinical isolates producing GES-5 and SHV-12 extended-spectrum beta-lactamases in Korea. Antimicrobial agents and chemotherapy 2005; 49:4809-10.

46. Pasteran F, Faccone D, Petroni A, et al. Novel variant (bla(VIM-11)) of the metallo-{beta}-lactamase bla(VIM) family in a GES-1 extended-spectrum-{beta}-lactamase-producing Pseudomonas aeruginosa clinical isolate in Argentina. Antimicrobial agents and chemotherapy 2005; 49:474-5.

47. Poirel L, Brinas L, Fortineau N, Nordmann P. Integron-encoded GES-type extended-spectrum beta-lactamase with increased activity toward aztreonam in Pseudomonas aeruginosa. Antimicrobial agents and chemotherapy 2005; 49:3593-7.

48. Poirel L, Weldhagen GF, De Champs C, Nordmann P. A nosocomial outbreak of Pseudomonas aeruginosa isolates expressing the extended-spectrum beta-lactamase GES-2 in South Africa. The Journal of antimicrobial chemotherapy 2002; 49:561-5.

56

49. Ryoo NH, Kim EC, Hong SG, et al. Dissemination of SHV-12 and CTX-M-type extended-spectrum beta-lactamases among clinical isolates of Escherichia coli and Klebsiella pneumoniae and emergence of GES-3 in Korea. The Journal of antimicrobial chemotherapy 2005; 56:698-702.

50. Vourli S, Giakkoupi P, Miriagou V, Tzelepi E, Vatopoulos AC, Tzouvelekis LS. Novel GES/IBC extended-spectrum beta-lactamase variants with carbapenemase activity in clinical enterobacteria. FEMS microbiology letters 2004; 234:209-13.

51. Wachino J, Doi Y, Yamane K, et al. Molecular characterization of a cephamycin-hydrolyzing and inhibitor-resistant class A beta-lactamase, GES-4, possessing a single G170S substitution in the omega-loop. Antimicrobial agents and chemotherapy 2004; 48:2905-10.

52. Wachino J, Doi Y, Yamane K, et al. Nosocomial spread of ceftazidime-resistant Klebsiella pneumoniae strains producing a novel class a beta-lactamase, GES-3, in a neonatal intensive care unit in Japan. Antimicrobial agents and chemotherapy 2004; 48:1960-7.

53. Mataseje LF, Bryce E, Roscoe D, et al. Carbapenem-resistant Gram-negative bacilli in Canada 2009-10: results from the Canadian Nosocomial Infection Surveillance Program (CNISP). The Journal of antimicrobial chemotherapy 2012; 67:1359-67.

54. Sepehri S, Poliquin G, Alfattoh N, et al. Osteomyelitis due to multiple carbapenemase-producing Gram-negative bacteria: The first case report of a GES-13-producing Pseudomonas aeruginosa isolate in Canada. The Canadian journal of infectious diseases & medical microbiology = Journal canadien des maladies infectieuses et de la microbiologie medicale / AMMI Canada 2014; 25:229-31.

55. Boyd D, Taylor G, Fuller J, et al. Complete Sequence of Four Multidrug-Resistant MOBQ1 Plasmids Harboring blaGES-5 Isolated from Escherichia coli and Serratia marcescens Persisting in a Hospital in Canada. Microbial drug resistance 2015; 21:253-60.

56. Makena A, Brem J, Pfeffer I, et al. Biochemical characterization of New Delhi metallo-beta-lactamase variants reveals differences in protein stability. The Journal of antimicrobial chemotherapy 2015; 70:463-9.

57. Djahmi N, Dunyach-Remy C, Pantel A, Dekhil M, Sotto A, Lavigne JP. Epidemiology of carbapenemase-producing Enterobacteriaceae and Acinetobacter baumannii in Mediterranean countries. BioMed research international 2014; 2014:305784.

58. Walsh TR, Toleman MA, Poirel L, Nordmann P. Metallo-beta-lactamases: the quiet before the storm? Clinical microbiology reviews 2005; 18:306-25.

59. Nordmann P, Poirel L, Walsh TR, Livermore DM. The emerging NDM carbapenemases. Trends in microbiology 2011; 19:588-95.

60. Mulvey MR, Grant JM, Plewes K, Roscoe D, Boyd DA. New Delhi metallo-beta-lactamase in Klebsiella pneumoniae and Escherichia coli, Canada. Emerging infectious diseases 2011; 17:103-6.

57

61. Walsh TR, Weeks J, Livermore DM, Toleman MA. Dissemination of NDM-1 positive bacteria in the New Delhi environment and its implications for human health: an environmental point prevalence study. The Lancet Infectious diseases 2011; 11:355-62.

62. Kumarasamy KK, Toleman MA, Walsh TR, et al. Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: a molecular, biological, and epidemiological study. The Lancet Infectious diseases 2010; 10:597-602.

63. Nordmann P, Poirel L, Toleman MA, Walsh TR. Does broad-spectrum beta-lactam resistance due to NDM-1 herald the end of the antibiotic era for treatment of infections caused by Gram-negative bacteria? The Journal of antimicrobial chemotherapy 2011; 66:689-92.

64. Chen Y, Zhou Z, Jiang Y, Yu Y. Emergence of NDM-1-producing Acinetobacter baumannii in China. The Journal of antimicrobial chemotherapy 2011; 66:1255-9.

65. Yong D, Toleman MA, Giske CG, et al. Characterization of a new metallo-beta-lactamase gene, bla(NDM-1), and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrobial agents and chemotherapy 2009; 53:5046-54.

66. van Duin D, Doi Y. The global epidemiology of carbapenemase-producing Enterobacteriaceae. Virulence 2016:1-10.

67. Ho PL, Cheung YY, Wang Y, et al. Characterization of carbapenem-resistant Escherichia coli and Klebsiella pneumoniae from a healthcare region in Hong Kong. European journal of clinical microbiology & infectious diseases : official publication of the European Society of Clinical Microbiology 2016; 35:379-85.

68. Khong WX, Marimuthu K, Teo J, et al. Tracking inter-institutional spread of NDM and identification of a novel NDM-positive plasmid, pSg1-NDM, using next-generation sequencing approaches. The Journal of antimicrobial chemotherapy 2016.

69. Preechachuawong P, Santimaleeworagun W, Jitwasinkul T, Samret W. Detection of New Delhi Metallo-Beta-Lactamase-1-Producing Klebsiella Pneumoniae at a General Hospital in Thailand. The Southeast Asian journal of tropical medicine and public health 2015; 46:1031-6.

70. Poirel L, Benouda A, Hays C, Nordmann P. Emergence of NDM-1-producing Klebsiella pneumoniae in Morocco. The Journal of antimicrobial chemotherapy 2011; 66:2781-3.

71. Mushi MF, Mshana SE, Imirzalioglu C, Bwanga F. Carbapenemase genes among multidrug resistant gram negative clinical isolates from a tertiary hospital in Mwanza, Tanzania. BioMed research international 2014; 2014:303104.

72. Sassi A, Loucif L, Gupta SK, Dekhil M, Chettibi H, Rolain JM. NDM-5 carbapenemase-encoding gene in multidrug-resistant clinical isolates of Escherichia coli from Algeria. Antimicrobial agents and chemotherapy 2014; 58:5606-8.

73. Poirel L, Revathi G, Bernabeu S, Nordmann P. Detection of NDM-1-producing Klebsiella pneumoniae in Kenya. Antimicrobial agents and chemotherapy 2011; 55:934-6.

58

74. Dortet L, Poirel L, Anguel N, Nordmann P. New Delhi metallo-beta-lactamase 4-producing Escherichia coli in Cameroon. Emerging infectious diseases 2012; 18:1540-2.

75. Kazmierczak KM, Rabine S, Hackel M, et al. Multiyear, Multinational Survey of the Incidence and Global Distribution of Metallo-beta-Lactamase-Producing Enterobacteriaceae and Pseudomonas aeruginosa. Antimicrobial agents and chemotherapy 2016; 60:1067-78.

76. Rozales FP, Ribeiro VB, Magagnin CM, et al. Emergence of NDM-1-producing Enterobacteriaceae in Porto Alegre, Brazil. International journal of infectious diseases : IJID : official publication of the International Society for Infectious Diseases 2014; 25:79-81.

77. Kus JV, Tadros M, Simor A, et al. New Delhi metallo-beta-lactamase-1: local acquisition in Ontario, Canada, and challenges in detection. CMAJ : Canadian Medical Association journal = journal de l'Association medicale canadienne 2011; 183:1257-61.

78. Lowe CF, Kus JV, Salt N, et al. Nosocomial transmission of New Delhi metallo-beta-lactamase-1-producing Klebsiella pneumoniae in Toronto, Canada. Infection control and hospital epidemiology 2013; 34:49-55.

79. Public Health Ontario Laboratories. Carbapenemase-producing Enterobacteriaceae (CPE) Surveillance Report : January to December 2015. Available at: https://www.publichealthontario.ca/en/DataAndAnalytics/Documents/Carbapenemase_Producing_Enterobacteriaceae_(CPE)_Surveillance_Report_April_2016.pdf. Accessed May 2016.

80. Rodrigues C, Novais A, Machado E, Peixe L. Detection of VIM-34, a novel VIM-1 variant identified in the intercontinental ST15 Klebsiella pneumoniae clone. The Journal of antimicrobial chemotherapy 2014; 69:274-5.

81. Cornaglia G, Giamarellou H, Rossolini GM. Metallo-beta-lactamases: a last frontier for beta-lactams? The Lancet Infectious diseases 2011; 11:381-93.

82. Lauretti L, Riccio ML, Mazzariol A, et al. Cloning and characterization of blaVIM, a new integron-borne metallo-beta-lactamase gene from a Pseudomonas aeruginosa clinical isolate. Antimicrobial agents and chemotherapy 1999; 43:1584-90.

83. Lee K, Lim JB, Yum JH, et al. bla(VIM-2) cassette-containing novel integrons in metallo-beta-lactamase-producing Pseudomonas aeruginosa and Pseudomonas putida isolates disseminated in a Korean hospital. Antimicrobial agents and chemotherapy 2002; 46:1053-8.

84. Ktari S, Arlet G, Mnif B, et al. Emergence of multidrug-resistant Klebsiella pneumoniae isolates producing VIM-4 metallo-beta-lactamase, CTX-M-15 extended-spectrum beta-lactamase, and CMY-4 AmpC beta-lactamase in a Tunisian university hospital. Antimicrobial agents and chemotherapy 2006; 50:4198-201.

85. Toleman MA, Rolston K, Jones RN, Walsh TR. blaVIM-7, an evolutionarily distinct metallo-beta-lactamase gene in a Pseudomonas aeruginosa isolate from the United States. Antimicrobial agents and chemotherapy 2004; 48:329-32.

59

86. Laupland KB, Parkins MD, Church DL, et al. Population-based epidemiological study of infections caused by carbapenem-resistant Pseudomonas aeruginosa in the Calgary Health Region: importance of metallo-beta-lactamase (MBL)-producing strains. The Journal of infectious diseases 2005; 192:1606-12.

87. Tijet N, Macmullin G, Lastovetska O, et al. Verona integron-encoded metallo-beta-lactamase 1 in Enterobacteria, Ontario, Canada. Emerging infectious diseases 2013; 19:1156-8.

88. Walkty A, Gilmour M, Simner P, et al. Isolation of multiple carbapenemase-producing Gram-negative bacilli from a patient recently hospitalized in Nigeria. Diagnostic microbiology and infectious disease 2015; 81:296-8.

89. Arakawa Y, Murakami M, Suzuki K, et al. A novel integron-like element carrying the metallo-beta-lactamase gene blaIMP. Antimicrobial agents and chemotherapy 1995; 39:1612-5.

90. Nordmann P, Poirel L. Emerging carbapenemases in Gram-negative aerobes. Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases 2002; 8:321-31.

91. Hirakata Y, Izumikawa K, Yamaguchi T, et al. Rapid detection and evaluation of clinical characteristics of emerging multiple-drug-resistant gram-negative rods carrying the metallo-beta-lactamase gene blaIMP. Antimicrobial agents and chemotherapy 1998; 42:2006-11.

92. Sidjabat HE, Townell N, Nimmo GR, et al. Dominance of IMP-4-producing enterobacter cloacae among carbapenemase-producing Enterobacteriaceae in Australia. Antimicrobial agents and chemotherapy 2015; 59:4059-66.

93. Takahashi A, Yomoda S, Kobayashi I, Okubo T, Tsunoda M, Iyobe S. Detection of carbapenemase-producing Acinetobacter baumannii in a hospital. Journal of clinical microbiology 2000; 38:526-9.

94. Senda K, Arakawa Y, Nakashima K, et al. Multifocal outbreaks of metallo-beta-lactamase-producing Pseudomonas aeruginosa resistant to broad-spectrum beta-lactams, including carbapenems. Antimicrobial agents and chemotherapy 1996; 40:349-53.

95. Haruta S, Yamaguchi H, Yamamoto ET, et al. Functional analysis of the active site of a metallo-beta-lactamase proliferating in Japan. Antimicrobial agents and chemotherapy 2000; 44:2304-9.

96. Kurokawa H, Yagi T, Shibata N, Shibayama K, Arakawa Y. Worldwide proliferation of carbapenem-resistant gram-negative bacteria. Lancet 1999; 354:955.

97. Ito H, Arakawa Y, Ohsuka S, Wacharotayankun R, Kato N, Ohta M. Plasmid-mediated dissemination of the metallo-beta-lactamase gene blaIMP among clinically isolated strains of Serratia marcescens. Antimicrobial agents and chemotherapy 1995; 39:824-9.

98. Watanabe M, Iyobe S, Inoue M, Mitsuhashi S. Transferable imipenem resistance in Pseudomonas aeruginosa. Antimicrobial agents and chemotherapy 1991; 35:147-51.

60

99. Hawkey PM, Xiong J, Ye H, Li H, M'Zali FH. Occurrence of a new metallo-beta-lactamase IMP-4 carried on a conjugative plasmid in Citrobacter youngae from the People's Republic of China. FEMS microbiology letters 2001; 194:53-7.

100. Yan JJ, Ko WC, Tsai SH, Wu HM, Wu JJ. Outbreak of infection with multidrug-resistant Klebsiella pneumoniae carrying bla(IMP-8) in a university medical center in Taiwan. Journal of clinical microbiology 2001; 39:4433-9.

101. Lee K, Lee WG, Uh Y, et al. VIM- and IMP-type metallo-beta-lactamase-producing Pseudomonas spp. and Acinetobacter spp. in Korean hospitals. Emerging infectious diseases 2003; 9:868-71.

102. Mendes RE, Toleman MA, Ribeiro J, Sader HS, Jones RN, Walsh TR. Integron carrying a novel metallo-beta-lactamase gene, blaIMP-16, and a fused form of aminoglycoside-resistant gene aac(6')-30/aac(6')-Ib': report from the SENTRY Antimicrobial Surveillance Program. Antimicrobial agents and chemotherapy 2004; 48:4693-702.

103. Peleg AY, Franklin C, Bell J, Spelman DW. Emergence of IMP-4 metallo-beta-lactamase in a clinical isolate from Australia. The Journal of antimicrobial chemotherapy 2004; 54:699-700.

104. Cornaglia G, Riccio ML, Mazzariol A, Lauretti L, Fontana R, Rossolini GM. Appearance of IMP-1 metallo-beta-lactamase in Europe. Lancet 1999; 353:899-900.

105. Daiyasu H, Osaka K, Ishino Y, Toh H. Expansion of the zinc metallo-hydrolase family of the beta-lactamase fold. FEBS letters 2001; 503:1-6.

106. Gibb AP, Tribuddharat C, Moore RA, et al. Nosocomial outbreak of carbapenem-resistant Pseudomonas aeruginosa with a new bla(IMP) allele, bla(IMP-7). Antimicrobial agents and chemotherapy 2002; 46:255-8.

107. Antunes NT, Lamoureaux TL, Toth M, Stewart NK, Frase H, Vakulenko SB. Class D beta-lactamases: are they all carbapenemases? Antimicrobial agents and chemotherapy 2014; 58:2119-25.

108. Antunes NT, Fisher JF. Acquired Class D beta-Lactamases. Antibiotics 2014; 3:398-434.

109. Walther-Rasmussen J, Hoiby N. OXA-type carbapenemases. The Journal of antimicrobial chemotherapy 2006; 57:373-83.

110. Potron A, Kalpoe J, Poirel L, Nordmann P. European dissemination of a single OXA-48-producing Klebsiella pneumoniae clone. Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases 2011; 17:E24-6.

111. Carrer A, Poirel L, Yilmaz M, et al. Spread of OXA-48-encoding plasmid in Turkey and beyond. Antimicrobial agents and chemotherapy 2010; 54:1369-73.

112. Poirel L, Heritier C, Tolun V, Nordmann P. Emergence of oxacillinase-mediated resistance to imipenem in Klebsiella pneumoniae. Antimicrobial agents and chemotherapy 2004; 48:15-22.

61

113. Poirel L, Potron A, Nordmann P. OXA-48-like carbapenemases: the phantom menace. The Journal of antimicrobial chemotherapy 2012; 67:1597-606.

114. Nagano N, Endoh Y, Nagano Y, et al. First report of OXA-48 carbapenemase-producing Klebsiella pneumoniae and Escherichia coli in Japan from a patient returned from Southeast Asia. Japanese journal of infectious diseases 2013; 66:79-81.

115. Lyman M, Walters M, Lonsway D, Rasheed K, Limbago B, Kallen A. Notes from the Field: Carbapenem-resistant Enterobacteriaceae Producing OXA-48-like Carbapenemases--United States, 2010-2015. MMWR Morbidity and mortality weekly report 2015; 64:1315-6.

116. Barguigua A, El Otmani F, Talmi M, Zerouali K, Timinouni M. Emergence of carbapenem-resistant Enterobacteriaceae isolates in the Moroccan community. Diagnostic microbiology and infectious disease 2012; 73:290-1.

117. Potron A, Poirel L, Bussy F, Nordmann P. Occurrence of the carbapenem-hydrolyzing beta-lactamase gene blaOXA-48 in the environment in Morocco. Antimicrobial agents and chemotherapy 2011; 55:5413-4.

118. World Health Organization. Emerging Issues in Water and Infectious Disease. Available at: http://www.who.int/water_sanitation_health/emerging/emerging.pdf. Accessed on July 2016.

119. Robert Friis. Epidemiology 101. Jones & Bartlett. p. 13.

120. Global Issues in Water, Sanitation, and Health: Workshop Summary. Washington (DC), 2009.

121. O’Connor D. The Walkerton Inquiry. Report of the Walkerton Inquiry The Events of May 2000 and Related Issues. Available at: http://www.archives.gov.on.ca/en/e_records/walkerton/ Accessed in September 2016.

122. Baquero F, Martinez JL, Canton R. Antibiotics and antibiotic resistance in water environments. Current opinion in biotechnology 2008; 19:260-5.

123. Hafliger D, Hubner P, Luthy J. Outbreak of viral gastroenteritis due to sewage-contaminated drinking water. International journal of food microbiology 2000; 54:123-6.

124. He LY, Ying GG, Liu YS, et al. Discharge of swine wastes risks water quality and food safety: Antibiotics and antibiotic resistance genes from swine sources to the receiving environments. Environment international 2016; 92-93:210-9.

125. Ljungstrom I, Castor B. Immune response to Giardia lamblia in a water-borne outbreak of giardiasis in Sweden. Journal of medical microbiology 1992; 36:347-52.

126. Stirling R, Aramini J, Ellis A, et al. Waterborne cryptosporidiosis outbreak, North Battleford, Saskatchewan, Spring 2001. Canada communicable disease report = Releve des maladies transmissibles au Canada 2001; 27:185-92.

62

127. Al-Jassim N, Ansari MI, Harb M, Hong PY. Removal of bacterial contaminants and antibiotic resistance genes by conventional wastewater treatment processes in Saudi Arabia: Is the treated wastewater safe to reuse for agricultural irrigation? Water research 2015; 73:277-90.

128. Harnisz M. Total resistance of native bacteria as an indicator of changes in the water environment. Environmental pollution 2013; 174:85-92.

129. Huang JJ, Hu HY, Lu SQ, et al. Monitoring and evaluation of antibiotic-resistant bacteria at a municipal wastewater treatment plant in China. Environment international 2012; 42:31-6.

130. Storteboom H, Arabi M, Davis JG, Crimi B, Pruden A. Tracking antibiotic resistance genes in the South Platte River basin using molecular signatures of urban, agricultural, and pristine sources. Environmental science & technology 2010; 44:7397-404.

131. Summers AO. Genetic linkage and horizontal gene transfer, the roots of the antibiotic multi-resistance problem. Animal biotechnology 2006; 17:125-35.

132. Ferreira da Silva M, Vaz-Moreira I, Gonzalez-Pajuelo M, Nunes OC, Manaia CM. Antimicrobial resistance patterns in Enterobacteriaceae isolated from an urban wastewater treatment plant. FEMS microbiology ecology 2007; 60:166-76.

133. Szczepanowski R, Linke B, Krahn I, et al. Detection of 140 clinically relevant antibiotic-resistance genes in the plasmid metagenome of wastewater treatment plant bacteria showing reduced susceptibility to selected antibiotics. Microbiology 2009; 155:2306-19.

134. Toronto Water. Ashbridges Bay Wastewater Treatment Plant 2012 Annual Report. Available at: http://www1.toronto.ca/city_of_toronto/toronto_water/files/pdf/abtp_annual_report_2012.pdf. Accessed on May 2016.

135. Chagas TP, Seki LM, Cury JC, et al. Multiresistance, beta-lactamase-encoding genes and bacterial diversity in hospital wastewater in Rio de Janeiro, Brazil. Journal of applied microbiology 2011; 111:572-81.

136. Korzeniewska E, Korzeniewska A, Harnisz M. Antibiotic resistant Escherichia coli in hospital and municipal sewage and their emission to the environment. Ecotoxicology and environmental safety 2013; 91:96-102.

137. Ontario Ministry of the Environment, Conservation Toronto and Region. Stormwater Pollution Prevention Handbook. 2001. Available at: http://www.sustainabletechnologies.ca/wp/wp-content/uploads/2013/01/SWPP-Ontario-case-studies.pdf. Accessed on July 2016.

138. Charron D, Thomas M, Waltner-Toews D, et al. Vulnerability of waterborne diseases to climate change in Canada: a review. Journal of toxicology and environmental health Part A 2004; 67:1667-77.

139. Sartor JD, Boyd GB, Agardy FJ. Water pollution aspects of street surface contaminants. Journal - Water Pollution Control Federation 1974; 46:458-67.

63

140. Rose JB, Epstein PR, Lipp EK, Sherman BH, Bernard SM, Patz JA. Climate variability and change in the United States: potential impacts on water- and foodborne diseases caused by microbiologic agents. Environmental health perspectives 2001; 109 Suppl 2:211-21.

141. Tischendorf J, de Avila RA, Safdar N. Risk of infection following colonization with carbapenem-resistant Enterobactericeae: A systematic review. American journal of infection control 2016; 44:539-43.

142. Lubbert C, Lippmann N, Busch T, et al. Long-term carriage of Klebsiella pneumoniae carbapenemase-2-producing K pneumoniae after a large single-center outbreak in Germany. American journal of infection control 2014; 42:376-80.

143. Mulvey M., Willey BM., Boyd, DA., et al. Carbapenemase-producing organisms isolated from environmental water samples collected in the greater Toronto area, Ontario, Canada. Available at: https://www.escmid.org/escmid_publications/escmid_elibrary/material/?mid=30937. Accessed August 2016.

144. Janecko N, Martz SL, Avery BP, et al. Carbapenem-Resistant Enterobacter spp. in Retail Seafood Imported from Southeast Asia to Canada. Emerging infectious diseases 2016; 22:1675-7.

145. Yousfi M, Touati A, Mairi A, et al. Emergence of Carbapenemase-Producing Escherichia coli Isolated from Companion Animals in Algeria. Microbial drug resistance 2016.

146. Gonzalez-Torralba A, Oteo J, Asenjo A, Bautista V, Fuentes E, Alos JI. Survey of Carbapenemase-Producing Enterobacteriaceae in Companion Dogs in Madrid, Spain. Antimicrobial agents and chemotherapy 2016; 60:2499-501.

147. City of Toronto. Humber Wastewater Treatment Plant. Available at: http://www1.toronto.ca/wps/portal/contentonly?vgnextoid=6b2655b89b6fe310VgnVCM10000071d60f89RCRD. Accessed on June 2016.

148. Edge TA, Khan IU, Bouchard R, et al. Occurrence of waterborne pathogens and Escherichia coli at offshore drinking water intakes in lake Ontario. Applied and environmental microbiology 2013; 79:5799-813.

149. Matuschek E, Brown DF, Kahlmeter G. Development of the EUCAST disk diffusion antimicrobial susceptibility testing method and its implementation in routine microbiology laboratories. Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases 2014; 20:O255-66.

150. ROSCO Diagnostica. Insert for KPC/Metallo-B-Lactamase Confirmation kit. Available at: http://www.bioconnections.co.uk/files/ARM/98015_ifu_riv7271.pdf. Accessed on May 2016.

151. Tijet N, Sheth PM, Lastovetska O, Chung C, Patel SN, Melano RG. Molecular characterization of Klebsiella pneumoniae carbapenemase (KPC)-producing Enterobacteriaceae in Ontario, Canada, 2008-2011. PloS one 2014; 9:e116421.

64

152. American Public Health Association. Standard methods for the examination of water and wastewater, 20th ed. American Public Health Association, Washington D.C. 1999.

153. Centers for Disease Control and Prevention. Multiplex Real-Time PCR Detection of Klebsiella pneumoniae Carbapenemase (KPC) and New Delhi metallo-β-lactamase (NDM-1). Available at: http://www.cdc.gov/HAI/pdfs/labSettings/KPC-NDM-protocol-2011.pdf. Accessed on February 2016.

154. Fattouh R, Tijet N, McGeer A, Poutanen SM, Melano RG, Patel SN. What Is the Appropriate Meropenem MIC for Screening of Carbapenemase-Producing Enterobacteriaceae in Low-Prevalence Settings? Antimicrobial agents and chemotherapy 2016; 60:1556-9.

155. Government of Canada. Daily Data Report for 2016. Available at: http://climate.weather.gc.ca/climate_data/daily_data_e.html?StationID=51459. Accessed on April 2016.

156. Random.org. True Random Number Service. Available at: https://www.random.org/ Accessed on February 2016.

157. Mount Sinai Hospital. About Toronto Invasive Bacterial Diseases Network. Available at: http://www.tibdn.ca/about . Accessed on February 2016.

158. Carattoli A. Plasmids in Gram negatives: molecular typing of resistance plasmids. International journal of medical microbiology : IJMM 2011; 301:654-8.

159. Johnson TJ, Wannemuehler YM, Johnson SJ, et al. Plasmid replicon typing of commensal and pathogenic Escherichia coli isolates. Applied and environmental microbiology 2007; 73:1976-83.

160. Novak A, Goic-Barisic I, Andrasevic AT, et al. Monoclonal outbreak of VIM-1-carbapenemase-producing Enterobacter cloacae in intensive care unit, University Hospital Centre Split, Croatia. Microbial drug resistance 2014; 20:399-403.

161. Galvin S, Boyle F, Hickey P, Vellinga A, Morris D, Cormican M. Enumeration and characterization of antimicrobial-resistant Escherichia coli bacteria in effluent from municipal, hospital, and secondary treatment facility sources. Applied and environmental microbiology 2010; 76:4772-9.

162. Hocquet D, Muller A, Bertrand X. What happens in hospitals does not stay in hospitals: antibiotic-resistant bacteria in hospital wastewater systems. The Journal of hospital infection 2016.

163. Koh TH, Ko K, Jureen R, et al. High counts of carbapenemase-producing Enterobacteriaceae in hospital sewage. Infection control and hospital epidemiology 2015; 36:619-21.

164. Prado T, Pereira WC, Silva DM, Seki LM, Carvalho AP, Asensi MD. Detection of extended-spectrum beta-lactamase-producing Klebsiella pneumoniae in effluents and sludge of a hospital sewage treatment plant. Letters in applied microbiology 2008; 46:136-41.

65

165. Roderova M, Sedlakova MH, Pudova V, et al. Occurrence of bacteria producing broad-spectrum beta-lactamases and qnr genes in hospital and urban wastewater samples. The new microbiologica 2016; 39:124-33.

166. Yang CM, Lin MF, Liao PC, et al. Comparison of antimicrobial resistance patterns between clinical and sewage isolates in a regional hospital in Taiwan. Letters in applied microbiology 2009; 48:560-5.

167. Fischer J, San Jose M, Roschanski N, et al. Spread and persistence of VIM-1 Carbapenemase-producing Enterobacteriaceae in three German swine farms in 2011 and 2012. Veterinary microbiology 2016.

168. Roschanski N, Friese A, von Salviati-Claudius C, et al. Prevalence of carbapenemase producing Enterobacteriaceae isolated from German pig-fattening farms during the years 2011-2013. Veterinary microbiology 2015.

169. Perrin T. The Business Of Urban Animals Survey: the facts and statistics on companion animals in Canada. The Canadian veterinary journal = La revue veterinaire canadienne 2009; 50:48-52.

170. City of Toronto. 2011 Census: Marital Status, Families, Households and Dwelling Characteristics. Available at: https://www1.toronto.ca/city_of_toronto/social_development_finance__administration/files/pdf/censusbackgrounder_hhds_2011.pdf. Accessed on September 2016.

171. Region of Peel. 2011 Census Bulletin Households & Dwelling Types. Available at: https://www.peelregion.ca/planning/pdc/data/census/2011-Census/households-dwelling-types/Households-Dwellings_Bulletin_85-11.pdf . Accessed on September 2016.

172. Zhang X, Lu X, Zong Z. Enterobacteriaceae producing the KPC-2 carbapenemase from hospital sewage. Diagnostic microbiology and infectious disease 2012; 73:204-6.

173. Aubron C, Poirel L, Ash RJ, Nordmann P. Carbapenemase-producing Enterobacteriaceae, U.S. rivers. Emerging infectious diseases 2005; 11:260-4.

174. Podschun R, Pietsch S, Holler C, Ullmann U. Incidence of Klebsiella species in surface waters and their expression of virulence factors. Applied and environmental microbiology 2001; 67:3325-7.

175. Bagley ST. Habitat association of Klebsiella species. Infection control : IC 1985; 6:52-8.

176. Lowe C, Willey B, O'Shaughnessy A, et al. Outbreak of extended-spectrum beta-lactamase-producing Klebsiella oxytoca infections associated with contaminated handwashing sinks(1). Emerging infectious diseases 2012; 18:1242-7.

177. Findlay J, Hopkins KL, Doumith M, et al. KPC enzymes in the UK: an analysis of the first 160 cases outside the North-West region. The Journal of antimicrobial chemotherapy 2016; 71:1199-206.

66

178. Papagiannitsis CC, Di Pilato V, Giani T, et al. Characterization of KPC-encoding plasmids from two endemic settings, Greece and Italy. The Journal of antimicrobial chemotherapy 2016.

179. Fernando DM, Tun HM, Poole J, et al. Detection of Antibiotic Resistance Genes in Source and Drinking Water Samples from a First Nation Community in Canada. Applied and environmental microbiology 2016.

180. Kieffer N, Poirel L, Bessa LJ, Barbosa-Vasconcelos A, da Costa PM, Nordmann P. VIM-1, VIM-34, and IMP-8 Carbapenemase-Producing Escherichia coli Strains Recovered from a Portuguese River. Antimicrobial agents and chemotherapy 2016; 60:2585-6.

181. Poirel L, Barbosa-Vasconcelos A, Simoes RR, Da Costa PM, Liu W, Nordmann P. Environmental KPC-producing Escherichia coli isolates in Portugal. Antimicrobial agents and chemotherapy 2012; 56:1662-3.

182. Girlich D, Poirel L, Nordmann P. Novel ambler class A carbapenem-hydrolyzing beta-lactamase from a Pseudomonas fluorescens isolate from the Seine River, Paris, France. Antimicrobial agents and chemotherapy 2010; 54:328-32.

183. Zurfluh K, Hachler H, Nuesch-Inderbinen M, Stephan R. Characteristics of extended-spectrum beta-lactamase- and carbapenemase-producing Enterobacteriaceae Isolates from rivers and lakes in Switzerland. Applied and environmental microbiology 2013; 79:3021-6.

184. Region of Peel. Wastewater Treatment in Peel. Available at: https://www.peelregion.ca/pw/water/sewage-trtmt/pdf/wastewater-treatment.pdf. Accessed on June 2016.

185. Hall-Stoodley L, Costerton JW, Stoodley P. Bacterial biofilms: from the natural environment to infectious diseases. Nature reviews Microbiology 2004; 2:95-108.

186. Costerton JW, Cheng KJ, Geesey GG, et al. Bacterial biofilms in nature and disease. Annual review of microbiology 1987; 41:435-64.

187. Santegoeds CM, Ferdelman TG, Muyzer G, de Beer D. Structural and functional dynamics of sulfate-reducing populations in bacterial biofilms. Applied and environmental microbiology 1998; 64:3731-9.

188. Santegoeds CM, Schramm A, de Beer D. Microsensors as a tool to determine chemical microgradients and bacterial activity in wastewater biofilms and flocs. Biodegradation 1998; 9:159-67.

189. Hoiby N, Bjarnsholt T, Givskov M, Molin S, Ciofu O. Antibiotic resistance of bacterial biofilms. International journal of antimicrobial agents 2010; 35:322-32.

190. Mao D, Yu S, Rysz M, et al. Prevalence and proliferation of antibiotic resistance genes in two municipal wastewater treatment plants. Water research 2015; 85:458-66.

191. Michael I, Rizzo L, McArdell CS, et al. Urban wastewater treatment plants as hotspots for the release of antibiotics in the environment: a review. Water research 2013; 47:957-95.

67

192. Rizzo L, Manaia C, Merlin C, et al. Urban wastewater treatment plants as hotspots for antibiotic resistant bacteria and genes spread into the environment: a review. The Science of the total environment 2013; 447:345-60.

193. Bengtsson-Palme J, Hammaren R, Pal C, et al. Elucidating selection processes for antibiotic resistance in sewage treatment plants using metagenomics. The Science of the total environment 2016.

194. Hirsch R, Ternes T, Haberer K, Kratz KL. Occurrence of antibiotics in the aquatic environment. The Science of the total environment 1999; 225:109-18.

195. Watkinson AJ, Murby EJ, Kolpin DW, Costanzo SD. The occurrence of antibiotics in an urban watershed: from wastewater to drinking water. The Science of the total environment 2009; 407:2711-23.

196. Luo, Y., Yang, F., Mathieu, J., et al. Proliferation of Multidrug-Resistant New Delhi Metallo-β-lactamase Genes in Municipal Wastewater Treatment Plants in Northern China. Environ. Sci. Technol. Lett., 2014; 1 (1), pp 26–30

197. Environmental Protection Agency. How Wastewater Treatment Works. The Basics. Available at: https://www3.epa.gov/npdes/pubs/bastre.pdf . Accessed on September 2016.

198. Xi C, Zhang Y, Marrs CF, et al. Prevalence of antibiotic resistance in drinking water treatment and distribution systems. Applied and environmental microbiology 2009; 75:5714-8.

199. Figueras MJ, Borrego JJ. New perspectives in monitoring drinking water microbial quality. International journal of environmental research and public health 2010; 7:4179-202.

200. Curriero FC, Patz JA, Rose JB, Lele S. The association between extreme precipitation and waterborne disease outbreaks in the United States, 1948-1994. American journal of public health 2001; 91:1194-9.

201. Auld H, MacIver D, Klaassen J. Heavy rainfall and waterborne disease outbreaks: the Walkerton example. Journal of toxicology and environmental health Part A 2004; 67:1879-87.

202. Payment P, Berte A, Prevost M, Menard B, Barbeau B. Occurrence of pathogenic microorganisms in the Saint Lawrence River (Canada) and comparison of health risks for populations using it as their source of drinking water. Canadian journal of microbiology 2000; 46:565-76.

203. Hinthong W, Indrawattana N, Pitaksajjakul P, et al. Effect of Temperature on Fimbrial Gene Expression and Adherence of Enteroaggregative Escherichia coli. International journal of environmental research and public health 2015; 12:8631-43.

204. Thomas KM, Charron DF, Waltner-Toews D, Schuster C, Maarouf AR, Holt JD. A role of high impact weather events in waterborne disease outbreaks in Canada, 1975 - 2001. International journal of environmental health research 2006; 16:167-80.

68

205. Viau R, Frank KM, Jacobs MR, et al. Intestinal Carriage of Carbapenemase-Producing Organisms: Current Status of Surveillance Methods. Clinical microbiology reviews 2016; 29:1-27.

206. Samra Z, Bahar J, Madar-Shapiro L, Aziz N, Israel S, Bishara J. Evaluation of CHROMagar KPC for rapid detection of carbapenem-resistant Enterobacteriaceae. Journal of clinical microbiology 2008; 46:3110-1.

207. Schechner V, Straus-Robinson K, Schwartz D, et al. Evaluation of PCR-based testing for surveillance of KPC-producing carbapenem-resistant members of the Enterobacteriaceae family. Journal of clinical microbiology 2009; 47:3261-5.

208. Hong DJ, Bae IK, Jang IH, Jeong SH, Kang HK, Lee K. Epidemiology and Characteristics of Metallo-beta-Lactamase-Producing Pseudomonas aeruginosa. Infection & chemotherapy 2015; 47:81-97.

209. Hughes HY, Conlan SP, Lau AF, et al. Detection and Whole-Genome Sequencing of Carbapenemase-Producing Aeromonas hydrophila Isolates from Routine Perirectal Surveillance Culture. Journal of clinical microbiology 2016; 54:1167-70.

210. Martinez T, Martinez I, Vazquez GJ, Aquino EE, Robledo IE. Genetic environment of the KPC gene in Acinetobacter baumannii ST2 clone from Puerto Rico and genomic insights into its drug resistance. Journal of medical microbiology 2016.

211. Montana S, Cittadini R, Del Castillo M, et al. Presence of New Delhi metallo-beta-lactamase gene (NDM-1) in a clinical isolate of Acinetobacter junii in Argentina. New microbes and new infections 2016; 11:43-4.

212. Aghamiri S, Amirmozafari N, Fallah Mehrabadi J, Fouladtan B, Hanafi Abdar M. Antibiotic Resistance Patterns and a Survey of Metallo-beta-Lactamase Genes Including bla-IMP and bla-VIM Types in Acinetobacter baumannii Isolated from Hospital Patients in Tehran. Chemotherapy 2016; 61:275-80.

213. Wisconsin Veterinary Diagnostic Laboratory. Real Time PCR Ct Values. Available at: http://www.wvdl.wisc.edu/wp-content/uploads/2013/01/WVDL.Info_.PCR_Ct_Values1.pdf. Accessed July 2016.

214. Dortet L, Poirel L, Nordmann P. Worldwide dissemination of the NDM-type carbapenemases in Gram-negative bacteria. BioMed research international 2014; 2014:249856.

215. Rizek C, Fu L, Dos Santos LC, et al. Characterization of carbapenem-resistant Pseudomonas aeruginosa clinical isolates, carrying multiple genes coding for this antibiotic resistance. Annals of clinical microbiology and antimicrobials 2014; 13:43.

216. O'Horo JC, Farrell A, Sohail MR, Safdar N. Carbapenem-resistant Enterobacteriaceae and endoscopy: An evolving threat. American journal of infection control 2016.

69

217. Pantel A, Richaud-Morel B, Cazaban M, Bouziges N, Sotto A, Lavigne JP. Environmental persistence of OXA-48-producing Klebsiella pneumoniae in a French intensive care unit. American journal of infection control 2016; 44:366-8.

218. Clarivet B, Grau D, Jumas-Bilak E, et al. Persisting transmission of carbapenemase-producing Klebsiella pneumoniae due to an environmental reservoir in a university hospital, France, 2012 to 2014. Euro surveillance : bulletin Europeen sur les maladies transmissibles = European communicable disease bulletin 2016; 21.

219. Leitner E, Zarfel G, Luxner J, et al. Contaminated handwashing sinks as the source of a clonal outbreak of KPC-2-producing Klebsiella oxytoca on a hematology ward. Antimicrobial agents and chemotherapy 2015; 59:714-6.

220. Kotsanas D, Wijesooriya WR, Korman TM, et al. "Down the drain": carbapenem-resistant bacteria in intensive care unit patients and handwashing sinks. The Medical journal of Australia 2013; 198:267-9.

221. Snitkin ES, Zelazny AM, Thomas PJ, et al. Tracking a hospital outbreak of carbapenem-resistant Klebsiella pneumoniae with whole-genome sequencing. Science translational medicine 2012; 4:148ra16.

222. Seara N, Oteo J, Carrillo R, et al. Interhospital spread of NDM-7-producing Klebsiella pneumoniae belonging to ST437 in Spain. International journal of antimicrobial agents 2015; 46:169-73.

223. Soothill JS. Carbapenemase-bearing Klebsiella spp. in sink drains: investigation into the potential advantage of copper pipes. The Journal of hospital infection 2016; 93:152-4.

224. Jamal W, Rotimi VO, Albert MJ, Khodakhast F, Nordmann P, Poirel L. High prevalence of VIM-4 and NDM-1 metallo-beta-lactamase among carbapenem-resistant Enterobacteriaceae. Journal of medical microbiology 2013; 62:1239-44.

225. Sonnevend A, Ghazawi AA, Hashmey R, et al. Characterization of Carbapenem-Resistant Enterobacteriaceae with High Rate of Autochthonous Transmission in the Arabian Peninsula. PloS one 2015; 10:e0131372.

226. Couturier M, Bex F, Bergquist PL, Maas WK. Identification and classification of bacterial plasmids. Microbiological reviews 1988; 52:375-95.

227. Novick RP. Plasmid incompatibility. Microbiological reviews 1987; 51:381-95.

228. Almeida AC, Cavalcanti FL, Martins WM, et al. First description of KPC-2-producing Klebsiella oxytoca in Brazil. Antimicrobial agents and chemotherapy 2013; 57:4077-8.

229. Almeida AC, de Sa Cavalcanti FL, Vilela MA, Gales AC, de Morais MA, Jr., Camargo de Morais MM. Escherichia coli ST502 and Klebsiella pneumoniae ST11 sharing an IncW plasmid harbouring the bla(KPC-2) gene in an Intensive Care Unit patient. International journal of antimicrobial agents 2012; 40:374-6.

70

230. Almeida AC, Vilela MA, Cavalcanti FL, Martins WM, Morais MA, Jr., Morais MM. First description of KPC-2-producing Pseudomonas putida in Brazil. Antimicrobial agents and chemotherapy 2012; 56:2205-6.

231. Chen L, Chavda KD, Al Laham N, et al. Complete nucleotide sequence of a blaKPC-harboring IncI2 plasmid and its dissemination in New Jersey and New York hospitals. Antimicrobial agents and chemotherapy 2013; 57:5019-25.

232. Chen L, Chavda KD, Fraimow HS, et al. Complete nucleotide sequences of blaKPC-4- and blaKPC-5-harboring IncN and IncX plasmids from Klebsiella pneumoniae strains isolated in New Jersey. Antimicrobial agents and chemotherapy 2013; 57:269-76.

233. Gootz TD, Lescoe MK, Dib-Hajj F, et al. Genetic organization of transposase regions surrounding blaKPC carbapenemase genes on plasmids from Klebsiella strains isolated in a New York City hospital. Antimicrobial agents and chemotherapy 2009; 53:1998-2004.

234. Leavitt A, Chmelnitsky I, Carmeli Y, Navon-Venezia S. Complete nucleotide sequence of KPC-3-encoding plasmid pKpQIL in the epidemic Klebsiella pneumoniae sequence type 258. Antimicrobial agents and chemotherapy 2010; 54:4493-6.

235. Naas T, Bonnin RA, Cuzon G, Villegas MV, Nordmann P. Complete sequence of two KPC-harbouring plasmids from Pseudomonas aeruginosa. The Journal of antimicrobial chemotherapy 2013; 68:1757-62.

236. Haraoui LP, Levesque S, Lefebvre B, et al. Polyclonal outbreak of KPC-3-producing Enterobacter cloacae at a single hospital in Montreal, Quebec, Canada. Journal of clinical microbiology 2013; 51:2406-8.

237. Cuzon G, Naas T, Nordmann P. Functional characterization of Tn4401, a Tn3-based transposon involved in blaKPC gene mobilization. Antimicrobial agents and chemotherapy 2011; 55:5370-3.

238. Di Luca MC, Sorum V, Starikova I, et al. Low biological cost of carbapenemase-encoding plasmids following transfer from Klebsiella pneumoniae to Escherichia coli. The Journal of antimicrobial chemotherapy 2016.

239. Sidjabat HE, Silveira FP, Potoski BA, et al. Interspecies spread of Klebsiella pneumoniae carbapenemase gene in a single patient. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America 2009; 49:1736-8.

240. Adler A, Navon-Venezia S, Moran-Gilad J, Marcos E, Schwartz D, Carmeli Y. Laboratory and clinical evaluation of screening agar plates for detection of carbapenem-resistant Enterobacteriaceae from surveillance rectal swabs. Journal of clinical microbiology 2011; 49:2239-42.

241. Leavitt A, Carmeli Y, Chmelnitsky I, Goren MG, Ofek I, Navon-Venezia S. Molecular epidemiology, sequence types, and plasmid analyses of KPC-producing Klebsiella pneumoniae strains in Israel. Antimicrobial agents and chemotherapy 2010; 54:3002-6.

71

242. Korzeniewska E, Harnisz M. Culture-Dependent and Culture-Independent Methods in Evaluation of Emission of Enterobacteriaceae from Sewage to the Air and Surface Water. Water, air, and soil pollution 2012; 223:4039-46.

243. Kilunga PI, Kayembe JM, Laffite A, et al. The impact of hospital and urban wastewaters on the bacteriological contamination of the water resources in Kinshasa, Democratic Republic of Congo. Journal of environmental science and health Part A, Toxic/hazardous substances & environmental engineering 2016:1-9.

244. Korzeniewska E, Harnisz M. Extended-spectrum beta-lactamase (ESBL)-positive Enterobacteriaceae in municipal sewage and their emission to the environment. Journal of environmental management 2013; 128:904-11.

245. Mokracka J, Koczura R, Kaznowski A. Multiresistant Enterobacteriaceae with class 1 and class 2 integrons in a municipal wastewater treatment plant. Water research 2012; 46:3353-63.

246. Girlich D, Poirel L, Nordmann P. First isolation of the blaOXA-23 carbapenemase gene from an environmental Acinetobacter baumannii isolate. Antimicrobial agents and chemotherapy 2010; 54:578-9.

247. Isozumi R, Yoshimatsu K, Yamashiro T, et al. bla(NDM-1)-positive Klebsiella pneumoniae from environment, Vietnam. Emerging infectious diseases 2012; 18:1383-5.

248. Chagas TP, Seki LM, da Silva DM, Asensi MD. Occurrence of KPC-2-producing Klebsiella pneumoniae strains in hospital wastewater. The Journal of hospital infection 2011; 77:281.

249. Dallenne C, Da Costa A, Decre D, Favier C, Arlet G. Development of a set of multiplex PCR assays for the detection of genes encoding important beta-lactamases in Enterobacteriaceae. The Journal of antimicrobial chemotherapy 2010; 65:490-5.

250. Yeung R, Eshaghi A, Lombos E, et al. Characterization of culture-positive adenovirus serotypes from respiratory specimens in Toronto, Ontario, Canada: September 2007-June 2008. Virology journal 2009; 6:11.

72

Figures

Figure 1.1 β-lactam Ring

Figure 1.2 Structural Differences between Penicillin and Carbapenem β-lactamases cleave the bond between nitrogen and carboxyl group on the β-lactam ring.

Penicillin G Carbapenem backbone

C2

C3

C1

73

Figure 2.1.1 Map of Sewage Treatment Plants (STPs) in the Greater Toronto Area (GTA)

Five STPs present in the GTA is shown above. Influent sewage at Toronto STP was collected immediately after grit removal of large

items such as bushes, plastic bags, and garbage, while influent sewage at Lakeview (Peel) STP was collected pre-grit removal. All

effluent sewage was collected after the de-chlorination step.

74

Figure 2.1.2 Surface Water Sites

Surface water was collected along the Humber River (Pine Grove, Clarence, Albion, Jane, Old Mill); at a stormwater outfall (Riverside);

and by the beach: SSI-C in Toronto.

Pine Grove

Clarence

Albion

Jane

Old Mill

Riverside SSI-C

75

Figure 2.1.3 Filter growth of Organisms

Culture of organisms from sewage filtered on a 0.45µm pore size membrane filter is displayed

(See Section 2.1.4 for description of filtration process). This picture displays confluent growth of

organisms and the various phenotypes including lactose fermenters, non-lactose fermenters,

mucoid, and non-mucoid. Organisms which appeared to be phenotypically distinct from another

was picked and purified on MacConkey w/o salt agar and subjected to further testing to confirm

its carbapenemase producing ability.

76

Figure 2.2.1.4 Proportion of CPE positives by STP

The proportion of CPE-positive specimens received from each site is displayed. Fisher’s exact

test showed that Ashbridges Bay (P<0.0003) and Humber (P<0.02) STP had a higher proportion

of specimens yielding CPE positives when compared with the other three STPs separately.

77

Figure 2.2.1.5 Proportion of species by STP

Proportions of different species identified from each site are displayed. The number of unique

CPE isolates obtained from each site is shown above each bar. Fisher’s exact test for RxC

showed that there was no significant difference in the proportion of C. freundii, E. cloacae, K.

intermedia, K. oxytoca, K. pneumoniae, and Raoultella spp. between the STPs (P>0.05).

However, there was a lower proportion of E. coli identified from Ashbridges STP compared to

TNT (P=0.046).

n=2 n=3 n=10 n=34 n=123

78

Figure 2.2.1.6 Proportion of Carbapenemase Genes by STP

Proportions of carbapenemase genes in CPE isolated from each site are displayed. The number

of unique CPE isolates obtained from each site is shown above each bar. Fisher’s exact test for

RxC showed that there was a significantly higher proportion of blaKPC positive isolates from

Ashbridges STP compared to Humber (P=0.026), Highland (P=0.003), and TNT (P=0.018) STPs

but not compared to Peel STP (P=0.14). Humber STP also had a higher proportion of blaKPC

specimens than Highland STP (P=0.04).

There was also a significantly higher proportion of isolates yielding blaGES CPE from Highland

STP compared to Ashbridges (P=0.02) and Humber (P=0.02).

Lastly, there was no significant difference in the proportion of blaVIM and blaOXA-48-like between

the five STPs when corrected for multiple comparisons (P>0.05).

n=2 n=3 n=10 n=34 n=123

79

Figure 2.2.1.7 Proportion of CPE by Influent and Effluent Trunk

The number of CPE positive specimens over the total number of specimens obtained from each

trunk is shown above each bar. All CPE positive specimens at Peel STP were obtained from the

influent trunk and was significantly different (P=0.021, Fisher’s exact test). There was no

statistically significant difference in CPE proportions between the influent and effluent trunks at

the other four sites (P=1.0, Fisher’s exact test). (In: influent trunk; Eff: effluent trunk).

80

Figure 2.2.1.8 Distribution of Species from Influent and Effluent Trunks at Ashbridges and Humber STP

Proportions of each species identified from the trunks of Ashbridges and Humber STP are

displayed. The number of unique species from each trunk is shown inside the stacked bars.

Fisher’s exact test for RxC showed that there was no significant difference between the

proportion of each species found between each trunk from a site. (In: influent trunk; Eff: effluent

trunk).

n=17 n=17 n=43 n=80

81

Figure 2.2.1.9 Distribution of Genes from Influent and Effluent Trunks at Ashbridges and Humber STP Proportions of genotypes identified from the trunks of Ashbridges and Humber STP are

displayed. The total number of unique CPE isolates obtained from each trunk is shown above

each bar. Fisher’s exact test for RxC showed that there was no difference in the distribution of

carbapenemases between the influent and effluent trunks at both Ashbridges Bay and Humber

STPs. (In: influent trunk; Eff: effluent trunk).

n=17 n=17 n=43 n=80

82

Figure 2.2.1.10 Summary of CPE isolated from STP

All unique CPE isolates obtained from STP are shown based on STP, trunk, species, and genotype.

83

Figure 2.2.2.1 Comparison of ln (E. coli counts) from Influent and Effluent Trunks based on CPE Negative and Positive Specimens ln (E. coli counts) of influent and effluent specimens, separated by CPE positive and negatives,

are displayed. The total number of unique CPE isolates obtained from each trunk is shown above

each box plot. CPE positive specimens had a higher E. coli count than CPE negative specimens

in both influent (p= 0.0583) and effluent trunks (p=0.0413, Wilcoxon Rank Sum test).

84

Figure 2.2.5.1 Visual Representation of the 3 Carbapenemase Detection Methods

85

Figure 2.2.5.2 Comparison of 3 Carbapenemase Detection Methods The proportion of specimens detecting carbapenemases are shown based on detection method,

carbapenemase gene, and by influent and effluent specimens. There was no significant difference

in the detection of carbapenemases by the three methods between the influent and effluent

trunks.

There was agreement between the culture and filter sweep PCR method for detection of the

blaKPC gene while no agreement was observed for blaVIM and blaOXA-48-like genes. There was a

significant difference between the proportion of specimens positive by raw sewage PCR method

compared to the filter sweep PCR method. The proportion of specimens detecting blaNDM was

similar for all three methods.

86

Figure 3.2.1 PFGE of blaVIM isolates PFGE of blaVIM positive E. cloacae water and clinical isolates are shown above. There were 3

patterns by PFGE which appear unrelated

Pattern A (in Purple) contained one Surface Water #7 isolate which was 74.7% similar to 6

clinical isolates coming from 4 patients. These isolates were collected in 2011 and 2012, and

come from 3 different hospitals.

Pattern B (in red) contained one isolate from Ashbridges Bay (H2O2015ID-#122) which was

related to 6 other clinical isolates coming from 4 different patients. The clinical isolates are

linked by Hospital D and were collected between 2014 and 2015.

Pattern C (in green) contains one patient (#9) who was unrelated to the two clusters and was

positive for both blaOXA-1 and blaVIM. This patient had a travel and hospitalization history in

Split, Croatia during a time when Split was experiencing a blaVIM-outbreak.

87

Figure 3.2.2.1 PFGE of K. oxytoca CPE from 2015 and 2012 Water, compared to Clinical Isolates

CPE number Date Specimen Collected Site Organism Gene H2O2015ID-07 2015.06.17 Ashbridges Influent P K. oxytoca blaKPC H2O2015ID-165 2015.08.06 Ashbridges Effluent K. oxytoca blaKPC H2O2015ID-26 2015.06.17 Ashbridges Influent P K. oxytoca blaKPC H2O2015ID-19 2015.06.17 Humber Effluent K. oxytoca blaKPC H2O2012ID-2 2012.07.31 Ashbridges In K. oxytoca blaKPC H2O2012ID-9 2012.08.21 North Toronto K. oxytoca blaGES H2O2015ID-138 2015.08.06 Ashbridges Influent 4 K. oxytoca blaKPC H2O2015ID-139 2015.08.06 Ashbridges Influent 4 K. oxytoca blaKPC H2O2012ID-7 2012.10.15 Ashbridges Effluent K. oxytoca blaGES H2O2012ID-8 2012.11.15 Ashbridges In K. oxytoca blaGES H2O2012ID-5 2012.06.29 Ashbridges In K. oxytoca blaKPC H2O2012ID-4 2012.11.15 Humber K. oxytoca blaKPC H2O2015ID-132 2015.07.23 Highland Effluent K. oxytoca blaGES H2O2015ID-108 2015.07.23 Ashbridges Effluent K. oxytoca blaKPC ClinKoxyKPC-#3 2015.09.28 Hospital G K. oxytoca blaKPC ClinKoxyKPC-#4 2015.08.24 Hospital H K. oxytoca blaKPC H2O2015ID-25 2015.06.17 Ashbridges Influent P K. oxytoca blaKPC H2O2015ID-92 2015.07.23 Ashbridges Influent 6 K. oxytoca blaKPC H2O2015ID-119 2015.07.23 Ashbridges Effluent K. oxytoca blaKPC H2O2015ID-45 2015.07.08 Ashbridges Effluent K. oxytoca blaKPC H2O2015ID-128 2015.07.23 Humber Effluent K. oxytoca blaKPC H2O2015ID-35 2015.06.17 Ashbridges Influent P K. oxytoca CPE negative H2O2012ID-6 2012.09.12 Ashbridges In K. oxytoca blaKPC H2O2015ID-159 2015.08.06 Peel Influent K. oxytoca blaKPC H2O2015ID-47 2015.07.08 Ashbridges Effluent K. oxytoca blaKPC H2O2015ID-48 2015.07.08 Ashbridges Effluent K. oxytoca blaKPC H2O2015ID-88 2015.07.08 Ashbridges Influent D K. oxytoca blaKPC H2O2015ID-130 2015.07.23 Ashbridges Effluent K. oxytoca blaKPC H2O2015ID-96 2015.07.23 Ashbridges Effluent K. oxytoca blaKPC H2O2015ID-05 2015.06.17 Ashbridges Influent P K. oxytoca blaKPC H2O2015ID-115 2015.07.23 Ashbridges Effluent K. oxytoca blaKPC H2O2015ID-23 2015.06.17 Ashbridges Effluent K. oxytoca blaKPC H2O2015ID-30 2015.06.17 Ashbridges Influent D K. oxytoca blaKPC H2O2015ID-18 2015.06.17 Humber Effluent K. oxytoca blaKPC H2O2015ID-46 2015.07.08 Ashbridges Effluent K. oxytoca blaKPC H2O2012ID-1 2012.07.13 Ashbridges In K. oxytoca blaKPC ClinKoxyKPC-#1 2015.02.04 Hospital B K. oxytoca blaKPC H2O2012ID-10 2012.08.21 Ashbridges In K. oxytoca blaKPC H2O2012ID-3 2012.08.21 Ashbridges Effluent K. oxytoca blaKPC ClinKoxyKPC-#2 2012.06.07 Hospital F K. oxytoca blaKPC H2O2015ID-24 2015.06.17 Ashbridges Influent D K. oxytoca blaGES

100

806040

87.5

79.4

59.5

81.1

97.6

65.4

97.3

71.2

62.6

54.9

64.9

57.4

51.6

62.9

92.3

92.7

73.8

57.2

68.3

62.4

59.1

55.1

100

94.1

94.1

96.6

89.5

83.4

78.3

51.9

50.7

58.1

46.2

46

44.7

100

52

43.3

38.9

Figure 3.2.2.1 PFGE of K. oxytoca CPE from 2015 and 2012 Water, compared to Clinical Isolates KOXY15-A Clone A is represented in blue; all clinical isolates are in yellow; all 2012 isolates are in green. Clinical K. oxytoca specimens were not related to environmental samples as shown by <50% similarity with all water CPE tested. No clonal relationships were observed between: 2015 H2O CPEs from different STPs (#18, 19, 128, 132, 159 vs everything else), CPEs within Humber STP in 2015 alone (#18, 19, 128), and CPEs collected in 2012 vs 2015. Clone KOXY15-A consists of K. oxytoca samples from Ashbridges Bay STP related by >76.8% similarity; this clone is seen in both influent and effluent trunks and were obtained on three different sampling dates.

88

Figure 3.2.2.2 PFGE of blaGES harboring organisms from sewage specimens + Related isolates from Influent to Effluent

All 2012 and 2015 blaGES positive isolates are shown in this pulse field. There appeared to be no relationship between the 2012 and

2015 K. oxytoca blaGES isolates tested in this study. However, within the 2012 isolates, two isolates (H2O2012-#7 and #8) which were

obtained on two different dates and from different trunks at Ashbridges Bay STP were 97.3% similar to each other.

Date Specimen Collected Site

Gene Organism

H2O2012-7 2012.10.15 Ashbridges Effluent + blaGES K. oxytoca H2O2012-8 2012.11.15 Ashbridges In + blaGES K. oxytoca H2O2012-9 2012.08.21 North Toronto blaGES K. oxytoca H2O2015-132 2015.07.23 Highland Eff blaGES K. oxytoca H2O2015-24 2015.06.17 Ash In D blaGES K. oxytoca

100

50

97.3

68.5

55.6

34.1

89

Figure 3.2.2.3 PFGE of K. oxytoca CPE from 2012 * Different carbapenemase genes present in similar clone + Identical isolates from Influent to Effluent

K. oxytoca CPE isolated from a 2012 study by our lab is displayed. H2O2012-#3 and #10 (in red) came from different sewage trunks

(influent vs effluent) and were identical to each other. H2O2012-#2 and #9 (in green) are isolates coming from two different STPs

carrying different carbapenemase genes; they were 81.1% similar.

Date Specimen Collected Site Gene

Organism

H2O2012-7 2012.10.15 Ashbridges Effluent blaGES K. oxytoca H2O2012-8 2012.11.15 Ashbridges In blaGES K. oxytoca H2O2012-5 2012.06.29 Ashbridges In blaKPC K. oxytoca H2O2012-2 2012.07.31 Ashbridges In3 blaKPC * K. oxytoca H2O2012-9 2012.08.21 North Toronto blaGES * K. oxytoca H2O2012-4 2012.11.15 Humber blaKPC K. oxytoca H2O2012-1 2012.07.13 Ashbridges In blaKPC K. oxytoca H2O2012-10 2012.08.21 Ashbridges In + blaKPC K. oxytoca H2O2012-3 2012.08.21 Ashbridges Effluent + blaKPC K. oxytoca H2O2012-6 2012.09.12 Ashbridges In blaKPC K. oxytoca

100

9080706050

97.3

71.2

81.1

62.5

56

50.8

100

53.3

49

90

Tables

Table 1.6.1 Antibiotic Resistant Bacteria found in Sewage Authors Year Isolated Country Reference Al-Jassim et al. 2015 ARB, ARG Saudi Arabia [127] Ferreira da Silva et al. 2007 ARB Portugal [132] Galvin et al. 2010 ARB Ireland [161] Huang et al. 2012 ARB China [129] Korzeniewska et al. 2013 ESBL Poland [244] Korzeniewska et al. 2013 ESBL Poland [136] Mao et al. 2015 ARG China [190] Mokracka et a. 2012 ARB Poland [245] Roderova et al. 2016 ARB, ARG Czech Republic [165] Szczepanowski et al. 2009 ARG Germany [133] *ARB: Antibiotic Resistant Bacteria; ARG: Antibiotic Resistant Genes; ESBL: Extended-Spectrum Beta-lactamases

Table 1.6.2 CPE in Surface Water

Authors Year Isolated Country Reference Fernando et al. 2016 Carbapenemase Genes Canada [179] Girlich et al. 2010 CPO France [246] Isozumi et al. 2012 CPE Vietnam [247] Kieffer et al. 2016 CPE Portugal [180] Kumarasamy et al. 2010 CPE India, Pakistan, UK [62] Poirel et al. 2012 CPE Portugal [181] Potron et al. 2011 Carbapenemase Genes Morocco [117] Walsh et al. 2011 CPE India [61] Zurfluh et al. 2013 CPE and ESBLs Switzerland [183]

91

Table 1.6.3 ARG in Hospital Sewage Authors Year Isolated Country Reference #

Chagas et al. 2011 ESBL Brazil [135] Chagas et al. 2011 CPE Brazil [248] Galvin et al. 2010 ARB Ireland [161] Hocquet et al. 2016 ARB France [162] Koh et al. 2015 CPE Singapore [163] Prado et al. 2008 ESBL Brazil [164] Roderova et al. 2016 ARB, ARG Czech Republic [165] Yang et al. 2009 ARB Taiwan [166]

*ARB: Antibiotic Resistant Bacteria; ARG: Antibiotic Resistant Genes; ESBL: Extended-Spectrum Beta-lactamases

92

Table 2.1.11 CPE Multiplex Primers Primer name Primer sequence Expected Sizes

MultiGES_for AGTCGGCTAGACCGGAAAG 399

MultiGES_rev TTTGTCCGTGCTCAGGAT

MultiOXA-48_for GCTTGATCGCCCTCGATT 281

MultiOXA-48_rev GATTTGCTCCGTGGCCGAAA

MultiNDM-F AATGGAATTGCCCAATATTATGC 490

MultiNDM-R CGAAAGTCAGGCTGTGTTGC

MultiKPC_for CATTCAAGGGCTTTCTTGCTGC 538

MultiKPC_rev ACGACGGCATAGTCATTTGC

MultiVIM_for GATGGTGTTTGGTCGCATA 390

MultiVIM_rev CGAATGCGCAGCACCAG

MultiIMP_for* GTTTATGTTCATACWTCGTTYG 232

MultiIMP_rev GATYGAGAATTAAGCCACYCT

16s rRNA-F AGGAGGTGATCCAACCGCA 370

16s rRNA-R AACTGGAGGAAGGTGGGGAT

Adapted from Dallenne et al. (2010) [249]

* MultiIMP_forward Primer designed at Public Health Ontario

93

Table 2.1.12 Primer and Probe specification for ABI7500 RT-PCR

CRE gene

Name Sequence5’->3’ Detector Quencher

Mul

tiple

x 1

*

KPC

KPC-F Primer GGCCGCCGTGCAATAC FAM BHQ1

KPC-R Primer GCCGCCCAACTCCTTCA

KPC-Probe (FAM) 5’-FAM-TGATAACGCCGCCGCCAATTTGT-BHQ1-3’

NDM

NDM-F Primer GACCGCCCAGATCCTCAA VIC BHQ1

NDM-R Primer CGCGACCGGCAGGTT

NDM-Probe (HEX) 5’-HEX-TGGATCAAGCAGGAGAT-BHQ1-3’

16S

16S rRNA-F TGGAGCATGTGGTTTAATTCGA CY5 BHQ2

16S rRNA-R TGCGGGACTTAACCCAACA

16S rRNA-Probe (CY5)

5’-Cy5-CACGAGCTGACGACARCCATGCA-BHQ2-3’

Mul

tiple

x 2

+

OXA

OXA-F Primer TGCTCACTTTACTGAACA FAM BHQ1

OXA-R Primer GCCCGTTTAAGATTATTGG

OXA-Probe (FAM) 5’FAM-TCATTCCAGAGCACAACTACGC-BHQ1-3’

GES

GES-F Primer GAGAGATTACGCTGTAGC VIC BHQ1

GES-R Primer CAGGATGAGTTGTGTAATAAC

GES-Probe HEX (VIC) 5’-HEX-CAGAGGCAACTAATTCGTCACGT-BHQ1-3’

VIM

VIM-F Primer GATGGTGTTTGGTCGCATA CY5 BHQ2

VIM-R Primer CCACGCTGTATCAATCAA

VIM-Probe (CY5) 5’-CY5-AACTCATCACCATCACGGACAATG-BHQ2-3’

*REF: adapted from CDC, 2011 [153] + REF: adapted from PHL, 2013 [154]

94

Table 2.1.13 Replicon Typing Panel Replicon Multiplex

Primer Sequence (5'→3') Annealing Temp (◦C)

Amplicon (base pairs)

1 FIC-F GTGAACTGGCAGATGAGGAAGG 60 262 FIC-R TTCTCCTCGTCGCCAAACTAGAT A/C-F GAGAACCAAAGACAAAGACCTGGA 60 465 A/C-R ACGACAAACCTGAATTGCCTCCTT

2 W-F CCTAAGAACAACAAAGCCCCCG 60 242 W-R GGTGCGCGGCATAGAACCGT FIA-F CCATGCTGGTTCTAGAGAAGGTG 60 462 FIA-R GTATATCCTTACTGGCTTCCGCAG FIB-F GGAGTTCTGACACACGATTTTCTG 60 702 FIB-R CTCCCGTCGCTTCAGGGCATT K/B-F GCGGTCCGGAAAGCCAGAAAAC 60 160 K/B-R TCTTTCACGAGCCCGCCAAA

3 HI1-F GGAGCGATGGATTACTTCAGTAC 60 471 HI1-R TGCCGTTTCACCTCGTGAGTA N-F GTCTAACGAGCTTACCGAAG 60 559 N-R GTTTCAACTCTGCCAAGTTC HI2-F TTTCTCCTGAGTCACCTGTTAACAC 60 644 HI2-R GGCTCACTACCGTTGTCATCCT L/M-F GGATGAAAACTATCAGCATCTGAAG 60 785 L/M-R CTGCAGGGGCGATTCTTTAGG I1-F CGAAAGCCGGACGGCAGAA 60 139 I1-R TCGTCGTTCCGCCAAGTTCGT X-F AACCTTAGAGGCTATTTAAGTTGCTGAT 60 376 X-R TGAGAGTCAATTTTTATCTCATGTTTTAGC

4 Frep-F TGATCGTTTAAGGAATTTTG 50 270 Frep-R GAAGATCAGTCACACCATCC Y-F AATTCAAACAACACTGTGCAGCCTG 50 765 Y-R GCGAGAATGGACGATTACAAAACTTT P-F CTATGGCCCTGCAAACGCGCCAGAAA 50 534 P-R TCACGCGCCAGGGCGCAGCC

5 B/O-F GCGGTCCGGAAAGCCAGAAAAC 60 159 B/O-R TCTGCGTTCCGCCAAGTTCGA T-F TTGGCCTGTTTGTGCCTAAACCAT 60 750 T-R CGTTGATTACACTTAGCTTTGGAC FIIA-F CTGTCGTAAGCTGATGGC 60 270 FIIA-R CTCTGCCACAAACTTCAGC Adapted from Carattoli et al (2005) [158] and Johnson et al, 2007 [159].

95

Table 2.2.1 Number of specimens and unique CPE isolates obtained from STP Influent and Effluent

Sewage Treatment Plant (STP)

# of Specimens received from

Influent

# of Specimens received from

Effluent

# of unique CPE from Influent

# of unique CPE from Effluent

Ashbridges Bay 28 11 80 43 Humber 10 10 17 17

Peel 7 7 10 0 Highland Creek 6 6 2 1 North Toronto 9 9 0 2

Total 60 43 109 63

Number of specimens received from each sewage treatment plant by trunk.

Table 2.2.2 Dates Specimens Received

Date of Collection # of STP specimens received # of Unique CPE

from Influent # of Unique CPE

from Effluent 2015/06/17 7 11 10 2015/07/08 10 14 11 2015/07/23 12 8 15 2015/08/06 12 21 9 2015/10/15 10 2 1 2015/11/18 8 11 3 2015/11/25 12 10 3 2015/12/10 10 13 5 2016/01/14 10 9 2 2016/02/18 12 10 4

The numbers of unique CPE isolated from each collection date are displayed.

96

Table 2.2.1.1 CPE in Sewage Treatment Plants

blaKPC blaNDM blaGES blaOXA-48-like blaVIM

Total # of CPE isolates

% of Total CPE

C. freundii 25

25 14.5% E. cloacae 21

1 1 23 13.4%

E. coli 6 10

3

19 11.1% K. oxytoca 53

2

55 31.9%

K. pneumoniae 25 1

1

27 15.7% K. intermedia 2

2 1.2%

Raoultella spp. 20

1

21 12.2% Total # of CPE isolates 152 11 4 4 1 172

% of Total CPE 88.4% 6.4% 2.3% 2.3% 0.6%

The number of isolates for each carbapenemase/species combination is displayed. blaKPC was

identified in all 7 different species while blaGES was isolated from E. cloacae, K. oxytoca, and

Raoultella spp. blaVIM was only isolated from E. cloacae while both blaNDM and blaOXA-48-like was

identified in E. coli and K. pneumoniae. E. coli differed in the distribution of carbapenemases

and had a higher proportion of blaNDM carbapenemase than the other organisms (p<0.0001).

97

Table 2.2.3 Temperature and Precipitation Records Date of Meteorological Measurements *

Mean Temp (°C) Total Precipitation

(mm) Proportion of Specimens

Yielding CPE 2015/06/16 21.2 17.7 0.71 2015/07/07 19.25 8.3 0.7 2015/07/22 21 0 0.58 2015/08/05 18.2 0 0.58 2015/10/14 11.1 0 0.3 2015/11/17 11.6 0 0.5 2015/11/24 4 0 0.58 2015/12/09 8.1 0.3 0.5 2016/01/13 -7.2 0 0.5 2016/02/17 -4.5 0 0.58

*Meteorological data was taken one day after sewage collection.

All meteorological measurements were recorded by Environment Canada from Toronto City

Centre Airport Site [155]. There was no relationship between temperature and proportion of

specimens yielding CPE . When precipitation was grouped into ‘wet’ and ‘dry’ events, there was

also no relationship between precipitation and CPE yield (P=0.38).

98

Table 2.2.4.1 Surface Water Specimens Surface Water Type

Site # of Specimens received

Date Specimens Received

River

Albion 3 2015.07.20 2015.08.04 2015.08.10 Clarence 3 2015.07.20 2015.08.04 2015.08.10 Jane 3 2015.07.20 2015.08.04 2015.08.10 Old Mill 3 2015.07.20 2015.08.04 2015.08.10 Pine Grove 3 2015.07.20 2015.08.04 2015.08.10

Beach SSI-C 1 - - 2015.08.10 Outfall Riverside 2 2015.07.20 2015.08.04 - Total 18

Table 2.2.4.2 CPE found in Surface Water Date Specimens Collected

Site Organism Gene # of Unique CPE isolates

2015.07.20 Old Mill C. freundii blaKPC 1 K. oxytoca blaKPC 1

2015.08.04 Albion

C. koseri blaKPC 1 E. cloacae blaVIM 1 E. gergoviae blaKPC 2 Raoultella spp. blaKPC 2

1

99

Table 2.2.5.1a Comparison of results of Culture and RT-PCR from sweeps of cultured filters blaKPC

blaNDM

blaOXA-48-like

blaVIM

blaGES

Culture Filter PCR

Culture Filter PCR

Culture Filter PCR

Culture Filter PCR Culture Filter PCR

Pos Neg

Pos Neg

Pos Neg

Pos Neg Pos Neg

CPE Pos

41 (6)

2

Pos 7

(1) 1

Pos 3

(1) 0

Pos 1

(1) 0

Pos 5

(2) 0

Neg 6

(2) 23

Neg 2 62

Neg 27

(11) 42

Neg 34

(12) 37

Neg 53

(30) 14

The numbers in brackets indicate the number of specimens with a cycle threshold of >30

A comparison of specimens yielding CPE for culture and carbapenemases for filter sweeps is displayed. Culture positive specimens

agreed with filter PCR positive specimens for all carbapenemases. blaOXA-48-like, blaVIM, and blaGES, had many specimens which were

filter PCR positive but culture negative.

100

Table 2.2.5.1b Comparison of results of RT-PCR from sweeps of cultured filters and PCR from raw sewage DNA extract blaKPC

blaNDM

blaOXA-48-like

blaVIM

blaGES

Filter PCR

Raw Sewage PCR

Filter PCR

Raw Sewage PCR

Filter PCR

Raw Sewage PCR

Filter PCR

Raw Sewage PCR

Filter PCR

Raw Sewage PCR

Pos Neg

Pos Neg

Pos Neg

Pos Neg Pos Neg

CPE Pos

46 (19)

1

Pos 2

(2) 7

(1)

Pos 28

(18) 2

Pos 33

(21) 2

Pos 57

(32) 1

Neg 20

(14) 5

Neg 7

(7) 56

Neg 37

(15) 5

Neg 35

(20) 2

Neg 14 (6) 0

The numbers in brackets indicate the number of specimens with a cycle threshold of >30

A comparison of specimens yielding carbapenemases for filter sweeps and raw sewage is displayed. Raw sewage DNA had more

positives for blaKPC, blaOXA-48-like, blaVIM, and blaGES. blaNDM was different and raw sewage DNA did not yield higher number of

carbapenemases than from filter sweep DNA.

101

Table 2.2.5.1c Comparison of results of Culture and RT-PCR from raw sewage DNA extract

blaKPC blaNDM blaOXA-48-like blaVIM blaGES

Culture Raw

Sewage PCR

Culture Raw

Sewage PCR

Culture Raw Sewage PCR

Culture Raw Sewage PCR Culture

Raw Sewage

PCR Pos Neg

Pos Neg

Pos Neg

Pos Neg Pos Neg

CPE Pos

42 (19)

1

Pos 2

(2) 6

Pos 3 0

Pos 1

(1) 0

Pos 5 0

Neg 24

(14) 5

Neg 7

(7) 57

Neg 62

(23) 7

Neg 67 4

Neg 66

(16) 1

The numbers in brackets indicate the number of specimens with a cycle threshold of >30

A comparison of specimens yielding CPE for culture and carbapenemases for raw sewage DNA is displayed. The raw sewage PCR

method was more likely to identify blaKPC, blaOXA-48-like, blaVIM, and blaGES carbapenemases than by culture. For blaNDM, raw sewage

DNA did not yield higher number of carbapenemases than from culture.

102

Table 3.1.2 blaVIM E. cloacae Clinical and Water Isolates Isolate Number Date Specimen Rec'd Hospital Species Genotype

Surface-7 2015.08.04 Albion E. cloacae blaVIM H2O2015ID-122 2015.07.23 AB Effluent E. cloacae blaVIM

EcloVIM-A1 2011.07.19 B E. cloacae blaVIM-1 EcloVIM-A2 2012.02.23 B E. cloacae blaVIM-1 EcloVIM-A3 2012.06.25 C E. cloacae blaVIM EcloVIM-A4 2011.08.26 A E. cloacae blaVIM-1 EcloVIM-B5 2014.02.25 D, J E. cloacae blaVIM EcloVIM-B6 2014.06.30 D E. cloacae blaVIM EcloVIM-B7 2015.06.08 D E. cloacae blaVIM EcloVIM-B8 2015.09.27 D E. cloacae blaVIM EcloVIM-C9 2012.09.01 E E. cloacae blaVIM /blaOXA-1

Abbreviations: AB: Ashbridges Bay STP

All 2015 blaVIM E. cloacae water isolates and clinical isolates identified between 2007 and 2015

by the Toronto Invasive Bacterial Disease Network are shown.

103

Table 3.1.3 blaKPC K. oxytoca Clinical and Water Isolates Isolate Number Date Specimen Rec'd Site Species Genotype ClinKoxyKPC-#1 2015.02.04 B K. oxytoca blaKPC ClinKoxyKPC-#2 2012.06.07 F K. oxytoca blaKPC ClinKoxyKPC-#3 2015.09.28 G K. oxytoca blaKPC ClinKoxyKPC-#4 2015.08.24 H K. oxytoca blaKPC

H2O2012-1 2012.07.13 AB In K. oxytoca blaKPC H2O2012-2 2012.07.31 AB In K. oxytoca blaKPC H2O2012-3 2012.08.21 AB Eff K. oxytoca blaKPC H2O2012-4 2012.11.15 HUM K. oxytoca blaKPC H2O2012-5 2012.06.29 AB In K. oxytoca blaKPC H2O2012-6 2012.09.12 AB In K. oxytoca blaKPC H2O2012-7 2012.10.15 AB Eff K. oxytoca blaGES H2O2012-8 2012.11.15 AB In K. oxytoca blaGES H2O2012-9 2012.08.21 TNT K. oxytoca blaGES

H2O2012-10 2012.08.21 AB In K. oxytoca blaKPC H2O2015ID-5 2015.06.17 AB In P K. oxytoca blaKPC H2O2015ID-7 2015.06.17 AB In P K. oxytoca blaKPC

H2O2015ID-18 2015.06.17 HUM Eff K. oxytoca blaKPC H2O2015ID-19 2015.06.17 HUM Eff K. oxytoca blaKPC H2O2015ID-23 2015.06.17 AB Eff K. oxytoca blaKPC H2O2015ID-24 2015.06.17 AB In D K. oxytoca blaGES H2O2015ID-25 2015.06.17 AB In P K. oxytoca blaKPC H2O2015ID-26 2015.06.17 AB In P K. oxytoca blaKPC H2O2015ID-30 2015.06.17 AB In D K. oxytoca blaKPC H2O2015ID-45 2015.07.08 AB Eff K. oxytoca blaKPC H2O2015ID-46 2015.07.08 AB Eff K. oxytoca blaKPC H2O2015ID-47 2015.07.08 AB Eff K. oxytoca blaKPC H2O2015ID-48 2015.07.08 AB Eff K. oxytoca blaKPC H2O2015ID-88 2015.07.08 AB In D K. oxytoca blaKPC H2O2015ID-92 2015.07.23 AB In6 K. oxytoca blaKPC H2O2015ID-96 2015.07.23 AB Eff K. oxytoca blaKPC

H2O2015ID-108 2015.07.23 AB Eff K. oxytoca blaKPC H2O2015ID-115 2015.07.23 AB Eff K. oxytoca blaKPC H2O2015ID-119 2015.07.23 AB Eff K. oxytoca blaKPC H2O2015ID-128 2015.07.23 HUM Eff K. oxytoca blaKPC H2O2015ID-130 2015.07.23 AB Eff K. oxytoca blaKPC H2O2015ID-132 2015.07.23 HC Eff K. oxytoca blaGES H2O2015ID-138 2015.08.06 AB In 4 K. oxytoca blaKPC H2O2015ID-139 2015.08.06 AB In 4 K. oxytoca blaKPC H2O2015ID-159 2015.08.06 PEEL In K. oxytoca blaKPC H2O2015ID-165 2015.08.06 AB Eff K. oxytoca blaKPC H2O2015ID-35 2015.06.17 AB In P K. oxytoca CPE Neg

Abbreviations: AB: Ashbridges Bay STP; HC: Highland Creek STP; HUM: Humber STP;

PEEL: Peel STP; TNT: North Toronto STP; In: influent; Eff: effluent

104

Table 3.2.4.2 Replicon Typing Results

CPE ID Date Specimen Collected

Site IncN IncFIIA blaKPC (kB) blaKPC harboring IncN (kB)

blaKPC harboring IncFIIA (kB)

Organism

119 2015.07.23 Ashbridges Eff FIIA ~132

FIIA ~132 K. oxytoca H2O2012-6 2012.09.12 Ashbridges In FIIA ~100, ~175

FIIA ~100 K. oxytoca

H2O2012-1 2012.07.13 Ashbridges In FIIA ~120 FIIA ~120 K. oxytoca ClinKoxyKPC-#3 2015.09.28 Hospital G FIIA ~60 FIIA ~60 K. oxytoca ClinKoxyKPC-#4 2015.08.24 Hospital H FIIA ~55

FIIA ~55 K. oxytoca

H2O2012-3 2012.08.21 Ashbridges Eff FIIA ~55 FIIA ~55 K. oxytoca ClinKoxyKPC-#1 2015.02.04 Hospital B FIIA ~78 FIIA ~78 K. oxytoca

138 2015.08.06 Ashbridges In 4 N FIIA ~78, ~104

FIIA ~78 K. oxytoca 26 2015.06.17 Ashbridges In P N FIIA ~78, ~104 N ~104 FIIA ~78, ~104 K. oxytoca

7 2015.06.17 Ashbridges In P N FIIA ~104, ~175 N ~175 FIIA ~104, ~175 K. oxytoca 19 2015.06.17 Humber Eff N FIIA ~104 N ~104 FIIA ~104 K. oxytoca 46 2015.07.08 Ashbridges Eff N FIIA ~104 N ~128 FIIA ~104 K. oxytoca 30 2015.06.17 Ashbridges In D N FIIA ~70 N ~70 FIIA ~70 K. oxytoca 23 2015.06.17 Ashbridges Eff N

~70 N ~70

K. oxytoca

115 2015.07.23 Ashbridges Eff N

~70 N ~70

K. oxytoca 130 2015.07.23 Ashbridges Eff N ~70 N ~70 K. oxytoca

ClinKoxyKPC-#2 2012.06.07 Hospital F N ~55 N ~55 K. oxytoca 25 2015.06.17 Ashbridges In P FIIA ~70 blaKPC NOT on FIIA K. oxytoca 18 2015.06.17 Humber Eff FIIA ~217 blaKPC NOT on FIIA K. oxytoca

H2O2012-2 2012.07.31 Ashbridges In FIIA ~217 blaKPC NOT on FIIA K. oxytoca H2O2012-4 2012.11.15 Humber N FIIA ~78 blaKPC NOT on N or FIIA K. oxytoca

108 2015.07.23 Ashbridges Eff No positives ~90

K. oxytoca 128 2015.07.23 Humber Eff No positives ~55

K. oxytoca

159 2015.08.06 Peel In No positives ~50

K. oxytoca H2O2012-5 2012.06.29 Ashbridges In No positives ~104 K. oxytoca

35 2015.06.18 Ashbridges In P FIIA blaKPC Negative Control K. oxytoca

105