Investigation of the Ribosome Independent mRNA Localization to … · 2016-01-08 · Abstract...

i

Investigation of the Ribosome Independent mRNA Localization to

the Endoplasmic Reticulum

by

Xianying Amy Cui

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy

Graduate Department of Biochemistry University of Toronto

© Copyright by Xianying Amy Cui (2015)

ii

Investigation of the Ribosome Independent mRNA

Localization to the Endoplasmic Reticulum

Xianying Cui

Doctor of Philosophy

Graduate Department of Biochemistry

University of Toronto

2015

Abstract

Localization of mRNA to various subcellular compartments is a widespread phenomenon

in both prokaryotes and eukaryotes. One group of mRNAs that exhibit this organelle specific

localization are mRNAs encoding secreted, organellar and membrane-bound proteins. These

mRNAs are localized on the surface of the plasma membrane in prokaryotes and on the

endoplasmic reticulum (ER) in eukaryotes. Previously, these mRNAs were thought to target and

later be maintained on the surface of the ER through information that is present in the encoded

polypeptide. However, here I provide direct visual evidence that a subset of these mRNAs can be

targeted and also later maintained on the ER independently of translation. I also identified an

mRNA receptor on the ER, p180, which anchors mRNAs on the ER via a highly positively

charged lysine-rich region. Subsequently I identified a region in the placental alkaline

phosphatase (ALPP) mRNA, the region that encodes the transmembrane domain (TMD), that is

required and sufficient to anchor mRNAs to the ER in a p180-dependent manner. Finally, I

demonstrate that certain mRNAs encoding tailed anchored (TA) proteins are also anchored to the

ER in a translation-independent manner. Overall my work provides the first mechanistic insight

into RNA-mediated targeting of mRNAs to the ER, suggesting a more complex role for the ER

in the post-transcriptional control of genes encoding secretory proteins.

iii

Acknowledgments

This thesis was completed with the generous support from a great number of people to

whom I am gratefully indebted. First, I would like to thank my supervisor, Dr. Alexander

Palazzo, who's passion for science inspired me to join this lab and take on this project. Over the

years, Alex has been an amazing mentor who not only guided me scientifically to complete this

thesis project, but also devoted a great amount of time to develop my presentation, writing and

interpersonal skills. I would also like to thank everyone in my supervisory committee, Dr. David

Williams and Dr. Henry Krause, their input and advices on this project was invaluable.

During my time in the Palazzo Lab, I had the opportunity to work with many talented

individuals. I would like to take this opportunity to express my gratitude to members of the

Palazzo Lab, past and present, who provided a helping hand in the completion of this thesis. Hui,

you are a great friend, I am privileged to have the opportunity to work with you and get to know

you. Kohila, you are a great discussion partner and motivator, I appreciate your input and

encouragement.

I would also like to thank my families and friends, without whom, I could not have done

this. My parents and sister, thank you for your love and support over the years, and your patients

to listen to me talking about my project and experiment. My dear friend, Ye, who is not only our

annual hiking trip buddy, but also wrote a program in an effort to relief me from the labor

intensity 'dot counting' tasks for my project.

It has been a great journey and it is now time to start a new chapter.

Amy C

iv

Table of Contents

Abstract ........................................................................................................................................ ii

Acknowledgments .................................................................................................................. iii

Table of Contents ..................................................................................................................... iv

List of Figures ......................................................................................................................... viii

List of Tables ............................................................................................................................. xi

List of Abreviations and Acrynoms .................................................................................. xii

Chapter 1 ..................................................................................................................................... 1

Introduction ......................................................................................................................................... 1

1.1 Overview ..................................................................................................................................................... 2

1.2 mRNA Localization to the ER: a Historical Perspective ........................................................... 3

1.2.1 Early studies on the endoplasmic reticulum. ....................................................................................... 3

1.2.3 Building a model of how mRNA localizes to the ER........................................................................... 4

1.3 RNA mediated targeting: an alternative route to the ER ........................................................ 8

1.3.1 Initial studies. ..................................................................................................................................................... 8

1.3.2 SRP-independent pathways. ........................................................................................................................ 8

1.3.3 Resurrection of the alternative model. ................................................................................................. 10

1.4 Biogenesis and Targeting of Tail-anchored Proteins ............................................................. 11

1.4.1 General Features of Tail-anchored Proteins ...................................................................................... 11

1.4.2 Biogenesis of ER Localized Tail-anchored Proteins ....................................................................... 11

1.4.3 Biogenesis of Mitochondria Localized Tail-Anchored Proteins ................................................ 12

1.4.4 Biogenesis of Peroxisome Localized Tail-Anchored Proteins .................................................... 14

1.5 Components that Mediate the Translation-Independent mRNA Localization to

Subcellular Organelles ................................................................................................................................ 14

1.5.1 Trans-acting factors. ..................................................................................................................................... 14

1.5.2 Cis-acting elements. ...................................................................................................................................... 16

1.6 Rationale and Approach ..................................................................................................................... 18

Chapter 2 .................................................................................................................................. 22

Materials and Methods ................................................................................................................... 22

2.1 DNA Plasmids and Construction of Fusion Genes .................................................................... 23

v

2.2 Cell Cultures ............................................................................................................................................. 24

2.3 Computational Analysis of the Features of Encoded Proteins ............................................ 24

2.4 Lentiviral Delivered shRNA Treatment ........................................................................................ 25

2.5 Digitonin Permeabilization ............................................................................................................... 25

2.6 Microinjection ......................................................................................................................................... 25

2.7 Transfection of Mammalian Tissue Cultured Cells .................................................................. 26

2.8 Fluorescent in situ Hybridization, Stellaries® Probe Staining, Imaging and

Computational Analysis ............................................................................................................................. 26

2.9 Cell Fractionation, Western Blots and Northern Blots .......................................................... 27

Chapter 3 .................................................................................................................................. 29

p180 Promotes the Ribosome-Independent Localization of a Subset of mRNA to the

Endoplasmic Reticulum ................................................................................................................. 29

3.1 Introduction ............................................................................................................................................. 30

3.2 ER-Targeted Transcripts and Ribosomes Co-Localize with the ER in Digitonin-

Extracted Cells ................................................................................................................................................ 31

3.3 mRNA Remains Associated to the ER Independently of Translation and Ribosome-

Association ...................................................................................................................................................... 34

3.4 The Extent of ER-Retention After Ribosome Dissociation Differs Among mRNA

Species ............................................................................................................................................................... 38

3.5 ALPP and CALR mRNAs Partially Target to the ER Independently of Translation ..... 47

3.6 Identification of Putative mRNA Receptors on the ER ........................................................... 49

3.7 Over-Expression of p180 Enhances the Ribosome- Independent Association of t-ftz

mRNA with the ER ........................................................................................................................................ 56

3.9 The Lysine-Rich Region of p180 Associates Directly with RNA In vitro ......................... 66

3.10 p180 Is Required for the Efficient Association of mRNA to the ER ................................ 67

3.11 p180 Is Required for the Translation- and Ribosome-Independent Maintenance of

ALPP and CALR mRNA at the ER. ............................................................................................................ 72

3.12 Discussion .............................................................................................................................................. 72

Chapter 4 .................................................................................................................................. 75

Identification of a Region Within the Placental Alkaline Phosphatase mRNA that

Mediates p180 Dependent Targeting to the Endoplasmic Reticulum ........................... 75

4.1 Introduction ............................................................................................................................................. 76

4.2 Efficient Translation-independent Maintenance of ALPP mRNA at the ER Requires

its Open Reading Frame ............................................................................................................................. 76

vi

4.3 The TMD Coding Region of ALPP mRNA Promotes the Translation-Independent

Maintenance of mRNA at the ER ............................................................................................................. 80

4.4 The Coding Potential of AP5 is not Required for ER-localization...................................... 82

4.5 The TMCR is Required for the Translational-Independent ER-Localization of ALPP86

4.6 AP5 Promotes the Efficient Targeting of mRNA to the ER Independently of

Translation ...................................................................................................................................................... 88

4.7 p180 is Required for the Efficient Targeting of ALPP mRNA to the ER .......................... 90

4.8 ER-maintenance of AP5 mRNA Requires p180 ......................................................................... 92

4.9 Discussion ................................................................................................................................................. 94

Chapter 5 .................................................................................................................................. 96

mRNA Encoding Sec61, a Tail-Anchored Protein, is Localized on the Endoplasmic

Reticulum ............................................................................................................................................ 96

5.1 Introduction ............................................................................................................................................. 97

5.2 Sec61β mRNA is partially localized on the ER ........................................................................... 98

5.3 The ORF of Sec61 mRNA is required to anchor to the ER independently of

translation ..................................................................................................................................................... 101

5.4 mRNAs encoding other exogenously expressed TA-proteins are mainly localized to

the cytoplasm .............................................................................................................................................. 105

5.5 The encoded TMD is not strictly required for the ER-localization of GFP-Sec61β

mRNA .............................................................................................................................................................. 108

5.6 The initial targeting of GFP-Sec61β mRNAs to the ER is partially independent of

translation and ribosomes ..................................................................................................................... 108

5.7 p180 is not required for the localization of either GFP-Sec61β mRNA or its encoded

protein ............................................................................................................................................................ 110

5.8 TRC40 and BAT3 are not required for the localization of either GFP-Sec61β mRNA or

its encoded protein to the ER. ............................................................................................................... 113

5.9 GFP-Sec61β mRNA competes with other mRNAs for ribosome binding sites on the

ER ..................................................................................................................................................................... 115

5.10 Discussion ........................................................................................................................................... 118

Chapter 6 .......................................................................................................................................... 121

Summary & Conclusion ............................................................................................................... 121

6.1 Translation Independent Localization of mRNAs on the ER Mediated in part by p180

........................................................................................................................................................................... 122

6.2 The TMCR of ALPP Contains the ER-Targeting RNA Element .......................................... 126

vii

6.3 Sec61β mRNA, which Encodes a Tail-anchored Translocon Component, Associates

with the ER Independently of Translation ...................................................................................... 128

6.4 Are mRNAs Encoding Cytosolic Proteins also Translated on the ER? .......................... 129

6.5 Conclusion ............................................................................................................................................. 131

References .............................................................................................................................. 133

viii

List of Figures

Figure 1.1 Targeting secretory proteins to the endoplasmic reticulum. ............................. 6

Figure 1.2 Illustration of key methods used in this thesis. ................................................ 20

Figure 1.3 Overview of project aims. ............................................................................... 21

Figure 3.1 Visualization of ER-targeted mRNAs and ribosomes. .................................... 33

Figure 3.2 Poly(A) transcripts associate with ER independently of ribosomes and

translation. ......................................................................................................................... 35

Figure 3.3 ALPP and CALR, but not t-ftz or INSL3, mRNA remain associated with the ER

independently of ribosomes and translation. .................................................................... 39

Figure 3.4 CALR mRNA, but not t-ftz mRNA, remains associated with the ER

independently of ribosomes and translation. .................................................................... 40

Figure 3.5 ALPP, but not CYP8B1 mRNA remains associated with the ER independently

of ribosomes and translation. ............................................................................................ 42

Figure 3.6 ALPP mRNA, but not t-ftz and INSL3 mRNAs, remains associated with the

ER after cells were treated with pactamycin to disrupt the mRNA-ribosome association.

........................................................................................................................................... 43

Figure 3.7 Endogenous mRNAs remain associated with the ER independently of

ribosomes and translation. ................................................................................................ 46

Figure 3.8 The initial ER-targeting of ALPP and CALR, but not t-ftz or INSL3, mRNA

occurs independently of translation or ribosomes. ........................................................... 48

Figure 3.9 Identification of proteins that associate with ER-derived mRNAs. ................ 51

Figure 3.10 Over-expression of p180 can enhance the ribosome-independent association

of t-ftz mRNA with the ER. .............................................................................................. 58

ix

Figure 3.11 Nuclear export of t-ftz mRNA remains unchanged in co-transfected cells, but

total t-ftz mRNA levels decrease in cells expressing H1B-GFP. ...................................... 60

Figure 3.12 GFP-kinectin over-expression slightly enhances the ER-association of t-ftz

mRNA after ribosome dissociation. .................................................................................. 62

Figure 3.13 GFP-p180 over-expression enhances the ER-association of bulk poly(A)

mRNA. .............................................................................................................................. 64

Figure 3.14 The lysine-rich region of p180 directly associates with RNA in vitro. ......... 66

Figure 3.15 p180 is required for the ER-association of mRNA. ...................................... 68

Figure 3.16 Depletion of p180 in U2OS cells increases cell size. .................................... 71

Figure 4.1 Schematic diagrams of constructs and U-content in ALPP and t-ftz. .............. 78

Figure 4.2 ALPP ORF can mediate the ribosome and translation independent mRNA

localization on the ER in the chimera construct. .............................................................. 79

Figure 4.3 AP5 contains the ER localizing RNA element. ............................................... 81

Figure 4.4 Frame-shifted AP5 can still efficiently be maintained on the ER independently

of ribosomes and translation. ............................................................................................ 83

Figure 4.5 The TMCD is required for the translational-independent ER-localization of

ALPP. ................................................................................................................................ 87

Figure 4.6 The initial ER-targeting of AP5 occurs independently of translation and

ribosomes. ......................................................................................................................... 89

........................................................................................................................................... 91

Figure 4.7 p180 is required for the initial ER-targeting of ALPP. .................................... 91

Figure 4.8 p180 is required for the ER association of AP5. ............................................. 93

Figure 1. Endogenous Sec61β and Nesprin2 mRNA associates with the ER membrane. 99

Figure 5.2. Endogenous Nesprin2 mRNA localization in U2OS cells. .......................... 100

x

Figure 5.3. Overexpressed GFP-Sec61β mRNA is associated with the ER membrane. 102

Figure 5.4. ER-association of overexpressed GFP-Sec61β mRNA is partially independent

of translation. .................................................................................................................. 104

Figure 5.5. Incorporation of leucines in the TMD of FIS1 reroutes the protein from the

mitochondria to the ER. .................................................................................................. 106

Figure 5.6. The coding potential of GFP-Sec61β is not required for its localization to the

ER. .................................................................................................................................. 107

Figure 5.7. The initial targeting of Sec61β mRNA to the ER is partially dependent on

ribosomes and translation. .............................................................................................. 110

Figure 5.8. p180, TRC40 and BAT3 are not required for the ER association of Sec61β

mRNA and protein. ......................................................................................................... 112

Figure 5.9. BAT3 is not required for the ER association of Sec61β mRNA and protein.

......................................................................................................................................... 114

Figure 5.10. GFP-Sec61β mRNA competes with t-ftz mRNA for the ribosome binding

sites on the ER. ............................................................................................................... 117

Figure 6.1 Schematic of p180 and kinectin. ................................................................... 123

Figure 6.2 Translation-independent mRNA localization to the ER via p180. ................ 124

xi

List of Tables

Table 3.1 Proteins Enriched in the ERMAP Fraction. ...................................................... 52

Table 3.2 Proteins Enriched in the ERMAP Fraction (P>0.05). ....................................... 54

xii

List of Abreviations and Acrynoms

AVG Average

Ctrl Control

d Day

EDTA Edetic Acid

ER Endoplasmic Reticulum

ERMAP ER membrane associated protein

FISH Fluorescence in situ hybridization

ftz fushi tarazu

GET Guided entry of tail-anchored proteins

GFP Green fluorescent protein

h Hour

HHT Homoharringtonine

min Minute

mm Millimeter

mM Millimolar

MWM Molecular weight marker

ORF Open reading frame

Puro Puromycin

SE Standard error

SRP Signal recognition particle

SS Signal sequence

SSCR Signal sequence coding region

STD Standard deviation

TA Tail anchored

TMCR Transmembrane domain coding region

TMD Transmembrane domain

TRC Transmembrane domain recognition complex

μm Micrometer

μM Micromolar

UTR Untranslated region

1

Chapter 1

Introduction

Localization of mRNAs to the Endoplasmic Reticulum

Part of this chapter is adapted from a review originally published as:

Cui, X. A. & Palazzo, A. F. Localization of mRNAs to the endoplasmic

reticulum. Wiley interdisciplinary reviews. RNA 5,481–92 (2014).

2

1.1 Overview

Cellular organization relies in part on the proper sorting of newly synthesized proteins to

their proper destinations. Information required for this sorting is present in either the protein

itself and/or the encoding mRNA. Importantly, spatial information found in one of these

molecules can lead to the localization of both. For example, sorting information present within

the nascent polypeptide can be interpreted as it emerges from the ribosome during translation.

Since the mRNA is physically linked to the newly synthesized protein via the ribosome, the

targeting of the nascent chain to a particular subcellular destination results in the localization of

both the encoded protein and the mRNA.

A number of genome-wide analyses in diverse organisms and cell types established that

mRNA localization is a widespread mechanism to establish subcellular compartmentalization

both structurally and functionally. Hundreds of mRNAs have been shown to specifically localize

in a diverse array of cellular compartments. The most striking example is the discovery that in

early Drosophila (Drosophila melanogaster) embryogenesis, more than 71% of expressed genes

exhibit a clear subcellular localization pattern (1). In yeast (Saccharomyces cerevisiae), several

groups of mRNAs have been shown to localize to distinct subcellular compartment. For example,

a subset of mRNAs encoding mitochondrial and peroxisomal proteins are found to localize in the

proximity of peroxisomes and mitochondria respectively (2-7). In Xenopus laevis oocytes and

HeLa cells, a specific and conserved set of mRNAs are found to associate with mitotic spindles

and are suggested to be involved in spindle localized mitotic translation critical for cell division

(8,9). In addition, specific mRNAs localized to neuronal dendrites help to establish neuronal

polarity in both dendrites and axons (10-15). Furthermore, mRNA localization in neuronal cells

allows transient local translation of mRNAs in response to extrinsic stimuli in the environment

and induce plastic changes that occur at synapses triggered by learning and memories (for

reviews, please see (16,17)).

One of the best-studied examples is the targeting of mRNAs encoding secreted and

membrane proteins to the surface of the endoplasmic reticulum (ER). The ER is an extensive

subcellular organelle composed of the nuclear envelope, large perinuclear sheets and a more

peripheral tubular network. In general, the sheets contain ribosomes and correspond to the rough

ER, whereas the tubules are relatively devoid of ribosomes and thus analogous to the smooth ER

(18). Transcripts can also be localized on the ER membrane asymmetrically. One prominent

3

example is the localization of the wingless transcript to the ER near the apical plasma membrane

of Drosophila ectodermal cells, which is crucial to embryonic development (19). In a variety of

other polarized systems, including Xenopus oocytes (20), plant endosperm cells (21), and

budding yeast (22), asymmetrically localized mRNAs have been reported to use the ER as a

scaffold. How mRNAs can be localized to distinct ER locales, however, still remains largely

unknown.

1.2 mRNA Localization to the ER: a Historical Perspective

1.2.1 Early studies on the endoplasmic reticulum.

The ER was first described and coined by Keith Porter in a series of landmark electron

microscopy studies in the 1940s (23,24). Very early on, Porter and his associate George Palade

recognized that the endoplasmic reticulum, which literally means ‘little network within the

cytoplasm’, corresponded to a preparation derived from cell lysates and purified by a series of

differential centrifugation techniques developed by their mentor, Albert Claude (25-27). This

“microsome” fraction consisted of vesicles studded with small dense particles that physically

resembled the ER. When this fraction was subjected to detergent treatment, the vesicles

disappeared, indicating that they were composed of lipids, while the particles remained loosely

connected to one another in a beads-on-a-string pattern. These particles were sensitive to RNase

treatment (26) and were thus eventually named ribosomes (i.e., the ribonucleo-protein particles

of the microsome fraction). By using these cell fractions to reconstitute protein synthesis in vitro,

it was then shown by several groups that ribosomes play a central role in this biological process.9

Next, the Palade group monitored the synthesis and transport of proteins in pancreas

slices by both electron microscopy and cell fractionation and demonstrated that secreted proteins

were first synthesized by ribosomes on the surface of the ER. The proteins were ejected into the

ER-lumen, then transported to the Golgi, followed by zymogen granule vesicles, and finally

ending up in the pancreatic lumen (28-31). Although it was originally thought that all ribosomes

were membrane bound, a second class of “free” ribosomes were identified (25), and it was soon

realized that they synthesized cytoplasmic proteins (32,33). Since free and ER-associated

ribosomes were functionally interchangeable (34), either the translated mRNA and/or the protein

being produced must dictate whether translation would occur on the ER. But how was this

partitioning accomplished?

4

1.2.3 Building a model of how mRNA localizes to the ER.

Important observations into the role of the N-terminal end of the nascent polypeptide in

membrane attachment came about from studies with puromycin, an analog of the 3′-terminal of

the aminoacyl tRNA. This compound is incorporated into the growing nascent polypeptide chain

and causes it to be ejected from the ribosome (35). In the presence of puromycin, nascent

polypeptide chains were directly released into the ER lumen (36) while the empty ribosomes

remained attached to the membrane (37). The interaction between ribosome and membrane was

disrupted with high salt washes; however, the very same high salt concentrations did not disrupt

interactions between translating ribosomes and the membrane. This implied that both the

ribosomes and the nascent peptides were involved in membrane attachment. Later, this idea was

confirmed by the fact that as the N-terminal polypeptide emerges from the ribosome, it is

immediately protected from exogenous proteases by microsome membranes (38). Taken together,

it was hypothesized that the N-terminal end of the nascent polypeptide chain interacts with

microsome components, likely with some sort of channel. This specialized activity of the N-

terminal peptide led David Sabatini and Gunter Blobel, two members of the Siekevitz/Palade lab,

to propose the signal hypothesis: that the amino terminal of the nascent peptide contains the

information that is capable of establishing the association between the translating ribosomes and

the ER membrane. At the time, it was already suspected that this ER localization signal could be

a stretch of hydrophobic sequences because polyphenylalanine peptides synthesized from poly(U)

sequences, remained membrane associated after puromycin treatment (39).

Concurrent with the ongoing work in the Siekevitz/Palade lab, several other groups took

advantage of the fact that murine myelomas produced primarily one microsome-associated

mRNA, which encodes an immunoglobulin light chain, to study the translation of a particular

mRNA species in vitro. Importantly, this mRNA species could be purified to near homogeneity

and its in vitro translational product could thus be unambiguously identified. Surprisingly, this in

vitro synthesized polypeptide was slightly larger than the protein produced in vivo, which was

missing its N-terminus (40-43). These observations suggested that the N-terminal portion of

secretory proteins may be removed upon insertion into the ER. This process was essentially

reconstituted in vitro by Blobel and Dobberstein in 1975 (44,45). Critical to their success was

their use of microsomes derived from canine pancreatic cells, which did not inhibit translation as

is the case with other microsomal preparations (46). This system provided clear evidence that

secretory proteins are co-translationally incorporated into microsomes and cleaved into a smaller

5

sized protein by a protease that is present in the membrane. Later, this model was extended to the

insertion of membrane-bound proteins (47,48). Using this canine microsome system, the soluble

factor, called the signal recognition particle (SRP), and its receptor (SRP receptor, or SR), were

identified by members of the Blobel and Dobberstein labs (49-55). SRP recognizes both signal

sequences (SSs), which are hydrophobic α-helices that are almost universally found at the N-

terminus of secretory proteins, and transmembrane domains (TMDs). Eventually a candidate for

the protein-conducting channel, Sec61, was identified by Randy Schekman’s group (56). Finally,

in the early 1990s, Tom Rapoport’s group reconstituted ribosome-membrane association and

translocation using purified components and demonstrated that the Sec61 complex acted as both

the ribosome receptor and protein conducting channel (57,58).

Thus after 30 years of research, the details of the co-translational translocation pathway

finally became clear. This peptide-directed membrane-targeting process is one of the few

biological activities that appears to be universal. The initial targeting of the mRNA-ribosome-

nascent peptide is mediated by SRP, which binds to the nascent-chain ribosome mRNA complex

and directs it to the surface of the ER by interacting with SR. The central component of SRP

(SRP54), one of the two subunits of SR (SRα) and the central subunit of the translocon

(Sec61α/SecY) are 3 of only 80 genes that are present in every genome that has been sequenced

to date (59). The subsequent maintenance on the ER is mediated by direct interactions between

the ribosome and the Sec61 channel, also known as the translocon (Figure 1.1A). The interaction

between ribosome and the translocon retains the mRNA on the surface of the ER during the

translation process. Although prokaryotes do not have an ER, their SR and translocon orthologs

are present in the plasma membrane where they mediate the translocation of secretory proteins

and membrane-bound proteins (60).

6

Figure 1.1 Targeting secretory proteins to the endoplasmic reticulum.

(A) SRP-mediated protein localization to the ER. In this pathway, mRNAs encoding secretory proteins are translated by cytoplasmic

ribosomes. After the N-terminal hydrophobic signal sequence exits the ribosome, the cytosolic signal recognition particle (SRP) binds

to it, halts the translation, and then delivers the ribosome-nascent peptide–mRNA complex to the ER by interacting with the SRP

receptor (SR). At the ER, the signal sequence is then inserted into the sec61 translocon, and translation resumes. (B–D) SRP-

independent localization to the ER. (B) In yeast, post-translational translocation of proteins requires Sec62/Sec63 and translocon

complexes. The mammalian versions of Sec62 and Sec63 have gained additional positively charged cytoplasmic domains which allow

them to interact with the ribosome. Sec62/Sec63-dependent translocation functions independently of SRP. (C) Membrane proteins that

do not encode an N-terminal signal sequence but instead contain a C-terminal transmembrane domain (also called tail-anchored

proteins) are thought to be targeted to the ER post-translationally via the TRC/GET pathway. In the mammalian system, a pre-

targeting complex recognizes the TMD as it exits the ribosome. The TMD is then transferred to a TRC40 oligomer that acts as a

chaperone. Two TRC40 receptors, CAML and WRB, have been identified on the surface of the ER; however, it is unclear how these

7

latter factors mediate translocation. It is also unclear whether the translocon is involved in the direct insertion of tail-anchored

substrates. (D) Calmodulin (CaM) might also play a role in mediating the insertion of small secretory proteins or TA-proteins into the

ER membrane.

8

1.3 RNA mediated targeting: an alternative route to the ER

1.3.1 Initial studies.

In the 1970s, researchers also tested the hypothesis that an RNA element common to

secretory mRNAs was also involved in the targeting and/or maintenance of mRNAs at the

surface of the ER. It was hypothesized that such an element would be found within untranslated

regions of these mRNAs. In these early studies, the association of mRNAs with microsomes was

directly investigated in vitro. Indeed, under certain conditions more than 90% of the rRNA could

be removed by treating microsomes with high salt and translation inhibitors, while disrupting

only 50% of the microsomal mRNA (61). A number of additional papers at the time also

presented data supporting the presence of translation-independent targeting of mRNAs to the ER

(62-64). However, it was later found that increasing the ionic strength used in the microsome

purification protocol led to the removal of 80% of the microsomal mRNAs even without the use

of translation inhibitors (65). It should be noted that such harsh treatments may have disrupted

any existing interactions between mRNA and putative receptors in the microsomal membranes.

Subsequent studies using RoT curves, which measure the hybridization kinetics between cDNA

and mRNAs isolated from different sources, also disagreed on whether the ER and cytosol

contained overlapping sets of mRNAs (66,67). A resolution between these various experiments

may have also been hampered by a dearth of tools, such as RT-PCR and microarrays, to analyze

the mRNA-content of membrane fractions accurately. In the end, the results from these studies

remained controversial, and this line of investigation was abandoned after the protein-mediated

ER-targeting pathway was reconstituted in vitro.

1.3.2 SRP-independent pathways.

Although the signal sequence hypothesis appeared to be largely vindicated, it remained

unclear whether cells had a parallel RNA-based targeting system. The latter hypothesis was

resuscitated by the observation that budding yeast lacking the SRP component, SRP54, were

viable (68,69). Later it was shown that SRP54 and SRP72 could also be depleted in human

tissue culture cells using RNAi with little impact on cell viability (70-72). These observations

clearly pointed to the existence of SRP-independent pathways (Figure 1.1B-D).

The first SRP-independent pathway identified involves the post-translational targeting of

secretory proteins to the translocon. This alternative targeting pathway has been best studied in

9

yeast and is likely to exist in mammalian cells as well. In S. cerevisiae this pathway requires the

Sec62/Sec63 complex and other cytoplasmic chaperones (73-75), while in mammalian cells the

components are less well defined but may include homologs of Sec62 and Sec63 (76) (Figure

1.1B). In more recent work, yet another post-translational targeting mechanism was discovered

that operates on tail-anchored (TA) proteins. Since these proteins are anchored by a TMD at the

C-terminus, which only emerges from the ribosome exit tunnel upon completion of translation,

these proteins are recognized in the cytoplasm by the GET (Guided Entry of TA-proteins, in

yeast)/TRC (Transmembrane domain Recognition Complex, in mammalian cells) pathway

(77,78) (Figure 1.1C). In addition, calmodulin may also play a role in the insertion of tail-

anchored proteins and small secretory proteins in a calcium dependent manner (79,80) (Figure

1.1D), which adds another layer of complexity to the post-translational targeting process.

As membrane-bound proteins are known to be highly dependent on co-translational

translocation (74), they are likely to be synthesized by translocon-attached ribosomes. However

this begs the question of how their mRNAs make it to the membrane in the absence of SRP

function. The notion that SRP-independent pathways exist for mRNA-ER interactions is

supported by the fact that the depletion of SRP54 has only a modest effect on the partitioning of

mRNAs to the ER membrane in HeLa cells (71). One potential explanation is that the translocon

itself could serve as a direct, albeit inefficient, receptor for SSs and thus capture nascent chain

ribosome-mRNA complexes. Alternatively, other nascent chain targeting pathways could exist.

For example, in comparison to its yeast counterpart, the mammalian version of Sec62 has gained

additional cytoplasmic domains that can bind to ribosomes (81). Since the Sec62/63 complex

functions to translocate proteins in an SRP-independent manner (74,76), this complex may

facilitate the capture of nascent chain-ribosome-mRNA complexes in SRP54 depleted cells

(Figure 1.1B). Another possibility that was advanced by Christopher Nicchitta is that all mRNAs,

regardless of whether they encode secretory or cytosolic proteins, might be initially translated by

translocon-bound ribosomes (82). According to this model, mRNAs that encode cytosolic

proteins, and thus lacke a SS, would then be ejected from the ER during translation. Finally, it is

also possible that a lack of SRP activity can be overcome by membrane-bound mRNA receptors

present in the ER (82). These putative receptors would recognize certain features that are

disproportionately present in mRNAs that encode secretory and membrane-bound proteins. ER-

anchored mRNAs could then access empty ribosomes, which are plentiful as they remain bound

to translocons even after translation is completed (83). This RNA-based targeting model is

10

supported by the fact that in yeast, the fraction of ribosomes that are bound to translocons

increases after SRP inhibition, thus potentially aiding ER-targeted mRNAs to initiate translation

on the surface of this membrane (84). Ultimately, this line of inquiry prompted some, such as the

Nicchitta lab, to further investigate the interaction of mRNAs with the ER.

1.3.3 Resurrection of the alternative model.

With the advent of new cell manipulation techniques and technologies to detect mRNA,

various groups began to reanalyze whether mRNAs could associate with the ER independently of

translation. This reconsideration was also spurred on by the discovery that in many polarized

systems, the ER acts as a scaffold for the localization of asymmetrically distributed mRNAs (19-

22,85,86). One of the best characterized examples is ASH1 mRNA (which encodes a cell fate

determinate protein in yeast) expressed during late mitosis. ASH1 mRNP is asymmetrically

targeted to the cortical ER of the bud through anchorage protein Myo4p and its adaptor protein

She2p and She3p (86,87). Differentially localized transcripts on specific ER domains have also

been identified in other systems, such as rice endosperm and Drosophila oocytes and embryos

(19,88).

One method that greatly aided this work was the development of new fractionation

techniques that utilized the differential permeability of membranes to certain detergents (89). By

using these methods, the Nicchitta lab found evidence that many mRNAs encoding cytosolic

proteins were present in ER-derived fractions from mammalian tissue culture cells (89). This

data was confirmed by another study from the Brown lab (90). In a series of parallel experiments,

the Nicchitta lab also provided evidence that many mRNAs encoding secretory proteins

remained associated with the ER-derived microsomes in a ribosome and SRP-independent

manner (71).

Recently, an alternative method, proximity specific ribosome profiling, was developed by

the Weissman lab for determining whether any given mRNA is translated on the ER (91). In this

assay, cells express both an Avi-tagged ribosomal protein and an ER-localized biotin ligase,

BirA, that biotinylates the Avi tag. Upon the addition of biotin to the media, ER-proximal

ribosomes are biotinylated by the ER-localized BirA. Following biotinylation, cell lysates were

collected and treated with nuclease to produce monosomes. The biotin labeled, ER-specific

ribosomes were then purified by affinity purification on streptavidin-beads. RNA fragments

protected by these ribosomes were then isolated and identified by deep sequencing analysis.

11

Their work suggested that mRNAs enriched on the ER are predominately encoding membrane-

bound and secretory proteins. Interestingly, in their raw sequencing data included in the

supplemental materials, they did find that a significant fraction of the ER-associated mRNAs

encoded cytosolic proteins, which would be consistent with findings from the Nicchitta lab.

However, it remains unclear whether these reads originated from ER-targeted ribosomes or from

the non-specific binding of unlabeled ribosomes to the streptavidin affinity column.

From this line of investigation it has become clear that the encoded polypeptide is not the

sole determinant for mRNA localization to the ER-surface.

1.4 Biogenesis and Targeting of Tail-anchored Proteins

1.4.1 General Features of Tail-anchored Proteins

Tail-anchored (TA) proteins are distinct types of membrane protein which are anchored

into the lipid bilayer by a single TMD within the last 50 amino acids of the C-teminus, and

display their functional N-terminal domain towards the cytosol (92). In mammalian cells, about 5%

of membrane proteins are TA-proteins, and they are present on the ER, Golgi, mitochondria and

peroxisomes. Except for those found in the mitochondria, TA-proteins are first inserted into the

ER and then are transported to their proper final destination (93).

TA-proteins play critical roles in a variety of critical cellular processes: intracellular

trafficking (SNARE proteins), components of the ER protein translocon machineries (sec61β &

sec61γ), mitochondrial structural proteins (FIS1), nuclear-cytoskeletal attachment protein

(Nesprin2) and apoptosis regulators Bax and Bcl2 (94,95).

1.4.2 Biogenesis of ER Localized Tail-anchored Proteins

Due to the functional importance of TA-proteins, much effort has been made to unveil the

molecular mechanism of their biogenesis, with a particular focus on how they are inserted into

membranes. The hydrophobic membrane-targeting signal of TA-proteins is located in the C-

terminal end of the protein, which only emerges from the ribosomes upon termination of

translation. These TMDs do not interact with SRP and instead employ a dedicated membrane-

insertion system, the TRC pathway, which acts post-translationally. In mammalian systems, the

biogenesis pathway for TA-proteins was largely built from studies of the homologous GET

pathway in yeast and from in vitro studies using cell fractions of mammalian cells (78,96,97).

12

The current model of TA-protein synthesis (Figure 1.1C) suggests that TA-proteins are

first synthesized in the cytoplasm. Upon completion of their synthesis, the TMD exits the

translating ribosome and is recognized by a series of chaperone proteins, which are thought to

assist the protein to its proper final destination. These chaperones include SGTA, BAT3 (also

known as Bag6), Ubl4a and TRC40 (78,97-100). The first 4 proteins are thought to form a “pre-

targeting complex” that receives the TMD as it exits from the ribosome (Figure 1.1C). The TMD

is then handed over to TRC40, thought to be either a dimeric or tetrameric ATPase (101) that

delivers the TA-protein to the ER membrane receptors, WRB and CAML (102,103). These last

two proteins likely mediate the membrane-insertion process in an ATP dependent manner

(78,97,99,102,104). In this case, the mRNAs are being translated by free cytoplasmic ribosomes

and thus should not be in contact with ER membrane. In addition, the current model predicts that

the insertion of the ER localized TA-protein is independent of the translocon complex, and this

has been experimentally observed in in vitro reconstitution models (105,106).

Despite all of this work, it remains unclear whether the GET/TRC system is the lone

mechanism responsible for targeting TA-proteins to the ER. The idea that alternative pathways

exist is supported by the fact that GET/TRC pathway components can be deleted in yeast (99)

and mammalian (107) cells with minimal effects on cell viability despite the fact that some of the

TA substrates are critical for cell homeostasis. Indeed, in vitro reconstitution studies have shown

that in certain circumstances these proteins are also targeted to the ER utilize cytosolic chaperone

proteins to the ER including SRP, and the HSP40/HSP70 system (105,108,109). Others have

shown that certain TA-proteins, most notably cytochrome B5, can spontaneously insert into

membranes (110). Recently, the Weissman group found that many transcripts encoding TA-

proteins associate with ER-proximal ribosomes, although this occurred mainly at the 3′ end of

the mRNA near the TMD (91). This result raised the possibility that mRNAs encoding TA-

proteins may be anchored to the ER.

1.4.3 Biogenesis of Mitochondria Localized Tail-Anchored Proteins

Relatively less is known about how TA-proteins are targeted to mitochondria. It has been

shown in yeast that when the fidelity of the GET machinery is impaired, TA-proteins that are

normally destined to the ER will either aggregate in the cytosol or mislocalize to the

mitochondria (99,111). Thus it was assumed that the mitochondria was the non-specific

destination for all TA-proteins. This model is supported by the observation that the insertion of

mitochondrial TA-proteins may not require assistance from additional soluble protein factors, as

13

these proteins can insert in vitro into protease-treated mitochondria membrane with the same

efficiency as they insert into untreated ones (112,113). It has been hypothesized that the lipid

composition might be one of the key determinants for this default targeting mechanism. The

mitochondrial outer membrane has the lowest sterol concentration among all intracellular

membranes facing the cytosol (114). When the ergosterol level increases in liposomes, the

insertion efficiency of mitochondria TA-proteins decreases (112).

However, this default mechanism for targeting TA-proteins to the mitochondria needs to

be curated in order to maintain the accuracy of protein localization. Two recently published

independent studies identified a mechanism for clearing mistargeted TA-proteins on the

mitochondrial outer membrane. These studies showed that the degradation of mistargeted TA-

proteins on the mitochondrial surface requires MSP1 in yeast and ATAD1 in humans, both of

which are members of the AAA-ATPase family of proteins (115,116). How MSP1/ATAD1

differentiate between mitochondrial- and ER-targeted TA-proteins is still unknown.

Other studies suggested that mitochondrial targeted TA-proteins are actively targeted to

their destination by a bipartite signal in the TMD. The TMDs of mitochondria targeted TA-

proteins are less hydrophobic than those targeted to the ER, and are flanked by a small stretch of

basic residues (117). Indeed, TA-proteins that are normally delivered to the ER can be rerouted

by alterations in the TMD or in the flanking regions (118). For TA-proteins destined to the

mitochondria membrane, the length of the TMD, spacing between the TMD and the flanking

basic residues, and the composition of luminal sequences all play a role in the efficiency of the

insertion of mitochondria targeted TA-proteins (118). In addition, disruption of the TMD or the

C-terminal luminal sequence results in the mislocalization of mitochondria TA-proteins to the

ER, revealing that these two organelles are linked by independent but competing pathways

(118,119).

In summary, active targeting via the bipartite signal and selective degradation of

mislocalized TA-proteins both contribute to accurate TA-protein localization on the

mitochondrial membrane. Regardless of the targeting mechanisms, current models suggest that

mitochondria targeted TA-proteins are post-translationally targeted and these mRNAs are

cytosolically localized.

14

1.4.4 Biogenesis of Peroxisome Localized Tail-Anchored Proteins

Although we do know that mitochondrial TA-proteins are directly inserted into the

mitochondrial outer membrane (112), until very recently, it has been unclear whether peroxisome

targeted TA-protein are directly inserted into the peroxisome membrane or first inserted in the

ER membrane.

Peroxisomes are membrane enclosed small intracellular organelles involved in a variety

of cellular processes including fatty acid oxidation and plasmalogen (a unique class of membrane

glycerophospholipids containing a fatty alcohol with a vinyl-ether bond at the sn-1 position)

synthesis. For peroxisomal luminal proteins, it is well established that these proteins are post-

translationally inserted into the peroxisomes (For a review on this topic, please see (120)).

However, for peroxisomal membrane proteins (PMPs), it is still unclear whether all or some of

these proteins are incorporated first into the ER and then trafficked to the peroxisome, or whether

they are directly post-translationally inserted into peroxisomal membranes.

For peroxisomal TA-proteins, it appears that yeast and mammalian cells employ two

different targeting mechanisms. In yeast, the TA-protein Pex15p is first inserted into the ER

membrane via the GET pathway (99,111). From the ER, Pex15p then shuttles to the peroxisome

in a Pex19p dependent manner (Lam et al., 2010). However, it was unclear whether the Pex15p

ortholog in human, Pex26, also traffic through the ER to arrive at peroxisomes. A recent study

showed that Pex26 forms a soluble complex with Pex19 in the cytosol, which is then recruited to

the peroxisome by binding to Pex3 (121). This targeting mechanism is ATP and TRC40

independent and does not appear to use the ER as a pit stop (121). However, recent work from

the Kim lab at the University of Toronto showed that Pex16, a PMP that is co-translationally

inserted into the ER membrane, is involved in the recruitment of other PMPs to the ER

membrane, including Pex26 (122). Thus, it is possible that Pex26 is transiently localized on the

ER before trafficking to the peroxisome, and the mRNAs encoding this TA-protein may also

reside in close-proximity to the ER membrane.

1.5 Components that Mediate the Translation-Independent mRNA

Localization to Subcellular Organelles

1.5.1 Trans-acting factors.

Presumably, subsets of mRNAs that share a common subcellular distribution should bind

to a common RNA binding protein. Indeed mRNA is never free inside of a cell but is likely

http://jcb.rupress.org/content/200/5/651.full#ref-40

15

always associated with a host of RNA binding proteins to form messenger ribonucleoprotein

(mRNP) complexes. The idea that mRNP composition may help to properly target an mRNA is

supported by two large-scale analyses which demonstrated that each RNA-binding protein in

Saccharomyces cerevisiae tends to associate with transcripts encoding functionally related

proteins (123,124). These associations may help to localize certain classes of mRNAs to different

organelles.

For example, 90% of the transcripts associated with the pumilio protein, Puf3p, code for

mitochondrial proteins in budding yeast. Puf3p localizes to mitochondria and is required for the

targeting of many of these mRNAs to this organelle (7,125). Puf3-mRNA complexes can also be

stored in P-bodies in the cell where they are translationally silenced (126). It is hypothesized that

when the overall cellular energy level is low, Puf3 can quickly translocate mRNAs to the

mitochondria outer membrane for translation in a translation dependent mechanism to synthesize

proteins required for mitochondria energy production (127). By having a centralized translational

control, Puf3-mRNA complexes allow mitochondria to swiftly adapt to the energy needs of the

cell. Interestingly, neither of the human pumilio proteins PUM1 or PUM2 specifically interact

with mRNAs encoding mitochondrial proteins or interact with mitocondria (128).

Recently, a cytosolic RNA binding protein, CLUH, has been identified to be involved in

the recruiting of nuclear encoded mitochondria proteins (129). Depletion of CLUH homolog in

yeast, Drosophila and plants, led to mitochondrial clustering (130-132). Gao et al, showed that in

humans, CLUH is partially localized to the mitochondria and recruits mRNAs encoding

mitochondrial proteins (129). RNA immunoprecipitation coupled with next generation

sequencing revealed that CLUH interacts with 259 transcripts, of which 234 encode

mitochondrial targeted proteins (129). These transcripts encode components of the respiratory

chain, tricarboxylic acid cycle (TCA) and also fatty acid and amino acid biosynthesis. Perhaps,

CLUH acts as a central hub, similar to the role of Puf3p, to bring these transcripts to the vicinity

of mitochondria. This localization allows these transcripts to be translated in close proximity of

mitochondria, which facilitates the protein import process. The idea that mRNAs encoding

mitochondrial proteins are localized in the vicinity of mitochondria is also supported by a

mitochondria proximity ribosome profiling study conducted by the Weissman Group (133). In

this study, a proximal ribosomal profiling assay was performed to identify mRNAs translated by

mitochondria proximal ribosomes. Ribosomes in the vicinity of mitochondria were biotinylated

by a BirA that was tethered to the mitochondrial outer membrane. mRNA sequences protected by

16

purified mitochondria-proximal ribosomes were then sequenced. Their findings were consistent

with the idea that mRNAs encoding mitochondrial proteins, especially for the mitochondria inner

membrane proteins, are translated on the mitochondrial outer membrane (133).

Another well-defined example of a trans-factor that mediates the targeting of mRNA to

an organelle is the set of protein machineries involved in the localization of more than twenty

mRNAs to the ER of the daughter cell in yeast, with a significant fraction of these mRNAs

encoding secreted and membrane proteins (86). One of the best-characterized examples in this

group of mRNA targets, is the ASH1 mRNA, essential for establish asymmetry of HO expression

and mating type switching. The initial re-localization of ASH1 mRNA to the daughter cell is

dependent on Puf6p, another pumilio-type protein which binds to several elements in the mRNA

and helps repress its translation (134). She2p also binds to this mRNA while it is still in the

nucleus, and once exported to the cytoplasm this protein helps tether the mRNA to the ER (135).

In the cytoplasm She2p also engages a protein complex that includes Myo4p (a Type V myosin),

She1p and She3p, which together move the ASH1 mRNA to the ER of the bud along the actin-

cytoskeleton network (for review on this topic, please see (136)). Together, She2p, She1p, She3p

and Myo4p form the locasome, to establish the asymmetrically localization of these mRNAs.

1.5.2 Cis-acting elements.

Some of the cis-acting RNA elements that contribute to the asymmetric localization of

mRNAs in many polarized systems have already been identified. These RNA elements are

present not only in the 5′ and 3′ untranslated regions (UTRs), but also in the open reading frame

(ORF). These elements are recognized by one or more RBPs, which then help to localize these

transcripts to their destination.

This localization process can be accomplished through selective degradation, local

protection or active transport of transcripts. For example, in Drosophila melanogaster oocytes,

the asymmetric distribution of nanos protein to the posterior is achieved by creating a gradient of

nanos mRNA in the oocytes. The Smaug response element located in the 3′UTR of nanos

mRNA is recognized by the protein Smaug, which in conjunction with the CCR4-Not1 complex

deadenylates this mRNA to translationally represses it. However, at the posterior side, nanos is

recognized by Oskar, which precludes Smaug association, thus leading to its stabilization and

translation (137). mRNAs can also be actively targeted to the destination. In the case of β-actin

mRNA, the RNA element is a 54-nucleotide sequence in the 3′UTR that is a bipartite motif. This

17

motif is recognized by the zipcode-binding protein 1 (ZBP1) which brings the β-actin mRNA to

the leading edge of fibroblasts in a cytoskeleton and motor-dependent manner (138-140). In

Xenopus Laevis oocytes, the 3′UTR of xcat2 contains six repeats of a short motif, UGCAC

(named R1). Mutation in the second, third and forth repeats results in the reduction of xcat2

localization to the mitochondrial cloud in the vegetal pole of the oocyte (141). However, when

R1 was inserted into the 3′UTR of another transcript, this element was not sufficient to bring the

transcript to the mitochondrial cloud, indicating it is required but insufficient for mitochondrial

localization of this transcript (141).

In the above examples, specificity is achieved through the sequence of the RNA

localization element. There are also instances where the secondary structure of the RNA element

is important for proper localization. For example, in bicoid mRNA, the 3′UTRs contains several

50-nt sequences which form stem-loop structures that associate with Staufen, a RBP which then

brings bicoid mRNA to the anterior pole of the oocytes along microtububles (142-145). Some

mRNAs can also contain multiple motifs and properties which are recognized by multiple

proteins. ASH1 mRNA contains four cis-acting localization elements, three of which are

localized in the ORF (E1, E2A, E2B), and the other extends into the 3′UTR (E3)(146,147). Each

of these elements by itself is sufficient for the asymmetrical localization of ASH1 to daughter

cells. For E3, the stem loop secondary structure appears to be critical for the localization ability

of this element but for E1, specific RNA sequences are required (146,147).

Nucleotide composition is another property that has been identified to play a part in

mRNA localization and downstream translation of its encoded protein. Recently, it was found

that that the Bgl polycistronic transcript is anchored to the plasma membrane of E. coli using a

mechanism that is independent of its translation (148). The anchoring of this transcript required a

portion of the BglF ORF, which encodes several transmembrane domains (TMDs) (148,149).

TMDs consist of long stretches of hydrophobic amino acids, whose codons tend to have certain

inherent biases, such as a high level of uracil-content. Indeed, it was suggested that the U-

richness is required for the targeting of this transcript to the bacteria membrane independently of

translation (148,150). In mammalian systems, the low level of adenine content in the signal

sequence coding region (SSCR) has also been demonstrated to play a role in the translatability of

mRNAs encoding secretory proteins (151). SSCRs tend to be depleted of adenines, contain

CUG-repeats and are enriched in certain GC-rich motifs (152-154). In this case, when adenine

mutations are incorporated into the SSCR of t-ftz (translocated fushi tarazu, an artificial model

18

transcript) or the calreticulum mRNA (which encodes an ER chaperone), the translatability of

these mRNAs are dramatically decreased (151).

In summary, RNA elements involved in the spatial regulation of transcripts are versatile

and can require both sequence and/or structural elements.

1.6 Rationale and Approach

mRNA localization is one of the mechanisms cell utilizes to establish asymmetrical

protein gradients. For mRNAs targeted to the ER, the controversy of whether they can be

localized to this organelle independently of translation still remains to be resolved. For my thesis

project, I aimed to reinvestigate this issue using a visualization based method to analyze mRNA

localization in cells.

To study a process that is translation independent, I first inhibited ribosome activity in

tissue cultured mammalian cells with translation inhibitors such as pactamycin, puromycin and

homoharringtonine. In order to visualize mRNA localization on the ER membrane without the

obstruction of cytoplasmic mRNAs, I used a digitonin-extraction treatment to selectively disrupt

the plasma membrane, thereby releasing the cytoplasmic content while retaining the integrity of

the ER membrane (Figure 1.2A). Following this treatment, I then visualized whether a particular

mRNA was ER-associated using fluorescence in situ hybridization (FISH). Specifically, I

investigated both the initial targeting of mRNAs to the ER and also the maintenance of these

mRNAs on the ER membrane (Figure 1.3). These two processes are independent of each other as

mRNAs targeted to the ER through the SRP mediated pathway can later be maintained on the ER

independently of translocon and ribosome interaction. To study the initial targeting process, I

microinjected plasmid encoding our gene of interest into cells pretreated with the translation

inhibitor (Figure 1.2B). This allowed us to visualize whether mRNAs were targeted to the ER in

the absence of functional ribosomes. To investigate the maintenance phase of the process, I

transfected plasmids encoding our gene of interest and investigated the steady state distribution

of the resulting mRNAs and determined whether they fell off of the ER after ribosomes were

disrupted (Figure 1.2C).

Using these techniques, I first established that a substantial fraction of mRNAs on the ER

are maintained there by a translation independent mechanism (Chapter 3). Then, I identified an

mRNA receptor on the ER (Chapter 3) and a cis-acting element in the ALPP (alkaline placental

19

phosphatase) mRNA (Chapter 4) responsible for this translation independent mRNA localization

on the ER. Lastly, I investigated the localization of mRNAs encoding TA-proteins and showed

that some members of this group are targeted to the ER independently of translation (Chapter 5).

20

Figure 1.2 Illustration of key methods used in this thesis.

(A) To visualize mRNAs on the ER without the obstruction of cytoplasmic mRNAs, mammalian

tissue cultured cells are treated with low level of digitonin to selectively permeabilize the plasma

membrane. This process allows the release of cytoplasmic content including cytoplasmic

mRNAs. In addition, both the ER and the nuclear envelop are undisturbed by this process,

including mRNAs associated with the ER. (B) To study the initial targeting of mRNAs to the ER,

cells are first treated with translation inhibitor to inhibit ribosome activity. After, plasmids

containing the gene of interest are microinjected into the nucleus of the cell. The targeting of

newly synthesized mRNA can be visualized using FISH probes against the gene of interest. (C)

To investigate the maintenance step of mRNA anchorage on the ER, cells are transfected with

plasmids expressing gene of interest. Twenty-four hour post transfection, cells are the treated

with digitonin, stained with specific FISH probes against the gene of interest to visualize whether

the mRNA of interest is anchored on the ER at steady state.

21

Figure 1.3 Overview of project aims.

In this thesis project, I am interested in studying whether mRNAs encoding secretory proteins

can be targeted to the ER using a translation independent mechanism. In particular, both the

initial targeting and the later maintenance steps of this process will be investigated. After

establishing the existence of this pathway, I am also interested in identifying the mRNA receptor

on the ER that is responsible for anchoring these transcripts on the ER and also the cis-acting

RNA element that provides the localization signal.

22

Chapter 2

Materials and Methods

Part of this chapter is adapted from articles originally published as:

Cui, X. A & Palazzo, A. F. Visualization of Endoplasmic Reticulum Localized

mRNAs in Mammalian Cells. J. Vis. Exp. (70), e50066, doi:10.3791/50066

(2012).

Cui, X. A, Zhang, H, & Palazzo, A. F. p180 Promotes the Ribosome-Independent

Localization of a Subset of mRNA to the Endoplasmic Reticulum. PloS

Biology 10(5): 3100136 (2012).

Cui, X. A, Zhang, Y, Hong, S.J. & Palazzo, A. F. Identification of a region within

the placental alkaline phosphatase mRNA that mediates p180 dependent targeting

to the endoplasmic reticulum. J. Biol. Chem 288(41): 29633-29641 (2013).

Cui, X. A. & Palazzo, A. F. mRNA Encoding Sec61a Tail-Anchored Protein, is

Localized on the Endoplasmic Reticulum. J. Cell. Sci, Submitted (2015).

23

2.1 DNA Plasmids and Construction of Fusion Genes

Full-length human INSL3 (GeneID: 3640), CALR (GeneID: 811), and ALPP (GeneID:

250) cDNAs (i.e., including both the open reading frames and complete untranslated regions),

inserted into the pSPORT6 vector, were purchased from Open Biosystems. FIS1 ORF (GeneID:

51204) was amplified from an U2OS cDNA library with forward primer-

AGATCTATGGAGGCCGTGCTGAACG and reverse primer-

GAATTCCTTGCTGTGTCCAAGTCCAAATCCTGA. The amplified ORFs were then inserted

into the pEGFP-C1 MCS (Multi-cloning sites) using EcoRI and BglII sites. For GFP-Sec22β

(GeneID: 9554), forward primer-ATGGTGTTGCTAACAATGATCGCC and reverse primer-

GTCCGATTCTGGTGGCTGTGA were used to amplify the Sec22β ORF from a U2OS cDNA

library, which was inserted into the TOPO cloning vector (Invitrogen) and subsequently cloned

into the pEGFP-C1 vector using the BglII cloning site. For Sec61γ (GeneID: 23480), forward

primer- GGCAGAAACCCGGA and reverse primer-

TTCATTTACTTTGAAATTACTTTAATTTAG were used to amplify the cDNA including the

UTRs which were subsequently inserted into the MCS of pcDNA3.1 vector. The GFP ORF from

pEGFP-C1 vector was then inserted at the N-terminal of the Sec61β sequence using restriction

enzyme free cloning with forward primer- GGTTGGGTAGGCAGTCATGGTGAGCAAGGGC

and reverse primer- CAAACTGCATTACCTGATCCATAGATCTGAGTCCGGACTTG. GFP-

Sec61β (Rolls et al., 1999) was obtained from the Rapoport Lab (Harvard University), and GFP-

Pex26 (Deosaran et al., 2013) and GFP-VAMP1 was obtained from the Kim Lab (University of

Toronto).

cyto-ALPP was constructed by amplifying nucleotides 123–1585 of the ALPP cDNA by

PCR. The PCR product was then inserted between the frame-shifted MHC SSCR and the ftz

ORF in the fs-ftz pCDNA3 construct (152) using restriction-free PCR subcloning. GFP-p180,

GFP-CLIMP63, and H1B-GFP were described previously (155,156). The GFP-

p180ΔLysΔRepeat construct, which lacks nucleotides 175–2028 of the p180 ORF, was

constructed from GFP-p180 using restriction-free PCR-based deletion (157). All chimeric

constructs between ALPP and t-ftz were constructed by restriction free subcloning (158) using

full length ALPP in pSPORT6 (124) and t-ftz (also known as MHC-ftz) in pCDNA3 (159).

Briefly, inserts were amplified by PCR, followed by a second vector-based PCR step that either

inserts the fragment or uses the fragment to replace a targeted sequence. AF1 was constructed by

replacing the t-ftz ORF with the ALPP ORF, while the converse is true for AF2 (Figure 3.2A).

24

APx constructs (AP1, AP2, AP3, AP4 and AP5, Figure 3.2A) were constructed by inserting

various fragments of ALPP (as indicated in Figure 3.2B) in-between the SSCR and ORF of t-ftz.

In particular AP1 contains nucleotides 134-480 of the full length ALPP cDNA transcript, AP2

contains 481-917, AP3 contains 918-1172, AP4 contains 1173-1564 and AP5 contains 1472-

1671. Note that AF1 and AP1-5 constructs are in pCDNA3, while AF2 is present in pSPORT6.

Frame shift AP5 (fs-AP5) was constructed by site directed mutagenesis using restriction free sub-

cloning to insert a Guanine between the 3rd

and 4th

nucleotide of the ORF. ALPP-∆TMD was

made by removing nucleotides 1504-1594 from the ALPP construct using restriction free

cloning. H1B-GFP and M1-ftz were described previously (152).

To alter the TMD of the FIS1 (GGMALGCAG to LLMALLVLL, see Figure 5.6B),

restriction free cloning was performed as previously described (157) to incorporate 5 Leucines

into the TMD (Forward primer-

TTACTTATGGCCCTGTTGGTGCTTTTGCTGGCCGGACTCATCGGACTTGC; Reverse

primer- CAAAAGCACCAACAGGGCCATAAGTAACACGATGGCCATGCCCACGAGTC).

To construct GFP-fs-Sec61β, a single cytosine was inserted right before the start of TMD using

restriction enzyme free cloning (157) with forward primer-

CGATTCTACACAGAAGATTCACCTGG and reverse primer-GCTCAAAGCTTGGCCCTGT

using GFP-Sec61β as template (see Figure 5.10 for location of the insertion) .

2.2 Cell Cultures

U2OS, COS-7, HEK293 and MEF cells were grown in DMEM (with high glucose and

sodium pyruvate) supplemented with 10% FBS. Cells were subcultured at 80% confluency and

kept at 37°C with 5% CO2. BAT3 knockout MEF cells were obtained from Dr. Hokada at

University of Toronto (107). Bat3-/-

cells were grown in DMEM supplemented with 10% FBS

and 2-mercaptoethanol.

2.3 Computational Analysis of the Features of Encoded Proteins

Presence of signal sequences or TMDs was predicted using SignalP

(http://www.cbs.dtu.dk/ services/SignalP/) and TMHMM servers

(http://www.cbs.dtu.dk/services/TMHMM/) (160,161). Kyte- Doolittle Hydropathy plot was

computed using ProtScale (http://web.expasy.org/protscale/)(162).

25

2.4 Lentiviral Delivered shRNA Treatment

Depletion of various proteins in this thesis was attained by lentiviral-mediated delivery of

shRNA constructs against a protein of interest. Specifically, lentivirus was collected from the

media of HEK293 packing cells transfected with plasmids including shRNA plasmid and

plasmid encoding viral components (VSV-G and Δ8.9) (163). Each shRNA carries a specific

sequence against our gene of interest and also the puromycin resistance marker for selection.

Lentivirus was harvested from the medium 24 h and 48 h post- transfection by filtering through a

0.44 mm filter. For infection, lentivirus was applied to U2OS cells with 8 mg/ml hexamethrine

bromide to enhance the infection efficiency. Puromycin (2 μg/ml) was applied to the cell 24 h

post-infection at 2 mg/ml to select for infected cells, and puromycin containing medium was

changed every other day. Cell lysates were collected 5 d post-infection to assess the level of

knockdown, and the cells were used for various experiments as described.

The shRNA constructs were obtained from MISSION® library (Sigma): plasmids

encoding shRNA against p180 (clone B9 - TRCN0000117407, clone B10 - TRCN0000117408,

Sigma), CLIMP63 (clone TRCN0000123296), kinectin (clone TRCN- 0000063520), BAT3

(TRCN0000007357), TRC40 (clone A - TRCN0000042959 and clone B - TRCN0000042960),

Nesprin2 (also known as SYNE2; TRCN0000303799) or empty vector (pLKO.1)

2.5 Digitonin Permeabilization

For extractions, cells were grown on acid treated coverslips, transfected and treated with

either control or drug containing medium. At the time of extraction, cells were typically at about

70% confluency. After rapidly washed twice in 37°C CHO buffer (115 mM Potassium Acetate,

25mM HEPES pH 7.4, 2.5mM MgCl2, 2mM EGTA, 150mM Sucrose), cells were then incubated

in CHO+0.025% digitonin (Sigma), with or without 20 mM EDTA at 37–42 °C for 10 s.

Extraction was terminated by the addition of 4% paraformaldehyde in PBS at 37 °C.

2.6 Microinjection

To determine the targeting of newly synthesized transcript, plasmids encoding our gene

of interest were microinjected into U2OS or COS-7 cells pretreated with DMEM containing

either DMSO, 200 μM puromycin (Sigma) or 5 μm HHT (Tocris Bioscience, Bristol, UK) for 15

min as demonstrated in a video protocol previously (164). After injection, cells were incubated

26

with DMEM containing DMSO, or 5 μm HHT for 30 min then permeabilized with digitonin and

then fixed as described in the previous section.

2.7 Transfection of Mammalian Tissue Cultured Cells

Transfection of COS-7, U2OS, HEK293 cells were performed using GenJet Transfection

Reagent (SignaGen Laboratories) as per the manufacture’s instruction. Bat3-/-

and MEFs cells

were transfected using JetPrime Polyplus (Invitrogen) transfection reagent as per the

manufacture’s instruction. 18-24 h post transfection, cells were treated with either control

medium, or medium containing 200 μM puromycin or 5 μm HHT for 30 mins followed by either

FISH and/or immunostaining.

2.8 Fluorescent in situ Hybridization, Stellaries® Probe Staining, Imaging and

Computational Analysis

After cells growing on coverslips were treated with various treatments and fixed with 4%

paraformaldehyde fixing buffer, cells were then staining with either specific FISH probes to

visualize exogenously expressed mRNAs, oligo-dT probe to visualize total mRNAs or with

Stellaris Probe for endogenous mRNAs. The deoxyoligonucleotides used to stain bulk mRNA

(polymer of 60 dT; poly(dT)), ftz (GTCGAGCCTG CCTTTGTCAT CGTCGTCCTT

GTAGTCACAA CAGCCGGGAC AACACCCCAT), INSL3 (GGGCCCCCGC

ACACGCGCAC TAGCGCGCGT ACGAAGTGGT GGCCGCA), CALR (CAGATGTCGG

GACCAAACAT GATGTTGTAT TCTGAGTCTC CGTGCATGTC), EGFP (CCGTCGCCGA

TGGGGGTGTT CTGCTGGTAG TGGTCGGCGA GCTGCACGCT GCC) and ALPP

(CAGCTTCTTG GCAGCATCCA GGGCCTCGGC TGCCTTTCGG TTCCAGAAG) were

conjugated at the 5′ end with Alexa546 (Integrated DNA Technologies). To ensure that poly(dT)

signal was dependent on mRNA, coverslips with FISH-stained cells were incubated in RNase H

reaction buffer (NEB) with or without RNase H (New England Biolabs) at 10 units per coverslip

for 1 h at 37°C.

Cells were then imaged using an inverted fluorescence microscope. The transfected cell

can be differentiated from untransfected cells by a bright fluorescence signal in the appropriate

channel. For each field images of the FISH and DAPI channel were acquired. In addition, if the

cells are co-stained with protein markers, an image of the immunofluorescence channel was also

acquired. To ensure that the fluorescence intensities between fields can be compared, the

exposure times for each channel were kept constant for each set of experiments. The amount of

27

mRNA localization in each regions of interest was determined using Nikon NIS Element

software (Nikon Corporation, Tokyo, Japan). Using the Nikon NIS ELEMENT image analysis

tool, the cell periphery and the nucleus were outlined as separate Regions of Interests (ROIs). For

each ROI, the fluorescent intensity (IT for the total cell intensity and IN for the nuclear intensity)

and the area (AT for cell size and AN for size of nucleus) were recorded and exported to an Excel

spreadsheet. For each image, the background fluorescent intensity (IB) was determined by

recording the intensity of a non-transfected cell. If poly(A)mRNA levels were being analyzed, a

cell-free area was selected as background. The total amount of fluorescence in a cell (ER with

nucleus in extracted cells or cytoplasmic with nucleus in unextracted cells) was calculated by the

formula: [AT][ IT - IB]- [AN][ IN - IB]. The nuclear staining intensity can also be calculated and

used as internal control between various treatments and was calculated by the formula of [AN][IN

- IB]. The percent of cytoplasmic mRNA that is ER-targeted can be calculated by subtracting the

fluorescence intensity in the nucleus from the total mRNA fluorescence intensity.

The localization of endogenous Sec61β, Nesprin-2 (SYNE2) and GAPDH mRNAs was

visualized using customized or catalogued Stellaris probe arrays (Biosearch Technologies,

Petaluma, CA) against human or mouse genes. U2OS, MEF and Bat3-/-

cells were grown on

coverslips, either treated with control or HHT containing media for 30 min, then fixed directly or

after digitonin extraction. The staining was performed as per the manufacture’s protocol with the

following exception: after overnight staining with FISH probes, the cells were washed 3 times

with 2X SSC solution containing 10% formamide at room temperature. After washing, the cells

were mounted with DAPI mounting solution and visualized. After cells were imaged using

fluorescent microscopy, the number of endogenous mRNA foci in each cell was quantified using

NIS Element software (Nikon Corporation, Tokyo, Japan). Briefly, cell and nuclear peripheries

were selected to generate ROIs. Then, the number of endogenous mRNA foci was counted using

“spot detection” function, selecting for bright spots that were about 0.40 μm in diameter.

2.9 Cell Fractionation, Western Blots and Northern Blots

To isolate fractions, cells were first pre-treated with cycloheximide (200 mM), or control

media for 30 min; then trypsinized, pelleted at 800 g for 2 min, washed 3 times with ice cold

PBS+Soy Bean Trypsin Inhibitor (0.1 mg/ml; Sigma), ±200 mM cycloheximide; washed once

with ice cold Phy Buffer (150 mM Potassium Acetate, 5 mM Magnesium Acetate, 20 mM

HEPES pH 7.4, 5 mM DTT, and protease inhibitors, with either control media or 200 mM

28

cycloheximide); and then resuspended in cold 0.5 ml Phy Buffer again with indicated reagents.

Cells were extracted by adding an equal volume (0.5 ml) of cold Phy Buffer+0.2% digitonin.

Lysates were then centrifuged at 800 g for 2 min to produce a suspension (cytoplasmic fraction)

and pellet (ER+nuclear fraction). The pellet was then washed once with cold Phy Buffer, then

resuspended in cold 0.5 ml Phy Buffer and extracted by adding an equal volume (0.5 ml) of Phy

Buffer+0.5% TritonX-100. This sample was then centrifuged at 800 g for 2 min to produce a

suspension (ER fraction) and pellet (nuclear fraction). Both cytoplasmic and ER fractions were

then centrifuged at 10,000 g for 10 min to remove solubilized contaminating organelles such as

mitochondria and nuclei. Total mRNAs were then isolated from each fraction using PureLink®

RNA Mini Kit (LifeTechnologies) and used for the following experiment. A portion of the cell

fractions was removed prior to the RNA extraction and mixed with Laemmli sample buffer,

heated to 65°C for 5 min, and separated by SDS-PAGE and used for western blotting analysis.

Cell lysates were collected in RIPA buffer (50 mM Tris-HCl, 150 mM NaCl, 0.1% SDS,

0.5% Triton-X100, 1 mM PMSF, and 1X protease inhibitor cocktail, Roche) from various cell

lines. Proteins were separated by SDS-PAGE and transferred onto the nitrocellulose membrane

and probed with antibodies specific to p180 (polyclonal, 1:1,000 dilution, Sigma), CLIMP63

(polyclonal, 1:1,000 dilution, Sigma), kinectin (polyclonal, 1:1,000 dilution, Sigma), GFP

(polyclonal, 1:1,000 dilution, Invitrogen), S6 (rabbit monoclonal, 1:250 dilution, Cell Signaling),

Trapα (rabbit polyclonal, 1:5,000 dilution, Sigma), Sec61β (rabbit polyclonal, 1:5,000 dilution),

αtubulin (mouse monoclonal DM1A, 1:20,000 dilution, Sigma), Aly (rabbit polyclonal, 1:1000

(165)), Bat3 (rabbit polyclonal 1:1000, Dr. Hegde’s Group (97)) and TRC40 (rabbit polyclonal

1:1000, Dr. Hegde’s Group (97)). Secondary antibody against rabbit, human or mouse IgG

(Sigma) conjugated with horse radish peroxide (HRP) were then used at 1:4000 dilution. HRP

conjugates were then visualized using Pierce™ ECL Plus Western Blotting Substrate and imaged

using Bio-rad VersaDocTM

Imaging system.

29

Chapter 3

p180 Promotes the Ribosome-Independent Localization of a Subset of mRNA to the

Endoplasmic Reticulum

This chapter is adapted from articles originally published as:

Cui, X. A, Zhang, H, & Palazzo, A. F. p180 Promotes the Ribosome-Independent

Localization of a Subset of mRNA to the Endoplasmic Reticulum. PloS

Biology 10(5): 3100136 (2012).

Cui, X. A & Palazzo, A. F. Visualization of Endoplasmic Reticulum Localized

mRNAs in Mammalian Cells. J. Vis. Exp. (70), e50066, doi:10.3791/50066

(2012).

Acknowledgements:

Experiments and figures in Figure 3.1 A-E, H-I, Figure 3.2 F, Figure 3.6 B-D,

Figure 3.7 & 3.9 were carried out and prepared by Dr. Alexander F. Palazzo.

The EMSA experiment in Figure 3.10 A was performed by Hui Zhang.

30

3.1 Introduction

The localization of mRNAs to various subcellular sites, through the interaction of

transcripts with mRNA localization proteins, is a widespread phenomenon important for the

proper sorting of proteins to their final destination, and for the fine-tuning of gene expression to

the local requirements of a subcellular region. One major class of transcripts, those encoding

membrane and secreted proteins, are targeted to and translated on ER. A series of landmark

studies in the early 1980s clearly showed that the targeting and the maintenance of these mRNAs

on the ER are translationally coupled and require active ribosomes. This targeting process is

initiated during the translation of mRNAs encoding secreted and membrane-bound proteins,

when a nascent N-terminal signal sequence or transmembrane segment recruits the signal

recognition particle (SRP) to the translating ribosome (53,54,159). Subsequent interactions

between SRP and an ER-bound SRP receptor promote the re-localization of the

mRNA/ribosome/nascent polypeptide chain complex to the surface of the ER (49). After

targeting is complete, the signal sequence or transmembrane segment is transferred to the

protein-conducting channel formed by the Sec61 translocon complex (58) and the mRNA is

retained on the surface of the ER by direct interactions of the translating ribosome with this

channel (58).

However, as discussed in Chapter 1, it remains unclear whether the SRP mediated

pathway is the sole mechanism that exists to recruit these mRNAs to the ER. Recent studies

support the existence of additional ER localization signals that might be present within the

mRNA molecules themselves. For example, certain mRNAs remain associated with ER-derived

microsomes even after ribosomes are partially stripped off (71,166). Moreover, mRNAs that

encode cytoplasmic polypeptides have also been found to bind to microsomes (71,89,90,166).

Furthermore, mRNAs remained ER-associated in HeLa cells that are depleted of SRP54, an

essential component of the SRP (71). Thus, it remains possible that mRNAs may directly

associate with the ER independently of the SRP mediated targeting pathway.

Here we investigated whether mRNAs encoding secretory proteins can be targeted and

maintained on the ER independently of translation by visualizing the localization of mRNAs in

vivo (Figure 1.2). Using digitonin extraction and conventional FISH, we provide conclusive

evidence that a subset of mRNAs can be maintained on the surface of the ER independent of

translation and ribosomes. In addition, using microinjection, we show that these mRNAs can also

31

be targeted to the ER using a translation independent mechanism. We also provide, to our

knowledge, the first mechanistic details on this alternative ER-localization pathway. In

particular, we show that p180, one of the proteins enriched on the ER via mRNA interactions,

promotes the general association of mRNA with the surface of the ER membrane. This activity is

likely mediated in part by a lysine-rich region in this ER-membrane protein that can directly

interact with RNA in vitro. Finally, we show that p180 is required for the ER-anchoring of

certain transcripts. We thus shed light on the workings of a basic biological process that up until

now remained poorly characterized and underappreciated.

3.2 ER-Targeted Transcripts and Ribosomes Co-Localize with the ER in

Digitonin-Extracted Cells

Although the ribosome-independent association of mRNA to the ER has been extensively

examined using cell fractionation (Discussed in details in Chapter 1.3), these measurements

require the interaction between ribosome-free transcripts and ER-derived microsomes to be

stable over long time intervals outside of the cellular context. Ideally one could overcome these

problems by investigating the ER-association of poly(A) transcripts within the cellular

environment. To overcome these potential problems we investigated the ER-association of

poly(A) transcripts in cells using microscopic analysis. In order to visualize ER-bound poly(A)

mRNA, mammalian tissue culture cells were first treated with low levels of digitonin to

selectively permeabilize the plasma membrane, thereby extracting the cytoplasm and all unbound

transcripts while maintaining the integrity of the ER membrane and thus preserving ER-

associated mRNAs (89). In order to ensure that this technique effectively separates these two

classes of mRNA while simultaneously preserving the ultrastructure of the ER, the distribution

of various versions of the fushi tarazu (ftz) mRNA fragment were examined in COS-7 cells by

fluorescent in situ hybridization (FISH).

First we monitored t-ftz mRNA, which encodes a secreted version of the ftz protein by

inserting the SSCR from a mouse Major Histocompatibility Complex (MHC) H-2kb gene at the

5′ end of the ftz ORF (152). Besides the SSCR, this artificial transcript does not contain any

sequence that is normally associated with the ER, as it was derived from a transcription factor

gene from Drosophila (167). This mRNA, which localizes to the ER ((152) and Figure 3.1A),

remained associated with the cells after digitonin extraction (Figure 3.1B–C). Next we monitored

c-ftz-i mRNA, which encodes a soluble, cytoplasmic version of the ftz polypeptide. The majority

of this transcript distributed diffusely across the cytoplasm in intact cells (Figure 3.1D) and was

32

extracted when cells were treated with digitonin (Figure 3.1E). Note that nuclear t-ftz and c-ftz-i

transcripts were resistant to extraction since digitonin treatment does not permeabilize the

nuclear envelope (168). We also monitored the distribution of the soluble adenosine kinase

(AdK) enzyme by indirect immunofluorescence. As previously reported (169), this protein was

present in both the nucleus and cytoplasm in intact COS-7 cells (Figure 3.1F). However, after

digitonin treatment only the nuclear fraction remained (Figure 3.1G). Finally, we monitored the

distributions of ribosomes and Trapα, a membrane-bound ER protein that associates with the

Sec61 translocon (170). The cellular distribution of Trapα was largely unaffected by extraction,

indicating that digitonin extraction did not disrupt the integrity of the ER. In contrast, the large

ribosomal protein RPLP0 localized in a diffuse cytoplasmic pattern in intact cells (Figure 3.1H)

and in a reticular pattern that co-localized with Trapα in digitonin-extracted cells (Figure 3.1I). In

summary, digitonin extraction effectively removes cytoplasmic, but not nuclear or ER-associated

factors, while simultaneously preserving ER-morphology.

33

Figure 3.1 Visualization of

ER-targeted mRNAs and

ribosomes.

(A) The nuclei of COS-7 cells

were microinjected with t-ftz

mRNA and Alexa488-

conjugated 70 kD dextran (see

inset) to label the microinjected

compartment. The cells were

incubated at 37°C for 2 h to

allow for the nuclear export and

targeting of the mRNA to the

surface of the ER. A single cell

is shown in (A) co-stained for

ftz mRNA using specific FISH

probes and for the ER marker

Trapα by immunofluorescence.

Note the extensive co-

localization between the mRNA

(green) and Trapα (red). Scale

bar = 15 μm. (B–E) The nuclei

of COS-7 cells were

microinjected with either t-ftz

(B–C) or c-ftz-i (D–E) mRNA

and Alexa488 conjugated 70 kD

dextran to label the

microinjected compartment

(insets). After incubating the

cells at 37°C for 1 h, the cells

were either directly fixed

(‘‘Non-ext’’, B, D) or first

extracted with digitonin

(‘‘Ext’’, C, E) and then fixed.

The cells were stained for ftz

mRNA using specific FISH

probes. Scale bar = 15 μm. (F–G) COS-7 cells were either directly fixed (‘‘Non-ext’’, F) or first

extracted with digitonin (‘‘Ext’’, G) and then fixed and stained for Adenosine Kinase (‘‘AdK’’).

Scale bar = 20 μm. (H–I) COS-7 cells were either directly fixed (‘‘Non-ext’’, H) or first

extracted with digitonin and then fixed (‘‘Ext’’, I) and then fixed and stained for ribosome

RPLP0 protein and the ER marker Trapα. Note the extensive co-localization between ribosomes

(green) and Trapα (red) after extraction (I). Scale bar = 15 μm.

34

3.3 mRNA Remains Associated to the ER Independently of Translation and

Ribosome-Association

Having validated a procedure to visually isolate ER-bound molecules, the distribution of

ER-associated poly(A) transcripts was then analyzed. We performed FISH on digitonin extracted

COS-7 cells with fluorescently labeled poly(dT) oligonucleotides and found a substantial amount

of fluorescence in the cytoplasm that co-localized with the ER marker Trapα (Figure 3.2A). This

co-localization was verified by analyzing line scans of the respective fluorescent intensities

across the same region of the cell (Figure 3.2B). Interestingly, although the overall distribution

was similar (Figure 3.2B, black arrows), different regions of the ER were enriched in either

poly(A) or Trapα (Figure 3.2B, note the relative levels of the two markers at each black arrow).

To ensure that the FISH signal was caused by an association of our probes with mRNA, we

treated the hybridized cells with RNase H, an enzyme that specifically degrades RNA that is

hybridized to DNA. Indeed, this treatment dramatically reduced the FISH signal when compared

to samples exposed to control buffer (Figure 3.2C, compare “Cont” to “RNase H”; see Figure 1D

for quantification). From these results, we conclude that the staining observed with fluorescent

poly(dT) oligonucleotide in digitonin-treated cells represented ER-bound poly(A) transcripts.

35

Figure 3.2 Poly(A) transcripts associate with ER independently of ribosomes and

translation.

(A) A single digitonin-extracted COS-7 cell co-stained for poly(A) mRNA using poly(dT) FISH

probes, and for the ER marker Trapα by immunofluorescence. Note the general co-localization

between the mRNA (green) and Trapα (red). (B) The fluorescence intensity (y-axis) of the

poly(A) mRNA (green) and Trapα (red) along the arrow (x-axis) in the overlay image in (A).

Note the correlation between peaks in intensity of poly(A) mRNA and Trapα (black arrows). (C–

D) COS-7 cells were treated with either DMSO, puromycin (“Puro”), homoharringtonine

36

(“HHT”) for 30 min, and then extracted with digitonin alone or with 20 mM EDTA. Cells were

then fixed, stained for poly(A) mRNA using poly(dT) FISH probes, and then treated with RNase

H (RNase H “+”) or control buffer (“Cont” or RNase H “-”) for 1 h at 37°C. Cells were imaged

(C) and the fluorescence intensity of the ER and nucleus were quantified (D). Each bar

represents the average and standard error of three independent experiments, each consisting of

the average integrated intensity of 30 cells over background normalized to the signal in the ER of

DMSO/control treated cells. Note that in cells not treated with RNase H, the amount of mRNA

bound to the ER decreased by about half in all the drug-treated cells as compared to DMSO-

treated cells. In contrast RNase H treatment eliminated most of the ER fluorescence and the

majority of the nuclear signal. All scale bars = 20 μm. (E) COS-7 cells were treated with control

medium (DMSO), puromycin, or HHT for 15 min, then incubated in 35

S-methionine to label

newly synthesized proteins for an additional 15 min. Cell lysates were collected and separated by

SDS-PAGE. Total proteins were visualized by Coomassie blue stain, and newly synthesized

proteins were detected by autoradiography. Molecular weight markers are indicated on the left

(‘‘Ladder’’; 188 kD, 62 kD, 49 kD, 38 kD, 28 kD, 18 kD). (F) COS-7 cells were either treated

with DMSO (“Cont”) or puromycin for 30 min, then extracted with digitonin (in the absence or

presence of 20 mM EDTA). Cytoplasmic (“C”; i.e., non-ER) and ER (“ER”) fractions were

separated by SDS-PAGE, then transferred to nitrocellulose, and immunoblotted with antibodies

against the small ribosomal protein S6, the ER marker Trapα, and the cytoplasmic marker

αtubulin. Note that most of the S6 protein is released from the membrane to the cytoplasmic

fraction only after cells are treated with puromycin and then extracted with EDTA. (G) COS-7

and U2OS cells were treated either with cycloheximide (“control”) and then extracted, or with

puromycin for 30 min and then extracted in the presence of 20 mM EDTA. ER and cytoplasmic

fractions were isolated as in (F) except that either cycloheximide, or puromycin and EDTA, was

present in all solutions. cDNA was synthesized from each fraction using poly(dT) primers and 32

P-dNTPs, and ratio of counts in the ER to total (cytoplasm+ER) were tabulated. Each bar

represents the average and standard error of three independent experiments.

37

Next, the ribosome-independent retention of mRNAs on the ER was assessed. First, poly(A)

transcripts were visualized in cells treated with homoharringtonine (HHT), a compound that

prevents the initiation of translation while allowing engaged ribosomes to complete translation

and naturally fall off the transcript (171). About half of the mRNA remained associated with the

ER after cells were treated with HHT for 30 min (Figure 3.2C-D), despite the fact that all

detectable translation was inhibited after 15 min of treatment, as assayed by the incorporation of

35S-Methionine into newly synthesized proteins (Figure 3.2E). Again, the incubation of HHT-

treated cells with RNase H eliminated the fluorescence signal (Figure 3.2C-D). Next, mRNA was

visualized in cells treated with the translation inhibitor puromycin. This compound ejects the

nascent polypeptide chain from the ribosome, facilitating the dissociation of small and large

ribosomal subunits. After dissociation, the large subunit will remain bound to the Sec61 channel,

while the small subunit is released from the membrane (83,172). To further disrupt ribosomes,

EDTA was included in the digitonin extraction buffer to chelate magnesium, which is required

for the subunits to remain bound to each other. In order to monitor the release of the small

ribosomal subunit, we probed ER and cytoplasmic (i.e., non-ER) fractions with antibodies

directed against the small ribosomal protein S6. In untreated COS-7 cells, about half of all small

ribosomal subunits were associated with ER membranes (Figure 3.2F, compare non-ER

cytoplasm “C” with ER membranes “ER” in the control “Cont” cell fractions). However when

cells were treated with puromycin for 30 min and then extracted in the presence of EDTA, small

ribosomal subunits were efficiently removed from the ER (Figure 3.2F, “Puro+EDTA”). Note

the incomplete removal of small subunits when cells were treated with EDTA or puromycin

alone. We then monitored the distribution of mRNA in these cells. In agreement with our

previous results, we found that approximately half of all mRNA remained associated with the ER

after ribosomes were disrupted by puromycin and EDTA (Figure 3.2C-D). Again the FISH

signal was reduced after RNase H treatment (Figure 3.2C-D). We also observed that mRNA was

retained on the ER in a human osteosarcoma cell line (U2OS) treated with either HHT or a

combination of puromycin and EDTA, as analyzed by poly(A) staining (data not shown).

To further confirm these results, we biochemically analyzed the poly(A) RNA content in

subcellular fractions that were prepared from cells treated with either cycloheximide, a

translation inhibitor that stabilizes polysomes, or puromycin and EDTA. We then converted

mRNA isolated from cytoplasmic and ER cell fractions into cDNA using poly(dT) primers and

radiolabeled nucleotides and then quantified the radioactivity incorporated in each library. We

38

found that in both cycloheximide-treated COS-7 and U2OS cells, about 50% of the non-nuclear

RNA was associated with the ER (Figure 3.2G, “Cont”) and that this fraction dropped to about

35% after puromycin/EDTA treatment (Figure 3.2G, “Puro+EDTA”).

From these results, we concluded that a substantial fraction of ER-anchored transcripts

are maintained on the ER independently of ribosomes in various mammalian tissue culture cell

lines.

3.4 The Extent of ER-Retention After Ribosome Dissociation Differs Among

mRNA Species

Next, the distribution of transcripts from individual genes was monitored by conventional

FISH in COS-7 cells. The majority of these genes have a signal sequence coding region (SSCR),

which not only encodes ER-targeting polypeptides but also contains an RNA element that

promotes nuclear export and the proper cytoplasmic localization of transcripts (152,153). With

this in mind, we first investigated the cellular distribution of the reporter transcript t-ftz.

Interestingly, t-ftz mRNA, which localizes to the ER in extracted cells (Figure 3.1A), no longer

associated with this organelle after ribosome disruption using either HHT or puromycin/EDTA

(Figure 3.3A and 3.4A). Note that the amount of nuclear t-ftz transcript was unaltered by any of

the treatments (Figure 3.3A), indicating that the change in ER-associated fluorescence was not

due to changes in expression levels or FISH efficiency. Thus, we conclude that although the

MHC SSCR can promote nuclear export, it is not sufficient to allow mRNAs to be maintained on

the surface of the ER after ribosome dissociation.

39

Figure 3.3 ALPP and CALR, but not t-ftz or INSL3, mRNA remain associated with the ER

independently of ribosomes and translation.

(A-E) COS-7 cells were transfected with plasmids containing either the t-ftz (A), INSL3 (A-B),

ALPP (A, C), cyto-ALPP (a version of ALPP lacking signal sequence; A, D-E), or CALR (A)

genes and allowed to express mRNA for 18-24 h. The cells were then treated with DMSO

(“Cont”), puromycin, or HHT for 30 min, and then extracted with digitonin alone or with 20 mM

EDTA. Cells were then fixed, stained for mRNA using specific FISH probes, and imaged (see

panels B-D for examples). The fluorescence intensities of mRNA in the ER and nucleus in the

micrographs were quantified (A). Each bar represents the average and standard error of three

independent experiments, each consisting of the average integrated intensity of 30 cells over

background. Note that although ribosome disruption caused INSL3 mRNA to dissociate from the

ER, the nuclear mRNA was unaffected (B, nuclei are denoted by arrows). (E) A single field of

view containing a single HHT-treated, digitonin-extracted, COS-7 cell expressing cyto-ALPP

mRNA. cyto-ALPP mRNA was visualized by FISH and for Trapα protein by

immunofluorescence. Note the extensive co- localization of cyto-ALPP mRNA (red) and Trapα

(green) in the overlay. All scale bars = 20 μm.

40

Figure 3.4 CALR mRNA, but not t-ftz mRNA, remains associated with the ER

independently of ribosomes and translation.

COS-7 cells were transfected with plasmids encoding either the t-ftz (A) or CALR (B) genes and

were allowed to express mRNA for 18-24 h. The cells were then treated with control media

(“Cont”), puromycin (“Puro”), or HHT for 30 min, and then extracted with digitonin alone or

with 20 mM EDTA. Cells were then fixed, stained for mRNA using specific FISH probes, and

imaged. Note that ER, but not nuclear, staining of t-ftz mRNA was lost after cells were treated

with HHT or puromycin/EDTA (arrows). (C) COS-7 cells were transfected with plasmids

encoding the ALPP gene and were allowed to express mRNA for 18–24 h. Cells were then

treated with HHT for 30 min, then extracted with digitonin, fixed, and stained for ALPP by FISH

and Trapα by immunofluorescence. Note the extensive co-localization of ALPP mRNA (red) and

Trapα (green) in the overlay. (C) All scale bars = 20 μm.

41

To determine whether natural mRNAs are maintained on the ER independently of

ribosomes, the distribution of transcripts generated from transfected plasmids containing the

insulin-like 3 (INSL3), placental alkaline phosphatase (ALPP), calreticulin (CALR) or

cytochrome p450 8B1 (CYP8B1) cDNAs was monitored in extracted cells. Previously it had been

demonstrated that CALR mRNA co-fractionated with microsomes in cells with inactivated SRP

and partly remained associated to microsomes after they were partially stripped of ribosomes

(71). Although INSL3 and CYP8B1 mRNAs could no longer associate with the ER membrane by

either HHT or puromycin/EDTA treatment (Figure 3.3A-B, Figure 3.5), about half of the ALPP

and CALR transcripts remained ER-associated under similar conditions (Figure 3.3A,C, Figure

3.4B). As seen previously with the t-ftz transcript, the amount of nuclear INSL3 mRNA was

unaffected by either HHT or puromycin/EDTA treatments (see arrows in Figure 3.3B, for

quantification see Figure 3.3A). Interestingly the amount of nuclear CALR mRNA increased after

the inhibition of translation, although this was quite variable (Figure 3.3A). This increase is

likely attributable to a slight block in nuclear export experienced by certain mRNAs after

translation inhibition, as previously reported (152). The retention of ALPP mRNA on the ER

after HHT-treatment was confirmed by the co-localization of these transcripts with Trapα in

digitonin-extracted cells (Figure 3.4C). To further validate our findings, we repeated these

experiments with pactamycin, another inhibitor of translation initiation. Pactamycin also allows

ribosomes to naturally fall off the transcript while preventing new ribosomes from associating

with the mRNA (173). Indeed, pactamycin effectively inhibits all protein production within 15

min (Figure 3.6A) and disrupts the ER-localization of t-ftz mRNA (Figure 3.6B), as seen

previously (152). Moreover, in agreement with our other findings, pactamycin treatment disrupts

the ER-localization of INSL3 but not ALPP mRNA (Figure 3.6C-D).

42

Figure 3.5 ALPP, but not CYP8B1 mRNA remains associated with the ER independently of

ribosomes and translation.

COS-7 cells were transfected with plasmids containing either the ALPP (top row), or CYP8B1

(bottom row) genes and allowed to express mRNA for 18-24 hrs. The cells were then treated

with DMSO control medium (“Ctrl”), puromycin (“Puro”) or HHT for 30 min. Cells were either

directly fixed (“unextracted”) or first extracted then fixed. Note that while the control and HHT-

treated cells were extracted with digitonin alone, Puro-treated cells were extracted with digitonin

and EDTA. Cells were stained for mRNA using specific FISH probes, and imaged. Scale bar =

20 μm.

43

Figure 3.6 ALPP mRNA, but not t-ftz and INSL3 mRNAs, remains associated with the ER

after cells were treated with pactamycin to disrupt the mRNA-ribosome association.

(A) COS-7 cells were treated with control media (“Cont”) or pactamycin (“Pact”) for 15 min and

then incubated in 35

S-methionine to label newly synthesized proteins for an additional 15 min.

Cell lysates were collected and separated by SDS-PAGE. Total proteins were visualized by

Coomassie blue stain, and newly synthesized proteins were detected by autoradiography.

Molecular weight markers are indicated on the left (“MWM”). (B–D) COS-7 cells were

transfected with plasmids encoding either the t-ftz (B), INSL3 (C), or ALPP (D) genes and were

allowed to express mRNA for 12-18 h. The cells were then treated with control media or

pactamycin for 30 min, and then either directly fixed (“Non-extracted”) or first extracted with

digitonin (“Extracted”) and then fixed. Cells were stained for mRNA using specific FISH probes

and imaged. Scale bar = 15 μm.

44

To eliminate the possibility, however remote, that the ER-association of ALPP mRNA is

signal-sequence dependent, we generated a new construct that the coding potential of the signal

sequence and transmembrane domain coding regions were eliminated. To ensure that the newly

synthesized mRNA was efficiently exported from the nucleus, we inserted the frame shifted

SSCR from MHC to the 5′end of the ALPP ORF. Previously we demonstrated that frame shifted

MHC SSCR, which encodes a soluble cytoplasmic (i.e., not ER-targeted) polypeptide, promotes

efficient nuclear mRNA export but not ER-targeting of either the mRNA or the encoded protein

(152). We expressed this new fusion construct (cyto-ALPP) in COS-7 cells and analyzed its

association to the ER. Indeed this mRNA was efficiently retained on the ER after extraction

(Figure 3.3A,D) despite the fact that the encoded protein lacked any features that would target it

for secretion. Strikingly, the level of ER-association for cyto-ALPP mRNA was unaffected by

HHT or puromycin/ EDTA treatments (Figure 3.3A,D). This result further supports the notion

that the localization of this transcript to the ER was completely independent of translation.

Moreover, the association of cyto-ALPP mRNA to the ER after HHT treatment was validated by

the co-localization of these transcripts with Trapα in digitonin-extracted cells (Figure 3.3E). Thus

we concluded that the ER-association of ALPP mRNA to the ER was independent of features

within the encoded polypeptide that are recognized by the SRP targeting pathway.

To determine whether endogenous mRNAs also displayed this activity, we analyzed the

level of 10 different transcripts in ER and cytoplasmic fractions (see Figure 3.2G for

fractionation) using quantitative reverse-transcription PCR. To ensure that our fractionation

protocol separated ER-bound transcripts from the rest, we first analyzed the distribution of

Sec61α and βactin mRNAs. The first mRNA encodes the central component of the translocon

and was predominantly found in the ER fraction, even when the fractions were derived from

cells treated with puromycin and EDTA (Figure 3.7A). In contrast most of the βactin mRNA was

in the cytoplasmic fraction. We then extended these studies to transcripts encoding ER-resident,

Golgi, plasma membrane, and secreted proteins. The majority of these mRNAs remained in the

ER fraction even after puromycin/EDTA treatments (Figure 3.7B). As with over-expressed

CALR, endogenous CALR mRNA was retained on the ER to a high degree after

puromycin/EDTA treatment. Again this activity varied between different transcripts; for

example, mRNAs encoding the Inositol-3-Phosphate Receptor (IP3 Receptor) and Fatty Acid

Desaturase 3 proteins (FADS3) exhibited a greater dependency on translation than other tested

transcripts.

45

From these results we concluded that some mRNAs that encode secreted or membrane-

bound proteins are retained on the ER in a manner that does not require translation or ribosome-

association.

46

Figure 3.7 Endogenous mRNAs remain associated with the ER independently of ribosomes

and translation.

(A) The levels of Sec61α and βactin transcripts isolated from

unbound (i.e., non-ER)

cytoplasmic and ER fractions

from either cycloheximide

treated (“Control”) or

puromycin treated EDTA

extracted

(“Puromycin+EDTA”) U2OS

cells were assessed by

quantitative RT-PCR analysis.

Each bar represents the levels

of the specified transcript

normalized to 28S rRNA

levels, standardized to the level

of mRNA in the control

sample, and averaged between

three independent experiments.

Error bars represent the

standard error of the mean.

Note that 28S rRNA was used

as the large ribosomal subunit

is known to associate to the ER

even after puromycin treatment

and that ribosomes are equally

distributed in cytoplasm and

ER (see Figure 3.2 F).

The level of Sec61α mRNA was normalized to the ER fraction from control cells,

while the βactin mRNA was normalized to the cytoplasmic fraction from control cells.

(B) The levels of several transcripts in the ER fraction were analyzed as in (A).

Measured transcripts include those encoding ER luminal proteins (BiP, Calreticulin),

ER membrane proteins (Inositol-3-phosphate Receptor (IP3 Receptor), Sec61α, Trapα,

and Fatty Acid Desaturase 3 (FADS3)), a Golgi protein (Mannosidase 2A (Man2A)),

plasma membrane proteins (Integrin β1, and Transferrin Receptor (Tf Receptor)), and

a secreted protein (Interleukin 7 (IL7)). All measurements were standardized to the

level of mRNA in the ER fraction from control cells.

47

3.5 ALPP and CALR mRNAs Partially Target to the ER Independently of

Translation

Our data indicated that once certain transcripts are targeted to the ER, they are retained

on the surface of this organelle independently of ribosomes. It, however, remained unclear

whether the initial targeting step could occur independently of translation. To address this

question, cells were pretreated with HHT to inhibit translation and then microinjected with

plasmid DNA. Two hours later, the distribution of the newly synthesized mRNA, which was

never in contact with functional ribosomes, was assessed. Surprisingly, both ALPP and CALR

mRNA targeted to the ER independently of translation (Figure 3.8A-B). In contrast INSL3

mRNA only displayed weak translation-independent targeting activity, while t-ftz mRNA failed

to target to the ER under these conditions (Figure 3.8A-B). All of the tested transcripts targeted

to the ER in the absence of translation inhibitors (i.e., DMSO treatment). To ensure that any

changes in fluorescence were not due to changes in mRNA expression or variability in FISH

staining, we monitored the nuclear mRNA levels of each construct, and these did not drastically

change between experiments (Figure 3.8B). The targeting of ALPP mRNA to the ER in HHT-

treated cells was confirmed by co-localization of the digitonin-resistant transcripts with Trapα

(Figure 3.8C).

From these results, we conclude that certain mRNA species, but not others, are efficiently

targeted to the ER independently of translation or ribosome-association. Based on current

research, we speculate this targeting is also likely to be independent of factors that recognize

nascent polypeptides, such as SRP, or ER-resident membrane proteins that bind to ribosomes,

such as the Sec61 complex, Sec62/Sec63 complex, and ERj1.

48

Figure 3.8 The initial ER-targeting of ALPP and CALR, but not t-ftz or INSL3, mRNA

occurs independently of translation or ribosomes.

(A–B) COS-7 cells were pretreated with DMSO (“Control”) or HHT for 15 min, then

microinjected with plasmids containing either the ALPP, INSL3, t-ftz, or CALR genes and

allowed to express mRNA for 2 h in the presence of DMSO or HHT. To label the microinjected

cells, Alexa488-conjugated 70 kD dextran was co-injected (see insets in A). The cells were then

extracted with digitonin, fixed, stained for mRNA using specific FISH probes, and imaged (A).

The fluorescence intensity of mRNA in the ER and nucleus in the micrographs were quantified

(B). Each bar represents the average and standard error of three independent experiments, each

consisting of the average integrated intensity of 30 cells over background. (C) COS-7 cells were

pretreated with HHT for 15 min, then microinjected with plasmids containing the ALPP gene.

Cells were then incubated for 2 h in the presence of HHT, then extracted with digitonin, fixed,

and then co-stained for ALPP mRNA by FISH and for Trapα protein by immunofluorescence.

Note the extensive co-localization of ALPP mRNA (red) and Trapα (green). All scale bars = 20

μm.

49

3.6 Identification of Putative mRNA Receptors on the ER

To identify proteins that may mediate the ribosome-independent interaction of mRNAs

with the ER, cells were subfractionated to enrich for proteins that interact with ER-associated

mRNAs. Since the annotation of the human proteome is more complete than that of the African

green monkey (from which COS-7 cells are derived), we performed this experiment in human

U2OS cells. Trypsinized cycloheximide-treated cells were washed, then treated with digitonin,

and the resulting lysates were subjected to low speed centrifugation to separate the intact ER-

nuclear fractions from the rest of the cytoplasm (see the Coomassie stained gel in Figure 3.9,

lanes 2 and 3). This ER-nuclear fraction was then solubilized with Triton X-100 and subjected to

low speed centrifugation to remove nuclei (pellet) and generate an ER fraction (supernatant; lane

4). Note that this “ER fraction” is free of histone proteins, which serve as a marker of nuclei

(labeled “H”, lane 3). The ER fraction was then subjected to high speed centrifugation through a

high percentage sucrose cushion to isolate polysomes (pellet; lane 6), which was then treated

with RNase A to digest mRNA and release any associated RNA-binding proteins, including the

putative mRNA receptor. The ribosomes, which are mostly resistant to RNase A treatments, and

ribosome-interacting proteins, such as the Sec61 complex, were removed from this fraction by

high speed sedimentation (pellet; lane 7). Note that this fraction contains all of the ribosomal

proteins, which are generally smaller than 40 kD (labeled “R”). The remaining supernatant,

which consists of proteins that associate with polysomes only when intact mRNA is present (ER

mRNA-associated proteins (ERMAP), lane 9), was analyzed by mass spectrometry. As a control

we also performed mass spectrometry on proteins that were released after treating polysomes

with a buffer that lacked RNase A (lane 10).

The experiment was repeated three times, and a list of proteins that were significantly

enriched in the ERMAP fraction (p<0.05) was compiled (Table 3.1, for proteins where p>0.05,

see Table 3.2). The final list contained 37 different proteins, of which six contained at least one

transmembrane segment (p180, kinectin, CLIMP63, transmembrane protein 214, mannosyl-

oligosaccharide glucosidase, and magnesium transporter protein 1), 16 were known to bind to

RNA, and five function as tRNA synthetases (Table 3.1). Analyzing our results further we

realized that all 10 of the tRNA synthetases that are known to form the large Multisynthetase

Complex (MSC) (174) were enriched in the ERMAP (see Table 3.1). This complex also contains

three core components, one of which, AIMP1, was also present in this fraction. Significantly,

50

only one of the other 10 tRNA synthetases was significantly enriched in the ERMAP

(phenylalanine tRNA synthetase). The ERMAP fraction was also free of any translocon

components, suggesting that our preparation was relatively depleted of proteins that directly

contact ribosomes. It is also worth noting that the composition of the ERMAP was different from

other preparations, such as the ribosome-associated membrane protein (RAMP) fraction (58).

51

Figure 3.9 Identification of proteins that associate with ER-derived mRNAs.

Cycloheximide treated U2OS cells were digitonin extracted and centrifuged at low speed to

separate cytoplasm (supernatant, lane 2) from ER and nuclear components (pellet, lane 3). The

pellet was then extracted with Triton-X100 and centrifuged at low speed to separate ER

(supernatant, lane 4) from the nucleus (pellet). Note that the ER fraction is relatively free of

histones (“H”) which are found in the ER+Nuc fraction (lane 2). The solubilized ER fraction was

then subjected to high-speed centrifugation through a sucrose cushion to separate polysomes

(pellet, lane 6) from the rest of the ER (supernatant, lane 5). The polysomes were then treated

with either RNase A (lanes 7, 9) or control buffer (lanes 8, 10) at 37°C for 15 min to digest all

mRNA. The samples were then subjected to another high-speed centrifugation step to separate

ribosomes and associated proteins (pellet, lanes 7-8) from proteins released by RNase A

(supernatant, lane 9) or control treatments (supernatant, lane 10). Note that the treatments did not

release ribosomal proteins (“R”), which all remained in the pellets (lanes 7,8). All fractions were

separated on a 4-20% gradient SDS-PAGE and visualized by silver-staining. To estimate protein

sizes, molecular weight markers (MWM) were loaded (lane 1, sizes of each band in kD are

indicated on the left). Lanes 9 and 10 were cut and sent for mass-spectrometry analysis.

52

Table 3.1 Proteins Enriched in the ERMAP Fraction.

Gene ID P Value

Membrane Proteins AVG STD AVG STD

p180 6238 53.7 5 0.7 0.6 0.0001

CLIMP63 10970 33 2.6 11.7 2.9 0.0007

Magnesium transporter protein 1 93380 3.3 1.2 0 0 0.0075

Transmembrane protein 214 54867 8.3 3.1 0 0 0.0091

Kinectin 3895 79.3 13.4 29.7 13.3 0.01

Mannosyl-oligosaccharide glucosidase 7841 7.3 3.1 1 1 0.027

RNA Binding Proteins

G3BP2 9908 5.7 0.6 0 0 0.0001

G3BP1 10146 11 1 0.7 0.6 0.0001

PRKRA/eIF2alpha protein kinase 8575 6.7 0.6 0.3 0.6 0.0002

PTB-associated-splicing factor 6421 7 1 0.3 0.6 0.0006

ASF/SF2 SR Protein 6426 5 1 0 0 0.001

Staufen 1 6780 17.3 3.5 1 1 0.0015

pa2g4* 5036 27 6 1.3 2.3 0.0023

Caprin1 4076 15.7 3.9 0.7 0.6 0.0025

Numatrin/Nucleophosmin* 4869 10 2.6 0.3 0.6 0.0035

PKR/eIF2alpha protein kinase 2 5610 7.7 2.5 0 0 0.0062

Tudor/SND1 27044 16.3 0.6 7.7 3.5 0.014

YTH domain protein 1 54915 5.3 2.1 0.3 0.6 0.016

Gemin 5* 25929 7 2.6 1 1 0.021

Insulin-like growth factor 2 mRNA bp2 10644 27 5.2 16.3 2.1 0.03

RBM4B RNA binding motif protein 4B 83759 4.7 0.6 1.7 1.5 0.034

SYNCRIP, synaptotagmin RNA binding protein 10492 26.3 2.1 17 5.3 0.047

Multisynthetase Complex (MSC)

Phenylalanyl-tRNA synthetase beta chain 10056 11.3 3.5 0.3 0.6 0.0059

Isoleucyl-tRNA synthetase 55699 12.7 5.1 1 1 0.018

Bifunctional (glutamyl, prolyl) tRNA synthetase 2058 18.7 8.5 1 1.7 0.024

Phenylalanyl-tRNA synthetase alpha chain 2193 6.7 3.2 0.3 0.6 0.028

Lysyl-tRNA synthetase 3735 7 3.6 0.3 0.6 0.034

Arginyl-tRNA synthetase¥ 5917 5 4.4 0 0 0.12

p43, AIMP1¥ 9255 3 2.6 0 0 0.12

Glutaminyl-tRNA synthetase¥ 5859 6.7 6 0 0 0.13

RNase + RNase -

53

Table 3.1 Proteins Enriched in the ERMAP Fraction.

List of significantly enriched proteins (P<0.05) in the ERMAP fraction (“RNase +”, see Figure 5,

lane 9) as compared to the control sample (“RNase -”, see Figure 5, lane 10) as analyzed by mass

spectrometry (for a larger list see Table 3.2). Included in the table are the Entrez Gene ID,

average number (“AVG”), and standard deviation (“STD”), of peptides from the analyses

performed on three independent experiments. In addition the average number of peptides from

all the components of the MSC was also tabulated, some of which P > 0.05. P values were

determined using a paired two-tailed student T test. On average 2427 +/- 311 total peptides were

recovered from the RNase + samples, and 1684 +/- 266 total peptides were recovered from the

RNase - samples.

Gene ID P Value

Membrane Proteins AVG STD AVG STD

Aspartyl-tRNA synthetase¥ 1615 6 5.6 0 0 0.14

Leucyl-tRNA synthetase¥ 51520 9 7.9 1.3 1.5 0.18

Methionyl-tRNA synthetase¥ 4141 8.7 10 1.7 2.9 0.31

Total MSC complex N/A 94.7 45.6 6 7.8 0.03

Others

FKBP-25, mTOR/rapamycin binding protein 2287 7.3 1.5 0.3 0.6 0.0018

2'-5'-oligoadenylate synthetase 3 4940 6.3 1.5 0 0 0.002

KU70† 2547 21.3 1.5 9 2.6 0.0022

KU86† 7520 19.7 1.5 8.3 2.5 0.0026

Glutamate dehydrogenase 1 2746 15.3 6.7 0 0 0.016

c1-tetrahydrofolate synthase 25902 12 5.3 1 1 0.024

eIF2-alpha 83939 11.3 2.5 3.3 3.1 0.025

Treacher Collins Syndrome protein 6949 11.7 6.8 0 0 0.041

eIF2-beta 8890 6 1.7 2 1.7 0.047

eEF1-alpha1 1915 8.7 3.1 3.7 0.6 0.049

* rRNA or snRNA binding protein

† primarily involved in DNA binding, but has been reported to bind to RNA

¥ members of the MSC where P > 0.05

RNase + RNase -

54

Table 3.2 Proteins Enriched in the ERMAP Fraction (P>0.05).

Proteins Gene ID P Value

AVG STD AVG STD

HNRNP F 3185 4.3 1.3 1.5 1.2 0.05

HNRNP M 4670 9 2.3 3 3.2 0.06

Leucine-rich repeat-containing protein 59 55379 9 3.7 3.5 1.2 0.06

Polypyrimidine tract-binding protein 1 5725 14.3 1.3 9.1 1.5 0.07

SMC1a (structural maintenance of

chromosomes 1A)8243 5.3 0 3.9 0 0.07

HNRNP H 3187 8.3 3.3 3.2 1.5 0.07

RPL10A 4736 12.7 2.7 6.4 3.1 0.07

Vigilin 3069 15.7 5.3 6.1 4.2 0.07

Matrin-3 9782 5 0 3.6 0 0.07

Hu-R/ELAV-like protein 1 1994 14 8 1 4.4 0.08

Partner of Y14 and mago homolog 84305 4.7 0 3.5 0 0.08

Developmentally-regulated gtp-binding

protein 14733 8 0 6.1 0 0.08

regulator of nonsense transcripts homolog 5976 36.7 17 11 10.4 0.09

interleukin enhancer binding factor 2,

45kDa3608 15.3 8 4.5 3.6 0.09

DEAH box polypeptide 30 22907 3.7 0.7 2.1 1.2 0.09

SRP receptor B 58477 6 1 3.6 1.7 0.1

NOP2/Sun domain family, member 2 54888 13 3.7 6.1 4.6 0.1

HNRNP K 3190 13.3 7.3 4.9 1.2 0.11

HNRNP A1 3178 13.3 9.7 0.6 3.1 0.11

DNA helicase Q1-like 5965 4 3.6 0 0 0.13

HNRNP U-Like 1 11100 19 6 8.7 7.2 0.13

MTHFD1L, methylenetetrahydrofolate

dehydrogenase 1-like25902 3.3 3.1 0 0 0.13

Nucleolin 379633 49.7 15.6 27.7 12.9 0.13

eIF2-gamma 1968 5.7 1.2 2.7 2.5 0.13

DEAH box polypeptide 36 170506 7.3 2.3 2.3 4 0.14

c1-tetrahydrofolate synthase cytoplasmic 4522 9 8.5 0 0 0.14

Zinc finger CCCH type antiviral protein 1 56829 7.7 4.7 2 2.6 0.14

cytoskeleton associated protein 5/ch-TOG 9793 12 11.5 0 0 0.15

Signal recognition particle receptor alpha 6734 12 7.8 3.3 3.5 0.15

Ubiquitin associated protein 2-like 9898 7.3 4 3.3 0.6 0.16

Purine-rich element-binding protein B 5814 4.3 2.1 1.3 2.3 0.17

Staufen 2 27067 3.3 3.5 0 0 0.18

Heterogeneous nuclear ribonucleoprotein

A3220988 6.7 2.1 2.7 3.9 0.18

AU-rich element RNA-binding protein 1 3184 10.7 3.1 7 3 0.21

Rnase+ Rnase-

55

Table 3.2 Proteins Enriched in the ERMAP Fraction (P>0.05).

List of additional proteins (P>0.05) identified in the ERMAP fraction in addition to proteins

listed in Table 1. Included in the table are the Entrez Gene ID, average number (“AVG”), and

standard deviation (“STD”), of peptides from the analyses performed on three independent

experiments. P values were determined using a paired two-tailed student t test.

Proteins Gene ID P Value

AVG STD AVG STD

SMC3 9126 5 6.1 0 0 0.23

DNA-dependent protein kinase, catalytic

subunit5591 10.7 12.2 0.7 1.2 0.23

Purine-rich single-stranded DNA-binding

protein alpha5813 7 2.6 4 2.6 0.24

Hu-B/elav-like protein 2 1993 4.3 3.9 1 1.7 0.24

interleukin enhancer binding factor 3,

90kDa3609 25.3 9 13.3 12.3 0.25

CGI-99 51637 4 3.5 1 1.7 0.25

RPLP0 6175 5.3 4.2 2 2 0.28

poly-ADP ribose polymerase-1 142 4.7 4.2 1.3 2.3 0.29

CNOT1, CCR4-NOT complex, subunit 1 23019 6 6.2 1.7 2.9 0.34

Ribophorin 2 6185 10.7 5 7.2 7.8 0.41

eIF4G1 1981 16.3 9.3 12.1 6 0.42

Valyl-tRNA synthetase 7407 13.3 7.4 8.7 7 0.47

Heterogeneous nuclear ribonucleoprotein

B13181 8 7.2 4.3 3.9 0.48

cold shock domain containing E1, RNA-

binding7812 5 7 1.7 2.9 0.49

Chaperonin containing TCP1, subunit 5 22948 10.3 4.7 7.3 6.4 0.55

Moloney leukemia virus 10, homolog 4343 14 9.2 10.7 7.6 0.65

Ribophorin 1 6184 16.7 9 13.7 11.5 0.74

Rnase+ Rnase-

56

3.7 Over-Expression of p180 Enhances the Ribosome- Independent

Association of t-ftz mRNA with the ER

The ER can be subdivided into morphologically distinct domains, such as the nuclear

envelope, perinuclear sheets, and peripheral tubules (18). Intriguingly, three of the membrane-

bound proteins from the ERMAP fraction-p180, kinectin, and CLIMP63-are abundant proteins

that localize to the perinuclear sheet portion of the ER, which is also enriched in translocon

components (156) and ribosomes (156,175). Interestingly, these three proteins diffuse into the

ER-tubules and nuclear envelope after puromycin or pactamycin treatment, indicating that their

enrichment in sheets is dependent on the integrity of polysomes and suggesting that they may

interact either with ribosomes or mRNA (156). In particular, p180 seems to be a suitable mRNA

receptor candidate. It has a very short luminal N-terminal segment followed by a single

transmembrane domain and a large C-terminal cytoplasmic region that is comprised of two basic

domains (a lysine-rich region followed by 54 tandem repeats of a basic decapeptide sequence)

and ends in a long coiled-coil domain. The highly charged domains are of particular interest as

they could potentially bind to the negatively charged phosphate backbone of RNAs. While p180

was initially identified as a ribosome receptor (176), more definitive experiments have shown

that the Sec61 translocon complex (57,58) and not p180 (177,178) is responsible for the majority

of ribosome binding activity present in ER-derived microsomes.

If p180 acts as a non-specific mRNA receptor, one would expect that the over-expression

of this protein would enhance the ribosome-independent ER-association of transcripts that

normally do not have this property. With this in mind we monitored the ER-association of t-ftz

mRNA in COS-7 cells that over-expressed green fluorescent protein (GFP)-tagged p180 (see

Figure 3.10A) in the presence and absence of HHT. As a control, we monitored the distribution

of t-ftz mRNA in cells expressing GFP-CLIMP63 and histone 1B-GFP (H1B-GFP). The

distribution of H1B-GFP, which binds to DNA in the nucleus, is not affected by extraction and

allowed us to identify co-expressing cells after digitonin- treatment. We observed that GFP-p180

over-expression promoted the ER-association of t-ftz mRNA in both control and HHT- treated

cells (Figure 3.10B-C). In contrast, over-expression of either GFP-CLIMP63 or H1B-GFP had

no effect (Figure 3.10B, D). Since the expression of GFP-p180 did not significantly affect the

cytoplasmic/nuclear distribution (Figure 3.11A) or the total level (Figure 3.11B) of t-ftz mRNA

in intact cells, we could rule out the possibility that the elevated level of ER-bound t-ftz was

caused by an upregulation of its nuclear export, production, or stability. Moreover, the level of

57

nuclear t-ftz FISH signal did not significantly change, except for cells expressing H1B-GFP, and

this was likely due to the fact that these cells had a lower overall expression of t-ftz mRNA

(Figure 3.11B).

58

Figure 3.10 Over-expression of p180 can enhance the ribosome-independent association of

t-ftz mRNA with the ER.

(A) COS-7 cells were transfected with plasmids containing vector alone (“mock”), GFP-p180 or

GFP-p180ΔLysΔRepeat. After 18-24 h cell lysates were collected, separated by SDS-PAGE and

immunoblotted for GFP, p180 or αtubulin. The position of molecular weight markers are

indicated on the left and proteins are labeled on the right. Note that a high molecular weight band

(denoted by an asterisk), which is positive for p180 and GFP, is detected in cells expressing

GFP-p180ΔLysΔRepeat. We suspect that this is an aggregate of the over-expressed protein. (B-E,

G-H) COS-7 cells were transfected with plasmids containing t-ftz gene alone (“mock”), or with

various GFP-tagged genes as indicated. The cells were allowed to express t-ftz mRNA and GFP-

tagged proteins for 18-24 h. Cells were then treated with either control media, or HHT for 30 min

to disrupt ribosomes, and then extracted, fixed, and stained for t-ftz mRNA using specific FISH

probes. (B, H) The fluorescence intensity of mRNA in the ER and nucleus in the micrographs

were quantified. Each bar represents the average and standard error of three independent

experiments, each consisting of the average integrated intensity of 30 cells over background. (C-

D, G) Each row represents a single field of HHT-treated cells (30 min) that was imaged for t-ftz

mRNA, and GFP. Cells co-expressing t-ftz mRNA and the GFP-tagged protein are denoted by

arrows, while cells that expressed only t-ftz are indicated by arrowheads. Scale bar = 20 μm.

Note that t-ftz mRNA remains associated to the ER in cells over-expressing GFP-p180 (C,

59

arrows), but not GFP-CLIMP63 (D, arrows) or in cells expressing t-ftz alone (C-D and G,

arrowheads). Cells over-expressing GFP-p180ΔLysΔRepeat (G, arrows) show an intermediate

phenotype. (E) COS-7 cells that were transfected with plasmids containing t-ftz gene alone

(“mock”), or with various GFP-tagged genes, were lysed, separated by SDS-PAGE and

immunoblotted for p180, GFP, CLIMP63, translocon components (Sec61β and Trapα) or

αtubulin. (F) Domain architecture of the GFP-tagged p180 constructs. Both contain the CALR

SSCR to mediate proper protein translocation (purple), GFP (green), the p180 luminal region

which is 7 amino acids long and the p180 single pass transmembrane domain (TMD, orange).

The lysine-rich region (“Lys”, dark blue) and decapeptide repeat region (light blue) are present

only in the GFP-p180 construct. Both end with the p180 coiled-coil domain (red).

60

Figure 3.11 Nuclear export of t-ftz mRNA remains unchanged in co-transfected cells, but

total t-ftz mRNA levels decrease in cells expressing H1B-GFP.

(A-B) COS-7 cells were transfected with either plasmids containing t-ftz alone or in combination

with plasmids containing GFP-p180, GFP-CLIMP63 or H1B-GFP. Cells were allowed to

express for 18-24 h, fixed and stained for t-ftz mRNA using specific FISH probes. Note that the

cells were not extracted prior to fixation. (A) The fraction of t-ftz mRNA in the cytoplasm and

nucleus in co-transfected cells. (B) The total level of t-ftz mRNA in the co-transfected cells,

normalized to cells expressing t-ftz alone. Each bar consists of the average and standard deviation

of 30-35 cells.

61

Next, we investigated whether kinectin could act as a general mRNA receptor. In the

majority of cells, over-expression of GFP-kinectin did not promote a dramatic increase in the

level of ER-bound t-ftz mRNA (Figure 3.12A-B). However, we did observe a drop in nuclear t-

ftz mRNA compared to mock co-transfected cells. This was caused by a decrease in the total

level of t-ftz mRNA (Figure 3.12C) and not changes in cytoplasmic/nuclear distribution (Figure

3.12D). As the absolute level of ER-associated t-ftz mRNA after HHT-treatment did not change

(Figure 3.12B), despite the drop in its expression level (Figure 3.12C), we re-evaluated our data.

Upon closer inspection we found that in certain cells with high levels of GFP-kinectin, there was

an increase in the ribosome-independent ER-association of t-ftz (for example, see Figure 3.12E).

Indeed, in HHT-treated cells the level of ER-associated t-ftz correlated with the amount of co-

expressed GFP-kinectin, but not H1B-GFP (Figure 3.12F).

62

Figure 3.12 GFP-kinectin over-expression slightly enhances the ER-association of t-ftz

mRNA after ribosome dissociation.

(A) COS-7 cells were transfected without (“mock”) or with plasmids containing GFP-p180 and

then lysed after 18-24 h. Cell lysates were separated by SDS-PAGE and immunobloted for

kinectin, GFP, αtubulin and translocon components (Sec61β and Trapα). (B-F) COS-7 cells were

transfected with plasmids containing t-ftz alone (“mock”) or in combination with GFP-kinectin

or H1B-GFP. After 18-24 h cells were either first extracted with digitonin and then fixed to

assess ER-association (B, E-F) or directly fixed to assess the total mRNA (C-D). After staining

63

for t-ftz mRNA using specific FISH probes, cells were imaged. (B) The fluorescence intensity of

t-ftz mRNA in the ER and nucleus in extracted cells. (C) The total level of t-ftz mRNA in

unextracted cells. (D) The fraction of t-ftz mRNA in the cytoplasm and nucleus. (B-D) All data

points are normalized to “mock” (cells expression t-ftz alone). Each bar represents the average

and standard error of three independent experiments, each consisting of the average integrated

intensity of 30 cells over background. (E) A single field of HHT-treated cells (30 min) that was

imaged for t-ftz mRNA, and GFP-kinectin. Scale bar = 20 μm. Note that t-ftz mRNA remains

associated to the ER in cells with very high levels of GFP-kinectin (arrow), but not those with

low levels (arrowhead). (F) For each cell the total level of ER-associated ftz FISH signal

(normalized from the background (0), to the brightest cell (1); y-axis) was plotted against total

integrated GFP signal (normalized from the background (0), to the brightest cell (1); x-axis).

64

We then examined whether over-expression of p180 affected the ER-association of bulk

mRNA. In cells expressing GFP-p180, there was almost a doubling in the amount of ER-

associated mRNA as compared to either H1B-GFP expressing, or untransfected cells (Figure

3.13). This was true for both untreated and HHT-treated cells. Although it is likely that a

substantial fraction of this enhanced ER-targeting was due to the recruitment of endogenous

transcripts, part of the observed increase was probably due to ER-bound GFP-p180 mRNA,

which is not present in the control transfected cells.

Figure 3.13 GFP-p180 over-expression enhances the ER-association of bulk poly(A)

mRNA.

COS-7 cells were transfected with either plasmids containing GFP-p180 or H1B-GFP and then

fixed after 18-24 h. Cells were then treated with either control medium, or HHT for 30 min to

disassemble ribosomes, and then extracted, fixed, and stained poly(A) mRNA using poly(dT)

FISH probes. (A) A single field of HHT-treated cells that was imaged for poly(A) mRNA and

GFP. Cells expressing GFP-p180 are denoted by arrows, while untransfected cells are indicated

by arrowheads. A cell with low GFP-p180 expression is denoted by an asterisk. Scale bar = 20

μm. The fluorescence intensity of mRNA in the ER was quantified (B). Each bar represents the

average and standard error of three independent experiments, each consisting of the average

integrated intensity of 50 cells over background.

65

Since the expression of p180 has been shown to be important in up regulating secretion in

specialized secretory cells (179,180), our results could have been ascribed to an increase in

ribosome-anchoring proteins. However, cells over-expressing GFP-p180 and t-ftz did not have

altered levels of translocon components, such as Sec61β or Trapα, as seen by immunoblot

(Figure 3.10E). Over-expression of kinectin also had no effect on the levels of Sec61β or Trapα

(Figure 3.12A).

In order to determine whether the lysine-rich region and basic repeats were required for

ER-anchoring of mRNA, we over-expressed a version of GFP-p180 that lacks both these

domains (GFP-p180LysRepeat; Figure 3.10F) and monitored t-ftz distribution. Cells that

over-expressed this construct retained about half as much t-ftz on the ER after HHT treatment as

compared to cells over-expressing p180 (Figure 3.10F-G, see Figure 3.10A to compare the

expression levels of the two constructs). Notably this level of residual ER-associated t-ftz was

above control HHT-treated cells, indicating that GFP-p180-ΔLysΔRepeat still had some activity.

Interestingly, in the absence of translation inhibitors, cells expressing this construct had elevated

levels of ER-associated t-ftz mRNA (Figure 3.10H). This increase was not due to changes in

either the nuclear/cytoplasmic distribution or total levels of t-ftz mRNA in cells expressing GFP-

p180-ΔLysΔRepeat (Figure 3.11). Thus, it is likely that p180 has the ability to enhance the

translation-dependent association of t-ftz mRNA with the ER and that this activity does not

require the lysine-rich region or the basic repeats.

From these results we conclude that the over-expression of p180 promotes the ribosome-

and translation-independent association of mRNAs with the ER. Moreover, our data suggest that

this activity is mediated in part by the basic domains found in the cytoplasmic region of p180. In

addition, our results indicate that p180 stimulates the recruitment of mRNAs to the ER even in

the presence of translating ribosomes, however the basic regions are dispensable for this second

activity. In addition, it is likely that kinectin may have some weak ability to anchor mRNAs to

the ER independently of ribosomes.

66

3.9 The Lysine-Rich Region of p180 Associates Directly with RNA In vitro

Next we investigated whether the basic cytoplasmic domains of p180 could associate

directly with RNA in vitro. In support of this idea we found that a bacterially expressed p180

lysine-rich region, fused to glutathione S-transferase (GST-p180-Lys; Figure 3.14A), could form

a complex with a 32

P-labeled RNA derived from the human insulin SSCR (Figure 3.14B). In

contrast, no complex was formed between this RNA and a control protein, GST-Ran (Figure

3.14A-B). By varying the amount of protein in our binding assay, we estimate that the GST-

p180-Lys binds to RNA with an affinity of about 0.8 μM. Since this protein could form

complexes equally well with other RNAs, such as a fragment of the human β-globin transcript

(unpublished data), it is unlikely that this domain has specificity for any particular sequence. We

also tested a peptide containing three copies of the consensus p180 decapeptide repeats;

however, we did not observe any complex between this reagent and any of the tested RNAs

(unpublished data). This result suggests that the repeats are not critical for mRNA interaction,

although we could not rule out the possibility that the peptide, which is 30 amino acids in length

and predicted to be disordered, failed to adopt some particular confirmation that is required for

RNA-interaction.

Figure 3.14 The lysine-rich region of p180 directly associates with RNA in vitro.

(A) GST-Ran and GST-p180-Lys were expressed in bacteria, purified using glutathione

sepharose, resolved by SDS-PAGE on a 12% acrylamide gel, and stained with Coomasie blue.

The size of relevant molecular weight markers (MWM) are indicated on the left. (B) 32

P-labeled

insulin SSCR RNA was incubated alone or with either GST-Ran or GST-p180-Lys for 15 min at

room temperature and then separated on a 10% non-denaturing TBE gel. Radiolabeled RNA was

visualized on a phosphorimager.

67

3.10 p180 Is Required for the Efficient Association of mRNA to the ER

Next, we depleted p180, kinectin, or CLIMP63, by infecting U2OS cells with lentivirus

that deliver short hairpin RNA (shRNA) that are processed into small interfering RNA directed

against the human genes of interest. These treatments effectively depleted p180 and kinectin

(Figure 3.15A), but the level of CLIMP63 after shRNA knockdown was quite variable. In

addition depletion of CLIMP63 occasionally resulted in a decrease in kinectin levels (Figure

3.15A), however this was not consistent throughout all our experiments. Note that in these

preliminary experiments p180 was depleted with shRNA clone B9.

68

Figure 3.15 p180 is required for the ER-association of mRNA.

(A–H) U2OS cells were infected with specific shRNAs against p180 (shRNA clones B9 and B10), kinectin or CLIMP63, or with

control lentivirus (“Cont”). (A-B) Cell lysates were separated by SDS-PAGE and immunoblotted for p180, CLIMP63, kinectin,

αtubulin, Trapα, and Sec61β. (C-E) Cells depleted of p180 (Clone B9; C, E) or kinectin (D), or infected with control lentivirus

(“cont”; C-E), were treated with control media (no drug, “ND”) or HHT for 30 min, then extracted with digitonin and stained for

69

poly(A) mRNA using poly(dT) FISH probes. (C-D) For each cell the total level of ER-associated poly (A) FISH signal (normalized

from the background (0), to the brightest cell in the entire experiment (1), y-axis) was plotted against cell size (pixels squared, x-axis).

For each data set a regression line was plotted and the coefficient of determination (R2) was indicated. (E) The ratio of ER to nuclear

poly(A) fluorescence was quantified and normalized. Each bar represents the average and standard error of five independent

experiments, each consisting of the average of >30 cells. (F-H) Cells were depleted of p180 or kinectin with specific shRNAs, or

infected with control lentivirus, then transfected with plasmids containing either the ALPP (F–G) or CALR (H) gene. The cells were

allowed to express mRNA for 18-24 h, then treated with control media (no drug, “ND”) or HHT for 30 min, and then extracted with

digitonin. Cells were then fixed, stained for mRNA using specific FISH probes against the exogenous mRNA, and imaged. Nuclei are

outlined with blue dotted lines. Scale bar = 20 µm. (G-H) The fluorescence intensity on the ER and nucleus were quantified. Each bar

represents the average and standard error of three independent experiments, each consisting of the average integrated intensity of 30

cells over background.

70

Previously it was shown that the depletion of these three factors had no obvious effect

on ER-morphology except that CLIMP63 depletion decreased the average width of the ER

lumen (156). Moreover, p180 depletion did not significantly affect the level of translocon

components, such as Sec61β or Trapα (Figure 3.15B). We did observe, however, that the average

cell size increased after p180 depletion (Figure 3.16A). As a consequence, the total area occupied

by the ER and the nucleus also increased (Figure 3.16B). Since we also observed an increase in

bi-nucleate cells (unpublished data), it is possible that p180 is required to complete cytokinesis,

which would explain the increase in cell and nuclear sizes. We next determined whether p180

was required for the ER-association of bulk mRNA to the ER using poly(dT) FISH probes. To

control for changes in cell size, we imaged and quantified poly(A) FISH staining in extracted

cells and plotted the total fluorescence intensity in the ER versus the cell area for each cell.

When cells of a similar size were compared, we observed a decrease in the steady-state levels of

ER-associated mRNA after p180 depletion (Figure 3.15C). In contrast, kinectin depletion had no

effect on the level of ER-associated mRNA (Figure 3.15D). When p180 knockdown cells, which

already had a low level of ER-associated mRNA, were treated with HHT the amount of mRNA

on the ER only decreased slightly (Figure 3.15C). In contrast when control or kinectin-depleted

cells were treated with HHT, the amount of ER-associated mRNA dropped but was still higher

than what was seen in p180 knockdown cells with or without HHT treatment (Figure 3.15C-D).

In order to quantify the amount of ER-associated mRNA while controlling for changes in cell

size and variation in FISH signals between experiments, we normalized the integrated

fluorescence intensities of FISH signal in the ER to the nucleus for each cell. We found that

p180-depleted cells had significantly less ER-associated mRNA in comparison to control cells

(Figure 3.15E). Using this analysis, we found that HHT treatment reduced the amount of ER-

associated mRNA in both control and p180 knockdown cells, however even in the absence of

p180 and translation, there was still ER-associated transcripts (Figure 3.15E).

From these experiments we conclude that p180 promotes the efficient anchoring of bulk

mRNA to the ER, however as p180 depletion did not abolish the ribosome-independent ER-

association of mRNA, it is likely that other mRNA receptors exist.

71

Figure 3.16 Depletion of p180 in U2OS cells increases cell size.

The area in square pixels of the whole cell (A) or the ER and the nucleus (B) were measured in

U2OS cells depleted of p180 with specific shRNAs or infected with control lentivirus and treated

with control media or HHT for 30 min prior to digitonin extraction. All values were normalized

to the size of either control cells (A) or ER (B). Each bar represents the average and standard

error of four independent experiments, each consisting of the average from >30 cells.

72

3.11 p180 Is Required for the Translation- and Ribosome-Independent

Maintenance of ALPP and CALR mRNA at the ER.

We then tested the requirement of p180 for ER-association of specific transcripts by

analyzing the level of mRNA in the cytoplasm and the nucleus by FISH. p180 depletion reduced

the association of ALPP to the ER in both control and HHT-treated cells (Figure 3.15F-G). In

contrast to poly(A) staining, we did not observe an increase in nuclear ALPP in the knockdown

cells. We believe that this is due to the fact that the total amount of ALPP mRNA produced per

transfected cell did not change despite the increase in cell and nuclear size. Depletion of p180

with a second shRNA construct (clone B10, Figure 3.15B) also reduced the association of ALPP

to the ER in both control and HHT-treated cells (Figure 3.15G). In contrast, depletion of kinectin

had no effect on the level of ER-associated ALPP mRNA in either control or HHT- treated cells

(Figure 3.15-G). p180 depletion by either shRNA clone also reduced the ER-association of

CALR mRNA in both control and HHT-treated cells (Figure 3.15H).

From these experiments we concluded that the ribosome-independent anchoring of ALPP

and CALR mRNA to the ER requires p180.

3.12 Discussion

The work presented here provides, to our knowledge, the first molecular insight into how

a large fraction of ER-anchored transcripts are maintained on the surface of this organelle

independently of ribosomes in mammalian cells. Importantly, we demonstrate that the degree of

ribosome- and translation-independent targeting and maintenance at the ER varies greatly

between different transcripts. We then provide evidence that p180 acts as a general mRNA

receptor on the ER. Over-expression of a GFP-tagged version of this protein potentiates mRNA-

ER interaction, while its depletion reduces the amount of ER-associated mRNA. Finally we

demonstrate that p180 is required for the ribosome-independent anchoring of ALPP and CALR

mRNAs. Although p180 appears to be a metazoan-specific gene, recent findings have suggested

that mRNA may be anchored directly to membranes in prokaryotes (149), suggesting that the

ribosome-independent association of mRNAs to membrane-bound receptors is universally

conserved (150). Indeed our data suggest that other mRNA receptors for the ER exist in

mammalian cells. One potential candidate that we have yet to rule out is kinectin. Although its

depletion has little to no effect on the distribution of bulk poly(A) or ALPP mRNA (Figure 3.15

D,F,G), its over-expression promoted a small but detectable increase in the ribosome-

73

independent association of t-ftz mRNA with the ER (Figure 3.12). Moreover, kinectin has a

cytoplasmic lysine-rich domain that resembles the RNA-binding region of p180. Future

experiments should determine the exact contribution of kinectin to this process.

Our results indicate that p180 and ribosome/translation dependent targeting mechanisms

act synergistically to enhance ER-anchoring of mRNAs (Figures 3.10B,H and 3.15E,G-H). In

agreement with our results, several groups have demonstrated that p180 expression promotes

secretion (179,180). Interestingly, the over-expression of p180 in budding yeast, which does not

express any endogenous p180-like proteins, leads to the proliferation of ER, the enhancement of

mRNA-ER association, and an increase in the half-life of ER-bound transcripts (181,182).

Furthermore, while ER- proliferation is stimulated by the over-expression of a version of p180

that lacks the basic domains, the enhanced mRNA-ER association requires these domains (182).

Although these results have been ascribed to the ability of p180 to directly recruit ribosomes, our

data support an alternative model where the basic domains of p180 associate directly to mRNA,

thus enhancing the partitioning of polysomes to the ER. It is also likely that p180 may have other

domains that mediate mRNA-ER association in mammalian cells. Indeed we found that the

expression of p180 lacking any basic regions (GFP-p180-LysRepeat) can promote ribosome-

dependent ER-anchoring of mRNA (Figure 3.10G-H). Taken together, our data suggest that the

coiled-coil domain may function primarily within the context of translation to enhance ER-

association. This result is in agreement with a recent study performed in collagen secreting cells

which demonstrated that p180 can promote the assembly of ER-bound polysomes, but that this

activity did not require its basic domains (183).

Importantly we demonstrate that p180 has a lysine-rich region that can directly bind to

RNA in vitro (Figure 3.14), likely through non-specific interactions with the mRNA backbone.

In light of this we predict that p180 acts in concert with proteins that recognize specific RNA

sequences to recruit particular mRNAs, such as ALPP and CALR, to the ER. Many candidate

proteins that could fulfill this function are likely found in the ERMAP fraction (Table 3.1).

Further studies will be required in order to determine whether these other ERMAP proteins play

a role in mediating specific interactions between mRNAs and the ER.

Intriguingly, our analysis also uncovered that the MSC, containing 10 tRNA synthetases,

and eEF1A1, which delivers charged tRNA to the ribosome, co-fractionates with ER-associated

mRNAs (Table 3.1). Recently it has been shown that the MSC not only co-fractionates with

74

polysomes in a sucrose gradient, but also is distributed in a reticular pattern that is resistant to

cellular extraction with digitonin (184), suggesting that this complex associates predominantly

with ER-bound mRNA. It is possible that the MSC may mediate the direct delivery of charged

tRNAs to the ribosome (known as ‘‘tRNA channeling’’ (185)), and thus be responsible for the

enhanced rate of protein synthesis experienced by ER-targeted transcripts (186).

Finally, it is likely that mRNA receptors may restrict various transcripts to particular

subdomains of the ER. As mentioned previously, many asymmetrically localized mRNAs are

anchored by mRNA receptors that are present in particular ER-subdomains. This is best

illustrated in rice endosperm cells, where the transport and anchoring of specialized mRNAs to

specific ER-domains is dependent on an RNA binding protein that is homologous to

SND1/Tudor (21,187), a protein we identified in the ERMAP fraction (Table 3.1). Interestingly,

the differential distribution of ER-bound transcripts is also seen in mammalian cells. For

example, t-ftz, but not ALPP, appears to be excluded from the nuclear envelope (X. Cui and A.

Palazzo, unpublished observations). Moreover unlike translocon-associated proteins, which are

concentrated in ER-sheets (18,156), poly(A) appears to be distributed more evenly across all of

the ER (for example, compare the distribution of Trap and poly(A) in Figure 3.2A), suggesting

that the association of certain mRNAs with ER-tubules is mediated by interactions with some

additional unidentified RNA receptor(s). Ultimately, the restricted localization of certain mRNAs

may help to target newly synthesized proteins to distinct areas of the ER. This may be critical for

the proper localization of proteins with polarized distributions (19-22), especially for secretory

proteins that are exported at specific ER exit sites and are processed in specialized Golgi outposts

(188), which are present at peripheral cellular sites, such as in neuronal dendrites. The restricted

distribution of particular ER-bound transcripts may also be important to confine certain newly

synthesized ER-resident proteins which function in certain subdomains of this organelle, such as

the nuclear envelope (189). Again further analysis of RNA-binding proteins (particularly those

found in the ERMAP fraction), and their interacting RNA elements, will be required for a clearer

understanding of these processes.

75

Chapter 4

Identification of a Region Within the Placental Alkaline Phosphatase mRNA that Mediates

p180 Dependent Targeting to the Endoplasmic Reticulum

This chapter is adapted from an article originally published as:

Cui, X. A, Zhang, Y, Hong, S.J. & Palazzo, A. F. Identification of a region within

the placental alkaline phosphatase mRNA that mediates p180 dependent targeting

to the endoplasmic reticulum. J. Biol. Chem 288(41): 29633-29641 (2013).

Acknowledgements:

Yangjing Zhang assisted with the image analysis for Figure 4.3 and constructed

Sec61-GFP and Sec22-GFP plasmid.

Seo Jung Hong contributed part of the data for Figure 4.2.

76

4.1 Introduction

Thus far we determined that a subset of mRNA encoding secretory proteins can target

and be maintained on the ER independently of translation and this process is partially p180-

dependent. Next we wanted to identify the cis-acting RNA element(s) that promote(s) ER-

localization.

Previously, studies showed that transcripts such as human GRP94 (71), and CALR

(Chapter 3) mRNAs, which encode chaperones that reside in the lumen of the ER, and mRNA

encoding secreted human placental alkaline phosphatase (ALPP) protein can be maintained on

the ER independently of active ribosomes. In addition, mRNAs encoding certain cytosolic

proteins also co-fractionate with the ER (89). Importantly, both CALR and ALPP require p180

for their translation-independent maintenance at the ER (190). In contrast, certain engineered

reporter mRNAs, such as t-ftz, and natural transcripts, such as the INSL-3 and CYP8B1,

predominantly use the translation-dependent pathway for ER-localization (190,191). In light of

this, p180 likely interacts with additional RNA binding proteins, which have motif-

discriminating RNA-binding domains to provide specificity to select for mRNAs entering this

pathway.

In order to better understand this basic cellular process in mammalian cells, it is critical

that we identify RNA elements that promote p180-dependent ER-localization. To address this

question, we first delineated the region in ALPP mRNA that is responsible for the targeting of

this mRNA to the ER independently of translation. Then, we determined whether this process is

p180 dependent by depleting p180 in the cell using Lentiviral delivered shRNA.

4.2 Efficient Translation-independent Maintenance of ALPP mRNA at the ER

Requires its Open Reading Frame

In order to identify putative ER localizing RNA element(s), we created chimera

constructs between ALPP, which can be targeted and then maintained on the ER in a

translational independent manner, and t-ftz, which strictly requires translation for its localization

to the ER (Chapter 3). First we created two constructs that had UTRs from one gene and the ORF

of the other. AF1 contains the ORF of ALPP and the UTRs of t-ftz, while AF2 contains the

converse (Figure 4.1A). These constructs were transfected into COS-7 cells, which were then

allowed to express mRNA for 18-24 h. The cells were then treated with either control media,

puromycin (“Puro”), or homoharringtonine (“HHT”) for 30 min. The cells were then treated with

77

digitonin to permeabilize the plasma membrane and extract any cytoplasmic mRNAs that are not

ER-bound, as previously described in Chapter 3. The cells were then fixed and AF1 mRNA was

detected by FISH using probes directed to the ALPP ORF, while AF2 was detected using probes

that hybridize to the ftz ORF.

Surprisingly, the majority of the AF1 mRNA was maintained on the ER after either

puromycin/EDTA, or HHT treatments. In contrast, the ER-association of AF2 mRNA was

sensitive to these treatments (Figure 4.2A-B). As an internal control we also monitored the

amount of nuclear mRNA, which is not affected by digitonin-permeabilization (Chapter 3), and

as expected this remained relatively unchanged among different treatment groups (Figure 4.2B).

As shown in Chapter 3, ALPP remained associated to the ER under all conditions, while t-ftz

required translation for ER-association. These results indicated that the ER-localizing cis-

element was present within the ORF of ALPP.

78

Figure 4.1 Schematic diagrams of constructs and U-content in ALPP and t-ftz.

A) Schematic of the chimeric constructs used in this study. All t-ftz sequences are depicted in

gray and ALPP sequences in white. B) Percent U content in ALPP, as analyzed using a moving

window of 50 nt, was plotted against the length of the construct. The signal sequence coding

region (SSCR), open reading frame (ORF), transmembrane domain coding region (TMCR), and

various fragments (AP1-5) are indicated. Note that the gray region represents AP5.

C) Percent U content in t-ftz, as analyzed using a moving window of 50 nt.

79

Figure 4.2 ALPP ORF can mediate the ribosome and translation independent mRNA localization on the ER in the chimera

construct.

COS-7 cells were transfected with plasmids containing either the AF1 or AF2 constructs and allowed to express mRNA for 18-24 h.

The cells were then treated with DMSO (“Ctrl”), puromycin (“Puro”), or HHT for 30 min, and then extracted with either digitonin

alone, or for puromycin-treated cells, with 20 mM EDTA. The cells were then fixed, stained for mRNA using specific FISH probes

(ALPP probe for AF1, ftz probe for AF2), and imaged. (A) Representative FISH images of cells expressing AF1 or AF2. (B)

Quantification of the fluorescence intensities of mRNA on the ER and nucleus. All data were normalized to the ER staining intensities

in the control treated group for each construct. Each bar represents the average and standard error of 3 independent experiments with

n>30 cells for each group. All scale bars = 20 m.

80

4.3 The TMD Coding Region of ALPP mRNA Promotes the Translation-

Independent Maintenance of mRNA at the ER

The ALPP transcript is translated into a protein product that is translocated into the ER

and then anchored to the membrane by a carboxy-terminal TMD. This TMD is then cleaved and

the processed protein becomes covalently linked to a phosphatidyl-inositol glycan moiety, which

retains the protein at the membrane (192). Mature ALPP is then transported through the secretory

pathway to the surface of the cell.

To determine where the ER-localizing RNA element is located, we inserted 5 segments

of the ALPP ORF in between the signal sequence coding region (SSCR) and ORF of t-ftz (AP1,

AP2, AP3, AP4 and AP5) (Figure 4.1A-B). This allowed us to use the ftz FISH probe to detect

each of these chimeric mRNAs. Moreover, the presence of the t-ftz SSCR ensured that these

mRNAs would be properly exported from the nucleus to the cytoplasm (152). Plasmids

containing each construct were transfected into COS-7 cells. After 18-24 h, translation-

independent ER-association was assessed. We found that the AP5 fusion mRNA was maintained

on the ER independently of translation at a level similar to the full length ALPP (Figure 4.3A-B).

In HHT-treated cells, AP5 mRNA co-localized with Trapα, an ER marker, confirming that this

localization is ER specific (Figure 4.3C). Of the other chimeras, only AP2 showed a modest

increase in its localization on the ER in HHT treated cells in comparison to t-ftz, suggesting that

this fragment may have some limited localization capability. Note that a region of AP5 is also

found in AP4 (Figure 4.1B), however this later mRNA requires translation for efficient ER-

anchoring (Figure 4.3A-B).

From these experiments we conclude that the AP5 region of ALPP contains an ER-

localizing sequence. It is likely that the region responsible for this activity resides in the region

that is unique to AP5 (i.e., not found in AP4), in particular the TMD-coding region (TMCR).

81

Figure 4.3 AP5 contains the

ER localizing RNA element.

COS-7 cells were transfected with

plasmid containing either full

length ALPP, t-ftz, AP1, AP2,

AP3, AP4 or AP5 and allowed to

express mRNA for 18-24 h. The

cells were then treated with

DMSO (“C” or “Ctrl”) or HHT

(“H”) for 30 min, and then

extracted with digitonin. Cells

were then fixed, stained for

mRNAs using specific FISH

probes (ftz probe was used to

detect AP1-5), and imaged. (A)

Quantification of the fluorescence

intensities of mRNA in the ER and

nucleus. All data were normalized

to the ER staining intensities in the

control treated group for each

construct. The results were

normalized to the ER staining

intensities in the control treated

group for each construct. Each bar

represents the average and

standard error of 3 independent

experiments with n>30 cells for

each group. (B) Examples of COS-

7 cells expressing either t-ftz, AP4

or AP5. (C) Example of a COS-7

cell expressing AP5 that has been

treated with HHT for 30min then

extracted with digitonin. The cell

was co-stained for AP5 using ftz

FISH probes and Trap, an ER

marker, by immunofluorescence.

All scale bars = 20 m.

82

4.4 The Coding Potential of AP5 is not Required for ER-localization

To ensure that ER-localization of AP5 was not due to a low level of translation in HHT-

treated cells, we inserted a guanine between the 3rd

and 4th

nucleotide of the ORF of this mRNA,

creating frame-shifted AP5 (fs-AP5, Figure 4.1A). This mRNA encodes a polypeptide that does

not contain a signal sequence or TMD, as predicted by either SignalP (161) or TMHMM (160)

(data not shown). Furthermore, this peptide is mostly hydrophilic as measured by Kyte-Doolittle

Hydropathy plot (162) (Figure 4.4A), and is thus not a likely substrate for co-translational

translocation into the ER.

83

Figure 4.4 Frame-shifted AP5 can still efficiently be maintained on the ER independently of ribosomes and translation. (A) Hydrophobicity (y-axis, left) of the polypeptides encoded by AP5 and fs-AP5 was plotted against the peptide length (x-axis,

bottom). The hydrophobicity was calculated with a moving window size of 21 amino acids. Note that AP5 encodes the t-ftz signal

sequence (residues 1-23 of the AP5 protein), followed by the C-terminal domain of ALPP (including the TMD of ALPP, residues 73-

90 of the AP5 protein), and then ends with the hydrophilic ftz protein. In contrast, fs-AP5 does not encode any hydrophobic region.

Also note that the frame shift mutation results in the creation of an early stop codon and thus a smaller encoded protein. For

comparison the U-content (x-axis, right) along AP5 (y-axis, top) was also plotted ((B-C) COS-7 cells were transfected with plasmid

84

Figure 4.4 Frame-shifted AP5 can still efficiently be maintained on the ER independently of ribosomes and translation. (Continued) containing either t-ftz, AP5, fs-AP5 or H1B-GFP and allowed to express mRNA for 18-24 h. Cells were then fixed

directly (“Unextracted”) or digitonin extracted (“Extracted”) and stained with specific FISH probes (ftz probes were used to for AP5

and fs-AP5) to visualize mRNA distribution. (B) Representative examples. (C) Quantification of mRNA export and percent ER

localization. For each transcript, mRNA distribution between cytoplasm and nucleus was calculated in unextracted cells by comparing

the FISH staining intensity in each compartment to the total fluorescence within the cell. Percent ER localization of each transcript

was calculated by comparing mRNAs on the ER in the extracted cells with cytoplasmic mRNA content in unextracted cells. For each

group at least 40 cells were quantified, averaged and the ratio of these numbers was plotted. (D-E) Distribution of mRNAs in the

cytoplasmic and ER fractions. U2OS cells transfected with plasmid containing either t-ftz, fs-AP5 or M1-ftz (a cytosolic protein

containing a mRNA nuclear export promoting element M1) was fractionated into cytoplasm (“C”), ER (“ER”) and nuclear (“N”)

fractions. mRNA distribution between cytoplasmic and ER of each transcript was then determined via northern blot with [32

P]-labeled

ftz probe. (E) Various cell fractionation from transfected cells were analyzed by immunoblot using antibodies against either Trapα (a

resident ER protein), αtubulin (a cytoplasmic protein) and Aly (a nuclear protein). (F-G) COS-7 cells were transfected with plasmids

containing the t-ftz or fs-AP5 constructs and allowed to express mRNA for 18-24 h. The cells were then treated with DMSO (“Ctrl”) or

HHT for 30 min, and then extracted with digitonin. Cells were then fixed, stained for mRNA using FISH probes against ftz, and

imaged. (F) Representative images. (G) Quantification of the fluorescence intensities of mRNAs in the ER and nucleus. Each bar

represents the average and standard error of 3 independent experiments with n>30 cells for each group. (H) Example of a COS-7 cell

expressing fs-AP5 that has been treated with HHT for 30 min then extracted with digitonin. The cell was co-stained for fs-AP5 using

ftz FISH probes and Trap, an ER marker, by immunofluorescence. All scale bars = 20 μm.

85

Next, we expressed fs-AP5 in COS-7 cells and observed its distribution in normal and

digitonin-permeabilized cells in comparison to AP5 and t-ftz. We also monitored H1B-GFP

mRNA, which is not expected to be at the ER as it encodes a nuclear localized Histone 1B-Green

Fluorescent Protein fusion. In the majority of cells the distribution of t-ftz, AP5, fs-AP5 and H1B-

GFP mRNA was mostly diffuse in the cytoplasm indicating that a substantial fraction of these

transcripts were not ER-bound (Figure 4.4B). However, after digitonin-permeabilization,

significant levels of t-ftz, AP5, and fs-AP5, but not H1B-GFP mRNA remained in the cytoplasm

in a reticular pattern (Figure 4.4B, for quantification see 4.4C), that co-localized with Trapα (data

not shown). Indeed, we calculated that approximately one quarter of the cytoplasmic fs-AP5

mRNA is bound to the ER (Figure 4.4C). In contrast, less than 10% of the H1B-GFP mRNA was

ER-associated. We next confirmed this result by analyzing the distribution of various mRNAs in

different cell fractions. Transfected U2OS cells were separated into cytoplasm ER and nuclear

fractions as previously described (151,190), and the presence of RNA was determined by

northern blot. fs-AP5 and t-ftz were present at slightly higher levels in the ER than the

cytoplasmic fraction (Figure 4.4D). In contrast, M1-ftz mRNA, which encodes a cytosolic protein

and contains the mRNA nuclear export promoting element M1 (153), was present predominantly

in the cytoplasmic fraction (Figure 4.4D). To ensure that the fractions were not cross-

contaminated, we examined them for various markers. Note that the ER fraction was free of

cytosolic proteins, such as αtubulin, and nuclear factors, such as the RNA-binding protein Aly

(Figure 4.4E). It is likely that the discrepancy in the degree of ER-localization for fs-AP5

between Figures 4.4B and 4.4E was due to the fact that COS-7 cells tend to have higher levels of

expression than U2OS, and thus flood all of the mRNA-binding sites on the ER.

We then assessed whether the localization of fs-AP5 mRNA required translation. In

contrast to t-ftz, fs-AP5 remained ER-associated in COS-7 cells treated with HHT (Figure 4.4F-

G). This ER- localization in HHT-treated cells was confirmed by the co-localization of the

mRNA with the ER marker Trapα (Figure 4.4H).

These results confirm that AP5 contains an RNA element that can anchor transcripts on

the ER independently of translation.

86

4.5 The TMCR is Required for the Translational-Independent ER-

Localization of ALPP

We next deleted the last 90 nucleotides of the ORF from the full length ALPP. This

construct, ALPP-∆TMD, lacks the TMCR. Although this mRNA localized to the ER in COS-7

cells, we found that it was not retained there after HHT-treatment, especially when compared to

ALPP (Figure 4.5A-B). These observations indicate that the ER-retention element likely resides

in the TMCR.

87

Figure 4.5 The TMCD is required for the translational-independent ER-localization of

ALPP.

COS-7 cells were transfected with plasmid containing either ALPP or ALPP- ΔTMD and allowed

to express mRNA for 18-24 h. The cells were then treated with DMSO (“Ctrl”) or HHT for 30

min, and then extracted with digitonin. The cells were then fixed, stained for mRNA using

specific FISH probe against ALPP ORF. (A) Representative examples. (B) Quantification of the

fluorescence intensities of mRNAs in the ER and nucleus. Each bar represents the average and

standard error of 3 independent experiments with n>30 cells for each group. All scale bars = 20

m.

88

4.6 AP5 Promotes the Efficient Targeting of mRNA to the ER Independently

of Translation

Thus far our data indicates that once localized to the surface of the ER, AP5 is retained

there even after ribosomes have dissociated from the transcript. It is however possible that the

initial targeting of this mRNA to the ER is still dependent on translation, with the TMCR

mediating its subsequent ER- retention independently of translation. To test whether this region

can promote the initial targeting to the ER independently of translation, we first treated COS-7

cells with HHT for 15 min to halt all translation, then microinjected plasmids and monitored the

localization of the newly synthesized transcripts. In principle, an mRNA should be free of active

ribosomes throughout its entire lifetime under these conditions. We found that newly synthesized

AP5 was targeted to the ER in both control treated and in cells pre-treated with HHT (Figure

4.6A-B). The targeting of AP5 was less efficient than the full length ALPP, but enhanced when

compared to t-ftz (Figure 4.6B). These results indicate that AP5 can both target to, and be

retained on the ER independently of translation.

89

Figure 4.6 The initial ER-targeting of AP5 occurs independently of translation and

ribosomes.

(A-B) COS-7 cells were pretreated with DMSO (“Ctrl”) or HHT for 15 min, then microinjected

with plasmids containing either the ALPP, t-ftz or AP5. These plasmids were microinjected with

Alexa488-conjuaged 70KDa dextran, which marks injected cells and can be seen in the insets

(A). Cells were allowed to express mRNAs for 2 h in the presence of DMSO or HHT, then

extracted with digitonin, fixed and stained with specific FISH probes, and imaged. (A)

Representative examples. (B) Quantification of the fluorescence intensities of mRNAs in the ER

and nucleus. Each bar represents the average and standard error of 3 independent experiments

with n>30 cells for each group. All scale bars = 20 m.

90

4.7 p180 is Required for the Efficient Targeting of ALPP mRNA to the ER

Previously, we showed that p180 acts as an mRNA receptor that anchors several different

transcripts, such as ALPP, on the surface of the ER (Chapter 3). To test whether p180 was

required for the initial ER-targeting of this mRNA, we microinjected plasmids containing ALPP

into p180-depleted U2OS cells (Figure 4.7B). We observed that in the absence of p180, the

ability of the newly synthesized ALPP mRNA to target to the ER decreased in both control and

HHT-treated cells (Figure 4.7A, C). In contrast, the ER-targeting of t-ftz was strictly dependent

on active translation and was not affected by p180-depletion. These data indicate that p180 is

required not only for ER-anchoring, but also for the efficient ER-targeting of a subset of mRNA,

such as the ALPP transcript.

The fact that we can observe a p180-dependence in targeting even in the presence of

active translation, suggests that p180 also either works in parallel and/or directly enhances SRP-

dependent processes. This first model is supported by the fact that p180 is required for enhanced

ER-targeting even when translation is inhibited. The second possibility is supported by

observations that p180 may directly contact ribosomes (183) and/or the translocon (193).

Nevertheless our results strongly indicate that p180 is involved in both the initial targeting and

also the anchoring of ALPP on the surface of the ER.

91

Figure 4.7 p180 is required for

the initial ER-targeting of ALPP.

(A-C) U2OS cells were infected

with Lentivirus carrying control

shRNA (“Ctrl shRNA”) or shRNA

clone B10 against p180. The control

and p180-depleted cells were

pretreated with DMSO (“Ctrl”) or

HHT for 15 min, then microinjected

with plasmids containing either the

ALPP or t-ftz and allowed to

express mRNAs for 2 h in the

presence of DMSO or HHT. The

cells were then extracted with

digitonin, fixed and stained with

specific FISH probes, and imaged.

(A) Representative examples. (B)

Cell lysate was collected on the day

of injection and the level of

depletion was assessed by

immunoblotting against p180 and

tubulin. (C) Quantification of the

fluorescence intensities of mRNAs

in the ER and nucleus. Each bar

represents the average and standard

error of 3 independent experiments

with n>30 cells for each group. All

scale bars = 20 m.

92

4.8 ER-maintenance of AP5 mRNA Requires p180

To examine whether TMCR-mediated ER localization is p180 dependent, we examined

the distribution of AP5 in U2OS cells depleted of p180 (Figure 4.8B). Indeed, similar to full

length ALPP mRNA, AP5 showed a significant decrease in its ability to associate with ER in

p180-depleted cells (Figure 4.8A,C). This decrease was seen in both control and HHT-treated

cells. Again the ability of t-ftz to be maintained on the ER was strictly dependent on translation

and was not affected by the depletion of p180.

In conclusion, our results indicate that the AP5 region of ALPP, which includes a TMCR,

contains an RNA element that anchors this mRNA to the surface of the ER in a p180-dependent

manner.

93

Figure 4.8 p180 is required for the ER association of AP5.

(A-C) U2OS cells were infected with Lentivirus carrying control shRNA (“Ctrl shRNA”) or

shRNAs (clones B9 or B10) against p180. The control and p180-depleted cells were transfected

with plasmids containing either the ALPP, t-ftz or AP5 constructs and allowed to express mRNAs

for 18-24 h. The cells were then treated with either DMSO (“C” or “Ctrl”) or HHT for 30 min

(“H”), digitonin extracted, fixed and stained with specific FISH probes, and imaged. (A)

Representative examples. (B) Cell lysate was collected on the day of injection and the level of

depletion was assessed by immunoblotting against p180 and tubulin. (C) Quantification of the

fluorescence intensities of mRNAs in the ER and nucleus. Each bar represents the average and

standard error of 3 independent experiments with n>30 cells for each group. All scale bars = 20

m.

94

4.9 Discussion

We have identified a region of ALPP that contains an RNA element which promotes ER-

localization. Furthermore, our data indicates that this element requires p180 for its activity.

Interestingly, this element maps to a region of ALPP that encodes a TMD. This finding suggests

that mammalian cells may have a propensity to recognize nucleotide features that are associated

with certain protein coding regions. These inherent biases would be maintained by natural

selection primarily to constraints imposed by the encoded polypeptide, however subsequently

these features could be further exaggerated to enhance activities that act at the nucleotide level.

For example, the amino acid composition of TMDs is enriched in hydrophobic residues such as

Leu, Ile, Met, Val, and Phe. Interestingly, all of these amino acids are encoded by codons that

have a uracil at their second position and are thus relatively U-rich (154). Indeed, it has been

noted that uracil content is a good predictor of whether any given region within an ORF encodes

a TMD or a signal sequence (150). As mentioned in Chapter 1, it has been shown that E. coli

also targets certain mRNAs to the plasma membrane by elements found within TMCRs that are

U-rich (149). These results may indicate that the propensity for TMCR to promote the

localization of mRNAs to sites of secretory protein production, independently of translation.

This simplistic model however does not explain all of our observations. When the U-

content of the ALPP transcript was analyzed, the TMCR contains a relatively high level of Uracil

when compared to other sections of the transcript, however one can clearly find regions within

the ORF and UTRs that have even higher levels (see Figure 4.1B). Furthermore, regions of the t-

ftz 3′UTR (present in both t-ftz and AP5, see Figures 4.1C and 4.4A) have levels of U-content

that exceed what is found in the TMCR of ALPP, yet t-ftz does not exhibit much translational-

independent ER targeting. We also recently reported that the CYP8B1 mRNA, which encodes a

membrane- bound protein, also requires translation for efficient ER-anchoring (see Chapter 3),

suggesting that not all TMCRs have this activity. Finally, CALR mRNA, which does not encode

any TMD, associates with the ER independently of translation in a p180-dependent manner

(Chapter 3). Thus it is clear that although U-richness in TMCRs may help contribute to this

activity, other features are also important. Work in budding yeast has identified other cis-

elements that are responsible for ER targeting. One example is Pmp1, which contains several UG

repeats in its 3′UTR that can promote ER-localization (194). Recently, other yeast mRNAs have

been shown to localize to the ER independently of translation in manners that depend on either

95

their ORFs and/or UTRs (195). Thus it is likely that many different elements may target mRNAs

to the ER.

Another element found within ORFs of metazoan mRNAs encoding secretory proteins is

the SSCR. It promotes nuclear export (152) and translation (151) of mRNAs. Mutations within

the SSCR redirect mRNAs from the ER to stress granules (152), large cytoplasmic aggregates of

mRNAs with stalled translation initiation complexes (196). SSCRs also have unusual nucleotide

compositions. They are depleted of adenine, enriched in guanine, cytosine and uracil, and tend to

contain CUG repeats (152,153). SSCRs however do not appear to promote translational-

independent ER-targeting as exemplified by t-ftz and INSL-3, which despite having SSCRs with

high U-content, absolutely require translation for efficient targeting and anchoring to the ER

(Figure 4.3A, also see Chapter 3). It is still possible that while the SSCR is not sufficient, it may

still be required for translation-independent ER-targeting.

We have attempted to analyze the degree of conservation in the 90 nucleotides at the end

of the ALPP ORF; however, this analysis was hampered by the fact that mammals contain

numerous ALPP paralogs, many of which lack TMCRs. Despite this, we found that these regions

had features that are associated with SSCRs. In particular, they have CUG repeats, GC-rich

regions and low adenine-content. These observations raise the possibility that the number of

SSCR-like segments present in a given mRNA impacts the efficiency of the p180-dependent

pathway. Future study is needed to identify p180-associated mRNAs and through this approach

we hope to computationally determine which sequence features, motifs or secondary structures

correlate with p180-dependency for ER-anchoring.

It remains unclear how p180 promotes the specific anchoring of a subset of mRNAs to

the ER. p180 likely binds the RNA backbone through ionic interactions (Chapter 3) and therefore

is not likely to act selectively. In light of this, other RNA-binding proteins, which have classic

RNA recognition motifs, may act in conjunction with p180 to selectively retain certain mRNAs.

Candidates were previously identified in a mass spectrometry screen of proteins that co-purify

with ER-derived polysomes (Chapter 3). Ultimately the ALPP TMCR could be used to identify

these accessory proteins.

96

Chapter 5

mRNA Encoding Sec61, a Tail-Anchored Protein, is Localized on the Endoplasmic

Reticulum

This chapter is adapted from an article that has been submitted to the Journal of Cell

Science:

Cui, X. A. & Palazzo, A. F. mRNA Encoding Sec61a Tail-Anchored Protein, is

Localized on the Endoplasmic Reticulum. J. Cell Science, Submitted (2015).

97

5.1 Introduction

One major mechanism that directs proteins to their correct subcellular destination is the

localization of their mRNA (197,198). Likely the most widespread example of this is the

localization of mRNAs encoding membrane and secreted proteins to the surface of the ER in

eukaryotic cells. This localization facilitates the targeting of the encoded proteins to the secretory

pathway (199). ER-localization of mRNAs is partially determined by the recognition of the

encoded polypeptide by the SRP system. In previous chapters, we demonstrated that a subset of

mRNAs also utilize a parallel mechanism, which is translation independent and partially

dependent on p180 (Chapter 3). In the ALPP mRNA, the cis-acting RNA element that mediates

this process resides within the TMCR (Chapter 4). In this chapter, we will examine the

localization of mRNAs encoding TA-proteins.

Tail anchored proteins account for about 5% of membrane anchored proteins in the cell.

This group of proteins does not contain an N-terminal signal sequence; instead they are targeted

and anchored to the phospholipid bilayer by a single hydrophobic transmembrane domain close

to the COOH terminus. They are involved in many essential cellular processes. Some prominent

examples of this class of protein include members of SNARE proteins (Soluble NSF Attachment

Protein), which mediate vesicle transport; and Bcl2 family of proteins, which are regulators of

the cellular life-or-death switch.

It is currently believed that TA-proteins are synthesized by cytoplasmic (i.e. non ER-

bound or “free”) ribosomes. Upon the completion of translation these proteins are post-

translationally targeted to the ER membrane via a cascade of protein chaperones (Figure 1.1C).

In the mammalian system, as the translation of tail-anchored protein finishes, the protein exits

the ribosome and is recognized by the pre-targeting recognition complex consisting of Bat3-

TRC35-Ubl4A (97,100). This complex then hands the TA-protein to TRC40, a conserved

cytosolic chaperone that recognizes and delivers the TMD of TA-proteins to the ER

membrane(78,97-100). Recently, the ER membrane receptor for TRC40 was identified to be a

heteromultimer composed of CAML and WRB, which interacts with the incoming TRC40 and

mediates the insertion of TA-protein into the ER membrane (97,100,103). This model is largely

based on studies in yeast and in vitro reconstitution of the protein-targeting pathway using

mammalian cell fractions (78,96,97). Interestingly, it has never been demonstrated that TRC

components are required for proper TA-protein localization in intact mammalian cells. Moreover,

98

many of the TRC/GET components are dispensable for cell viability despite the fact many of the

TA-protein substrates are essential for life. This discrepancy suggests that an alternative

biogenesis mechanism exists for this group of proteins.

Here we investigated the alternative mechanism for the biogenesis of TA-proteins

including Sec61β and Nesprin2. By studying both overexpressed and endogenous mRNA

transcripts, our study demonstrates that some mRNAs encoding the TA-proteins, such as Sec61β,

associate with the ER. In addition, the ER-association of Sec61β mRNA is not dependent on

TRC40, BAT3 or p180. Moreover, overexpression of Sec61β mRNA displaces other mRNAs

from the ER, including those that are anchored by translocon-bound ribosomes. This suggests

that some mRNAs encoding TA-proteins can access translocon-bound ribosomes on the surface

of the ER.

5.2 Sec61β mRNA is partially localized on the ER

It is currently believed that mRNAs encoding TA-proteins are first translated by free

ribosomes, and that the encoded polypeptide is later post-translationally targeted to the ER via

the GET/TRC pathway (105,110,200).

To assess the distribution of endogenous mRNA in human cells, we stained U2OS cells

with a panel of fluorescent in situ hybridization (FISH) probes. By simultaneously staining with

many probes, one can efficiently visualize individual mRNA molecule (201), as can be seen in

Figure 1. To determine whether these RNAs were tethered to the ER we repeated the experiment

in cells that were treated with digitonin, which permeabilizes the plasma membrane and thus

extracts the cytoplasm and removes any molecule that is not ER-associated (89,190,191). By

comparing the number of puncta in non-extracted versus extracted cells, we can determine the

percentage of mRNAs are anchored to the ER.

First we examined the localization of Sec61β mRNA, which encodes a TA-protein.

Sec61 is a component of the translocon, the major protein-conducting channel in the ER, and

has been widely used as a model GET/TRC pathway substrate (110). Surprisingly we found that

about 30% of the endogenous Sec61β mRNA was resistant to digitonin extraction (Figure 5.1A-

B). To test whether the localization of Sec61β mRNA was translation dependent, we examined

the mRNA localization in cells treated with either homoharringtonine (HHT) or puromycin and

extracted with EDTA (Puro+EDTA), two treatments that effectively dissociate ribosomes from

99

mRNA (190). To our surprise, most of the ER-localized mRNA was unaffected by these

treatments.

Figure 1. Endogenous Sec61β

and Nesprin2 mRNA

associates with the ER

membrane.

U2OS cells were either: fixed

(“Unextracted”); first extracted

with digitonin and then fixed

(“Extracted”); or pre-treated

with Puromycin (Puro) or

Homoharringtonine (HHT) for

30 min, extracted with

digitonin in the presence or

absence of EDTA and then

fixed. Cells were stained with a

pool of FISH probes to

visualize individual

endogenous human

Sec61βNesprin2 or GAPDH

mRNA molecules. Each cell

was visualized by phase

microscopy to determine the

cell contours. mRNA foci were

identified using NIS-element

“Spot Detection” function (see

Methods section). Shown in (A)

are the mRNA FISH signals

overlaid with the contours of

the cells and nuclei and the

detected foci highlighted by the

spot detection function. (B)

The number of cytoplasmic (i.e.

non-nuclear) foci were

determined for each condition.

Each bar is the average and

standard error of 30 cells.

Next we monitored the localization of Nesprin2 mRNA, which encodes a giant TA-

protein (796 kDa) that is present on the outer nuclear envelope and is involved in nuclear

100

positioning (202). After extraction about two thirds of the foci remained, indicating that some of

this mRNA was anchored to the ER (Figure 5.1A-B). To ensure that the FISH signal was specific,

we also probed cells that were depleted of their endogenous Nesprin2 mRNA using RNAi.

Indeed, RNAi-treated cells lost 90% of their signal (Figure 5.2), indicating that our Nesprin2

probes detected the intended target. Like Sec61β, Nesprin2 mRNA largely remained ER-

associated in cells treated with HHT and puromycin/EDTA. Thus Nesprin2, like Sec61β, can

associate with the ER-membrane and that this activity is mostly independent of translation.

To determine whether partial ER-association was a general phenomenon for all mRNAs,

we next investigated the localization of an mRNA encoding a cytosolic protein, glyceraldehyde

3-phosphate dehydrogenase (GAPDH). We could reproducibly find 15% of the GAPDH puncta

in digitonin-extracted cells (Figure 5.1A-B). However, in contrast to what we had seen for

Sec61β and Nesprin2, most of the GAPDH mRNAs were extracted in cells treated with either

HHT or puromycin/EDTA (Figure 5.1), suggesting that the small amount of ER-association was

mediated by translating ribosomes.

Thus we concluded that at least two endogenous mRNAs that encode TA-anchored

proteins are also ER-associated, and this was mostly mediated by contacts that did not involve

the ribosome.

Figure 5.2. Endogenous Nesprin2 mRNA

localization in U2OS cells.

U2OS cells were treated with control medium

or HHT for 30 min then either fixed directly

or first digitonin-extracted, stained with

specific pools of FISH probes against

endogenous human Nesprin2, and imaged.

101

5.3 The ORF of Sec61 mRNA is required to anchor to the ER independently

of translation

We next wanted to identify the region of Sec61 mRNA responsible for its ER-anchorage.

We followed a strategy that we had previously used to identify regions in the placental alkaline

phosphatase (ALPP) mRNA that promoted ER-anchorage (203). We fused different regions of

Sec61 to t-ftz (Figure 5.3A), an artificial mRNA that encodes a secretory protein and requires

translation for ER-association (190). These constructs were expressed in COS7 cells. After 18-24

hrs, cells were either treated with control or HHT for 30min to disrupt ribosomes, then extracted

to remove non-ER associated mRNAs, and then stained by FISH. To our surprise, versions of t-

ftz containing either the 5’UTR (5’UTR-t-ftz) or 3’UTR (3’UTR-t-ftz) of Sec61 did not remain

anchored to the ER after HHT-treatment, resembling the original t-ftz mRNA (Figure 5.3B, for a

quantification of the fluorescence intensity, see 5.3C). In contrast, a version of t-ftz fused to the

Sec61 ORF (t-ftz-ORF) remained ER-associated after HHT-treatment (Figure 5.3B). In fact

quantification of the FISH intensities revealed that the level of ER-association did not

significantly change between control and HHT-treated cells (Figure 5.3C).

To further validate these findings we examined the distribution of GFP-Sec61, a

construct that contains the ORF of the human Sec61 gene (Figure 5.3A). In unextracted COS7

cells the mRNA had a noticeable reticular-like distribution, suggesting that a large fraction of

this mRNA may be localized to the ER (Figure 5.3D). In digitonin-treated cells, a large portion

of the GFP-Sec61β mRNA was resistant to extraction (Figure 5.3D). In these cells GFP-Sec61β

mRNA co-localized with its translated product, GFP-Sec61β protein (Figure 5.3E), which is a

well-established marker of the ER (204). In contrast, H1B-GFP mRNA, which encodes a nuclear

histone protein, was mostly extracted by digitonin treatment (Figure 5.3D). When the FISH

fluorescence levels in extracted and unextracted cells were compared, we observed that 60% of

the GFP-Sec61β mRNA was resistant to extraction (Figure 5.3F). This is comparable to what we

previously observed for other over-expressed mRNAs encoding secreted and membrane-bound

proteins (190,191). In contrast, only about 10% of H1B-GFP mRNA was resistant to digitonin

extraction (Figure 5.3F), which is also in line with our previous observations (190).

102

Figure 5.3. Overexpressed GFP-Sec61β mRNA is associated with the ER membrane.

(A) Schematic diagram of constructs. All t-ftz sequences are shown in white, Sec61β sequences

are shown in grey and EGFP sequences are shown as checked boxes. (B-C) Chimera plasmids

containing either the Sec61β 5’UTR, 3’UTR or the ORF fused to t-ftz were transfected into

COS7 cells. 18-24 hrs post-transfection, cells were treated with either control or HHT, followed

by digitonin extraction to remove cytoplasmic contents. Cells were fixed, stained using FISH

probes against ftz, and imaged. (D-F) Plasmids encoding GFP-Sec61β or H1B-GFP were

transfected into U2OS cells. 18-24 hrs post transfection, cells were either fixed directly

(“Unextracted”) or after digitonin extraction (“Extracted”). GFP-Sec61β or H1B-GFP mRNAs

were stained with FISH probes against the GFP-coding sequence and visualized. mRNAs in

unextracted and digitonin-extracted cells are shown in (D). Note that GFP-Sec61β, but not H1B-

GFP mRNA, is resistant to digitonin extraction and exhibits a reticular staining pattern. (E)

Distribution of GFP-Sec61β protein and mRNA in a digitonin-extracted U2OS cell. Both images

are from a single field of view. Note the extensive colocalization of the mRNA with its encoded

protein, which is localized to the ER. (F) Quantification of GFP-Sec61β and H1B-GFP mRNA

cytoplasmic intensity signals. The ratio of fluorescence in the cytoplasms of extracted versus

unextracted cells was determined. Each bar represents the average and standard error of 3

independent experiments, each containing at least 30 cells. All scale bars = 20µm.

103

Next we assessed whether ER-association of GFP-Sec61β mRNA required translation.

Neither puromycin/EDTA nor HHT treatment disrupted the ER-association of GFP-Sec61β

mRNA in COS7 cells, as assessed by digitonin extraction (Figure 5.4A-B). HHT-treatment only

slightly decreased the ER-localization of this mRNA in U2OS cells (Figure 5.4C-D). To control

for differences in mRNA expression and staining efficiency, we also measured the nuclear

fluorescence, and this did not change under any of the tested conditions (Figure 5.4B-C). The

localization of GFP-Sec61β mRNA to the ER in HHT-treated U2OS cells was confirmed by

colocalization of the mRNA with the ER-marker Trapα (Figure 5.4E).

From these experiments we concluded that the ORF of Sec61β mRNA can promote ER-

association and that this activity is largely independent of ribosome-association and active

translation.

104

Figure 5.4. ER-association of overexpressed GFP-Sec61β mRNA is partially independent of

translation.

(A-B) COS7 and U2OS (C-D) cells were transfected with plasmid encoding GFP-Sec61β and

allowed to express mRNA for 18-24 hrs. Cells were then treated with DMSO (“Ctrl”),

puromycin (“Puro”) or homoharringtonin (“HHT”) for 30 min, and then extracted with digitonin

with or without EDTA. Cells were then fixed, stained for mRNAs using a specific FISH probe

against the GFP-coding sequence. Cells were imaged (A,D), and the fluorescent intensities were

quantified (B,C). To control for changes in staining, nuclear fluorescent intensities were also

analyzed. Each bar represents the average and standard error of 3 independent experiments, with

each experiment consisting of at least 30 cells. (E) U2OS cells expressing GFP-Sec61β were

treated with HHT and then digitonin-extracted. Cells were then stained for the GFP-Sec61β

mRNA, and immunostained with the ER marker Trapα. Images in (E) are from a single field of

view including a color overlay showing the GFP-Sec61β mRNA in red and Trapα in green. All

scale bars = 20µm.

105

5.4 mRNAs encoding other exogenously expressed TA-proteins are mainly

localized to the cytoplasm

To determine whether the results obtained with GFP-Sec61β mRNA can be generalized

to other mRNAs encoding TA-proteins, we examined the localization of other overexpressed

GFP-fusion transcripts. In particular we analyzed the distribution of mRNAs containing ORFs

that encode TA-proteins destined to the ER (Sec22β and Sec61γ), peroxisome (Pex26) or

mitochondria (FIS1). Previously, it has been shown that newly synthesized Pex26 protein is

targeted to the peroxisome via Pex19 and thus is independent of the TRC40 dependent pathway

(121). For TA-proteins destined for the mitochondria, they are thought to be recognized by a pre-

targeting complex which then prevents their sorting to the ER and instead diverts these to the

mitochondrial outer membrane (98). This sorting process is thought to be dictated by the relative

hydrophobicity of the TMD and the presence of charged residues in the vicinity of the TMD

(98,119,205).

As expected, GFP-Sec22β and GFP-Sec61γ proteins were targeted to the ER in COS7

cells (data not shown). Likewise, GFP-FIS1 and GFP-Pex26 proteins were targeted, as expected,

to the mitochondria (Figure 5.5) and peroxisomes (data not shown) respectively. However,

unlike GFP-Sec61β, all of the other tested mRNAs were efficiently removed by digitonin-

extraction (Figure 5.6A, compare “Cyto/ER” levels in unextracted to extracted cells), similar to

what was seen for mRNAs encoding non-secretory proteins (H1B-GFP; Figure 5.6A).

We next explored the idea of whether the targeting of a mitochondrial TA-protein to the

ER would also increase the amount of ER-targeting of its mRNA. When we increased the

hydrophobicity of the TMD of FIS1 (FIS1-5L, Figure 5.5B), the protein was successfully

rerouted to the ER (Figure 5.5A). However, the mRNA of GFP-FIS1-5L was still sensitive to

extraction and did not localize to the ER (Figure 5.6A).

From these experiments we concluded that ER-targeting of the protein product is not

sufficient for the ER-localization of an mRNA.

106

Figure 5.5. Incorporation of leucines in the TMD of FIS1 reroutes the protein from the

mitochondria to the ER.

(A) COS7 cells were transfected with plasmid encoding GFP-FIS1 or GFP-FIS1-5L, which

contains 5 leucine mutations (see the sequence in panel B). Cells were either directly fixed

(“unextracted’) or first extracted with digitonin then fixed. The fixed cells were stained with

DAPI and immuostained for either ATP5A (a mitochondrial marker), or Trapα (an ER marker).

Each row represents a single field of view including overlays of GFP-FIS1/FIS1-5L (green),

ATP5A/Trap (red) and DAPI (blue) Scale bar = 20m.

107

Figure 5.6. The coding potential of GFP-Sec61β is not required for its localization to the

ER.

(A) COS7 cells were transfected with plasmid encoding various GFP tagged TA-proteins and

allowed to express for 18-24 hrs. The cells were treated with control medium or HHT for 30 min,

then either directly fixed or extracted with digitonin and then fixed. Cells were stained for

mRNAs using specific FISH probe against the GFP coding sequence, imaged and quantified.

Fluorescent intensities in the cytoplasm and nucleus were quantified. All results were normalized

to the cytoplasmic staining intensity in the unextracted cells. Each bar represents the average and

standard error of 3 independent experiments, each consisting of at least 30 cells. (B)

Hydrophobicity (y-axis, left) of the polypeptides encoded by GFP-Sec61β and GFP-fs-Sec61β

was plotted against the peptide length (x-axis, bottom). Kyte-Doolittle Hydropathy values were

computed with ProtScale (http://web.expasy.org/protscale/), using a moving window size of 21

amino acids. Note the high hydrophobicity of the TMD region of GFP-Sec61β that is lost in

GFP-fs-Sec61β. (C) COS7 cells were transfected with plasmid encoding GFP-fs-Sec61β and

allowed to express mRNA for 18-24 hrs. Cells were then treated with control medium or HHT

for 30 min, and then either fixed (“Unextracted”) or extracted with digitonin and then fixed

(“Extracted’). Cells were stained for mRNAs using a specific FISH probe against the GFP-

coding sequence, and for DNA using DAPI. Each row represents a single field of view imaged

for GFP-fs-Sec61β mRNA, GFP protein and DAPI. (D) Quantification of the cytoplasmic (in

unextracted cells), ER (in extracted cells) and nuclear fluorescence intensities of GFP-fs-Sec61β

mRNA. Each bar represents the average and standard error of 30 cells. All scale bars = 20µm.

http://web.expasy.org/protscale/

108

5.5 The encoded TMD is not strictly required for the ER-localization of GFP-

Sec61β mRNA

Although ER-targeting of the protein product did not correlate with ER-association of the

mRNA, it was still possible that Sec61β mRNA localization was dependent on its encoded trans-

membrane domain (TMD). To further examine this possibility, we frame shifted the TMD of

Sec61β by inserting a single Cytosine before the TMD coding region (to create GFP-fs-Sec61β).

This mutation eliminated the hydrophobic region at the C-terminus of the coding protein (Figure

4B). Only a few COS7 cells that expressed the GFP-Sec61β mRNA showed GFP-protein

expression (for example, see Figure 5.6B first row). When it was present, GFP-fs-Sec61β was

found in small aggregates that concentrated in the nucleus (see GFP protein localization in

Figure 4B). Consistent with the idea that the translation of the mRNA was not required for ER-

localization, a substantial fraction of GFP-fs-Sec61 mRNA was anchored to the ER (Figure

5.6C). When we quantified the amount of mRNA before and after extraction, we found that the

amount of ER-association in COS7 cells was about 30% (Figure 5.4D), about half of what we

observed for GFP-Sec61 mRNA (see Figure 5.3F). This level of ER-association was not

affected by HHT-treatment (Figure 5.6D), further confirming that this localization activity

occurred independently of ribosomes and translation.

From these results we conclude that the ER-localization of the encoded protein was not

required for the localization of GFP-Sec61β mRNA. However since the targeting of the frame

shifted mutant was clearly decreased from what we had seen with GFP-Sec61β mRNA, it is

likely that translation of this mRNA into an ER-targeted protein may enhance mRNA

localization.

5.6 The initial targeting of GFP-Sec61β mRNAs to the ER is partially

independent of translation and ribosomes

Although our data indicated that most ER-targeted GFP-Sec61β mRNA could be

maintained on the ER independently of translation and ribosomes, we wanted to investigate

whether these processes were required for the initial targeting of this mRNA to the membrane.

This could potentially explain why more of the GFP-Sec61β mRNA was ER-associated in

comparison to GFP-fs-Sec61β mRNA. To test this, we microinjected plasmid encoding GFP-

Sec61β into the nuclei of U2OS cells that were pretreated with either control or the translation

inhibitor HHT, and examined the targeting of the newly synthesized transcript. As these mRNAs

109

would have never encountered a ribosome, their initial targeting would be strictly mediated by

RNA-localization pathways. In unextracted cells, mRNAs were efficiently exported out of the

nucleus (Figure 5.7A). As expected, GFP-Sec61β protein was only made in the control and not

the HHT-treated cells, indicating that the translation inhibitor efficiently blocked protein

synthesis (Figure 5.7A). In extracted cells, GFP-Sec61β mRNA was still observed on the ER

(Figure 5.7A), and by comparing the difference between FISH intensity in unextracted and

extracted cells we estimate that ~70% of the cytosolic mRNA is ER-targeted. After HHT-

treatment, ER-targeting of the Sec61β mRNAs decreased by two thirds (Figure 5.7A-B). It is

possible that this number underestimates the level of ER-targeting, as in the absence of

ribosome-association, newly synthesized mRNAs may be more efficiently degraded.

In conclusion, these results suggest that although the initial targeting of Sec61β mRNA

can occur to a certain extent in the absence of translation, it is clearly enhanced in the presence of

translating ribosomes.

110

5.7 p180 is not required for the localization of either GFP-Sec61β mRNA or its

encoded protein

We previously identified p180 as an mRNA receptor that promoted the ER-anchoring of

several mRNAs to the ER in a ribosome- and translationally-independent manner (190), and we

next tested whether it was required for the localization of GFP-Sec61β mRNA. p180 was

depleted from U2OS cells using two separate lentiviral delivered shRNAs (B9 and B10, Figure

5.8A). As a positive control we tested the ER-localization of the ALPP mRNA. This transcript,

Figure 5.7. The initial targeting

of Sec61β mRNA to the ER is

partially dependent on ribosomes

and translation.

U2OS cells were pretreated with

control medium (“Ctrl”) or HHT

for 15 min, then microinjected with

plasmids containing GFP-Sec61β

and allowed to express mRNAs for

2 hrs in the presence of medium

with or without HHT. The cells

were then extracted with digitonin,

fixed and stained with FISH probe

against the GFP coding sequence,

and imaged. (A) Representative

samples, with each row

representing a single field of view

imaged for GFP-Sec61β mRNA

(“mRNA”) and GFP fluorescence

(“GFP”). (B) Quantification of the

fluorescence intensities of mRNAs

in the ER and nucleus of extracted

cells. Each bar represents the

average and standard error of 3

independent experiments, each

experiment consisting of at least 30

cells. Scale bar = 20µm.

111

which encodes a GPI-anchored protein, can be targeted and maintained on the surface of the ER

by the action of p180 (190,203). Indeed, depletion of p180 with either shRNA constructs

decreased the ER-association of ALPP mRNA in both control and HHT-treated cells (Figure

5.8B), as we had previously published. In contrast, depletion of p180 did not consistently

decrease the amount of GFP-Sec61β mRNA on the ER (Figure 5.8C). p180-depletion did not

affect ER-localization (Figure 5.8D), or the overall levels (Figure 6E) of GFP-Sec61β protein.

When various cell fractions were assayed, GFP-Sec61β protein was present in the ER (Figure

5.8F), which was consistent with localization data (Figure 5.8D). When we measured the number

of individual endogenous Sec61β mRNA foci (as in Figure 1) we observed that p180-depletion

did not have a significant impact on the percent of ER-associated mRNAs (Figure 5.8G).

From these observations we concluded that p180 is dispensable for the ER-association of

GFP-Sec61β mRNA and protein. It formally remains possible that p180 may still play a role, but

that other compensatory pathways exist for the ER-localization of this mRNA.

112

Figure 5.8. p180, TRC40 and BAT3 are not required for the ER association of Sec61β

mRNA and protein.

(A-C) U2OS cells were infected with lentivirus carrying control shRNA (“Lenti”), shRNAs

against p180 (clones B9 or B10), TRC40 (clones A or B), or BAT3 (clone E). The control and

shRNA infected cells were transfected with plasmids containing either the ALPP or GFP-Sec61β

constructs and allowed to express these mRNAs for 18-24 hrs. Cells were then treated with either

control medium or HHT for 30 min, digitonin-extracted, fixed and stained with specific FISH

probes, and imaged. (A) Cell lysate was collected on the day of transfection, separated by SDS-

PAGE and immunoblotted against p180, TRC40, BAT3 and tubulin. (B-C) Quantification of the

fluorescence intensities of ALPP (B) and GFP-Sec61β (C) mRNAs, in the ER and nucleus. The

results were normalized to the ER staining intensity of cells infected with control shRNA and

treated with control medium. Each bar represents the average and standard error of 3 to 4

independent experiments, each experiment consisting of at least 30 cells. * p<0.05 (D) shRNA-

infected U2OS cells were transfected with plasmids containing GFP-Sec61β and allowed to

express mRNAs for 18-24 hrs. The cells were then treated with or HHT for 30 min. Cells were

digitonin-extracted, fixed and stained for GFP-Sec61β mRNA using FISH probe against GFP

coding region. Each column represents a single field of cells imaged for GFP protein and GFP

mRNA. (E-F) shRNA-infected U2OS cells were transfected with plasmids containing GFP-

Sec61β and allowed to express mRNAs for 18-24 hrs. Cells were either lysed directly (E) or

fractionated into cytosolic (“Cyto”) and ER fractions (F). The total lysate (E) and fractionated

samples (F) were analyzed by immunoblot using antibody against GFP (GFP-

113

Sec61βSec61βendogenous Sec61βTrap (an ER marker) and GAPDH (a cytosolic marker).

Depletion of p180 or TRC40 either alone or together did not affect the levels or ER-localization

of GFP-Sec6 or endogenous Sec6 protein. (G) shRNA-infected U2OS cells that were either

digitonin-extracted, or directly fixed were stained with a pool of FISH probes to visualize

individual endogenous human Sec61β mRNAs. The percentage of cytoplasmic foci remaining in

digitonin-extracted versus unextracted cells were calculated. Each bar represents the average and

relative error of 30 cell unextracted versus extracted cells. Scale bar = 20µm.

5.8 TRC40 and BAT3 are not required for the localization of either GFP-

Sec61β mRNA or its encoded protein to the ER.

As the initial ER-targeting of GFP-Sec61β mRNA was partially dependent on translation

(Figure 5.7A-B) and that GFP-fs-Sec61β mRNA was not as efficiently localized to the ER as

GFP-Sec61β, it was possible that mRNA localization may be partially coupled to the proper

targeting of the encoded protein. In light of this, we assessed whether components of the TRC

pathway were required for GFP-Sec61β mRNA localization to the ER.

TRC40 and BAT3 were depleted in U2OS cells by lentiviral delivered shRNAs (Figure

5.8A), but to our surprise these treatments did not significantly interfere with the ER localization

of the GFP-Sec61β protein (for TRC40-depleted cells see Figure 5.8D; for BAT3-depleted cells

the data is not shown). Depletion of TRC40 seem to have some effect on the amount of ER-

localization of GFP-Sec61β mRNA; however, this varied greatly between experiments (Figure

5.8C). TRC40-depletion did not affect GFP-Sec61β protein levels (Figure 5.8E) or the

mislocalization of the protein to mitochondria (Figure 5.8D) or the cytosol (5.8F). Even when

both p180 and TRC40 were co-depleted, levels of GFP-Sec61β protein remained constant

relative to the loading control (Figure 5.8E).

Depletion of TRC40 did not have a significant impact of the amount of endogenous

Sec61β mRNA that was associated to the ER (Figure 5.8G).

Unexpectedly, depletion of TRC40 affected ER-localization of ALPP mRNA in the HHT

treated cells (Figure 6B). Interestingly, it had been previously shown that the S. cerevisiae

ortholog of TRC40, Get3, was required for the ER-targeting of GPI-anchored proteins in SRP-

disrupted yeast cells. Our new results suggest that cells depleted of TRC40 may have defects in

the localization of certain mRNAs, and this may explain these previous results.

Depletion of BAT3 had no effect on the ER-localization of GFP-Sec61β and ALPP

mRNA (Figure 5.8B-C).

114

To confirm the observation that the ER localization of GFP-Sec61β mRNA and its

encoded protein are mostly independent of the TRC pathway, we repeated these experiments in

BAT3 knockout mouse embryonic fibroblasts (MEFs; Figure 5.9A). In unextracted cells,

exogenously expressed GFP-Sec61β protein clearly colocalized with the ER marker Trapα

(Figure 5.9B, see high magnification of the boxed area in 5.9C), indicating that BAT3 was not

required for the ER-targeting of this protein. In extracted cells, both the Sec61β mRNA and

protein co-localized with Trap (Figure 5.9D, high magnification of Sec61β mRNA and Trap

in the boxed area are shown in 5.9E).

Figure 5.9. BAT3 is not required for the ER association of Sec61β mRNA and protein.

(A) Western blot of BAT3 protein in control and BAT3-/-

MEFs. (B-C) BAT3-/-

MEFs expressing

GFP-Sec61β for 18-24hrs were fixed and immunostained for the ER-marker Trap. Images in (B)

are from a single field of view including a color overlay showing the GFP-Sec61β mRNA in

green and Trapα in red. Higher magnification images of the boxed area in (B) are shown in (C).

(D-E) BAT3-/-

MEFs expressing GFP-Sec61β for 18-24hrs were extracted and stained for the

115

GFP mRNA by FISH and immunostained for the ER-marker Trapα. (D) A single field of view

showing GFP mRNA, GFP protein, Trap and an overlay of the GFP mRNA (red) and Trap

(green). Higher magnification images of the boxed area are shown in (E) with an overlay of

GFP-Sec61β mRNA (red), GFP-Sec61β protein (green) and Trap (blue). (F) BAT3-/-

MEFs

were either directly fixed (“Unextracted”), first extracted with digitonin and then fixed

(“Extracted”), or pre-treated with Homoharringtonine (HHT) for 30 min, extracted with digitonin

and then fixed (“HHT”). Cells were stained with a pool of FISH probes to visualize individual

endogenous mouse Sec61β mRNA molecules. (G) The number of cytoplasmic (i.e., non-nuclear)

foci were determined for each condition in control MEFs and BAT3-/-

cells. Each bar is the

average and standard error of 30 cells. All scale bars = 20µm.

We then investigated whether the endogenous Sec61β mRNA was ER-associated. As we

had seen previously with U2OS cells, a sizeable number of Sec61β mRNA foci were resistant to

digitonin-extraction in both BAT3-/-

cells and wildtype MEFs (about 50%, Figure 5.9F-G). The

number of foci decreased after ribosomes were disrupted with either HHT or puromycin/EDTA

treatments, but were still substantial.

From these results we conclude that the ER-targeting of GFP-Sec61β mRNA and its

encoded protein was largely independent of the TRC pathway components TRC40 and BAT3.

Although it remains possible that the small amount of TRC40 left after depletion may be

sufficient for the correct targeting of mRNA and/or protein, the fact that these processes are

unaltered in BAT3-/-

cells suggests that this last component is dispensable. Although TRC

pathway components may promote mRNA and protein targeting to the ER, our data suggests that

other parallel pathways should exist. The presence of these alternative pathways for TA-protein

insertion, beyond the TRC pathway, would explain how BAT3 knockout cells are able to survive,

despite the fact that certain TA-proteins, such as Sec61γ, are required for cell viability.

5.9 GFP-Sec61β mRNA competes with other mRNAs for ribosome binding

sites on the ER

In order to understand how different mRNAs associate with the ER and whether they

share similar binding sites, we investigated whether two mRNAs would compete with each other

(i.e. whether an increase in the levels of one would displace the other from the ER).

We co-expressed GFP-Sec61β with two different mRNAs, t-ftz and ALPP. The first

mRNA requires translation for both its targeting and maintenance on the surface of the ER (190);

thus we presume that it is anchored to the ER by virtue of the fact that it is being translated by

116

translocon-bound ribosomes. As mentioned above we previously demonstrated that >50% of

ALPP mRNA is associated to the ER in a translation dependent manner and that the remaining

fraction is largely dependent on p180 (190).

Interestingly, cells expressing GFP-Sec61β, had a significant decrease in the amount of t-

ftz mRNA on the ER in comparison to cells either expressing t-ftz alone or in combination with a

control gene (H1B-GFP) (Figure 5.10A-B). In most cases, no t-ftz mRNA could be detected on

the ER (for an example, see the cell denoted by an arrow in Figure 5.10A, Panel e). In agreement

with our previous published results (190), t-ftz mRNAs were also displaced from the ER by

HHT-treatment (Figure 5.10A-B), further underscoring the fact that this mRNA requires active

translation for ER-association. Note that nuclear levels of t-ftz remained largely unaltered by

GFP-Sec61 expression (see quantification in Figure 5.10B).

117

Figure 5.10. GFP-Sec61β mRNA competes with t-ftz mRNA for the ribosome binding sites

on the ER.

(A-B) COS7 cells were transfected with plasmid containing a test gene (t-ftz or ALPP) alone or

in combination with plasmid containing a competitor gene (GFP-Sec61β or H1B-GFP). The cells

were then treated with either control medium (“Ctrl”) or HHT for 30 min, then digitonin-

extracted, fixed and stained with specific FISH probes, and imaged. (A) Representative images

of COS7 cells expressing t-ftz mRNA alone (a-c) or in combination with GFP-Sec61β (d-i) or

H1B-GFP (j-o). Panels (a-c) are stained for t-ftz mRNA, while each pair of panels in (d-o)

represents a single field of view imaged for t-ftz mRNA and GFP fluorescence. (B)

Quantification of the ER and nuclear staining intensity of either t-ftz mRNA or ALPP mRNA in

transfected cells. All data were normalized to the ER staining intensities in the control treated

group for each construct. Each bar represents the average and standard error of 3 independent

experiments, each consisting of at least 30 cells. (C) COS7 cells were transfected with t-ftz alone

or in combination of GFP-fs-Sec61β. 18-24 hrs post transfection, cells were digitonin extracted

to remove cytoplasmic contents. GFP-fs-Sec61β mRNAs were stained with FISH probe against

the GFP-coding sequence and visualized. (D) Cell lysate of COS7 cells cotransfected with t-ftz

in combination with either H1B-GFP or GFP-fs-Sec61β were analyzed by Western Blot. t-ftz

protein expression was examined using HA antibody against an HA epitope present in the t-ftz

protein and antibodies against Tubulin to control for loading. Scale bar = 20µm.

118

When GFP-Sec61β was co-expressed with ALPP, we again observed a decrease in the

amount of ALPP mRNA on the ER in comparison to cells expressing ALPP alone (Figure 5.10B).

However unlike t-ftz, the amount of ER-associated ALPP dropped by only 60%. When the co-

expressing cells were treated with HHT, the level of ALPP mRNA on the ER did not decrease

further (Figure 5.10B), suggesting the decrease was mainly due to competition between GFP-

Sec61β and ALPP for translocon-associated ribosomes.

Thus it is clear that the expression of GFP-Sec61β disrupts the ER-localization of other

mRNAs. The displacement of t-ftz by GFP-Sec61β suggests that both of these mRNAs occupy

the same ER-attachment site, namely translocon bound-ribosomes. It is however possible that

expression of GFP-Sec61β may have promoted some other indirect effects that ultimately results

in a reduction of mRNA-ER association.

We next tested whether expression of GFP-fs-Sec61 would also displace t-ftz. Since

many of the cells expressing GFP-fs-Sec61 mRNA could not be identified as few cells express

visible levels of protein (for example see Figure 5.6C), we could not readily identify co-

expressing proteins. However, we observed that very few of the cells contained detectable levels

of t-ftz in the cytosol after extraction, whether they expressed GFP-fs-Sec61 protein or not

(Figure 5.10C). If GFP-fs-Sec61 mRNA was displacing t-ftz off of the ER, we would also

expect that the level of t-ftz protein should decrease in the co-transfected cells. To test this we

co-expressed t-ftz with either GFP-fs-Sec61or H1B-GFP, to control for non-specific

competition of translation factors by an over-expressed protein. We found that expression of

GFP-fs-Sec61b completely disrupted the production of t-ftz protein (Figure 5.10D).

From these results we conclude that overexpressed GFP-Sec61β disrupts the ER-

localization of other mRNAs and likely perturbs their translation into secretory proteins.

5.10 Discussion

In this chapter we provide evidence that at least one mRNA that encodes a TA-protein is

efficiently targeted and then maintained on the surface of the ER. Although our data suggests

that this process does not strictly require active translation and/or ribosomes, it appears that these

processes may contribute to the mRNA’s proper localization. Our results also suggest that

119

multiple pathways exist to target TA-anchored proteins to the ER in addition to the TRC pathway.

This includes a pathway that helps to target mRNAs, such as Sec61, to the surface of the ER.

The encoded protein may then either be spontaneously inserted into the membrane or use some

protein conducting channel. In addition it is likely that other critical TA-anchored proteins, such

as Sec61γ, whose mRNA does not appear to be ER-associated (at least through overexpression),

must be able to be correctly inserted into the ER independently of BAT3, as BAT3-/-

cells are

viable.

Our data also suggests that once the GFP-Sec61β mRNA is at the ER, it may be able to

access translocon-bound ribosomes. This finding raises the possibility that the encoded protein of

GFP-Sec61β mRNA may use translocons for membrane insertion in vivo. Although it has been

shown that many TA-proteins do not require translocon activity for membrane-insertion in vivo

(207), it is unknown whether this is the case for Sec61β. Interestingly, this protein does not

require translocons, but does require the TRC pathway, for its insertion into membranes using in

vitro reconstituted systems (76,78). This contrasts sharply with the in vivo situation in which

deletion of GET/TRC components is compatible with cellular viability in both yeast (208) and

mammalian tissue culture cells (107) despite the fact that many protein substrates that are

thought to use this pathway are essential. Intriguingly, newly synthesized Sec61β and other TA-

proteins can interact with SRP and translocon components in vitro (108,209); thus although TA-

proteins do not require these components for in vitro membrane insertion, they nevertheless

exhibit the ability to interact with this machinery. It should also be pointed out that certain TA-

proteins, such as cytochrome B5, can spontaneously insert into membranes (110,210), and it is

possible that localization of the mRNA to the membrane may facilitate this activity.

Our final finding that the expression of GFP-Sec61β displaces other mRNAs off of the

ER has one major caveat. Although we have interpreted this observation as being due to the

action of the GFP-Sec61β mRNA, we cannot totally rule out the possibility that this is due to the

expression of the GFP-Sec61β protein. In particular, it is possible that this protein may be

incorporated into native translocons, which are composed of α, β and γ Sec61 subunits. These

altered translocons would have an additional GFP on their cytosolic face, which would likely

prevent the binding of ribosomes and thus impede all translation/ribosome-dependent anchoring

of mRNAs to the ER. We however believe that this is unlikely for several reasons. First, GFP-

Sec61β diffuses in the membrane of the ER at a rate compatible with that of membrane-tethered

GFP and not of a large complex such as the translocon (211) (for diffusion measurements of

120

translocons see (212)). Second, translocon disruption is extremely toxic to mammalian tissue

culture cells (207), while the expression of GFP-Sec61β has little to no effect on cell viability.

Third, translocons are typically distributed to the perinuclear sheets of the ER and are excluded

from both the nuclear envelope and the peripheral tubes (18,38,156), while in contrast, GFP-

Sec61β is distributed to the all three regions (nuclear envelope, sheets and tubes) and does not

show a preference for the sheets even when expressed at very low levels (211)(X. Cui and A.

Palazzo, unpublished observations). It is possible that a minority of translocons incorporate GFP-

Sec61β; however this would not explain why the majority of ER-bound t-ftz mRNA would be

prevented from accessing translocon-bound ribosomes. Finally, direct perturbation of translocons

would not explain why the expression of GFP-fs-Sec61β mRNA, which does not encode an ER-

targeted protein, also displaces t-ftz mRNA from the ER (Figure 5.10C).

Finally it is interesting to note that Sec61β is required for efficient secretion and is an

integral part of the endomembrane system. Work from the Nicchitta lab has found that mRNAs

that encode endomembrane system components have an enhanced affinity for the ER in a

translation independent manner (166). Additionally, the association between Sec61β mRNA with

translocon-bound ribosome may provide an opportunity for feedback regulation. In this way,

translocon availability could potentially be linked to the translation of the Sec61β mRNA in

order to regulate the production of new translocons and boost secretory capacity.

121

Chapter 6

Summary & Conclusion

Part of this chapter is adapted from a review originally published as:

Cui, X. A. & Palazzo, A. F. Localization of mRNAs to the endoplasmic

reticulum. Wiley interdisciplinary reviews. RNA 5,481–92 (2014).

122

6.1 Translation Independent Localization of mRNAs on the ER Mediated in

part by p180

In this thesis, a visualization-based method was used to investigate whether mRNA

encoding secretory proteins can be targeted and maintained on the ER independently of

ribosomes. We first established that a substantial fraction of mRNAs encoding membrane and

secreted proteins can be targeted and later maintained on the ER using a translation independent

mechanism (Chapter 3). This is in agreement with previously published studies using

fractionation and sequencing based techniques (71,90,166). This translation independent mRNA-

ER association works together with the SRP mediated pathway to ensure mRNAs encoding

secretory proteins are anchored on the ER for translation and further processing, such as ER

chaperone assisted folding, glycosylation and disulfide bond formation.

However, this translation-independent pathway does not appear to be a universal

mechanism. For example, while ALPP and CALR mRNAs, which encode secreted and

membrane-bound proteins, do not strictly require translation for their localization, the INSL3 and

cytochrome p450 (CYP 8B1) do require translation for ER-association. Such selectivity suggests

that this ribosome-independent mRNA localization requires certain features within the transcript

that are presumably recognized by an mRNA receptor.

To identify candidate mRNA receptors, our group isolated and identified ER mRNA

associated proteins (ERMAPs) by mass spectrometry (Figure 3.9, Table 3.1 and Table 3.2).

Among the proteins we identified are six that contained TMDs and could thus physically link

mRNAs to the ER membrane. Furthermore, three of these proteins, p180, kinectin and CLIMP63,

were the most abundant proteins in the ERMAP fraction. p180 is a highly expressed ER-resident

protein that is present in most metazoans. It contains a short luminal N-terminal domain, a single

TMD and a large cytoplasmic C-terminal region with an unusual sequence composition (Figure

6.1). After the TMD, there is a lysine rich region of 87 amino acids that contains 23 positive

residues. This region can interact with RNA in vitro (Figure 3.14), likely by forming ionic

interactions with the phosphate backbone. This is followed by a ten amino acid peptide, with a

consensus sequence of NQGKKAEGAQ (thus bearing a net charge of +1 per repeat), which is

repeated 54 times in tandem. This repeat region, which contains an additional pool of positive

charges could also potentially bind to the negatively charged phosphate backbone and thereby

anchor mRNAs onto the ER. These two positively charged regions are followed by a long coiled-

coil domain at the N-terminus.

123

Figure 6.1 Schematic of p180 and kinectin.

Both kinectin and p180 contain a short N-terminal luminal domain, followed by a single

transmembrane domain and a large cytosolic C-terminal region. For p180 the cytosolic domain is

comprised of a highly positively charged lysine-rich region, a 10-amino acid (decapeptide)

sequence that is repeated 54 times in tandem, and a coiled-coil domain. Kinectin shares a low

degree of similarity to p180 throughout its length; however, it lacks the decapeptide repeats.

Overexpression of p180 enhances mRNA association with the ER, regardless of whether

ribosomes remain assembled or are disassembled, whereas its depletion inhibits the ER-

association of ALPP and CALR mRNAs, both in the presence and absence of ribosomes (Figure

3.10). Thus p180 likely acts as an mRNA receptor (Figure 6.2). Interestingly, overexpression of a

version of p180 that lacks both the lysine-rich region and the decapeptide repeats enhances ER-

association of mRNA only in the presence of ribosomes (Figure 3.10), supporting the notion that

the coiled-coil domain may promote the membrane-association of polysomes. Indeed, p180 was

originally identified as the ribosome receptor on the ER (176). However this result was heavily

criticized as ribosome binding-activity in the ER largely co-fractionated with Sec61 translocon

and not p180 (57,177,178). Nonetheless, more recent work has demonstrated that the coiled-coil

domain directly binds to ribosomes in vitro (183), supporting our observations. Thus p180 may

act both as an mRNA receptor and a ribosome binding protein, but that each of these activities is

restricted to separate domains (Figure 6.2). Overall, p180 may function to promote secretory

function, and this is supported by the observation that depletion of p180 impairs secretion in a

124

variety of cell types (179,180). Interestingly, p180 is highly susceptible to being cleaved after

cell lysis (X. Cui and A. Palazzo, unpublished observations), and this may explain the conflicting

reports from early studies investigating the interaction of mRNA with microsomes (See Chapter

1).

Figure 6.2 Translation-independent mRNA localization to the ER via p180.

Recent studies including data presented in this thesis have shown that mRNAs can be targeted to

the ER by p180 in the absence of translation. While details of this targeting pathway are still

being elucidated, it is clear that this activity differs between various mRNA species. As p180 is

unlikely to provide any specificity, features that distinguish targeting mRNAs from non-targeting

mRNAs are likely due to an unidentified cytosolic RNA binding protein ‘X’. These mRNAs are

then maintained on the ER by p180 nonspecifically and can gain access to ER-bound ribosomes.

Several studies suggest that p180 interacts directly with ribosomes and indirectly with

translocons, and thus may facilitate the general synthesis of membrane-bound and secretory

proteins.

A second mRNA-receptor candidate that we have yet to rule out is kinectin. This protein

resembles p180 in its overall domain structure and contains a lysine-rich domain resembling the

identified RNA-binding region in p180 (Figure 6.1). Both p180 and kinectin are rich in N/Q

residues, suggesting that they may adopt amyloid like folds. Kinectin was originally

characterized as a kinesin-binding protein (213), although the significance of this finding remains

unclear, as other kinesin-receptors for the ER were subsequently identified (214). Its role in the

anchoring of mRNA to the ER is also uncertain. Kinectin overexpression only moderately

increases the non-specific mRNA localization to the ER (Figure 3.12) and kinectin-depletion did

not have any significant impact on ER-association of mRNA (Figure 3.15). Interestingly,

125

kinectin can bind to RhoA and RhoG (215,216), raising the possibility that its putative function

as an mRNA-receptor may be subjected to small G-protein regulation. The ability of kinectin to

mediate mRNA-ER association in the presence of active and/or inactive G-proteins should be

examined in the future.

Both kinectin and p180 are enriched in the peri-nuclear sheets of the ER where translocon

components are found (156). In addition, a third membrane-bound protein identified in the

ERMAP, CLIMP63, also partitions to peri-nuclear sheets. All three proteins appear to interact

with translocon components (183,193) suggesting that these three proteins may all function

synergistically with the translocation machinery to promote the synthesis of secretory and

membrane-bound proteins. For reasons that we do not understand, p180, kinectin, CLIMP63 and

translocon-associated proteins are depleted from the nuclear envelope (156). Even more

mysteriously, these proteins diffuse into the nuclear envelope after polysomes are disassembled

(156). In contrast, ribosomes are present on the nuclear envelope under normal conditions. It is

possible that these ribosomes are translating proteins that are not targeted for the secretory

pathway, and this may be facilitated by the segregation of translocons and p180 away from this

membrane. Another activity that links p180, kinectin and CLIMP63 is their affinity for

microtubules. As mentioned above, kinectin binds to the microtubule motor kinesin, while p180

and CLIMP63 appear to interact directly with microtubules (217,218). Again the significance of

this link to the cytoskeleton is not understood.

Future studies should further investigate whether kinectin and CLIMP63 are involved in

the anchoring of mRNA transcripts on the ER. Given that these proteins were found in the same

area on the ER, perhaps they are functionally linked. Although initial knockdown experiments of

these proteins did not provide conclusive evidence to their involvement in anchoring transcripts

on the ER, future studies should be performed with double or triple knockdowns of these

proteins in different combinations. Furthermore, in various polarized systems, the ER has been

shown to act as a scaffold for the localization of asymmetrically distributed mRNAs (19-

22,85,86). Because p180, kinectin and CLIMP63 are enriched in the peri-nuclear sheets, it is

possible that they are also involved in further spatial segregation of transcripts on the ER. This

can be examined by identifying transcripts associated with p180 using deep sequencing analysis

and examining the endogenous localization of these transcripts in the cell in the presence and

absence of translation inhibitors. This will firstly, identify at an endogenous level, whether these

transcripts are associated with the ER membrane in the absence of translation as we have

126

observed with Nesprin2 and Sec61β mRNAs. Secondly, this will also provide clues whether

these transcripts are preferentially enriched in a particular region on the ER.

Although p180 (and perhaps kinectin) acts as a putative mRNA receptor, its non-specific

ionic mode of interaction with RNA does not explain the selectivity of different transcripts for

binding to the ER. Thus, it is possible that p180 may act in conjunction with more classical

RNA-binding proteins to select these mRNAs for ER-association (Figure 6.2). Some candidates

were identified in our mass spectrometry analysis of ERMAPs. These include Staufen proteins,

which have been shown to associate with the ER (219,220), and tudor/SND1, whose homolog in

rice is responsible for transporting certain mRNAs to specialized ER sub-compartments (187).

Future studies should investigate protein factors that provide the specificity to this targeting

mechanism. There are two possible approaches to this: 1) screen proteins we identified in our

ERMAPs (Figure 3.9 and Table 3.1), especially Staufen and tudor/SNDs via lentiviral mediated

shRNA knockdown; or 2) perform RNA-protein pulldown assays with RNA elements that

promote translation-independent ER localization, which we have recently identified to be the

TMCR in our model transcript ALPP, to identify proteins associated with this RNA motif.

6.2 The TMCR of ALPP Contains the ER-Targeting RNA Element

We have identified some of the RNA features that dictate whether a particular transcript

can access the translation-independent ER-targeting pathway. By dissecting the ALPP mRNA,

we determined that this activity maps to the ORF and coincides with the TMCR (Chapter 4).

This mRNA-targeting activity was maintained even when the region was frame-shifted so that it

did not code for hydrophobic amino acids. Interestingly, a recent transcriptome-wide analysis of

subcellular RNA partitioning in human cells demonstrated that mRNAs encoding membrane-

bound proteins predominantly associate with the ER membrane using the ribosome-independent

mechanism, whereas mRNAs encoding secretory cargos preferentially utilize the ribosome-

dependent mechanism (166). Remarkably, studies in Escherichia coli demonstrated that the Bgl

polycistronic mRNA, encoding secreted and membrane proteins, is also targeted to the plasma

membrane in a translation-independent manner via a region that codes for TMDs (149). Together,

these results suggest in both mammalian and E. coli mRNAs the propensity of a region of the

ORF to encode a TMD also endows it with the ability to act as an RNA element that promotes

membrane-association of the mRNA.

127

To understand why TMCRs have this dual property, it is useful to take a closer look at

their characteristics. TMDs consist of long stretches of hydrophobic amino acids, whose codons

tend to have certain inherent biases. One well-documented bias is that these codons tend to have

uracils at their second nucleotide position (154). Indeed, uracil content in the ORF is a good

predictor of hydrophobicity (150). Unfortunately uracil-content per se is not a good predictor of

translation-independent ER-association in mammalian cells (Figure 4.4). Thus it is likely that

other nucleotide features are required. One recent bioinformatic analysis has indicated that

several other aspects of nucleotide composition may also be associated with ORFs that encode

hydrophobic proteins (221). Nevertheless, certain mRNAs that encode ER-luminal proteins (i.e.,

GRP94, BiP and CALR (71,191)), and thus lack TMCRs, are also ER-associated in a translation-

independent manner, while other mRNAs encoding membrane-bound proteins strictly require

translation for ER-anchoring, bolstering the notion that other aspects of nucleotide composition

are involved.

Some possible insights could be gained from signal sequence coding regions (SSCRs),

which are found at the beginning of the ORF. These elements resemble TMCRs in that they code

for hydrophobic peptides and are enriched in uracils. The Palazzo lab have previously

documented that certain SSCRs also act as RNA elements that promote the nuclear export and

translation of newly synthesized mRNAs (151,152). In addition to their enrichment in uracil

content, these SSCRs tend to be found in the first exon, are depleted in adenines, and contain

certain GC-rich motifs (152,153). Furthermore, despite the fact that uracil tends to be present at

the second coding nucleotide position, it is actually depleted at the third position (153).

Importantly, some of these additional features, such as adenine-depletion, are critical for SSCRs

to function as cis-elements (151-153). In light of these observations, it is possible that TMCRs

may have additional motifs and features that are required for ER-localization.

It is still unclear how an RNA element within the ORF could mediate localization,

especially when one considers that translating ribosomes should displace any interactions

between these regions of the transcript and RNA-binding proteins. Of course these types of

interactions may be primarily required either to target mRNAs to the membrane prior to

ribosome engagement or to maintain the mRNAs on the surface of the organelle in the event of

ribosome dissociation. Another possibility is the presence of additional cis-elements in the UTRs

of the mRNA. For example, UG repeats in the 3′UTR of the yeast Pmp1 mRNA are

responsible for translation-independent ER-association of this transcript (194). Again, a deeper

128

understanding of how this would work will require us to identify additional trans- and cis-

elements.

6.3 Sec61β mRNA, which Encodes a Tail-anchored Translocon Component,

Associates with the ER Independently of Translation

Lastly, we demonstrated that some mRNAs encoding the TA-proteins, such as Sec61β

and Nesprin2, associate with the ER independently of translation which differs from the current

model of TA-protein biogenesis. The ER-association of Sec61β mRNA is not dependent on

known TRC components TRC40 and BAT3 or p180. In addition, when we frame shifted the

TMCR so the encoded peptide no longer encodes any hydrophobic sequences, the mRNA still

efficiently associate with the ER membrane, confirming this mechanism is mediated by an RNA

element (Figure 5.11).

However, out of the mRNAs that encode ER targeted TA-proteins we examined, only

Sec61β and Nesprin2 appear to associate with the ER (Chapter 5), while others are localized in

the cytoplasm indicating a post-translational targeting mechanism for their encoded proteins.

Therefore, it will be important to screen additional transcripts to examine whether this is a

generalized mechanism or only utilized by a select few mRNAs encoding TA-proteins. In

addition, although FIS1 mRNAs did not appear to localize on the mitochondria, it will be of

interest to screen additional transcripts encoding mitochondria and peroxisome targeted TA-

proteins, to determine whether there is a correlation between the protein destination and mRNA

localization for these subcellular organelles.

One important finding that I made was that the overexpression of Sec61β mRNA

displaces other mRNAs from the ER, including those that are anchored by translocon-bound

ribosomes. This suggests that certain mRNAs encoding TA-proteins can access translocon-bound

ribosomes on the surface of the ER and imply a novel alternative pathway for their targeting. We

hypothesize that perhaps the translocon itself is involved in anchoring Sec61β mRNA on the ER.

To address this question, we are currently performing a protein-RNA pulldown assay to isolate

mRNAs associated with the translocon in the absence of ribosomes. Briefly, component of the

translocon component will be tagged and affinity purified using column purification. After,

mRNAs associated with the translocon in the presence and absence of functional ribosomes can

then be identified using deep-sequencing analysis.

129

6.4 Are mRNAs Encoding Cytosolic Proteins also Translated on the ER?

For mRNA encoding secretory proteins, including TA-proteins, it is economically

favorable for the cell to localize and translate these mRNAs at the ER where their encoded

protein products are destined. In addition, secretory proteins often contain hydrophobic segments

or require additional modifications, such as glycosylation and disulfide bond formation. It is thus

advantageous to centralize these enzymes at a single location, in this case, inside the ER lumen.

Because of these reasons, the ER has thought of as a specialized region in the cell dedicated to

the translation of mRNAs encoding secretory proteins. After all, for cytosolic proteins, being

synthesized on the ER does not provide any clear advantage over being made in the cytoplasm.

Recently, there has been some controversy over whether mRNAs encoding cytosolic

proteins can also localize to the ER and even be translated by ER-associated ribosomes. This

idea that the ER can support the translation of both secretory and cytosolic proteins was initially

proposed by the Nicchitta lab (222). It is well known that non-translating ribosomes remain

bound to the translocon (83) on the ER and these could likely initiate translation of mRNAs

without SSCR or TMCR. In addition, it appears that the translation potential of ER far exceeds

the needs for translating secretory proteins. In HEK293 cells, ~ 50% of all ribosomes are ER

associated despite only about 13% of the total transcribed genes encoding secretory proteins

(223). These findings suggest that ER might play a broader role in translating not only secretory

proteins but also cytosolic proteins as well. The Nicchitta lab tested this idea by using cellular

fractionation in combination with biochemical and sequencing analyses (71,223,224). They

estimated that as much as 75% of the translational activity on the ER is devoted to mRNAs

encoding cytosolic proteins in HEK cells; and for an average mRNA that encodes a cytosolic

protein, about half of its transcripts are localized on the ER (223,224). In addition to classical

cellular fractionation techniques and biochemical analysis, the group also examined the

distribution of endogenous mRNA to provide direct visual evidence for their hypothesis. They

found that about half of the endogenous GAPDH mRNAs were found to associate with the ER

membrane in Hela cells by comparing intact and digitonin-permeabilized cells (224). From these

studies, they proposed that the ER is a general site for translation for all mRNAs; and that ER-

bound ribosomes translate mRNAs encoding both secretory and cytosolic proteins. They

hypothesized that ER-associated ribosomes, which do not require translation in order to be

docked to translocons, can initiate translation. Since translation initiation happens before the

emergence of the signal sequence, ER-bound ribosomes would not distinguish between mRNAs

130

that encode cytosolic or secretory proteins. In this way a certain fraction of mRNAs encoding

cytosolic proteins would be tethered to the ER.

Interestingly, a recent paper published by the Weissman lab strongly opposed this idea

that ER-associated ribosomes do not differentiate cytosolic or secretory mRNA transcripts. In

this study, ER-proximal ribosomal footprints were used to determine what was translated on the

ER (91). They found that the encoded polypeptide strongly predicted whether a given mRNA

was ER-associated. Moreover, ER-association along the ORF correlated with the occurrence of

the first encoded hydrophobic polypeptide. In contrast, mRNAs encoding cytoplasmic proteins

were depleted from ER samples (91).

The contradicting results between the two labs can be potentially reconciled when their

data is examined more closely. For example, in the paper published by the Weissman lab,

approximately 55% of the ER-derived reads came from mRNAs encoding cytosolic proteins (91).

Thus although these mRNAs are depleted in the ER fraction, they are still present at considerable

levels. It is unclear whether these reads originated from ER-targeted ribosomes, from the non-

specific labeling of non-ER associated ribosomes or from the non-specific binding of unlabeled

ribosomes to the streptavidin affinity column during their pulldown protocol. Similarly, studies

carried out by the Nicchitta lab also face possible cross-contamination issues between the

cytosolic and ER fractions with their fractionation protocol.

When I investigated the ER-localization of either over-expressed mRNAs (e.g. H1B-GFP

mRNA) or endogenous mRNAs (e.g. GAPDH mRNA) encoding cytosolic proteins, I

consistently found that approximately 10-20% are ER-associated in U2OS cells (Figure 5.2 E-F).

Although these levels are much lower than what was reported by the Nicchitta lab, my data is

consistent with the idea that these mRNAs are not completely excluded from the ER. In more

recent work, we found that about 20% of GAPDH mRNAs are ER associated in HeLa cells

(unpublished data). We obtained similar results in other cell lines including COS7, NIH3T3 and

MEFs. Even more surprising was that in Bat3-/-

cells we observed a 40% increase in the amount

of GAPDH mRNA association with the ER membrane independently of translation (Chapter 5).

Perhaps disruption of the TA protein targeting machinery activates compensatory mechanisms to

enhance the overall association of mRNAs with the ER membrane, including mRNAs encoding

cytosolic proteins. Our lab is currently in the process of validating these results and examining

131

whether the mRNA that is resistant to digitonin extraction is indeed ER-associated by co-

localizing with an ER marker.

6.5 Conclusion

The spatial regulation of protein translation is an important mechanism to achieve

structural and functional asymmetry and subcellular differentiation. As part of the process to

achieve this compartmentalization, mRNAs encoding secretory proteins are localized on the ER

to facilitate the subsequent post-translational modification and transportation processes. The

mechanism of how these mRNAs are localized on the ER was first identified and investigated in

the early 70s. At the time, it was shown that these mRNAs are targeted to the ER utilizing a SRP

mediated co-translational translocation process. The work presented here provide data supporting

alternative pathway for targeting mRNAs encoding secretory proteins targeted to the ER

membrane. We showed that an RNA element in the TMCR of ALPP targets this mRNA to the

ER in a translation and ribosome independent process. The anchoring of a subset of mRNAs on

the ER is in part dependent on p180, an ER membrane protein. Additionally, this work provides

clues of the existence of additional biogenesis pathways of certain TA-proteins. The

identification of additional players of this pathway, especially trans-factors that provide

specificity of this process, will be topics of great interest in the future.

About 30% of proteins in the human proteome are membrane and secreted proteins.

These proteins are involved in many important and essential cellular processes. Together,

secretory proteins account for more than 70% of the FDA approved drug targets (225). Because

their functional importance and therapeutic potential, it will be of great interest to further our

understanding of the biogenesis process of secretory proteins. In addition, recent studies suggest

that the ER, in addition to its role as a specialized unit for secretory protein production, also

helps to further spatially compartmentalize transcripts even in non-polarized cells, to provide an

additional layer of organization. Furthermore, mRNA was originally considered as a ‘passive’

intermediary between DNA and protein: to merely act as a messenger to pass the genetic code in

a temporary form available to be translated by ribosomes. Evidences suggest that mRNAs are

also involved in the temporal and spatial post-transcriptional control of gene expression. In our

study, we showed that mRNAs encoding secretory proteins contain spatial regulation elements

that help to locate these transcripts at the site where its protein products are destined. Future

132

studies on this topic will likely provide a more comprehensive understanding of the structural

role of the ER and of the mRNAs associated with it within the cell.

133

References

1. Lecuyer, E., Yoshida, H., and Krause, H. M. (2009) Global implications of mRNA

localization pathways in cellular organization. Current opinion in cell biology 21, 409-

415

2. Corral-Debrinski, M., Blugeon, C., and Jacq, C. (2000) In yeast, the 3' untranslated

region or the presequence of ATM1 is required for the exclusive localization of its

mRNA to the vicinity of mitochondria. Mol Cell Biol 20, 7881-7892

3. Marc, P., Margeot, A., Devaux, F., Blugeon, C., Corral-Debrinski, M., and Jacq, C. (2002)

Genome-wide analysis of mRNAs targeted to yeast mitochondria. EMBO reports 3, 159-

164

4. Margeot, A., Blugeon, C., Sylvestre, J., Vialette, S., Jacq, C., and Corral-Debrinski, M.

(2002) In Saccharomyces cerevisiae, ATP2 mRNA sorting to the vicinity of mitochondria

is essential for respiratory function. The EMBO journal 21, 6893-6904

5. Sylvestre, J., Margeot, A., Jacq, C., Dujardin, G., and Corral-Debrinski, M. (2003) The

role of the 3' untranslated region in mRNA sorting to the vicinity of mitochondria is

conserved from yeast to human cells. Mol Biol Cell 14, 3848-3856

6. Zipor, G., Haim-Vilmovsky, L., Gelin-Licht, R., Gadir, N., Brocard, C., and Gerst, J. E.

(2009) Localization of mRNAs coding for peroxisomal proteins in the yeast,

Saccharomyces cerevisiae. Proceedings of the National Academy of Sciences of the

United States of America 106, 19848-19853

7. Gadir, N., Haim-Vilmovsky, L., Kraut-Cohen, J., and Gerst, J. E. (2011) Localization of

mRNAs coding for mitochondrial proteins in the yeast Saccharomyces cerevisiae. RNA

17, 1551-1565

8. Blower, M. D., Feric, E., Weis, K., and Heald, R. (2007) Genome-wide analysis

demonstrates conserved localization of messenger RNAs to mitotic microtubules. The

Journal of cell biology 179, 1365-1373

9. Sharp, J. A., Plant, J. J., Ohsumi, T. K., Borowsky, M., and Blower, M. D. (2011)

Functional analysis of the microtubule-interacting transcriptome. Mol Biol Cell 22, 4312-

4323

10. Moccia, R., Chen, D., Lyles, V., Kapuya, E., E, Y., Kalachikov, S., Spahn, C. M., Frank,

J., Kandel, E. R., Barad, M., and Martin, K. C. (2003) An unbiased cDNA library

prepared from isolated Aplysia sensory neuron processes is enriched for cytoskeletal and

translational mRNAs. J Neurosci 23, 9409-9417

11. Poon, M. M., Choi, S. H., Jamieson, C. A., Geschwind, D. H., and Martin, K. C. (2006)

Identification of process-localized mRNAs from cultured rodent hippocampal neurons. J

Neurosci 26, 13390-13399

134

12. Suzuki, T., Tian, Q. B., Kuromitsu, J., Kawai, T., and Endo, S. (2007) Characterization of

mRNA species that are associated with postsynaptic density fraction by gene chip

microarray analysis. Neuroscience research 57, 61-85

13. Andreassi, C., Zimmermann, C., Mitter, R., Fusco, S., De Vita, S., Saiardi, A., and Riccio,

A. (2010) An NGF-responsive element targets myo-inositol monophosphatase-1 mRNA

to sympathetic neuron axons. Nature neuroscience 13, 291-301

14. Gumy, L. F., Yeo, G. S., Tung, Y. C., Zivraj, K. H., Willis, D., Coppola, G., Lam, B. Y.,

Twiss, J. L., Holt, C. E., and Fawcett, J. W. (2011) Transcriptome analysis of embryonic

and adult sensory axons reveals changes in mRNA repertoire localization. RNA 17, 85-98

15. Zivraj, K. H., Tung, Y. C., Piper, M., Gumy, L., Fawcett, J. W., Yeo, G. S., and Holt, C.

E. (2010) Subcellular profiling reveals distinct and developmentally regulated repertoire

of growth cone mRNAs. J Neurosci 30, 15464-15478

16. Doyle, M., and Kiebler, M. A. (2011) Mechanisms of dendritic mRNA transport and its

role in synaptic tagging. The EMBO journal 30, 3540-3552

17. Holt, C. E., and Schuman, E. M. (2013) The central dogma decentralized: new

perspectives on RNA function and local translation in neurons. Neuron 80, 648-657

18. Shibata, Y., Voeltz, G. K., and Rapoport, T. A. (2006) Rough sheets and smooth tubules.

Cell 126, 435-439

19. Simmonds, A. J., dosSantos, G., Livne-Bar, I., and Krause, H. M. (2001) Apical

localization of wingless transcripts is required for wingless signaling. Cell 105, 197-207

20. Deshler, J. O., Highett, M. I., and Schnapp, B. J. (1997) Localization of Xenopus Vg1

mRNA by Vera protein and the endoplasmic reticulum. Science 276, 1128-1131

21. Choi, S. B., Wang, C., Muench, D. G., Ozawa, K., Franceschi, V. R., Wu, Y., and Okita,

T. W. (2000) Messenger RNA targeting of rice seed storage proteins to specific ER

subdomains. Nature 407, 765-767

22. Schmid, M., Jaedicke, A., Du, T.-G., and Jansen, R.-P. (2006) Coordination of

endoplasmic reticulum and mRNA localization to the yeast bud. Curr Biol 16, 1538-1543

23. Porter, K. R., Claude, A., and Fullam, E. F. (1945) A Study of Tissue Culture Cells by

Electron Microscopy : Methods and Preliminary Observations. The Journal of

experimental medicine 81, 233-246

24. Porter, K. R., and Thompson, H. P. (1948) A particulate body associated with epithelial

cells cultured from mammary carcinomas of mice of a milkfactor strain. The Journal of

experimental medicine 88, 15-24

25. Palade, G. E., and Siekevitz, P. (1956) Pancreatic microsomes; an integrated

morphological and biochemical study. The Journal of biophysical and biochemical

cytology 2, 671-690

135

26. Palade, G. E., and Siekevitz, P. (1956) Liver microsomes; an integrated morphological

and biochemical study. The Journal of biophysical and biochemical cytology 2, 171-200

27. Palade, G. E. (1955) A small particulate component of the cytoplasm. The Journal of

biophysical and biochemical cytology 1, 59-68

28. Caro, L. G., and Palade, G. E. (1964) Protein Synthesis, Storage, and Discharge in the

Pancreatic Exocrine Cell. An Autoradiographic Study. The Journal of cell biology 20,

473-495

29. Jamieson, J. D., and Palade, G. E. (1967) Intracellular transport of secretory proteins in

the pancreatic exocrine cell. II. Transport to condensing vacuoles and zymogen granules.

The Journal of cell biology 34, 597-615

30. Jamieson, J. D., and Palade, G. E. (1967) Intracellular transport of secretory proteins in

the pancreatic exocrine cell. I. Role of the peripheral elements of the Golgi complex. The


31. Redman, C. M., Siekevitz, P., and Palade, G. E. (1966) Synthesis and transfer of amylase

in pigeon pancreatic micromosomes. The Journal of biological chemistry 241, 1150-1158

32. Hicks, S. J., Drysdale, J. W., and Munro, H. N. (1969) Preferential synthesis of ferritin

and albumin by different populations of liver polysomes. Science 164, 584-585

33. Redman, C. M. (1969) Biosynthesis of serum proteins and ferritin by free and attached

ribosomes of rat liver. The Journal of biological chemistry 244, 4308-4315

34. Borgese, D., Blobel, G., and Sabatini, D. D. (1973) In vitro exchange of ribosomal

subunits between free and membrane-bound ribosomes. Journal of molecular biology 74,

415-438

35. Yarmolinsky, M. B., and Haba, G. L. (1959) Inhibition by Puromycin of Amino Acid

Incorporation into Protein. Proceedings of the National Academy of Sciences of the

United States of America 45, 1721-1729

36. Redman, C. M., and Sabatini, D. D. (1966) Vectorial discharge of peptides released by

puromycin from attached ribosomes. Proceedings of the National Academy of Sciences of

the United States of America 56, 608-615

37. Adelman, M. R., Sabatini, D. D., and Blobel, G. (1973) Ribosome-membrane interaction.

Nondestructive disassembly of rat liver rough microsomes into ribosomal and

membranous components. The Journal of cell biology 56, 206-229

38. Sabatini, D. D., and Blobel, G. (1970) Controlled proteolysis of nascent polypeptides in

rat liver cell fractions. II. Location of the polypeptides in rough microsomes. The Journal

of cell biology 45, 146-157

39. Sabatini, D. D., Blobel, G., Nonomura, Y., and Adelman, M. R. (1971) Ribosome-

membrane interaction: Structural aspects and functional implications. Advances in

cytopharmacology 1, 119-129

136

40. Milstein, C., Brownlee, G. G., Harrison, T. M., and Mathews, M. B. (1972) A possible

precursor of immunoglobulin light chains. Nature: New biology 239, 117-120

41. Schechter, I. (1973) Biologically and chemically pure mRNA coding for a mouse

immunoglobulin L-chain prepared with the aid of antibodies and immobilized

oligothymidine. Proceedings of the National Academy of Sciences of the United States of

America 70, 2256-2260

42. Swan, D., Aviv, H., and Leder, P. (1972) Purification and properties of biologically

active messenger RNA for a myeloma light chain. Proceedings of the National Academy

of Sciences of the United States of America 69, 1967-1971

43. Tonegawa, S., and Baldi, I. (1973) Electrophoretically homogeneous myeloma light chain

mRNA and its translation in vitro. Biochemical and biophysical research

communications 51, 81-87

44. Blobel, G., and Dobberstein, B. (1975) Transfer of proteins across membranes. II.

Reconstitution of functional rough microsomes from heterologous components. The


45. Blobel, G., and Dobberstein, B. (1975) Transfer of proteins across membranes. I.

Presence of proteolytically processed and unprocessed nascent immunoglobulin light

chains on membrane-bound ribosomes of murine myeloma. The Journal of cell biology

67, 835-851

46. Blobel, G. (2012) Entering an Unseen World, The Rockefeller University Press, New

York

47. Katz, F. N., Rothman, J. E., Lingappa, V. R., Blobel, G., and Lodish, H. F. (1977)

Membrane assembly in vitro: synthesis, glycosylation, and asymmetric insertion of a

transmembrane protein. Proceedings of the National Academy of Sciences of the United

States of America 74, 3278-3282

48. Lingappa, V. R., Katz, F. N., Lodish, H. F., and Blobel, G. (1978) A signal sequence for

the insertion of a transmembrane glycoprotein. Similarities to the signals of secretory

proteins in primary structure and function. The Journal of biological chemistry 253,

8667-8670

49. Gilmore, R., Blobel, G., and Walter, P. (1982) Protein translocation across the

endoplasmic reticulum. I. Detection in the microsomal membrane of a receptor for the

signal recognition particle. The Journal of cell biology 95, 463-469

50. Gilmore, R., Walter, P., and Blobel, G. (1982) Protein translocation across the

endoplasmic reticulum. II. Isolation and characterization of the signal recognition particle

receptor. The Journal of cell biology 95, 470-477

51. Meyer, D. I., and Dobberstein, B. (1980) Identification and characterization of a

membrane component essential for the translocation of nascent proteins across the

membrane of the endoplasmic reticulum. The Journal of cell biology 87, 503-508

137

52. Meyer, D. I., Krause, E., and Dobberstein, B. (1982) Secretory protein translocation

across membranes-the role of the "docking protein'. Nature 297, 647-650

53. Walter, P., and Blobel, G. (1981) Translocation of proteins across the endoplasmic

reticulum. II. Signal recognition protein (SRP) mediates the selective binding to

microsomal membranes of in-vitro-assembled polysomes synthesizing secretory protein.



reticulum III. Signal recognition protein (SRP) causes signal sequence-dependent and

site-specific arrest of chain elongation that is released by microsomal membranes. The



reticulum. Oncodevelopmental biology and medicine : the journal of the International

Society for Oncodevelopmental Biology and Medicine 4, 137-146

56. Deshaies, R. J., and Schekman, R. (1987) A yeast mutant defective at an early stage in

import of secretory protein precursors into the endoplasmic reticulum. The Journal of cell

biology 105, 633-645

57. Gorlich, D., Prehn, S., Hartmann, E., Kalies, K. U., and Rapoport, T. A. (1992) A

mammalian homolog of SEC61p and SECYp is associated with ribosomes and nascent

polypeptides during translocation. Cell 71, 489-503

58. Gorlich, D., and Rapoport, T. A. (1993) Protein translocation into proteoliposomes

reconstituted from purified components of the endoplasmic reticulum membrane. Cell 75,

615-630

59. Harris, J. K., Kelley, S. T., Spiegelman, G. B., and Pace, N. R. (2003) The genetic core of

the universal ancestor. Genome research 13, 407-412

60. Rapoport, T. A. (2007) Protein translocation across the eukaryotic endoplasmic reticulum

and bacterial plasma membranes. Nature 450, 663-669

61. Cardelli, J., Long, B., and Pitot, H. C. (1976) Direct association of messenger RNA

labeled in the presence of fluoroorotate with membranes of the endoplasmic reticulum in

rat liver. The Journal of cell biology 70, 47-58

62. Lande, M. A., Adesnik, M., Sumida, M., Tashiro, Y., and Sabatini, D. D. (1975) Direct

association of messenger RNA with microsomal membranes in human diploid fibroblasts.


63. Mechler, B., and Vassalli, P. (1975) Membrane-bound ribosomes of myeloma cells. III.

The role of the messenger RNA and the nascent polypeptide chain in the binding of

ribosomes to membranes. The Journal of cell biology 67, 25-37

64. Adesnik, M., Lande, M., Martin, T., and Sabatini, D. D. (1976) Retention of mRNA on

the endoplasmic reticulum membranes after in vivo disassembly of polysomes by an

inhibitor of initiation. The Journal of cell biology 71, 307-313

138

65. Kruppa, J., and Sabatini, D. D. (1977) Release of poly A(+) messenger RNA from rat

liver rough microsomes upon disassembly of bound polysomes. The Journal of cell

biology 74, 414-427

66. Adesnik, M., and Maschio, F. (1981) Segregation of specific classes of messenger RNA

into free and membrane-bound polysomes. European journal of biochemistry / FEBS 114,

271-284

67. Mueckler, M. M., and Pitot, H. C. (1981) Structure and function of rat liver polysome

populations. I. Complexity, frequency distribution, and degree of uniqueness of free and

membrane-bound polysomal polyadenylate-containing RNA populations. The Journal of

cell biology 90, 495-506

68. Stirling, C. J., and Hewitt, E. W. (1992) The S. cerevisiae SEC65 gene encodes a

component of yeast signal recognition particle with homology to human SRP19. Nature

356, 534-537

69. Hann, B. C., and Walter, P. (1991) The signal recognition particle in S. cerevisiae. Cell

67, 131-144

70. Lakkaraju, A. K., Luyet, P. P., Parone, P., Falguieres, T., and Strub, K. (2007) Inefficient

targeting to the endoplasmic reticulum by the signal recognition particle elicits selective

defects in post-ER membrane trafficking. Exp Cell Res 313, 834-847

71. Pyhtila, B., Zheng, T., Lager, P. J., Keene, J. D., Reedy, M. C., and Nicchitta, C. V.

(2008) Signal sequence- and translation-independent mRNA localization to the

endoplasmic reticulum. RNA 14, 445-453

72. Ren, Y. G., Wagner, K. W., Knee, D. A., Aza-Blanc, P., Nasoff, M., and Deveraux, Q. L.

(2004) Differential regulation of the TRAIL death receptors DR4 and DR5 by the signal

recognition particle. Mol Biol Cell 15, 5064-5074

73. Matlack, K. E., Plath, K., Misselwitz, B., and Rapoport, T. A. (1997) Protein transport by

purified yeast Sec complex and Kar2p without membranes. Science 277, 938-941

74. Ng, D. T., Brown, J. D., and Walter, P. (1996) Signal sequences specify the targeting

route to the endoplasmic reticulum membrane. The Journal of cell biology 134, 269-278

75. Panzner, S., Dreier, L., Hartmann, E., Kostka, S., and Rapoport, T. A. (1995)

Posttranslational protein transport in yeast reconstituted with a purified complex of Sec

proteins and Kar2p. Cell 81, 561-570

76. Johnson, N., Hassdenteufel, S., Theis, M., Paton, A. W., Paton, J. C., Zimmermann, R.,

and High, S. (2013) The signal sequence influences post-translational ER translocation at

distinct stages. PloS one 8, e75394

77. Denic, V. (2012) A portrait of the GET pathway as a surprisingly complicated young man.

Trends in biochemical sciences 37, 411-417

78. Stefanovic, S., and Hegde, R. S. (2007) Identification of a targeting factor for

posttranslational membrane protein insertion into the ER. Cell 128, 1147-1159

139

79. Hassdenteufel, S., Schauble, N., Cassella, P., Leznicki, P., Muller, A., High, S., Jung, M.,

and Zimmermann, R. (2011) Ca2+-calmodulin inhibits tail-anchored protein insertion

into the mammalian endoplasmic reticulum membrane. FEBS Lett 585, 3485-3490

80. Shao, S., and Hegde, R. S. (2011) A calmodulin-dependent translocation pathway for

small secretory proteins. Cell 147, 1576-1588

81. Muller, L., de Escauriaza, M. D., Lajoie, P., Theis, M., Jung, M., Muller, A., Burgard, C.,

Greiner, M., Snapp, E. L., Dudek, J., and Zimmermann, R. (2010) Evolutionary gain of

function for the ER membrane protein Sec62 from yeast to humans. Mol Biol Cell 21,

691-703

82. Nicchitta, C. V., Lerner, R. S., Stephens, S. B., Dodd, R. D., and Pyhtila, B. (2005)

Pathways for compartmentalizing protein synthesis in eukaryotic cells: the template-

partitioning model. Biochemistry and cell biology = Biochimie et biologie cellulaire 83,

687-695

83. Seiser, R. M., and Nicchitta, C. V. (2000) The fate of membrane-bound ribosomes

following the termination of protein synthesis. The Journal of biological chemistry 275,

33820-33827

84. Mutka, S. C., and Walter, P. (2001) Multifaceted physiological response allows yeast to

adapt to the loss of the signal recognition particle-dependent protein-targeting pathway.

Mol Biol Cell 12, 577-588

85. Aronov, S., Gelin-Licht, R., Zipor, G., Haim, L., Safran, E., and Gerst, J. E. (2007)

mRNAs encoding polarity and exocytosis factors are cotransported with the cortical

endoplasmic reticulum to the incipient bud in Saccharomyces cerevisiae. Mol Cell Biol

27, 3441-3455

86. Shepard, K. A., Gerber, A. P., Jambhekar, A., Takizawa, P. A., Brown, P. O., Herschlag,

D., DeRisi, J. L., and Vale, R. D. (2003) Widespread cytoplasmic mRNA transport in

yeast: identification of 22 bud-localized transcripts using DNA microarray analysis.

Proceedings of the National Academy of Sciences of the United States of America 100,

11429-11434

87. Gonsalvez, G. B., Urbinati, C. R., and Long, R. M. (2005) RNA localization in yeast:

moving towards a mechanism. Biol Cell 97, 75-86

88. Li, X., Franceschi, V. R., and Okita, T. W. (1993) Segregation of storage protein mRNAs

on the rough endoplasmic reticulum membranes of rice endosperm cells. Cell 72, 869-

879

89. Lerner, R. S., Seiser, R. M., Zheng, T., Lager, P. J., Reedy, M. C., Keene, J. D., and

Nicchitta, C. V. (2003) Partitioning and translation of mRNAs encoding soluble proteins

on membrane-bound ribosomes. RNA 9, 1123-1137

90. Diehn, M., Bhattacharya, R., Botstein, D., and Brown, P. O. (2006) Genome-scale

identification of membrane-associated human mRNAs. PLoS genetics 2, e11

140

91. Jan, C. H., Williams, C. C., and Weissman, J. S. (2014) Principles of ER cotranslational

translocation revealed by proximity-specific ribosome profiling. Science 346, 1257521

92. Kutay, U., Hartmann, E., and Rapoport, T. A. (1993) A class of membrane proteins with

a C-terminal anchor. Trends Cell Biol 3, 72-75

93. Kutay, U., Ahnert-Hilger, G., Hartmann, E., Wiedenmann, B., and Rapoport, T. A. (1995)

Transport route for synaptobrevin via a novel pathway of insertion into the endoplasmic

reticulum membrane. The EMBO journal 14, 217-223

94. Borgese, N., Colombo, S., and Pedrazzini, E. (2003) The tale of tail-anchored proteins:

coming from the cytosol and looking for a membrane. The Journal of cell biology 161,

1013-1019

95. Wattenberg, B., and Lithgow, T. (2001) Targeting of C-terminal (tail)-anchored proteins:

understanding how cytoplasmic activities are anchored to intracellular membranes.

Traffic 2, 66-71

96. Mariappan, M., Mateja, A., Dobosz, M., Bove, E., Hegde, R. S., and Keenan, R. J. (2011)

The mechanism of membrane-associated steps in tail-anchored protein insertion. Nature

477, 61-66

97. Mariappan, M., Li, X., Stefanovic, S., Sharma, A., Mateja, A., Keenan, R. J., and Hegde,

R. S. (2010) A ribosome-associating factor chaperones tail-anchored membrane proteins.

Nature 466, 1120-1124

98. Wang, F., Brown, E. C., Mak, G., Zhuang, J., and Denic, V. (2010) A chaperone cascade

sorts proteins for posttranslational membrane insertion into the endoplasmic reticulum.

Molecular cell 40, 159-171

99. Schuldiner, M., Metz, J., Schmid, V., Denic, V., Rakwalska, M., Schmitt, H. D.,

Schwappach, B., and Weissman, J. S. (2008) The GET complex mediates insertion of

tail-anchored proteins into the ER membrane. Cell 134, 634-645

100. Leznicki, P., Clancy, A., Schwappach, B., and High, S. (2010) Bat3 promotes the

membrane integration of tail-anchored proteins. Journal of cell science 123, 2170-2178

101. Suloway, C. J., Rome, M. E., and Clemons, W. M., Jr. (2012) Tail-anchor targeting by a

Get3 tetramer: the structure of an archaeal homologue. The EMBO journal 31, 707-719

102. Vilardi, F., Lorenz, H., and Dobberstein, B. (2011) WRB is the receptor for

TRC40/Asna1-mediated insertion of tail-anchored proteins into the ER membrane.

Journal of cell science 124, 1301-1307

103. Vilardi, F., Stephan, M., Clancy, A., Janshoff, A., and Schwappach, B. (2014) WRB and

CAML are necessary and sufficient to mediate tail-anchored protein targeting to the ER

membrane. PloS one 9, e85033

104. Yamamoto, Y., and Sakisaka, T. (2012) Molecular machinery for insertion of tail-

anchored membrane proteins into the endoplasmic reticulum membrane in mammalian

cells. Molecular cell 48, 387-397

141

105. Rabu, C., Wipf, P., Brodsky, J. L., and High, S. (2008) A precursor-specific role for

Hsp40/Hsc70 during tail-anchored protein integration at the endoplasmic reticulum. The

Journal of biological chemistry 283, 27504-27513

106. Yabal, M., Brambillasca, S., Soffientini, P., Pedrazzini, E., Borgese, N., and Makarow, M.

(2003) Translocation of the C terminus of a tail-anchored protein across the endoplasmic

reticulum membrane in yeast mutants defective in signal peptide-driven translocation.

The Journal of biological chemistry 278, 3489-3496

107. Sasaki, T., Gan, E. C., Wakeham, A., Kornbluth, S., Mak, T. W., and Okada, H. (2007)

HLA-B-associated transcript 3 (Bat3)/Scythe is essential for p300-mediated acetylation

of p53. Genes & development 21, 848-861

108. Abell, B. M., Pool, M. R., Schlenker, O., Sinning, I., and High, S. (2004) Signal

recognition particle mediates post-translational targeting in eukaryotes. The EMBO

journal 23, 2755-2764

109. Cross, B. C., Sinning, I., Luirink, J., and High, S. (2009) Delivering proteins for export

from the cytosol. Nature reviews. Molecular cell biology 10, 255-264

110. Borgese, N., and Fasana, E. (2011) Targeting pathways of C-tail-anchored proteins.

Biochim Biophys Acta 1808, 937-946

111. Jonikas, M. C., Collins, S. R., Denic, V., Oh, E., Quan, E. M., Schmid, V., Weibezahn, J.,

Schwappach, B., Walter, P., Weissman, J. S., and Schuldiner, M. (2009) Comprehensive

characterization of genes required for protein folding in the endoplasmic reticulum.

Science 323, 1693-1697

112. Kemper, C., Habib, S. J., Engl, G., Heckmeyer, P., Dimmer, K. S., and Rapaport, D.

(2008) Integration of tail-anchored proteins into the mitochondrial outer membrane does

not require any known import components. Journal of cell science 121, 1990-1998

113. Setoguchi, K., Otera, H., and Mihara, K. (2006) Cytosolic factor- and TOM-independent

import of C-tail-anchored mitochondrial outer membrane proteins. The EMBO journal 25,

5635-5647

114. Zinser, E., Sperka-Gottlieb, C. D., Fasch, E. V., Kohlwein, S. D., Paltauf, F., and Daum,

G. (1991) Phospholipid synthesis and lipid composition of subcellular membranes in the

unicellular eukaryote Saccharomyces cerevisiae. Journal of bacteriology 173, 2026-2034

115. Chen, Y. C., Umanah, G. K., Dephoure, N., Andrabi, S. A., Gygi, S. P., Dawson, T. M.,

Dawson, V. L., and Rutter, J. (2014) Msp1/ATAD1 maintains mitochondrial function by

facilitating the degradation of mislocalized tail-anchored proteins. The EMBO journal

116. Okreglak, V., and Walter, P. (2014) The conserved AAA-ATPase Msp1 confers

organelle specificity to tail-anchored proteins. Proceedings of the National Academy of

Sciences of the United States of America

117. Beilharz, T., Egan, B., Silver, P. A., Hofmann, K., and Lithgow, T. (2003) Bipartite

signals mediate subcellular targeting of tail-anchored membrane proteins in

Saccharomyces cerevisiae. The Journal of biological chemistry 278, 8219-8223

142

118. Horie, C., Suzuki, H., Sakaguchi, M., and Mihara, K. (2002) Characterization of signal

that directs C-tail-anchored proteins to mammalian mitochondrial outer membrane. Mol

Biol Cell 13, 1615-1625

119. Borgese, N., Gazzoni, I., Barberi, M., Colombo, S., and Pedrazzini, E. (2001) Targeting

of a tail-anchored protein to endoplasmic reticulum and mitochondrial outer membrane

by independent but competing pathways. Mol Biol Cell 12, 2482-2496

120. Rucktaschel, R., Girzalsky, W., and Erdmann, R. (2011) Protein import machineries of

peroxisomes. Biochim Biophys Acta 1808, 892-900

121. Yagita, Y., Hiromasa, T., and Fujiki, Y. (2013) Tail-anchored PEX26 targets

peroxisomes via a PEX19-dependent and TRC40-independent class I pathway. The


122. Hua, R. G., S.K; Aranovich, A; Mullen, R.T; Kim, P.T. (2015) Multiple domains in

PEX16 mediate its trafficking and recruitment of peroxisomal proteins to the ER. Traffic

In revision

123. Gerber, A. P., Herschlag, D., and Brown, P. O. (2004) Extensive association of

functionally and cytotopically related mRNAs with Puf family RNA-binding proteins in

yeast. PLoS biology 2, E79

124. Hogan, D. J., Riordan, D. P., Gerber, A. P., Herschlag, D., and Brown, P. O. (2008)

Diverse RNA-binding proteins interact with functionally related sets of RNAs, suggesting

an extensive regulatory system. PLoS biology 6, e255

125. Garcia-Rodriguez, L. J., Gay, A. C., and Pon, L. A. (2007) Puf3p, a Pumilio family RNA

binding protein, localizes to mitochondria and regulates mitochondrial biogenesis and

motility in budding yeast. The Journal of cell biology 176, 197-207

126. Brengues, M., Teixeira, D., and Parker, R. (2005) Movement of eukaryotic mRNAs

between polysomes and cytoplasmic processing bodies. Science 310, 486-489

127. Garcia, M., Delaveau, T., Goussard, S., and Jacq, C. (2010) Mitochondrial presequence

and open reading frame mediate asymmetric localization of messenger RNA. EMBO

reports 11, 285-291

128. Morris, A. R., Mukherjee, N., and Keene, J. D. (2008) Ribonomic analysis of human

Pum1 reveals cis-trans conservation across species despite evolution of diverse mRNA

target sets. Mol Cell Biol 28, 4093-4103

129. Gao, J., Schatton, D., Martinelli, P., Hansen, H., Pla-Martin, D., Barth, E., Becker, C.,

Altmueller, J., Frommolt, P., Sardiello, M., and Rugarli, E. I. (2014) CLUH regulates

mitochondrial biogenesis by binding mRNAs of nuclear-encoded mitochondrial proteins.


130. Cox, R. T., and Spradling, A. C. (2009) Clueless, a conserved Drosophila gene required

for mitochondrial subcellular localization, interacts genetically with parkin. Disease

models & mechanisms 2, 490-499

143

131. Fields, S. D., Conrad, M. N., and Clarke, M. (1998) The S. cerevisiae CLU1 and D.

discoideum cluA genes are functional homologues that influence mitochondrial

morphology and distribution. Journal of cell science 111 ( Pt 12), 1717-1727

132. Logan, D. C., Scott, I., and Tobin, A. K. (2003) The genetic control of plant

mitochondrial morphology and dynamics. Plant J 36, 500-509

133. Williams, C. C., Jan, C. H., and Weissman, J. S. (2014) Targeting and plasticity of

mitochondrial proteins revealed by proximity-specific ribosome profiling. Science 346,

748-751

134. Chang, W., Zaarour, R. F., Reck-Peterson, S., Rinn, J., Singer, R. H., Snyder, M., Novick,

P., and Mooseker, M. S. (2008) Myo2p, a class V myosin in budding yeast, associates

with a large ribonucleic acid-protein complex that contains mRNAs and subunits of the

RNA-processing body. RNA 14, 491-502

135. Gallardo, F., Laterreur, N., Cusanelli, E., Ouenzar, F., Querido, E., Wellinger, R. J., and

Chartrand, P. (2011) Live cell imaging of telomerase RNA dynamics reveals cell cycle-

dependent clustering of telomerase at elongating telomeres. Molecular cell 44, 819-827

136. Weis, B. L., Schleiff, E., and Zerges, W. (2013) Protein targeting to subcellular

organelles via MRNA localization. Biochim Biophys Acta 1833, 260-273

137. Zaessinger, S., Busseau, I., and Simonelig, M. (2006) Oskar allows nanos mRNA

translation in Drosophila embryos by preventing its deadenylation by Smaug/CCR4.

Development 133, 4573-4583

138. Patel, V. L., Mitra, S., Harris, R., Buxbaum, A. R., Lionnet, T., Brenowitz, M., Girvin,

M., Levy, M., Almo, S. C., Singer, R. H., and Chao, J. A. (2012) Spatial arrangement of

an RNA zipcode identifies mRNAs under post-transcriptional control. Genes &

development 26, 43-53

139. Oleynikov, Y., and Singer, R. H. (2003) Real-time visualization of ZBP1 association with

beta-actin mRNA during transcription and localization. Curr Biol 13, 199-207

140. Latham, V. M., Yu, E. H., Tullio, A. N., Adelstein, R. S., and Singer, R. H. (2001) A

Rho-dependent signaling pathway operating through myosin localizes beta-actin mRNA

in fibroblasts. Curr Biol 11, 1010-1016

141. Chang, P., Torres, J., Lewis, R. A., Mowry, K. L., Houliston, E., and King, M. L. (2004)

Localization of RNAs to the mitochondrial cloud in Xenopus oocytes through entrapment

and association with endoplasmic reticulum. Mol Biol Cell 15, 4669-4681

142. Ferrandon, D., Elphick, L., Nusslein-Volhard, C., and St Johnston, D. (1994) Staufen

protein associates with the 3'UTR of bicoid mRNA to form particles that move in a

microtubule-dependent manner. Cell 79, 1221-1232

143. Ferrandon, D., Koch, I., Westhof, E., and Nusslein-Volhard, C. (1997) RNA-RNA

interaction is required for the formation of specific bicoid mRNA 3' UTR-STAUFEN

ribonucleoprotein particles. The EMBO journal 16, 1751-1758

144

144. Macdonald, P. M., and Kerr, K. (1997) Redundant RNA recognition events in bicoid

mRNA localization. RNA 3, 1413-1420

145. Macdonald, P. M., Kerr, K., Smith, J. L., and Leask, A. (1993) RNA regulatory element

BLE1 directs the early steps of bicoid mRNA localization. Development 118, 1233-1243

146. Chartrand, P., Meng, X. H., Singer, R. H., and Long, R. M. (1999) Structural elements

required for the localization of ASH1 mRNA and of a green fluorescent protein reporter

particle in vivo. Curr Biol 9, 333-336

147. Gonzalez, I., Buonomo, S. B., Nasmyth, K., and von Ahsen, U. (1999) ASH1 mRNA

localization in yeast involves multiple secondary structural elements and Ash1 protein

translation. Curr Biol 9, 337-340

148. Bibi, E. (2011) Early targeting events during membrane protein biogenesis in Escherichia

coli. Biochim Biophys Acta 1808, 841-850

149. Nevo-Dinur, K., Nussbaum-Shochat, A., Ben-Yehuda, S., and Amster-Choder, O. (2011)

Translation-independent localization of mRNA in E. coli. Science 331, 1081-1084

150. Prilusky, J., and Bibi, E. (2009) Studying membrane proteins through the eyes of the

genetic code revealed a strong uracil bias in their coding mRNAs. Proceedings of the

National Academy of Sciences of the United States of America 106, 6662-6666

151. Mahadevan, K., Zhang, H., Akef, A., Cui, X. A., Gueroussov, S., Cenik, C., Roth, F. P.,

and Palazzo, A. F. (2013) RanBP2/Nup358 potentiates the translation of a subset of

mRNAs encoding secretory proteins. PLoS biology 11, e1001545

152. Palazzo, A. F., Springer, M., Shibata, Y., Lee, C. S., Dias, A. P., and Rapoport, T. A.

(2007) The signal sequence coding region promotes nuclear export of mRNA. PLoS

biology 5, e322

153. Cenik, C., Chua, H. N., Zhang, H., Tarnawsky, S. P., Akef, A., Derti, A., Tasan, M.,

Moore, M. J., Palazzo, A. F., and Roth, F. P. (2011) Genome analysis reveals interplay

between 5'UTR introns and nuclear mRNA export for secretory and mitochondrial genes.

PLoS genetics 7, e1001366

154. Palazzo, A. F., Mahadevan, K., and Tarnawsky, S. P. (2013) ALREX-elements and

introns: two identity elements that promote mRNA nuclear export. Wiley

interdisciplinary reviews. RNA 4, 523-533

155. Contreras, A., Hale, T. K., Stenoien, D. L., Rosen, J. M., Mancini, M. A., and Herrera, R.

E. (2003) The dynamic mobility of histone H1 is regulated by cyclin/CDK

phosphorylation. Mol Cell Biol 23, 8626-8636

156. Shibata, Y., Shemesh, T., Prinz, W. A., Palazzo, A. F., Kozlov, M. M., and Rapoport, T.

A. (2010) Mechanisms determining the morphology of the peripheral ER. Cell 143, 774-

788

157. van den Ent, F., and Lowe, J. (2006) RF cloning: a restriction-free method for inserting

target genes into plasmids. Journal of biochemical and biophysical methods 67, 67-74

145

158. Jambhekar, A., McDermott, K., Sorber, K., Shepard, K. A., Vale, R. D., Takizawa, P. A.,

and DeRisi, J. L. (2005) Unbiased selection of localization elements reveals cis-acting

determinants of mRNA bud localization in Saccharomyces cerevisiae. Proceedings of the

National Academy of Sciences of the United States of America 102, 18005-18010

159. Walter, P., Ibrahimi, I., and Blobel, G. (1981) Translocation of proteins across the

endoplasmic reticulum. I. Signal recognition protein (SRP) binds to in-vitro-assembled

polysomes synthesizing secretory protein. The Journal of cell biology 91, 545-550

160. Krogh, A., Larsson, B., von Heijne, G., and Sonnhammer, E. L. (2001) Predicting

transmembrane protein topology with a hidden Markov model: application to complete

genomes. Journal of molecular biology 305, 567-580

161. Petersen, T. N., Brunak, S., von Heijne, G., and Nielsen, H. (2011) SignalP 4.0:

discriminating signal peptides from transmembrane regions. Nature methods 8, 785-786

162. Kyte, J., and Doolittle, R. F. (1982) A simple method for displaying the hydropathic

character of a protein. Journal of molecular biology 157, 105-132

163. Moore, C. B., Guthrie, E. H., Huang, M. T., and Taxman, D. J. (2010) Short hairpin RNA

(shRNA): design, delivery, and assessment of gene knockdown. Methods Mol Biol 629,

141-158

164. Gueroussov, S., Tarnawsky, S. P., Cui, X. A., Mahadevan, K., and Palazzo, A. F. (2010)

Analysis of mRNA nuclear export kinetics in mammalian cells by microinjection.

Journal of visualized experiments : JoVE

165. Zhou, Z., Luo, M. J., Straesser, K., Katahira, J., Hurt, E., and Reed, R. (2000) The protein

Aly links pre-messenger-RNA splicing to nuclear export in metazoans. Nature 407, 401-

405

166. Chen, Q., Jagannathan, S., Reid, D. W., Zheng, T., and Nicchitta, C. V. (2011)

Hierarchical regulation of mRNA partitioning between the cytoplasm and the

endoplasmic reticulum of mammalian cells. Mol Biol Cell 22, 2646-2658

167. Reed, R., and Maniatis, T. (1985) Intron sequences involved in lariat formation during

pre-mRNA splicing. Cell 41, 95-105

168. Adam, S. A., Marr, R. S., and Gerace, L. (1990) Nuclear protein import in permeabilized

mammalian cells requires soluble cytoplasmic factors. The Journal of cell biology 111,

807-816

169. Cui, X. A., Singh, B., Park, J., and Gupta, R. S. (2009) Subcellular localization of

adenosine kinase in mammalian cells: The long isoform of AdK is localized in the

nucleus. Biochemical and biophysical research communications 388, 46-50

170. Gorlich, D., Prehn, S., Hartmann, E., Herz, J., Otto, A., Kraft, R., Wiedmann, M.,

Knespel, S., Dobberstein, B., and Rapoport, T. A. (1990) The signal sequence receptor

has a second subunit and is part of a translocation complex in the endoplasmic reticulum

as probed by bifunctional reagents. The Journal of cell biology 111, 2283-2294

146

171. Fresno, M., Jimenez, A., and Vazquez, D. (1977) Inhibition of translation in eukaryotic

systems by harringtonine. European journal of biochemistry / FEBS 72, 323-330

172. Schaletzky, J., and Rapoport, T. A. (2006) Ribosome binding to and dissociation from

translocation sites of the endoplasmic reticulum membrane. Mol Biol Cell 17, 3860-3869

173. Brodersen, D. E., Clemons, W. M., Jr., Carter, A. P., Morgan-Warren, R. J., Wimberly, B.

T., and Ramakrishnan, V. (2000) The structural basis for the action of the antibiotics

tetracycline, pactamycin, and hygromycin B on the 30S ribosomal subunit. Cell 103,

1143-1154

174. Park, S. G., Ewalt, K. L., and Kim, S. (2005) Functional expansion of aminoacyl-tRNA

synthetases and their interacting factors: new perspectives on housekeepers. Trends in

biochemical sciences 30, 569-574

175. West, M., Zurek, N., Hoenger, A., and Voeltz, G. K. (2011) A 3D analysis of yeast ER

structure reveals how ER domains are organized by membrane curvature. The Journal of

cell biology 193, 333-346

176. Savitz, A. J., and Meyer, D. I. (1990) Identification of a ribosome receptor in the rough

endoplasmic reticulum. Nature 346, 540-544

177. Collins, P. G., and Gilmore, R. (1991) Ribosome binding to the endoplasmic reticulum: a

180-kD protein identified by crosslinking to membrane-bound ribosomes is not required

for ribosome binding activity. The Journal of cell biology 114, 639-649

178. Nunnari, J. M., Zimmerman, D. L., Ogg, S. C., and Walter, P. (1991) Characterization of

the rough endoplasmic reticulum ribosome-binding activity. Nature 352, 638-640

179. Ueno, T., Tanaka, K., Kaneko, K., Taga, Y., Sata, T., Irie, S., Hattori, S., and Ogawa-

Goto, K. (2010) Enhancement of procollagen biosynthesis by p180 through augmented

ribosome association on the endoplasmic reticulum in response to stimulated secretion.

The Journal of biological chemistry 285, 29941-29950

180. Benyamini, P., Webster, P., and Meyer, D. I. (2009) Knockdown of p180 eliminates the

terminal differentiation of a secretory cell line. Mol Biol Cell 20, 732-744

181. Becker, F., Block-Alper, L., Nakamura, G., Harada, J., Wittrup, K. D., and Meyer, D. I.

(1999) Expression of the 180-kD ribosome receptor induces membrane proliferation and

increased secretory activity in yeast. The Journal of cell biology 146, 273-284

182. Hyde, M., Block-Alper, L., Felix, J., Webster, P., and Meyer, D. I. (2002) Induction of

secretory pathway components in yeast is associated with increased stability of their

mRNA. The Journal of cell biology 156, 993-1001

183. Ueno, T., Kaneko, K., Sata, T., Hattori, S., and Ogawa-Goto, K. (2012) Regulation of

polysome assembly on the endoplasmic reticulum by a coiled-coil protein, p180. Nucleic

acids research 40, 3006-3017

184. David, A., Netzer, N., Strader, M. B., Das, S. R., Chen, C. Y., Gibbs, J., Pierre, P.,

Bennink, J. R., and Yewdell, J. W. (2011) RNA binding targets aminoacyl-tRNA

147

synthetases to translating ribosomes. The Journal of biological chemistry 286, 20688-

20700

185. Cannarozzi, G., Schraudolph, N. N., Faty, M., von Rohr, P., Friberg, M. T., Roth, A. C.,

Gonnet, P., Gonnet, G., and Barral, Y. (2010) A role for codon order in translation

dynamics. Cell 141, 355-367

186. Stephens, S. B., and Nicchitta, C. V. (2008) Divergent regulation of protein synthesis in

the cytosol and endoplasmic reticulum compartments of mammalian cells. Mol Biol Cell

19, 623-632

187. Wang, C., Washida, H., Crofts, A. J., Hamada, S., Katsube-Tanaka, T., Kim, D., Choi, S.

B., Modi, M., Singh, S., and Okita, T. W. (2008) The cytoplasmic-localized, cytoskeletal-

associated RNA binding protein OsTudor-SN: evidence for an essential role in storage

protein RNA transport and localization. Plant J 55, 443-454

188. Prydz, K., Dick, G., and Tveit, H. (2008) How many ways through the Golgi maze?

Traffic 9, 299-304

189. Schirmer, E. C., Florens, L., Guan, T., Yates, J. R., 3rd, and Gerace, L. (2003) Nuclear

membrane proteins with potential disease links found by subtractive proteomics. Science

301, 1380-1382

190. Cui, X. A., Zhang, H., and Palazzo, A. F. (2012) p180 promotes the ribosome-

independent localization of a subset of mRNA to the endoplasmic reticulum. PLoS

biology 10

191. Cui, X. A., and Palazzo, A. F. (2012) Visualization of endoplasmic reticulum localized

mRNAs in mammalian cells. Journal of visualized experiments : JoVE, e50066

192. Amthauer, R., Kodukula, K., and Udenfriend, S. (1992) Placental alkaline phosphatase: a

model for studying COOH-terminal processing of phosphatidylinositol-glycan-anchored

membrane proteins. Clinical chemistry 38, 2510-2516

193. Dejgaard, K., Theberge, J. F., Heath-Engel, H., Chevet, E., Tremblay, M. L., and Thomas,

D. Y. (2010) Organization of the Sec61 translocon, studied by high resolution native

electrophoresis. Journal of proteome research 9, 1763-1771

194. Loya, A., Pnueli, L., Yosefzon, Y., Wexler, Y., Ziv-Ukelson, M., and Arava, Y. (2008)

The 3'-UTR mediates the cellular localization of an mRNA encoding a short plasma

membrane protein. RNA 14, 1352-1365

195. Kraut-Cohen, J., Afanasieva, E., Haim-Vilmovsky, L., Slobodin, B., Yosef, I., Bibi, E.,

and Gerst, J. E. (2013) Translation- and SRP-independent mRNA targeting to the

endoplasmic reticulum in the yeast Saccharomyces cerevisiae. Mol Biol Cell 24, 3069-

3084

196. Anderson, J. R., Mukherjee, D., Muthukumaraswamy, K., Moraes, K. C., Wilusz, C. J.,

and Wilusz, J. (2006) Sequence-specific RNA binding mediated by the RNase PH

domain of components of the exosome. RNA 12, 1810-1816

148

197. Holt, C. E., and Bullock, S. L. (2009) Subcellular mRNA localization in animal cells and

why it matters. Science 326, 1212-1216

198. Martin, K. C., and Ephrussi, A. (2009) mRNA localization: gene expression in the spatial

dimension. Cell 136, 719-730

199. Cui, X. A., and Palazzo, A. F. (2014) Localization of mRNAs to the endoplasmic

reticulum. Wiley interdisciplinary reviews. RNA 5, 481-492

200. Hegde, R. S., and Keenan, R. J. (2011) Tail-anchored membrane protein insertion into the

endoplasmic reticulum. Nature reviews. Molecular cell biology 12, 787-798

201. Coassin, S. R., Orjalo, A. V., Jr., Semaan, S. J., and Johansson, H. E. (2014)

Simultaneous detection of nuclear and cytoplasmic RNA variants utilizing Stellaris(R)

RNA fluorescence in situ hybridization in adherent cells. Methods Mol Biol 1211, 189-

199

202. Luxton, G. W., Gomes, E. R., Folker, E. S., Vintinner, E., and Gundersen, G. G. (2010)

Linear arrays of nuclear envelope proteins harness retrograde actin flow for nuclear

movement. Science 329, 956-959

203. Cui, X. A., Zhang, Y., Hong, S. J., and Palazzo, A. F. (2013) Identification of a region

within the placental alkaline phosphatase mRNA that mediates p180-dependent targeting

to the endoplasmic reticulum. The Journal of biological chemistry 288, 29633-29641

204. Rolls, M. M., Stein, P. A., Taylor, S. S., Ha, E., McKeon, F., and Rapoport, T. A. (1999)

A visual screen of a GFP-fusion library identifies a new type of nuclear envelope

membrane protein. The Journal of cell biology 146, 29-44

205. Horie, C., Suzuki, H., Sakaguchi, M., and Mihara, K. (2003) Targeting and assembly of

mitochondrial tail-anchored protein Tom5 to the TOM complex depend on a signal

distinct from that of tail-anchored proteins dispersed in the membrane. The Journal of

biological chemistry 278, 41462-41471

206. Ast, T., Cohen, G., and Schuldiner, M. (2013) A network of cytosolic factors targets

SRP-independent proteins to the endoplasmic reticulum. Cell 152, 1134-1145

207. Lang, S., Benedix, J., Fedeles, S. V., Schorr, S., Schirra, C., Schauble, N., Jalal, C.,

Greiner, M., Hassdenteufel, S., Tatzelt, J., Kreutzer, B., Edelmann, L., Krause, E., Rettig,

J., Somlo, S., Zimmermann, R., and Dudek, J. (2012) Different effects of Sec61alpha,

Sec62 and Sec63 depletion on transport of polypeptides into the endoplasmic reticulum

of mammalian cells. Journal of cell science 125, 1958-1969

208. Schuldiner, M., Collins, S. R., Thompson, N. J., Denic, V., Bhamidipati, A., Punna, T.,

Ihmels, J., Andrews, B., Boone, C., Greenblatt, J. F., Weissman, J. S., and Krogan, N. J.

(2005) Exploration of the function and organization of the yeast early secretory pathway

through an epistatic miniarray profile. Cell 123, 507-519

209. Abell, B. M., Jung, M., Oliver, J. D., Knight, B. C., Tyedmers, J., Zimmermann, R., and

High, S. (2003) Tail-anchored and signal-anchored proteins utilize overlapping pathways

during membrane insertion. The Journal of biological chemistry 278, 5669-5678

149

210. Brambillasca, S., Yabal, M., Soffientini, P., Stefanovic, S., Makarow, M., Hegde, R. S.,

and Borgese, N. (2005) Transmembrane topogenesis of a tail-anchored protein is

modulated by membrane lipid composition. The EMBO journal 24, 2533-2542

211. Shibata, Y., Voss, C., Rist, J. M., Hu, J., Rapoport, T. A., Prinz, W. A., and Voeltz, G. K.

(2008) The reticulon and DP1/Yop1p proteins form immobile oligomers in the tubular

endoplasmic reticulum. The Journal of biological chemistry 283, 18892-18904

212. Nikonov, A. V., Snapp, E., Lippincott-Schwartz, J., and Kreibich, G. (2002) Active

translocon complexes labeled with GFP-Dad1 diffuse slowly as large polysome arrays in

the endoplasmic reticulum. The Journal of cell biology 158, 497-506

213. Kumar, J., Yu, H., and Sheetz, M. P. (1995) Kinectin, an essential anchor for kinesin-

driven vesicle motility. Science 267, 1834-1837

214. Verhey, K. J., Meyer, D., Deehan, R., Blenis, J., Schnapp, B. J., Rapoport, T. A., and

Margolis, B. (2001) Cargo of kinesin identified as JIP scaffolding proteins and associated

signaling molecules. The Journal of cell biology 152, 959-970

215. Alberts, A. S., Bouquin, N., Johnston, L. H., and Treisman, R. (1998) Analysis of RhoA-

binding proteins reveals an interaction domain conserved in heterotrimeric G protein beta

subunits and the yeast response regulator protein Skn7. The Journal of biological

chemistry 273, 8616-8622

216. Vignal, E., Blangy, A., Martin, M., Gauthier-Rouviere, C., and Fort, P. (2001) Kinectin is

a key effector of RhoG microtubule-dependent cellular activity. Mol Cell Biol 21, 8022-

8034

217. Nikonov, A. V., Hauri, H. P., Lauring, B., and Kreibich, G. (2007) Climp-63-mediated

binding of microtubules to the ER affects the lateral mobility of translocon complexes.

Journal of cell science 120, 2248-2258

218. Ogawa-Goto, K., Tanaka, K., Ueno, T., Tanaka, K., Kurata, T., Sata, T., and Irie, S.

(2007) p180 is involved in the interaction between the endoplasmic reticulum and

microtubules through a novel microtubule-binding and bundling domain. Mol Biol Cell

18, 3741-3751

219. Marion, R. M., Fortes, P., Beloso, A., Dotti, C., and Ortin, J. (1999) A human sequence

homologue of Staufen is an RNA-binding protein that is associated with polysomes and

localizes to the rough endoplasmic reticulum. Mol Cell Biol 19, 2212-2219

220. Wickham, L., Duchaine, T., Luo, M., Nabi, I. R., and DesGroseillers, L. (1999)

Mammalian staufen is a double-stranded-RNA- and tubulin-binding protein which

localizes to the rough endoplasmic reticulum. Mol Cell Biol 19, 2220-2230

221. Polyansky, A. A., Hlevnjak, M., and Zagrovic, B. (2013) Analogue encoding of

physicochemical properties of proteins in their cognate messenger RNAs. Nature

communications 4, 2784

222. Reid, D. W., and Nicchitta, C. V. (2015) Diversity and selectivity in mRNA translation

on the endoplasmic reticulum. Nature reviews. Neuroscience 16, 221-231

150

223. Reid, D. W., and Nicchitta, C. V. (2012) Primary role for endoplasmic reticulum-bound

ribosomes in cellular translation identified by ribosome profiling. The Journal of

biological chemistry 287, 5518-5527

224. Jagannathan, S., Reid, D. W., Cox, A. H., and Nicchitta, C. V. (2014) De novo translation

initiation on membrane-bound ribosomes as a mechanism for localization of cytosolic

protein mRNAs to the endoplasmic reticulum. RNA 20, 1489-1498

225. Law, V., Knox, C., Djoumbou, Y., Jewison, T., Guo, A. C., Liu, Y., Maciejewski, A.,

Arndt, D., Wilson, M., Neveu, V., Tang, A., Gabriel, G., Ly, C., Adamjee, S., Dame, Z.

T., Han, B., Zhou, Y., and Wishart, D. S. (2014) DrugBank 4.0: shedding new light on

drug metabolism. Nucleic acids research 42, D1091-1097

Investigation of the Ribosome Independent mRNA Localization to … · 2016-01-08 · Abstract...

Documents

Transcript of Investigation of the Ribosome Independent mRNA Localization to … · 2016-01-08 · Abstract...