Is DNA living? Is DNA living? In genetics we talked about how parents pass their genes onto their...
-
Upload
cody-wilkerson -
Category
Documents
-
view
217 -
download
0
Transcript of Is DNA living? Is DNA living? In genetics we talked about how parents pass their genes onto their...
![Page 1: Is DNA living? Is DNA living? In genetics we talked about how parents pass their genes onto their offspring. How do these genes (made of DNA) turn into.](https://reader036.fdocuments.in/reader036/viewer/2022062719/56649ecb5503460f94bd98d0/html5/thumbnails/1.jpg)
Is DNA living?Is DNA living?
In genetics we talked about how In genetics we talked about how parents pass their genes onto their parents pass their genes onto their offspring. How do these genes (made offspring. How do these genes (made of DNA) turn into things like hair color, of DNA) turn into things like hair color, eye color or genetic disorders?eye color or genetic disorders?
![Page 2: Is DNA living? Is DNA living? In genetics we talked about how parents pass their genes onto their offspring. How do these genes (made of DNA) turn into.](https://reader036.fdocuments.in/reader036/viewer/2022062719/56649ecb5503460f94bd98d0/html5/thumbnails/2.jpg)
Answer: Answer: Protein SynthesisProtein Synthesis
RNA
Proteins
DNATranscription
Translation
![Page 3: Is DNA living? Is DNA living? In genetics we talked about how parents pass their genes onto their offspring. How do these genes (made of DNA) turn into.](https://reader036.fdocuments.in/reader036/viewer/2022062719/56649ecb5503460f94bd98d0/html5/thumbnails/3.jpg)
RNARNA (ribonucleic acid) (ribonucleic acid)
Difference between RNA and DNADifference between RNA and DNA Ribose instead of deoxyriboseRibose instead of deoxyribose Uracil instead of thymine (U bonds to Uracil instead of thymine (U bonds to
A)A) Single strandedSingle stranded Types of RNATypes of RNA Messenger RNAMessenger RNA ( (mRNAmRNA) – transfers ) – transfers
information from DNA to ribosome. information from DNA to ribosome. Contains the codons.Contains the codons.
Transfer RNATransfer RNA ( (tRNAtRNA) – made of an ) – made of an anticodon and amino acid. There are anticodon and amino acid. There are only 20 amino acids but many tRNAsonly 20 amino acids but many tRNAs
![Page 4: Is DNA living? Is DNA living? In genetics we talked about how parents pass their genes onto their offspring. How do these genes (made of DNA) turn into.](https://reader036.fdocuments.in/reader036/viewer/2022062719/56649ecb5503460f94bd98d0/html5/thumbnails/4.jpg)
Part 1 of Protein Synthesis: Part 1 of Protein Synthesis: TranscriptionTranscription
-synthesis of mRNA--synthesis of mRNA-
1.1. Only Only 11 strand of DNA is strand of DNA is transcribed – RNA polymerase transcribed – RNA polymerase determines where to determines where to startstart by by finding “promotor” base finding “promotor” base sequence on the DNA (sequence on the DNA (TACTAC))
2.2. TerminationTermination is controlled by a is controlled by a Stop sequence Stop sequence
![Page 5: Is DNA living? Is DNA living? In genetics we talked about how parents pass their genes onto their offspring. How do these genes (made of DNA) turn into.](https://reader036.fdocuments.in/reader036/viewer/2022062719/56649ecb5503460f94bd98d0/html5/thumbnails/5.jpg)
CodonsCodons
CodonCodon – a group of 3 bases on – a group of 3 bases on mRNA that codes for an amino mRNA that codes for an amino acid. Example: UUAacid. Example: UUA
![Page 6: Is DNA living? Is DNA living? In genetics we talked about how parents pass their genes onto their offspring. How do these genes (made of DNA) turn into.](https://reader036.fdocuments.in/reader036/viewer/2022062719/56649ecb5503460f94bd98d0/html5/thumbnails/6.jpg)
Take a closer look at this Take a closer look at this processprocess
http://www.youtube.com/watch?http://www.youtube.com/watch?v=D3fOXt4MrOM&feature=relatedv=D3fOXt4MrOM&feature=related
![Page 7: Is DNA living? Is DNA living? In genetics we talked about how parents pass their genes onto their offspring. How do these genes (made of DNA) turn into.](https://reader036.fdocuments.in/reader036/viewer/2022062719/56649ecb5503460f94bd98d0/html5/thumbnails/7.jpg)
![Page 8: Is DNA living? Is DNA living? In genetics we talked about how parents pass their genes onto their offspring. How do these genes (made of DNA) turn into.](https://reader036.fdocuments.in/reader036/viewer/2022062719/56649ecb5503460f94bd98d0/html5/thumbnails/8.jpg)
AnticodonsAnticodons
AnticodonAnticodon – group of 3 bases on – group of 3 bases on a tRNA that is complementary to a tRNA that is complementary to the codon. Example AAUthe codon. Example AAU
![Page 9: Is DNA living? Is DNA living? In genetics we talked about how parents pass their genes onto their offspring. How do these genes (made of DNA) turn into.](https://reader036.fdocuments.in/reader036/viewer/2022062719/56649ecb5503460f94bd98d0/html5/thumbnails/9.jpg)
Part 2 of Protein Synthesis: Part 2 of Protein Synthesis: TranslationTranslation
1.1. mRNA is held in place by the mRNA is held in place by the ribosome.ribosome.
2.2. tRNAs with the anticodon and tRNAs with the anticodon and amino acid temporarily bond to amino acid temporarily bond to the complimentary codon of the the complimentary codon of the mRNAmRNA
3.3. The tRNAs carry the amino acid.The tRNAs carry the amino acid.4.4. The amino acids attach to each The amino acids attach to each
other making the protein.other making the protein.
![Page 10: Is DNA living? Is DNA living? In genetics we talked about how parents pass their genes onto their offspring. How do these genes (made of DNA) turn into.](https://reader036.fdocuments.in/reader036/viewer/2022062719/56649ecb5503460f94bd98d0/html5/thumbnails/10.jpg)
For the following DNA strand For the following DNA strand determine the mRNA, tRNAs determine the mRNA, tRNAs and the protein.and the protein.
gggtacagtcggtagtggattgccgggtacagtcggtagtggattgcc
cccatgtcagccatcacctaacggcccatgtcagccatcacctaacgg
![Page 11: Is DNA living? Is DNA living? In genetics we talked about how parents pass their genes onto their offspring. How do these genes (made of DNA) turn into.](https://reader036.fdocuments.in/reader036/viewer/2022062719/56649ecb5503460f94bd98d0/html5/thumbnails/11.jpg)
ggggggtacagtcggtagtggatttacagtcggtagtggattgccgcc
mRNAmRNAaugucagccaucaccuaaaugucagccaucaccuaa
tRNA tRNA uac agu cgg uag ugg auuuac agu cgg uag ugg auu
Protein: Start-Serine-Alanine-isolucine-threonine-Stop
![Page 12: Is DNA living? Is DNA living? In genetics we talked about how parents pass their genes onto their offspring. How do these genes (made of DNA) turn into.](https://reader036.fdocuments.in/reader036/viewer/2022062719/56649ecb5503460f94bd98d0/html5/thumbnails/12.jpg)
For the following DNA strand For the following DNA strand determine the mRNA, tRNAs determine the mRNA, tRNAs and the protein.and the protein.
ccctacatattacgagaacacgtaactccccctacatattacgagaacacgtaactcc