Research in Veterinary Science 93 (2012) 743–748

Contents lists available at SciVerse ScienceDirect

Research in Veterinary Science

journal homepage: www.elsevier .com/locate / rvsc

Isolation, culturing and characterization of feeder-independent amniotic fluidstem cells in buffalo (Bubalus bubalis)

Kapil Dev a, Sanjeev K. Gautam a,⇑, Shiv K. Giri a, Anil Kumar a, Anita Yadav a, Vinod Verma b,Pushpander Kumar c, Birbal Singh d

a Department of Biotechnology, Kurukshetra University, Kurukshetra 136 119, Indiab AgResearch, Ruakura Research Center-3123, Hamilton, New Zealandc Department of Pharmaceutical Sciences, Kurukshetra University, Kurukshetra 136 119, Indiad Indian Veterinary Research Institute, Regional Station, Palampur 176 061, India

a r t i c l e i n f o

Article history:Received 17 March 2011Accepted 9 September 2011

Keywords:BuffaloAmniotic fluidStem cellsCharacterization

0034-5288/$ - see front matter � 2011 Elsevier Ltd. Adoi:10.1016/j.rvsc.2011.09.007

⇑ Corresponding author.E-mail address: sgautam@kuk.ac.in (S.K. Gautam).

a b s t r a c t

Heterogeneous amniotic fluid contains various cell types. The aim of this study was to characterize anddifferentiate some of the key stemness attributes of the amniotic fluid-derived cells in buffalo (Bubalusbubalis). The amniotic fluid (AF) cells were cultured without feeder cells, in DMEM containing 15% FBS,1% non-essential amino acids, 1% penicillin/streptomycin/ampicillin, 1% vitamin solution, and 1% L-gluta-mine in 5% CO2 in humidified air at 38.5 ± 0.5 �C. After 6 days of culture different types of cells viz., starshaped (62.7%), spherical without nucleus (1.9%), spherical with nucleus (26.4%), pentagonal (0.4%), andfree floating/rounded cells (8.3%) were observed. Most of the cells started anchorage-dependent growthafter day 7 of the culture. Expression of alkaline phosphatase (AP) and Oct-4, Nestin and FGF-5 wereobserved from the AF cells at different passages. Using species-specific primers, a PCR amplicon of 200,296 and 210 bp were observed for Oct-4, Nestin and FGF-5, respectively. The cells were found to havea normal karyotype at different passages. These results may contribute towards establishing non-embry-onic pluripotent stem cells for various therapeutic and reproductive biotechnological applications in thespecies.

� 2011 Elsevier Ltd. All rights reserved.

1. Introduction

Recent findings have placed stem cell research at the forefrontof biomedical sciences. The stem cell technology may prove to bea boon in current perspective of livestock conservation and pro-duction (Talbot and Blomberg le, 2008; Telugu et al., xxxx).

AF contains a variety of cell types derived from fetal tissues, ofwhich a small percentage is believed to represent stem cell sub-population (s), that express Oct-4, a major stem cell-specific pluri-potency marker (De Coppi et al., 2007; Kim et al., 2007). Ex vivoexpansion, expression of ES cell-specific markers, like SSEA-4 andOct-4, and the mesenchymal stem cell marker, the vimentin (DeCoppi et al., 2007; Chiavegato et al., 2007) and differentiation intomultiple cell lineages including adipogenic, osteogenic, myogenic,endothelial, neurogenic, hepatic, and embryonic germ (EG) layers(Tsai et al., 2006; Kim et al., 2007; Parolini et al., 2009) is alreadyreported in AF cells.

The AF cells can be cultured without feeder cells. Moreover,compared to establishing ES cells and induced pluripotent stem

ll rights reserved.

(iPS) cells, it is easier to obtain and culture AF stem cells in animals.Thus, ability to grow in vitro and expression of key pluripotencymarkers indicate the possibilities of using AF cells in veterinarytherapeutic and livestock assisted reproduction applications. A re-cent report on the use of AF-derived stem cells to develop clonedporcine embryos (Zhao and Zheng, 2010) have raised the possibil-ities of using the AF stem cells in assisted reproduction in otherlivestock species. The information is scarce whether AF cells couldbe cultured, and could serve as novel source of stem cells in buffalo(Bubalus bubalis), a multipurpose livestock species in many parts ofthe world. This study was undertaken on isolation and prolongedculturing of AF cells with expression of stem cell-like pluripotencymarkers in water buffalo.

2. Materials and methods

2.1. Chemicals and media

All chemicals, reagents, culture media and antibiotics used inthis study were of cell culture grade, obtained from Sigma Chemi-cals Co., (St. Louis, MO, USA) unless otherwise indicated. Fetal bo-vine serum (FBS) was from Hyclone (Thermo Scientific, USA) and

744 K. Dev et al. / Research in Veterinary Science 93 (2012) 743–748

Trizol was from Invitrogen (USA). Disposable 35 mm � 10 mm cellculture Petri dishes, 6 well tissue culture plates, and centrifugetubes were procured from Tarsons Products Pvt. Ltd. (Kolkata, In-dia). Membrane filters were from Advanced Micro-Devices(Ambala, India). The primers were got synthesized from GenxBio(India). The culture media were reconstituted freshly as per manu-facturers’ instructions and filter-sterilized (0.22 lm) prior to use.

2.2. Collection and transport of amniotic fluid samples

Buffalo gravid uteri at 50–70 days gestation were obtained froma nearby abattoir, washed 2–3 times with isotonic saline fortifiedwith 400 IU/ml penicillin and 500 lg/ml streptomycin, and trans-ported to the laboratory in a thermally insulated ice box within6 h. The curved crown-rump (CVR) measurement was made andfetal/gestation age was estimated as suggested by Soliman(1975):Y = 28.66 + 4.496 X (If CVR is less than 20 cm), where Y isthe age in days and X is the CVR length in centimeters.

Uterine incision, fetus and membranes were located and AF wasaspirated aseptically with the help of 20 ml syringe fitted with 18gauge hypodermic needle. AF was collected in centrifuge tubes.The appearance and volume of fluid collected were observed.

2.3. Isolation and culturing of AF cells

The AF cells were separated by centrifugation (3000 g, 10 min)and washed twice with phosphate buffered saline (PBS). The cellswere seeded at density of 103 cells/cm2 in 6-well culture platescontaining cell culture medium (DMEM supplemented with 10%FBS, 1% non-essential amino acids, 1% penicillin/streptomycin/ampicillin, 1% vitamin solution) and incubated in humidified CO2

incubator (Lark, China) at 38.5 ± 0.5 �C in presence of 5% CO2 inhumidified air (Dev et al., 2010).

The cells were allowed to grow, and were sub cultured by pas-saging after achieving >80% confluency. No feeder layer was usedfor culture of AF cells. Viability of the cells was monitored by stan-dard protocols of exclusion of trypan blue dye, and the cells werecounted with a hemocytometer (ROHEM, India). Morphologicalfeatures of the cells and their anchorage to culture plates weremonitored and recorded regularly.

2.4. Growth kinetics

For the estimation of growth characteristics, AF cells were cul-ture-expanded at the passage 2nd and passage 4th in DMEM + 15%FBS containing 1% L-glutamine and 1% antibiotics as cell culturemedium. The number of cells was counted in duplicate culturesevery day over 11 days (Fig. 1).

2.5. Characterization of stem cells

2.5.1. Alkaline phosphatase (AP) expressionThe cultured cells were screened for AP expression using

AP-staining kit (Sigma Chemical Co., Catalog No. 86C). For this cellculture medium was removed and the cells were fixed using thefixative (157 ll citrate solution, 50 ll formaldehyde and 406 ll ofacetone) for 30 s. After fixation, the cells were washed thrice withDPBS for 60 s and 60 ll alkaline dye (10 ll sodium nitrate, 10 llfast blue base alkaline, 10 ll naphthalene and 470 ll of water)was added. The cells were left at room temperature for 15 min.The treated cells were washed 8–10 times with DPBS. Naturalred dye was added and removed after 30 s. The cells were observedunder inverted microscope (Radical Instruments, India). Skin-de-rived adult bubaline fibroblast cells (from our cell culture collec-tion) were taken and processed as control for detection of AP andOct-4 expression.

2.5.2. Oct-4, Nanog and FGF-5 expression with differentiation assayThe method proposed by Hummon et al. (2007) with minor

modifications was used for extracting total cellular RNA. RNAwas extracted from approximately 0.6 � 107 cells using the Trizol(Invitrogen, USA) reagent. The Trizol extract (with the cell pellet)was transferred to 2 ml centrifuge tubes and mixed with 200 llchloroform and isoamyl alcohol (24:1). Aqueous and organicphases were mixed by gentle shaking followed by centrifugationat 12,000 g for 15 min at room temperature. The supernatant wascollected and 500 ll of isopropyl alcohol was added to 1 ml of Tri-zol extract. The contents were remixed gently and centrifuged at9500 g for 15 min. The RNA pellet was washed with 500 ll of70% chilled ethanol, and dried at room temperature. The driedRNA pellet was dissolved in 190 ll of DEPC-treated water and trea-ted with RNase-free DNase for removing DNA, if any. The RNA con-centration was measured using a spectrophotometer (ND-1000spectrophotometer, Rockland, MD).

The cDNA was synthesized by reverse transcription of mRNApurified from the cultures AF cells. The reaction mixture comprisedof total cellular 5 ng RNA, 0.2 lg/ll random hexamer, 7 lg/ll cDNAdirect RT, 10 lM/ll AMV reverse transcriptase, and 40 U/ll RNaseinhibitor in a total volume of 20 ll. The reverse transcriptase PCR(RT-PCR) was carried out at 42 �C for 60 min followed by denatur-ation at 95 �C for 8 min. The cDNA taken was generally 5–10 ng/lL,and ultra pure water instead of standard DNA was taken as nega-tive control. The final volume of the PCR reaction consisted of60 ng cDNA, 20 pmol of each primer (GenxBio, India), 10 mMdNTPs mixture, 25 mM of MgCl2, 3 U of Taq polymerase (all fromBangalore GeNei, Bangalore, India).

The primers sequences used were for Oct-4, Nestin and FGF-5(Table 1). The PCR conditions were same except the annealing tem-perature (Table 1), as 94 �C for 5 min (initial denaturation), denatu-rion at 94 �C for 30 s, elongation at 72 �C for 1 min (35 cycles) andthe final extension at 72 �C for 10 min. The amplified DNA frag-ments were resolved on 2% agarose gel containing 10 mg/ml ethi-dium bromide.

2.6. Karyotyping

Standard protocols were used to investigate the chromosomalprofiles of the cells at different passages. The actively growing cellswere incubated with colchicine (0.1 lg/ml) for 4 h at 37 �C. Thetreated cultures were washed twice with Dulbecco’s phosphatebuffered saline (DPBS) and trypsinized (as above). The cells weresuspended and incubated in a hypotonic solution (68 mM KCl)for 20 min at 37 �C. The cells were harvested by centrifugationand fixed in a chilled fixative (methanol and glacial acetic acid,3:1) for 10 min. The cell pellet was obtained and finally suspendedin 5 ml of chilled fixative for another 10 min. The metaphasespreads were prepared by dropping the cell suspension onto pre-chilled glass slides. The air-dried cell spreads were stained withGiemsa stain and observed under oil immersion. Additionally, thecells were also examined for appearance of micronuclei as indica-tors of genetic abnormalities (Thomas et al., 2009) duringculturing.

3. Results

3.1. Isolation and culturing of AF cells

Upon collection, all the cells were spherical and variable in sizes(Fig. 2). No anchorage was observed before 48–72 h of culturingthe cells. After day 6, morphologically different cells viz., starshaped (62.7%), spherical without nucleus (1.9%), spherical withnucleus (26.4%), pentagonal (0.4%), and free floating and rounded

Fig. 1. Growth curves of pluripotent AFS Cells in Bubalus bubalis. Results are expressed as mean ± standard error of the mean. There was a major difference in cell number andgrowth kinetics during the culture period with respect to different passaging.

Table 1Primer used for RT-PCR expression.

Gene Primer sequence Product size (bp) Annealing temperature (�C)

(Oct-4) 50AGTGAGAGGCAACCTGGAGA 30

50CTGCGAAAGGAGACCCAGTA 30200 59

Nestin 50-ACC TGC TGT ACA TCG GCT TT-30

50-GAG GAT GGT GAA GAC GGA GA-30296 56

FGF-5 50-GAGCACTATTATCAAAAATCACAAGG-30

50-CGGAAAGCTGGTTCTTTTCA-30210 57

Fig. 2. Morphological pattern of various AFS cells. (A) The cells were round shaped (�100) after one day incubation. (B) After 3rd day of incubation cells were star shaped (a),without nucleus (b), with nucleus (c), pentagonal (d) free floating rounded cells (e) (�100). (C) After 7th day of incubation most of the cells converted into star shaped. (D) On19th day cells started to convert into fibroblast like cells (�400).

K. Dev et al. / Research in Veterinary Science 93 (2012) 743–748 745

cells (8.3%) were observed (Fig. 2B). At day 7 of culturing, most ofthe cells converted into star shaped cells (Fig. 2C) which subse-quently started anchoring to surface. The anchorage-dependent

cells subsequently gained typical fibroblasts-like shape and formeda confluent monolayer. A few spherical and freely-floating cellswere also visible (Fig. 2Bd).

746 K. Dev et al. / Research in Veterinary Science 93 (2012) 743–748

Instead of forming uniform cell monolayer, certain cell clumpswere also observed. Initially the cells reached 70–80% confluenceafter two weeks. However, the passaged cells exhibited highergrowth rate, reaching a 90–100% confluence after day 6 ofculturing.

Fig. 4. Expression of AP (alkaline phosphate) at passage-2 AFS cells revealed astrong positive staining (red) in buffalo ES cell-like cells (�400) (For interpretationof the references to colour in this figure legend, the reader is referred to the web

3.2. Characterization of AF cells for AP staining and Oct-4, Nestin FGF-5expression

The AF stem cells were found to expand extensively withoutfeeder layer. Whereas, the adult bubaline cultured fibroblasts didnot acquire stain, the cultured AF cells were stained red and wereconsidered as positive for AP expression (Fig. 4). Agarose gel elec-trophoresis of analysis RT-PCR product revealed a 200, 296 and210 bp amplicon of Oct-4 (Fig. 3), Nestin and FGF-5 genes(Fig. 5), respectively.

version of this article.).

3.3. Karyotyping

The cells had a normal karyotype. No apparent genomic abnor-malities namely, appearance of micronuclei, chromosomal frag-mentation etc. were observed (Fig. 6).

Fig. 5. Nestin and FGF-5 expression in buffalo AFS cells using RT-PCR at the day19th of the culture. Lane 1: Marker (100 bp). Lane 2: Nestin, Lane 3: FGF-5.

Fig. 6. The cells were found to have a normal karyotype during the differentpassages.

4. Discussion

Mammalian AF contains diverse cell types representative ofthree germ layers (Gosden, 1983; Fauza, 2004). Amniotic mem-brane and AF-derived cells have therefore, attracted a deal of atten-tion globally as an alternative cell sources for transplantation andtissue engineering, and as a possible reserve of pluripotent stemcells that may be useful for clinical application in regenerativemedicine (Atala, 2006; Parolini et al., 2009; Dobreva et al., 2010)and reproductive biotechnological applications (Zhao and Zheng,2010). However, the potential of AF stem cells in livestock assistedreproduction and health applications has yet to be exploited. Theestablishment of pluripotent stem cell lines in domestic speciescould have great impact in the agricultural as well as in the bio-medical field. Accordingly, the study of the AF stem cells in live-stock species has become a new focus recently (Zhang and Chen,2008).

Efforts are being made to study various types of pluripotentstem cells (Verma et al., 2007; Sritanaudomchai et al., 2007; Huanget al., xxxx) in buffalo (B. bubalis), the mainstay of dairy and meatindustries in many countries of the world. The present study is apreliminary effort to investigate whether the cells in bubaline AFcan be cultured and exhibit stem cell-like attributes. It was ob-served that bubaline AF cells were able to grow without feedercells.

Fig. 3. Oct-4 expression in buffalo AFS cells using RT-PCR at the day 19th of theculture. Lane 1: Marker (100 bp). Lane 2: Positive control. Lane 3: Embryonic stemcells like cells. Lane 4: AFS Cells. Lane 5: Negative control.

The choice of the culture medium and conditions chosen togrow bubaline AF cells were based on reports already establishedfor human AF stem cells (De Coppi et al., 2007). However, the finalselection was based on our preliminary observations on the growthof the cells in various combinations of culture media and supple-ments (data not shown). After 7 days of incubation, the bubalineAF cells had five different types of morphologically different cells(Fig. 2). The polygonal or star shaped cells were cultured for pro-longed periods (at >10th passage). It was found that these cellstransformed into fibroblast-like cells (Fig. 2D). We could not com-pare all the morphologies of AFS cells with any other studies ex-cept one (Mihu et al., 2009) where the authors observed the AFstem cells to show morphological features similar to fibroblasts.The normal karyotypes of buffalo AF cells can be correlated to nor-mal cellular multiplication and morphological characteristics atdifferent passages. The bubaline AF cells were found to have en-larged nuclei compared to adult skin fibroblasts, cumulus cells

K. Dev et al. / Research in Veterinary Science 93 (2012) 743–748 747

and granulose cells (data not shown). The AF cells, which were ini-tially rounded in structure, started anchorage-dependent growthafter day 6 of culture in vitro. These findings are comparable to ear-lier reports wherein AF has been shown to be rich in mesenchymalstem cells that possess high proliferation potential and are able todifferentiate into cells types of the three germ layers, like adipo-genic, osteogenic, myogenic and endothelial cell types, neurogeniccell types, and hepatic cell types (You et al., 2008; Zheng et al.,2008; Ditadi et al., 2009). At the moment we could not correlateour results with other studies as reports are currently scarce onAF-derived stem cells in buffaloes.

In this study, we explored characteristics and multilineage po-tential in AFCs of buffalo. Sakuragawa et al. (1996) and Ishii et al.(1999) reported that AF epithelial cell subpopulation derived fromplacenta may give rise to neurons and glial cells. From our studyand observation after the exposition of AFCs into DMSO and BHAmedia, cells alter their morphology with neural cells specific mark-ers as compare to negative control i.e. AFCs without DMSO andBHA supplemented medium. Regarding the neuronal markers, ex-pressed mRNA and proteins involved in neural differentiation andfunction. Sakuragawa et al. (1997) have related human amnioticepithelial cells (HAEC) neurotrophic function (i.e. acetylcholineand catecholamine synthesis and release) to their ability to sustainthe early phase of neuro-epithelium formation and neural develop-ment to the embryo. From our results by positive expression ofNestin RT-PCR (Fig. 6) clearly showed that AFCs differentiated intoneuron like cells after cultured into DMSO and BHA supplementedmedium.

Further, the AF cells studied were found to express AP andOct-4, Nestin and FGF-5 at different passages. Among the variouspluripotency markers studied till date, Oct-4 is one of the key reg-ulators thought to be crucial for maintaining the gene regulatorynetworks for pluripotency during early mammalian embryonicdevelopment (Nichols et al., 1998; Hart et al., 2004; Boyer et al.,2005). The AP is a stem cell membrane marker and elevatedexpression of this enzyme is associated with undifferentiated plu-ripotent stem cell state. Most of the pluripotent stem cells, like ES,embryonic germ (EG) and embryonal carcinoma (EC) cells, expressAP activity (Shamblott et al., 1998; Hua, 2009).

Using species-specific primers an amplicon of 200, 296 and210 bp product were detected. In the present study Oct-4, Nestin,FGF-5 and AP expression coincided with the differentiation of thecells into cells of various types and the finding are comparable tothe earlier reports on ES cell-like cells in the species (Vermaet al., 2007; Anand et al., 2009; Sakuragawa et al., 1996; Lendahlet al., 1990). Since the AF-derived cells have been proposed to bea promising source of cells for clinical applications, research hasbeen carried out on establishing and characterizing stemness inAF-derived cells in other livestock species as well. Ovine AF-de-rived stem cells were found to proliferate, and express the key plu-ripotency markers including Oct-4, Tert, and ability to differentiatein both osteogenic and smooth muscle cell lineages in vitro (Mauroet al., 2010).

The classic human and mouse ES cell markers such as Oct-4, Na-nog, SSEA-1, SSEA-4 and AP are indeed also expressed by ungulatesinner cell mass cells embryo-derived cell lines; however, the samegenes are also expressed in the trophectoderm and endoderm (VanEijk et al., 1999; Kirchhof et al., 2000; Talbot et al., 2002; He et al.,2006). Nevertheless, characterization of pluripotent stem cells indomestic species is primarily carried out on the basis of morpho-logical criteria, given the fact that, until recently, no specific molec-ular marker has been identified. Although evidence based on thecomparison between the transcriptomes of mouse and human EScells leads to the conclusion that mouse ES cells are substantiallydifferent from human cell lines, they express the same set of regu-latory gene networks and factors for maintaining pluripotency

(Eckfeldt et al., 2005). Elucidation of livestock species-specific plu-ripotency markers and gene regulatory networks is necessary topractically exploit the potential of ES as well as non-embryonicstem cells.

5. Conclusions

In summary, the present study is a preliminary attempt on iso-lation, culturing and characterization of pluripotent stem cell-likecells from AF in water buffalo. The expression of pluripotencymarkers in the cells suggests that AF cells represent an intermedi-ate stage between pluripotent ES cells stage and lineage-restrictedadult stem cells, and these cells can serve as alternative methodsfor obtaining the pluripotent stem cells in buffaloes. The assess-ment of the gene expression evidenced some of the key pluripoten-cy properties of these cells, whose ability to differentiate intovarious cell lines are under investigations and will be reported sep-arately. However, use of AF stem cells in bubaline therapeutic andassisted reproduction biotechnology needs further studies.

Acknowledgments

The authors are thankful to the Vice Chancellor, KurukshetraUniversity, Kurukshetra (Hr) India for providing necessary researchfacilities for carrying out the work. Financial assistance for the re-search project under SERC FAST Track scheme (SR/FT/035/2008) byDepartment of Science and Technology, Government of India is du-ally acknowledged.

References

Anand T, Kumar D, Singh MK, Shah RA, Chauhan MS, Manik RS, Singla SK, Palta P.Buffalo (Bubalus bubalis) embryonic stem cell-like cells and preimplantationembryos exhibit comparable expression of pluripotency-related antigens.Reproduction in Domestic Animals 2009;doi:10.1111/j.1439-0531.2009.01564.x.

Atala, A., 2006. Recent developments in tissue engineering and regenerativemedicine. Current Opinion in Pediatrics 18, 167–171.

Boyer, L.A., Lee, T.I., Cole, M.F., Johnstone, S.E., Levine, S.S., Zucker, J.P., Guenther,M.G., Kumar, R.M., Murray, H.L., Jenner, R.G., Gifford, D.K., Melton, D.A., Jaenisch,R., Young, R.A., 2005. Core transcriptional regulatory circuitry in humanembryonic stem cells. Cell 122, 947–956.

Chiavegato, A., Bollini, S., Pozzobon, M., Callegari, A., Gasparotto, L., Taiani, J., Piccoli,M., Lenzini, E., Gerosa, G., Vendramin, I., Cozzi, E., Angelini, A., Iop, L., Zanon, G.F.,Atala, A., De Coppi, P., Sartore, S., 2007. Human amniotic fluid-derived stem cellsare rejected after transplantation in the myocardium of normal, ischemic,immuno-suppressed or immuno-deficient rat. Journal of Molecular and CellularCardiology 42, 746–759.

De Coppi, P., Bartsch Jr., G., Siddiqui, M.M., Xu, T., Santos, C.C., Perin, L.,Mostoslavsky, G., Serre, A.C., Snyder, E.Y., Yoo, J.J., Furth, M.E., Soker, S., Atala,A., 2007. Isolation of amniotic stem cell lines with potential for therapy. NatureBiotechnology 25, 100–106.

Dev K, Khuttan A, Giri SK, Kumar A, Yadav A, Singh B, Verma V, Aggarwal NK,Gautam SK. Isolation and culturing of putative amniotic fluid stem cells inwater buffalo (Bubalus bubalis), 25th International Conference on Buffalo, NewDelhi, India (Feb 1–4) 2010; p. 50.

Ditadi, De., Coppi, P., Picone, O., Gautreau, L., Smati, R., Six, E., Bonhomme, D., Ezine,S., Frydman, R., Cavazzana-Calvo, M., 2009. Human and murine amniotic fluid c-kit+lin- cells display hematopoietic activity. Blood 113, 3953–3960.

Dobreva, M.P., Pereira, P.N., Deprest, J., Zwijsen, A., 2010. On the origin of amnioticstem cells: of mice and men. International Journal of Developmental Biology 54,761–777.

Eckfeldt, C.E., Mendenhall, E.M., Verfaillie, C.M., 2005. The molecular repertoire ofthe ‘almighty’ stem cell. Nature Reviews Molecular Cell Biology 6, 726–737.

Fauza, D., 2004. Amniotic fluid and placental stem cells. Best Practice and ResearchClinical Obstetrics and Gynaecology 18, 877–891.

Gosden, C.M., 1983. Amniotic fluid cell types and culture. British Medical Bulletin39, 348–354.

Hart, A.H., Hartley, L., Ibrahim, M., Robb, L., 2004. Identification, cloning andexpression analysis of the pluripotency promoting Nanog genes in mouse andhuman. Developmental Dynamics 230, 187–198.

He, S., Pant, D., Schiffmacher, A., Bischoff, S., Melican, D., Gavin, W., Keefer, C., 2006.Developmental expression of pluripotency determining factors in caprineembryos: novel pattern of NANOG protein localization in the nucleolus.Molecular Reproduction and Development 73, 1512–1522.

748 K. Dev et al. / Research in Veterinary Science 93 (2012) 743–748

Hua, J., Haisheng, Yu, Sheng, Liu, Zhongying, Dou, Yadong, Sun, Jing, X., Yang, C., Lei,A., Wang, H., Gao, Z., 2009. Derivation and characterization of human embryonicgerm cells: serum-free culture and differentiation potential. ReproductiveBiomedicine Online 19, 238–249.

Huang B, Li T, Wang XL, XIE TS, Lu YQ, Da Silva FM, Shi DS. Generation andcharacterization of embryonic stem-like cell lines derived from in vitrofertilization in buffalo (Bubalus bubalis) embryos. Reproduction in DomesticAnimals doi: 10.1111/j.1439-0531.2008.01268.x.

Hummon, A.B., Lim, S.R., Difilippantonio, M.J., Ried, T., 2007. Isolation andsolubilization of proteins after TRIzol extraction of RNA and DNA from patientmaterial following prolonged storage. BioTechniques 42, 467–470.

Ishii, T., Ohsugi, K., Nakamura, S., 1999. Gene expression of oligodendrocyte markersin human epithelial cells using neural cells-type-specific expression system.Neuroscience Letters 268, 131–134.

Kim, J., Lee, Y., Kim, H., Hwang, K.J., Kwon, H.C., Kim, S.K., Cho, D.J., Kang, S.G., You, J.,2007. Human amniotic fluid-derived cells have characteristics of multipotentstem cells. Cell Proliferation 40, 75–90.

Kirchhof, N., Carnwath, J.W., Lemme, E., Anastassiadis, K., Scholer, H., Niemann, H.,2000. Expression pattern of Oct-4 in preimplantation embryos of differentspecies. Biology of Reproduction 63, 1698–1705.

Lendahl, U., Zimmerman, L.B., McKay, R.D., 1990. CNS stem cells express a new classof intermediate filament protein. Cell 60, 585–595.

Mauro, A., Turriani, M., Ioannoni, A., Russo, V., Martelli, A., Di Giacinto, O.,Nardinocchi, D., Berardinelli, P., 2010. Isolation, characterization, and in vitrodifferentiation of ovine amniotic stem cells. Veterinary Research 34 (Suppl. 1),S25–S28.

Mihu, C.M., Ciuca, D.R., Soritau, O., Susman, S., Mihu, D., 2009. Isolation andcharacterization of mesenchymal stem cells from the amniotic membrane.Romanian Journal of Morphology and Embryology 50 (1), 73–77.

Nichols, J., Zevnik, B., Anastassiadis, K., Niwa, H., Klewe-Nebenius, D., Chambers, I.,Scholer, H., Smith, A., 1998. Formation of pluripotent stem cells in themammalian embryo depends on the POU transcription factor Oct4. Cell 95,379–391.

Parolini, O., Soncini, M., Evangelista, M., Schmidt, D., 2009. Amniotic membrane andamniotic fluid-derived cells: potential tools for regenerative medicine? ReviewRegenerative Medicine 4, 275–291.

Sakuragawa, N., Thangavel, R., Mizuguchi, M., Hirasawa, M., Kamo, I., 1996.Expression of markers for both neuronal andglial cells in human amnioticepithelial cells. Neuroscience Letters 209, 209–212.

Sakuragawa, N., Hisawa, H., Ohsugi, K., 1997. Evidence for active acetylcholinemetabolism in human amniotic epithelial cells: applicable to intracerebralallografting for neurological disease. Neuroscience Letters 232, 53–56.

Shamblott, M.J., Axelman, J., Wang, S., Bugg, E.M., Littlefield, J.W., Donovan, P.J.,Blumenthal, P.D., Huggins, G.R., Gearhart, J.D., et al., 1998. Derivation of

pluripotent stem cells from cultured human primordial germ cells. Proceedingsof the National Academy of Sciences of the United States of America 95 (23),13726–13731.

Soliman, M.K., 1975. Studies on physiological chemistry of allantoic fluid of buffaloat various periods of pregnancy. Indian Veterinary Journal 52, 106–112.

Sritanaudomchai, H., Pavasuthipaisit, K., Kitiyanant, Y., Kupradinum, P., Mitalipov,S., Kusamran, T., 2007. Characterization and multilineage differentiantion ofembryonic stem cells derived from a buffalo parthenogenetic embryo.Molecular Reproduction and Development 74, 1295–1302.

Talbot, N.C., Blomberg le, A., 2008. The pursuit of ES cell lines of domestic ungulates.Stem Cell Reviews 4, 235–254.

Talbot, N.C., Powell, A.M., Garrett, W.M., 2002. Spontaneous differentiation ofporcine and bovine embryonic stem cells (epiblast) into astrocytes or neurons.In Vitro Cellular and Developmental Biology – Animal 38, 191–207.

Telugu BP, Ezashi T, Roberts RM. The promise of stem research in pigs and otherungulate species. Stem Cell Reviews doi: 10.1007/s12015-009-9101-1.

Thomas, P., Holland, N., Bolognesi, C., Kirsch-Volders, M., Bonassi, S., Zeiger, E.,Knasmueller, S., Fenech, M., 2009. Buccal micronucleus cytome assay. NatureProtocols, 4825–4837.

Tsai, M.S., Hwang, S.M., Tsai, Y.L., Cheng, F.C., Lee, J.L., Chang, Y.J., 2006. Clonalamniotic fluid-derived stem cells express characteristics of both mesenchymaland neural stem cells. Biology of Reproduction 74, 545–551.

Van Eijk, M.J., van Rooijen, M.A., Modina, S., Scesi, L., Folkers, G., van Tol, H.T., Bevers,M.M., Fisher, S.R., Lewin, H.A., Rakacolli, D., Galli, C., de Vaureix, C., Trounson,A.O., Mummery, C.L., Gandolfi, F., 1999. Molecular cloning, genetic mapping,and developmental expression of bovine POU5F1. Biology of Reproduction 60,1093–1103.

Verma, V., Gautam, S.K., Singh, B., Manik, R.S., Palta, P., Singla, S.K., Goswami, S.L.,Chauhan, M.S., 2007. Isolation and characterization of embryonic stem cell-likecells from in vitro-produced buffalo (Bubalus bubalis) embryo. MolecularReproduction and Development 74, 520–529.

You, Q., Cai, L., Zheng, J., Tong, X., Zhang, D., Zhang, Y., 2008. Isolation of humanmesenchymal stem cells from third-trimester amniotic fluid. InternationalJournal of Gynaecology and Obstetrics 103, 149–152.

Zhang, S.L., Chen, F., 2008. Characterization of amniotic fluid-derived stemcells. Journal of Clinical Rehabilitative Tissue Engineering Research 12,3152–3155.

Zhao, X.E., Zheng, Y.M., 2010. Development of cloned embryos from porcine neuralstem cells and amniotic fluid-derived stem cells. Animal 4 (6), 921–929.

Zheng, Y.B., Gao, Z.L., Xie, C., Zhu, H.P., Peng, L., Chen, J.H., Chong, Y.T., 2008.Characterization and hepatogenic differentiation of mesenchymal stem cellsfrom human amniotic fluid and human bone marrow: a comparative study. CellBiology International 32, 1439–1448.