Proc. Natl. Acad. Sci. USAVol. 81, pp. 2945-2949, May 1984Biochemistry

Isolation and sequence of a human apolipoprotein CII eDNA cloneand its use to isolate and map to human chromosome 19 the genefor apolipoprotein CII

(cDNA library/oligonucleotide probe/genomic clone/gene mapping)

CYNTHIA L. JACKSON*, GAIL A. P. BRUNSt, AND JAN L. BRESLOW**Metabolism Division and IGenetics Division, Children's Hospital Department of Pediatrics, Harvard Medical School, Boston, MA 02115

Communicated by Richard J. Havel, December 27, 1983

ABSTRACT cDNA clones encoding human apolipoproteinCII (apo CII) were identified by screening an adult humanliver cDNA library with a mixed oligonucleotide probe corre-sponding to all possible codons for apo CII amino acid 6-10.One clone with an -500-base-pair (bp) insert, designatedpCII-711, was selected for DNA sequence analysis. This clonecontained a DNA sequence that corresponded with the previ-ously reported amino acid sequence of apo CII with only minordifferences. The DNA sequence specified a polypeptide of 79amino acids, compared to the 78 amino acids previously re-ported. The pCII-711 clone contains a 36-bp DNA sequenceupstream from that specifying the NH2-terminal threoninewhich, when read in frame, specifies the amino acid sequenceLeu-Val-Leu-Leu-Val-Leu-Gly-Phe-Glu-Val-Gln-Gly and maybe part of an apo CII signal peptide. The pCII-711 clone alsocontains a 144-bp region that corresponds to the 3' untranslat-ed region of apo CII mRNA as well as a portion of the poly(A)tail. Clone pCII-711 was used to isolate and characterize byrestriction endonuclease digestion the gene for apo CII from ahuman genomic library. In addition, through Southern blotanalysis of DNA from human-rodent somatic cell hybrids,clone pCII-711 also was used to provisionally map the gene forapo CII to human chromosome 19.

Apolipoprotein (apo) CII is a polypeptide composed of a sin-gle chain of 79 amino acids. It is present in plasma at a con-centration of 2.7 ± 0.6 mg/dl (mean ± SEM) (1) and residesin both the very low density lipoprotein (VLDL) and highdensity lipoprotein (HDL) fractions (2). Purified apo CII hasbeen shown to have cofactor activity for the enzyme lipopro-tein lipase (triacylglycerol acylhydrolase, EC 3.1.1.3) (3, 4),which catalyzes the hydrolysis of triglycerides in chylomi-crons and very low density lipoproteins (5). The physiologi-cal importance of apo CII in activating lipoprotein lipase hasbeen established by the finding of patients with inherited apoCII deficiency who have functional lipoprotein lipase defi-ciency (6-10). These individuals are severely hypertriglycer-idemic and have impaired clearance of very low density lipo-proteins and chylomicrons from their plasma. The functionallipoprotein lipase deficiency can be relieved by the infusionof blood or plasma containing apo CII (6, 11). Studies usingtryptic fragments of apo CII have shown that the COOH-terminal amino acids 55-79 are necessary for maximal lipo-protein lipase activation (12-14). The exact mechanism ofthe interaction between apo CII and lipoprotein lipase is notyet known. To better understand the normal regulation ofapo CII synthesis and defects that might occur in this proc-ess at the molecular level, we have undertaken the isolationof cDNA and genomic clones for this apoprotein. In addi-tion, to further elucidate the structure of the human apopro-

tein gene family, we have used the cDNA clone as a probe todetermine on which chromosome the gene for apo CII is lo-cated.

METHODSIsolation of apo CII Double-Stranded cDNA Clones. A 14-

base long mixture of oligonucleotides was synthesized by de-scribed methods (15) that corresponds to all possible codonsspecifying the region of apo CII containing amino acids 6-10[apo CII-(6-10); (Gln-Asp-Glu-Met-Pro)]. Fig. 1 Uppershows the sequence of mRNA from 5' to 3' specifying apoCII amino acids 6-10 as well as the cDNA sequence from 3'to 5'. This mixture of oligonucleotides was radiolabeled atthe 5' termini with polynucleotide kinase and used as a probeto screen a cDNA library made from adult human livermRNA (16). After growth and chloramphenicol amplication,the colonies were transferred to nitrocellulose filters and hy-bridized to the oligonucleotide probe as described (15), andputative apo CII cDNA clones were selected.

Preparation and Restriction Endonuclease Digestion of Plas-mid DNA. Bacterial clones were grown in double-strengthYT broth (Difco) supplemented with tetracycline (20 ,g/ml),and plasmid DNA was isolated by the alkaline lysis method(17). When necessary, plasmid DNA was further purified onCsCl gradients. Restriction endonucleases were purchasedfrom New England Biolabs and used according to the condi-tions recommended by the manufacturer. pCII-711 was di-gested with various restriction endonucleases, and the re-sults were analyzed by agarose and polyacrylamide gel elec-trophoresis.DNA Sequence Analysis. DNA sequence analysis was per-

formed by the chemical method of Maxam and Gilbert (18)with appropriate restriction fragments derived from the Pst Iinsert of cDNA clone pCII-711. In order to determine thesequence of both DNA strands, restriction fragments wereeither treated with bacterial alkaline phosphatase and la-beled at their 5' ends with T4 polynucleotide kinase in thepresence of [y32P]ATP (18) or labeled at their 3' ends with[a-32P]cordycepin. The labeled DNA fragments were thensubjected to secondary restriction endonuclease digestion,separated by polyacrylamide gel electrophoresis, electroe-luted, and precipitated from ethanol.

Isolation and Restriction Endonuclease Mapping of an apoCII Genonic Clone. A human genomic library cloned inCharon 4A phage (19) was screened by utilizing the nick-translated cDNA clone pCII-711 as a probe as described pre-viously. Several strongly hybridizing clones were identified,and one of these designated Xapo CII 1 was plaque-purifiedand then grown in large amounts in 500 ml of double-strengthYT media (20) with the bacterial strain LE392 as host. The

Abbreviations: apo CII, CIII, A-1, etc., apolipoproteins CII, CIII,A-1, etc.; apo CII-(6-10), region of apo CII containing amino acids6-10; bp, base pair(s); kb, kilobase pairs.

2945

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Feb

ruar

y 4,

202

0

2946 Biochemistry: Jackson et al.

APO CII OLIGONUCLEOTIDE PROBE

A.A. RESIDUE 6 7 8 9 10GLN ASP GLU MET PRO

MRNA

cDNA

l

5' CAA GAU GAG AUG

3' GTT CTA CTT TAC

Fl r Rs DRs ST DS

CC 3'

GG 5'

1'

100 bp

APO CII CDNA CLONE 711

LeuValLeuLeuValLeuGlyPheGluValGlnGlyCTTGTCCTCCTGGTATTGGGATTTGAGGTCCAGGGG

ThrGlnGlnProGlnGlnAspGluMetProSerProThrPheLeuThrGlnValLysGluSerLeuSerSerTyrACCCAACAGCCCCAGCAAGATGAGATGCCTAGCCCGACCTTCCTCACCCAGGTGAAGGAATCTCTCTCCAGTTAC

TrpGluSerAlaLysThrAlaAlaGlnAsnLeuTyrGluLysThrTyrLeuProAlaValAspGluLysLeuArgTGGGAGTCAGCAAAGACAGCCGCCCAGAACCTGTACGAGAAGACATACCTGCCCGCTGTAGATGAGAAACTCAGG

AspLeuTyrSerLysSerThrAlaAlaMetSerThrTyrThrGlyIlePheThrAspGlnValLeuSerValLeuGACTTGTACAGCAAAAGCACAGCAGCCATGAGCACTTACACAGGCATTTTTACTGACCAAGTTCTTTCTGTGCTG

LysGlyGluGluAAGGGAGAGGAGTAACAGCCAGACCCCCCATCAGTGGACAAGGGGAGAGTCCCCTACTCCCCTGATCCCCCAGGT

TCAGACTGAGCTCCCCCTTCCCAGTAGCTCTTGCATCCTCCTCCCAACTCTAGCCTGAATTCTTTTCAATAAAAA

ATACAATTC

recombinant phage was precipitated with polyethylene gly-col and purified on CsCl step gradients. Phage DNA wasprepared by phenol extraction and ethanol precipitation. Tomap the gene for apo CII in Xapo CII 1, the phage DNA wasdigested by various restriction enzymes and then electropho-resed on 0.7% agarose gels. After Southern transfer to a ni-trocellulose filter, hybridization was carried out with the PstI insert from cDNA clone pCII-711 that had been radiola-beled by nick-translation (21). Hybridization was carried outfor 16 hr at 650C in 5 x SET (1x SET is 150 mM NaCl/20 mMTris, pH 7.8/1 mM EDTA) containing lOx Denhardt's solu-tion (0.2% polyvinylpyrrolidone/0.2% Ficoll/2% bovine se-rum Albumin), 0.1% Na pyrophosphate, 0.1% NaDodSO4,and 50 ,g of heat-denatured calf thymus DNA per ml (19),and the filter was then washed for 1 hr at 65°C in 0.3 MNaCl/0.03 M Na citrate, pH 7, containing 0.1% NaDodSO4and for 1 hr at 650C with 0.015 M NaCl/0.0015 M Na citrate,pH 7, containing 0.1% NaDodSO4.Chromosomal Localization Utilizing Somatic Cell Hybrids.

A panel of DNA obtained from human-rodent somatic cellhybrids was used. The primary hybrid clones were derivedfrom fusion of hypoxanthine phosphoribosyltransferase(HPRT)-deficient Chinese hamster E36 cells or mouse RAGcells with leukocytes or fibroblasts from four unrelated indi-

FIG. 1. (Upper) Apo CII oli-gonucleotide probe used to screenthe human cDNA library. (Mid-dle) The sequence analysis strate-gy. Only the position of the rele-vant restriction sites are indicat-ed: Hinfl (Fl), Rsa I (Rs), Dde I(D), Sau3A (S3A), Sac I (S), Pst I(P). The horizontal arrows indi-cate the direction and extent ofsequence determination. A.A.amino acid; bp, base pair(s).(Lower) Complete nucleotide se-quence of clone pCII-711.

viduals. Two of the leukocyte donors were female carriersof different, reciprocal X/19 translocation chromosomes.These included the X/19W translocation t(X;19) (q23-25::ql3) (22) and the X/19B translocation t(X;19) (ql::?p/q13). In the latter translocation, the breakpoint on chromo-some 19 has not been more precisely determined because ofthe absence of easily distinguishable landmarks on this chro-mosome. The hybrid clones have been characterized exten-sively for human chromosome complements by analysis ofhuman isozyme markers characteristic of each chromosomeand by cytogenetic techniques (23, 24). In addition, clonedDNA probes have been used to monitor 19 of the humanautosomes and the X chromosome in the DNAs of the map-ping panels used in the present study (25-27). The 19q+ andXq- translocation chromosomes were monitored in the hy-brid clones by isozyme and cytogenetic techniques (23, 24)and with cloned X-chromosome DNAs (28). The chromo-some 19 isozyme markers were: phosphohexose isomerase,a-mannosidase, lysosomal deoxyribonuclease, and pepti-dase D; those for the X chromosome were hypoxanthinephosphoribosyltransferase, glucose-6-phosphate dehydro-genase, phosphoglycerate kinase, and a-galactosidase (29).DNA from parental and hybrid cells was digested to comple-tion, separated by electrophoresis on 0.8% agarose gels, and

Proc. Natl. Acad Sci. USA 81 (1984)

Dow

nloa

ded

by g

uest

on

Feb

ruar

y 4,

202

0

Proc. NatL Acad Sci. USA 81 (1984) 2947

transferred to nitrocellulose. Prehybndization and hybrid-ization were carried out as described (28) with the nick-translated insert from pCII-711 as the probe.

RESULTSIsolation and DNA Sequence Analysis of an apo CII cDNA

Clone. Ten thousand cDNA clones were hybridized with theradiolabeled mixture of 14-base-long oligonucleotide probesdesigned to correspond to all possible codons specifying apoCII-(6-10) (Fig. 1 Upper). Several clones were isolated thatmaintained strong hybridization after washing with 0.9 MNaCl/0.09 M Na citrate, pH 7, containing 1% NaDodSO4 at370C. One of these clones, pCII-711, was subjected to DNAsequence analysis, which confirmed the identity of thisclone. The restriction endonuclease sites and fragments usedfor DNA sequence analysis are shown in Fig. 1 Middle. Thecomplete DNA sequence of pCII-711 is shown in Fig. 1 Low-er, This clone is -500 bp long and contains sequences corre-sponding to the mRNA coding for the entire plasma form ofapo CII. From the known NH2-terminal amino acid threo-nine to the stop codon TAA, it appears that mature apo CIIis 79 amino acids in length. In addition, upstream from theNH2 terminus, there are 36 bp which, when read in frame,code for the amino acid sequence Leu-Val-Leu-Leu-Val-Leu-Gly-Phe-Glu-Val-Gln-Gly. Furthermore, pCII-711 alsocontains a 144-bp region that corresponds to the 3' untrans-lated region of apo CII mRNA, which includes a standardpolyadenylylation signal A-A-T-A-A-A, the last A of whichis 12 bp upstream from the polyadenylylation site. pCII-711also includes a portion of the poly(A) tail of apo CII'mRNA.

Isolation and Restriction Endonuclease Mapping of theGene for apo CII. The cDNA clone pCII-711 was u'sed as aprobe to isolate the human apo CII gene cloned in a humangenomic library made in Charon 4A phage. Approximately106 phage were screened, and several'positive clones wereisolated. One of these, Xapo CII1, was digested with variousrestriction endonucleases, and the apo CII gene in this clonewas mapped by Southern blot analysis with the radiolabeledcDNA clone pCII-711. Enzymatic digestion of Xapo CII 1DNA singly with EcoRI, BamHI, HindIII, and Pst I pro-duced single hybridization bands of 4.2, 5.8, 10.8, and 4.0kilobase pairs (kb), respectively. These single, as well asmultiple, enzymatic digests allowed the construction of a re-striction endonuclease'map of the human apo CII gene inXapo CII 1 (Fig. 2). These studies also showed that the sizeof the human DNA insert in Xapo CII 1 is -14 kb. The se-quence of the apo CII gene that hybridizes to pCII-711 is inthe middle of the human DNA insert. In a similar analysis,DNA was prepared from peripheral blood leukocytes of nor-mal individuals, digested with restriction enzymes, and sub-jected to Southern blot analysis with radiolabeled pCII-711.This experiment revealed the same map of the apo CII genein the genome as was found in the cloned gene (data notshown).Chromosomal Assignment of the apo CII Gene. The pCII-

711 clone was used as a probe with a mapping panel ofDNAsfrom human-rodent somatic cell hybrids. After BamHI di-gestion, under the hybridization conditions used, humanDNA gave a band of 5.8 kb, which was easily distinguishablefrom the 5.3-kb band of-the mouse parental cell RAG (Fig.3). Cross-hybridization of pCII-711 with DNA from hamsterE36 cells has not been observed. The 5.8-kb componentcharacteristic of human DNA exhibited concordant segrega-tion with chromosome 19 in 7 clones from fusion of RAGcells with leukocytes or fibroblasts of two normal males,with the 19q+B translocation chromosome in 7 clones; andwith the 19q+W translocation chromosome in all but 1 of 14clones (Table 1). The single discordant clone had a rear-ranged 19q+ translocation chromosome by cytogenetic anal-ysis and did not express the chromosome 19 isozyme mark-

A

a b c d e f g h i k mn o

-231

-94

_6.5

- - - _4.3

.23-2O0-.16

eo_f2SIa::: .I - i

BH3 R B

I I IP RI I

B P H3I I i

1kb

FIG. 2. Restriction analysis of clone XCII 1. (A) DNA (1 ,ug) wasdigested with restriction enzyme, first singly, then in various combi-nations. The DNA was separated by electrophoresis on 0.7% agar-ose gels, transferred to nitrocellulose filters, and hybridized with32P-labeled pCII-711 insert. Size markers were Hind.I1-digested Xphage DNA and Hinfl-digested pBR322. The restriction enzymesused per lane were: a, EcoRl; b, BamHI; c, HindII; d, Pst I; e,BamHI/EcoRI; f, HindIII/EcoRI; g, HindIII/BamII; h, Pst I/Hin-dIII; i, Pst I/BamHI; j, Pst IlEcoRI; k, HindIII/BamHI/EcoRI; l,Pst I/HindIII/EcoRI; m, Pst I/HindIII/BamHI; n, Pst I/BamHI/EcoRI; o, Pst I/HindIII/BamHI/EcoRI. The faint bands present arepartial digestion products. (B) This map was constructed from theresults obtained in A. The thick line indicates the region hybridizingto the pCII-711 probe. Restriction sites are: EcoRI (R), BamHI (B),Pst I (P), and WindIII (H3).

ers phosphohexose isomerase or a-mannosidase. As the19q+ translocation chromosomes contained an overlappingregion of the X chromosome (q24-qter), the segregation ofpCII-711 was analyzed in the 7 hybrid clones derived fromkaryotypically normal males. In 6 of these clones, pCII-711segregation was independent of the X chromosome. Theseobservations suggest that the apo CII gene may be assign-able to chromosome 19 and regionalized to 19pter---q13.The hybridization pattern of pCII-711 was discordant withthe segregation of the other autosomes and the sex chromo-somes in the somatic cell hybrids studied. The discordancyindices varied from 0.25 to 0.86 (Table 1).

DISCUSSIONIn this paper we report the isolation and DNA sequence of acDNA clone, pCII-711, encoding apo CII. From the DNAsequence of this clone, it is possible to deduce the aminoacid sequence of the entire mature or plasma form of apoCII. The amino acid sequence predicted differs somewhatfrom the previously determined- amino acid sequence (30).The DNA sequence specifies a polypeptide of 79 amino ac-ids rather than the 78 previously reported. In addition, aminoacids 2 and 17 are glutamine not glutamic acid, amino acid 27is glutamic acid not glutamine, and amino acids 20 through26 are Glu-Ser-Leu-Ser-Ser-Tyr-Trp not the reported Glu-Trp-Leu-Ser-Ser-Tyr. Whether these differences reflect cor-rections to the amino acid sequence or whether they reflectapo CII polymorphisms in the population has yet to be deter-mined.The pCII-711 clone contains a 36-bp DNA sequence up-

stream from the codon specifying the NH2-terminal threo-nine of the plasma form of apo CII. These bases, when readin frame, specify the amino acid sequence Leu-Val-Leu-Leu-Val-Leu-Gly-Phe-Glu-Val-Gln-Gly. Almost all secreted

Biochemistry: Jackson et aL

Dow

nloa

ded

by g

uest

on

Feb

ruar

y 4,

202

0

2948 Biochemistry: Jackson etaLP

+ + J +-+ + + + + + + R CH/, f9

1 2 3 4 5 6 7 9 1011 12 1314 15

FIG. 3. Hybridization of pC1I-711 with DNAs from human-ham-

ster somatic cell hybrids. The DNAs in lanes are: 1, hamster E36

cells; 2-12, human-hamster hybrid clones that express human phos-

phohexose isomerase and a-mannosidase and have the 19q+W

translocation chromosomes (19pter-q13::Xq24-qter) (23, 24) (these

clones also express human hypoxanthine phosphoribosyltransferaseand glucose-6-phosphate dehydrogenase; 13, human-hamster hy-

brid from the same hybrid series that has an extensively rearranged

19q+ translocation chromosome and does not express phosphohex-

ose isomerase or a-mannosidase (pCII-711 does not hybridize with

DNA from this clone); 14, human DNA; 15, T4 polymerase-labeled

HindIll digest of X phage DNA. The 19q+ translocation chromo-

some (CHR.19) is the only chromosome shared by the hybrids in

-lanes 2-12. Segregation of pC1I-711 with the X chromosome was

excluded by analysis of other clones (Table 1).

proteins have 15- to 30-amino-acid-long leader amino acid

sequences, called signal peptides, that aid in the transloca-

tion of nascent polypeptide chains through the membrane of

the endoplasm'c reticulum into the Golgi (31). A portion of

these signal peptides consists of an uninterrupted string of

hydrophobic amino acids. The 12 amino acids upstream of

the NH2-terminus of apo CII specified by pCII-711 are typi-

cal of other signal peptides. These results suggest that apo

CII has a signal peptide. This has been found also for apo A-

I, apo E, and -apo A-IV (32). However, pC1I-711 does not

specify the entire signal peptide because this clone does not

include an ATG in this region to initiate translation. In addi-

tion to the DNA sequence upstream of that corresponding to

the coding region for plasma apo CII, pCII-711 also contains

a 144-bp region that corresponds to the 3' untranslated re-

gion of apo, CII mRNA as well as a portion of the poly(A)

tail. Our analysis indicates that the total length of pCII-711 is

approximately 500 bp. Northern hybridization of pCII-711 to

liver mRNA (data not shown) indicates that the full length of

the mRNA coding for apo CII is 550 bp, just slightly larger

than pCII-711.In most individuals, plasma apo CII is a single spot on

two-dimensional gels and a single band on one-dimensional

size- or charge-separation gels. Recently three hypertriglyc-

enidemic individuals have been described who have a normal

apo CII component and an apo CII isoprotein 1 charge-unit

more acidic than normal (33). It has been determined that

this is due to a substitution of glutamine for lysine at residue55. The apo CII DNA sequence at this residue determinedfor cDNA clone pCII-711 is AAA which specifies lysine. It ispossible to explain the occurrence of glutamine at this resi-due by a single-base substitution in the first base of this co-don, substituting C for A. Although this mutant form of apoCII was isolated from hypertriglyceridemic patients, it ap-pears to activate lipoprotein lipase normally, which makesthe relationship between the amino acid substitution and thehypertriglyceridemia probably not cause and effect.

Several patients have been described who lack apo CII intheir plasma (6-10). Since apo CII is a cofactor for the lipo-protein lipase, these individuals have a functional deficiencyof this enzyme and as a result are severely hypertriglycerid-emic. Apo CII deficiency appears to be a recessive geneticdisorder with obligate heterozygotes having half normal apoCII levels but normal triglyceride concentrations (10). It isnot known whether the defect in this condition is in the apoCII gene or another gene that affects apo CII gene expres-sion. In this paper we report the isolation and mapping of thenormal apo CII gene. This information should be helpful inthe study of the basic defect in apo CII-deficient individuals.It should be possible to determine whether this condition isassociated with a gene deletion or a DNA restriction-frag-ment-length polymorphism in the region of the apo CII gene.It is also possible that apo CII gene restriction-fragment-length polymorphisms may be associated with other dyslipo-proteinemia conditions. In recent studies, DNA alterationsin the apo A-I-apo CIII gene complex have been associatedwith lipoprotein disorders (34). A DNA polymorphism asso-

ciated with the apo A-I gene has been found in individualswith a deficiency in high density lipoprotein, apo A-I, andapo CIII and with severe premature atherosclerosis (35).This polymorphism is due to a large, DNA insertion in thecoding region of the apo A-I gene. Rees et al. (36) have de-scribed another polymorphism associated with the apo A-Igene that occurs in 50% of hypertriglyceridemic individualsbut only 5% of normals. In very recent studies we haveshown that this polymorphism is actually in the apo CIIIgene (37).

It has been suggested that the apolipoproteins were all de-rived from a common evolutionary precursor (38). Thiswould suggest that their genes comprise a multigene family.Mapping of other gene families has revealed that some aredispersed in the genome, whereas others have remainedclustered (39). To determine the structural relationships be-tween the apolipoprotein genes and to establish linkage rela-tionships between these genes and other genes, it is neces-sary to determine the chromosomal localization of the apo-lipoprotein genes. In this study we have utilized the pCII-711clone and somatic cell hybrids to provisionally map the apo

CII gene to human chromosome 19. In previous work we

have shown that the apo A-I and apo CIII genes are within 3kb of each other and are located on human chromosome 11

Table 1. Hybridization pattern of apo CIH probe with DNA mapping panels

Hybrid- Chromo- Human chromosomesization some 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19* 20 21 22 Xt Y

+ + 8 5 9 11 9 15 10 6 11 12 10 13 11 14 12 8 6 10 21 13 15 12 3 1- - 5 4 3 2 5 6 3 4 7 4 4 4 3 2 4 4 4 3 6 4 5 4 1 5+ - 13 16 12 10 12 6 11 15 10 9 11 8 10 7 9 13 13 10 0 8 6 9 18 20- + 2 3 2 4 2 1 4 3 0 3 3 3 2 5 3 2 1 2 it 3 2 1 6 0

Discordant fraction 0.54 0.68 0.54 0.52 0.50 0.25 0.54 0.64 0.36 0.43 0.50 0.39 0.46 0.43 0.43 0.56 0.58 0.52 0.04 0.46 0.29 0.38 0.86 0.77

*For the 21 hybrid clones derived from fusions with leucocytes from the two different X/19 translocation carriers, this column represents the19q+ translocation chromosome.

tThe X column represents the intact X chromosome and the two different Xq-translocation chromosomes. As the 19q+ translocation chromo-somes included a region of the X chromosome (q24-qter or qi-ter), the segregation of apo CII was shown to be discordant with that of an intactX chromosome in six of the seven clones derived from fusions with karyotypic normal males.*This single discordant clone has a rearranged 19q+ translocation chromosome by cytogenetic analysis and does not express phosphohexoseisomerase or a-mannosidase, two isozyme markers for chromosome 19 (29).

Proc. Nad Acad Sci. USA 81 (1984)

Dow

nloa

ded

by g

uest

on

Feb

ruar

y 4,

202

0

Proc. NatL Acad Sci. USA 81 (1984) 2949

(37). Another group has studied two families in which poly-morphic forms of apo E demonstrated linkage with electro-phoretic variants of the third component of complement inmales (40). The latter has been mapped to human chromo-some 19 (41); therefore, this group suggested that apo E alsoresided on chromosome 19. In a recent study, we have useda cDNA clone for apo E as a probe and somatic cell hybridsto prove that apo E does indeed reside on human chromo-some 19. The distance between the apo CII and the apo Egenes is not currently known. However, the apo E cDNAclone did not hybridize to the Xapo CII 1 clone, and the pCII-711 clone did not hybridize to a Xapo E clone (data notshown). Thus, it appears that the apo CII and apo E genesare not as closely linked as the apo A-I and apo CIII genes.Further analysis of somatic cell hybrids with chromosome 19translocations and/or in situ hybridization studies will benecessary to determine if apo CII and apo E reside in thesame region of chromosome 19 and to orient apo CII relativeto the C3:Le:peptidase D:DM:Se:Lu complex (42) on thischromosome. Familial hypercholesterolemia also has beenlinked to the locus for the third component of complementon human chromosome 19 (43, 44). This disorder involves agenetic defect in the low density lypoprotein receptor, andsuggests that the genetic locus for this receptor will map tochromosome 19. It will be interesting to ascertain if any oth-er apolipoprotein genes or genes for related proteins alsomap to this chromosome.

The authors wish to thank Dr. Steven Humphries for communica-tion of unpublished results on the sequence of apo CII cDNA, aswell as Joseph McPherson, Hilary Williams, Ellen Johnson, Lor-raine Duda, and Michelle Hardiman for their expert assistance. Thisresearch was supported by National Institutes of Health grantsHL32354, HD18658, and AG00376. Dr. Jan L. Breslow is an Estab-lished Investigator of the American Heart Association.

1. Alaupovic, P., McConathy, W. J. & Fesmire, J. D. (1982) inProceedings of the Workshop on Apoprotein Quantification,ed. Lippel, K. (U.S. Department of Health and Human Serv-ices, National Institutes of Health, Bethesda, MD), pp. 42-52.

2. Smith, L. C., Pownall, H. J. & Gotto, A. M. (1978) Annu.Rev. Biochem. 47, 751-777.

3. Havel, R. J., Shore, V. G., Shore, B. & Bier, D. M. (1970)Circ. Res. 33, 595-600.

4. LaRosa, J. C., Levy, R. I., Herbert, P., Lux, S. E. & Fred-rickson, D. S. (1970) Biochem. Biophys. Res. Commun. 41,57-62.

5. Nilsson-Ehle, P., Garfinkel, A. S. & Schotz, M. C. (1980)Annu. Rev. Biochem. 49, 667-693.

6. Breckenridge, W. C., Little, J. A., Steiner, G., Chow, A. &Poapst, M. (1978) N. Engl. J. Med. 298, 1265-1273.

7. Stalenhoef, A. F. H., Casparie, A. F., Demacker, P. N. M.,Stouten, J. T. J., Lutterman, J. A. & van't Laar, A. (1981)Metabolism 30, 919-926.

8. Yamamura, T., Sudo, H., Ishikawa, K. & Yamamoto, A.(1979) Atherosclerosis 34, 53-65.

9. Miller, N. E., Rao, S. N., Alaupovic, P., Noble, N., Slack, J.,Brunzell, J. D. & Lewis, B. (1981) Eur. J. Clin. Invest. 11, 69-75.

10. Cox, D. W., Breckenridge, W. C. & Little, J. A. (1978) N.Engl. J. Med. 299, 1421-1424.

11. Nikkila, E. A. (1983) in The Metabolic Basis of Inherited Dis-ease, eds. Stanbury, J. B., Wyngaarden, J. B., Fredrickson,D. S., Goldstein, J. L. & Brown, M. S. (McGraw-Hill, NewYork), 5th Ed., pp. 622-642.

12. Smith, L. C., Voyta, J. C., Catapano, A. L., Kinnunen,P. K. J., Gotto, A. M., Jr., & Sparrow, J. T. (1980) in Athero-sclerosis, V, eds. Gotto, A. M., Jr., Smith, L. C. &Allen, B.(Springer, New York), pp. 397-407.

13. Musliner, T. A., Church, E. C., Herbert, P. N., Kingston,

M. J. & Shulman, R. S. (1977) Proc. Natl. Acad. Sci. USA 74,5358-5362.

14. Kinnunen, P. K. J., Jackson, R. L., Smith, L. C., Gotto,A. M. & Sparrow, J. T. (1977) Proc. NatI. Acad. Sci. USA 74,4848-4851.

15. Breslow, J. L., Ross, D., McPherson, J., Williams, H., Kur-nit, D., Nussbaum, A. L., Karathanasis, S. K. & Zannis, V. I.(1982) Proc. NatI. Acad. Sci. USA 79, 6861-6865.

16. Woods, D. E., Markham, A. F., Ricker, A. I., Goldberger, G.& Colten, H. R. (1982) Proc. Natl. Acad. Sci. USA 79, 5661-5665.

17. Birboim, H. C. & Doly, J. (1979) Nucleic Acids Res. 1, 1513-1516.

18. Maxam, A. M. & Gilbert, W. (1980) Methods Enzymol. 65,499-560.

19. Maniatis, T., Hardison, R. C., Lacy, E., Lauer, J., O'Connell,C., Quon, D., Sim, D. K. & Efstratiadis, A. (1978) Cell 15,687-705.

20. Miller, J. H. (1972) in Experiments in Molecular Genetics,(Cold Spring Harbor Laboratory, Cold Spring Harbor), p. 433.

21. Rigby, P. W. J., Dieckmann, M., Rhodes, C. & Berg, P. (1977)J. Mol. Biol. 113, 237-241.

22. Latt, S. A., Willard, H. F. & Gerald, P. S. (1976) Chromo-soma 57, 135-143.

23. Ingram, P. H., Bruns, G. A. P., Regina, V. M., Eisenman,R. E. & Gerald, P. S. (1977) Biochem. Genet. 15, 455-476.

24. Bruns, G. A. P., Mintz, B. J., Teary, A. C., Regina, V. N. &Gerald, P. S. (1978) Cytogenet. Cell Genet. 22, 182-185.

25. Kurnit, D. M., Philipp, B. W. & Bruns, G. A. P. (1983) Cyto-genet. Cell Genet. 34, 282-288.

26. Whitehead, A. S., Bruns, G. A. P., Markham, A. P., Colten,H. R. & Woods, D. E. (1983) Science 221, 69-71.

27. Kanda, N., Alt, F., Schreck, R. R., Bruns, G. A. P., Balti-more, D. & Latt, S. A. (1983) Proc. Natl. Acad. Sci. USA 80,4069-4073.

28. Bruns, G. A. P., Gusella, J. F., Keys, C., Leary, A. C., Hous-man, D. & Gerald, P. S. (1982) Adv. Exp. Med. Biol. 154, 60-72.

29. Shows, T. B. & McAlpine, P. J. (1982) Cytogenet. Cell Genet.32, 221-245.

30. Jackson, R. L., Baker, H. N., Gilliam, E. B. & Gotto, A. M.(1977) Proc. Natl. Acad. Sci. USA 74, 1942-1945.

31. Blobel, G., Walter, P., Chang, C. N., Goldman, B., Erickson,A. H. & Lingappa, V. R. (1979) in Symposium of the Societyof Experimental Biology (Great Britain), eds. Hopkins, C. R.& Duncan, C. J. (Cambridge Univ. Press, London), Vol. 33,pp. 9-36.

32. Zannis, V. I. & Breslow, J. L. (1984) Adv. Hum. Genet., inpress.

33. Havel, R. J., Kotite, L. & Kane, J. P. (1979) Biochem. Med.21, 121-128.

34. Karathanasis, S. K., Norum, R. A., Zannis, V. I. & Breslow,J. L. (1983) Nature (London) 301, 718-720.

35. Karathanasis, S. K., Zannis, V. I. & Breslow, J. L. (1983) Na-ture (London) 305, 823-825.

36. Rees, A., Shoulders, G. C., Stocks, J., Galton, D. J. & Bar-alle, F. E. (1983) Lancet 1, 444 447.

37. Karathanasis, S. K., McPherson, J., Zannis, V. I. & Breslow,J. L. (1983) Nature (London) 304, 371-373.

38. Barker, W. C. & Dayhoff, M. 0. (1977) Comp. Biochem.Physiol. 57B, 309-315.

39. D'Eustachio, P. & Ruddle, F. H. (1983) Science 220, 919-924.40. Glaisen, B., Teisberg, P. & Gedde-Dahl, T. (1982) Hum. Gen-

et. 62, 233-236.41. Whitehead, A. S. Solomon, E., Chambers, S., Bodmer,

W. F., Povey, S. & Fey, G. (1982) Proc. Natl. Acad. Sci. USA79, 5021-5025.

42. Westerveld, A. & Naylor,S. (1983) Cytogenet. Cell Genet. 37,155-175.

43. Ott, J., Schrrott, H. G., Goldstein, J. F., Hazzard, W. R., Al-len, F. H., Falk, C. T. & Motulsky, A. G. (1974) Am. J. Hum.Genet. 26, 598-603.

44. Berg, K. & Heiberg, A. (1978) Cytogenet. Cell Genet. 22, 621-623.

Biochemistry: Jackson et aL

Dow

nloa

ded

by g

uest

on

Feb

ruar

y 4,

202

0