Investigation 9 A “ whodunit ”
description
Transcript of Investigation 9 A “ whodunit ”
Investigation 9Investigation 9A “whodunit”A “whodunit”
Biotechnology: Restriction Enzyme Biotechnology: Restriction Enzyme Analysis of DNAAnalysis of DNA
Big Idea 3Big Idea 3Connections to Big Idea 1Connections to Big Idea 1
Investigation 9 LO’sInvestigation 9 LO’s
LO 3.5 The student can justify the claim LO 3.5 The student can justify the claim that humans can manipulate heritable that humans can manipulate heritable information by identifying at least two information by identifying at least two commonly used technologies.commonly used technologies.
LO3.13 The student is able to pose LO3.13 The student is able to pose questions about ethical, social, or medical questions about ethical, social, or medical issues surrounding human genetic issues surrounding human genetic disordersdisorders
Safety Note:Safety Note:
Power supply on last and off first!Power supply on last and off first! Don’t handle gels with bare hands.Don’t handle gels with bare hands.
manmonthly.com.au
Informational videosInformational videos
Preparing and pouring a gel.Preparing and pouring a gel. http://bcove.me/mweu5eru Loading a gelLoading a gel http://bcove.me/z1gm7u7j
Concentration MattersConcentration Matters
Gels are made with buffer!
Heat, cool to 60Heat, cool to 60°, and pour smoothly.°, and pour smoothly.
Keep reagents coldKeep reagents cold
Avoid errors when you pipette.Avoid errors when you pipette.
Practice with 10 Practice with 10 drops of glycerol or drops of glycerol or corn syrup with 50 corn syrup with 50 drops of water and drops of water and one drop of blue one drop of blue food coloring.food coloring.
Load, add water to empty wells Load, add water to empty wells then fill right below top of gelthen fill right below top of gel
No budget? Make your own.No budget? Make your own.
Pause when DNA has begun Pause when DNA has begun moving through gel, add buffer.moving through gel, add buffer.
Staining…troublesome area.Staining…troublesome area.Destaining may take large volumes of waterDestaining may take large volumes of water
Restriction EnzymesRestriction Enzymes
DNA ProfilingDNA Profiling
FoodsFoods PaternityPaternity Inherited Inherited
diseasedisease Historical Historical
questionsquestions
Question to ponder: Who owns your DNA?
Restriction EnzymesRestriction Enzymes
Restriction enzymes cut DNA at very Restriction enzymes cut DNA at very specific locations. They are very specific locations. They are very predictable, each enzyme always cutting predictable, each enzyme always cutting the same way. This characteristic is used the same way. This characteristic is used in genetic engineering.in genetic engineering.
Restriction Enzyme Cut from EcoRI
Restriction EnzymesRestriction EnzymesCut at palindromesCut at palindromes
EcoRIEcoRI GAATTCGAATTCCTTAAGCTTAAG
HindIIIHindIII AAGCTTAAGCTTTTCGAATTCGAA
PstIPstI CTGCAGCTGCAGGACGTCGACGTC
These are molecular tools!
It is really useful when they leave “sticky ends.”
Try the exercise on page S113.
http://asymptotia.com/wp-images/2008/08/e_coli.jpg
Recombinant DNARecombinant DNA
Is to “recombine.”Is to “recombine.” Yep, a new piece of DNA from knitting Yep, a new piece of DNA from knitting
pieces together.pieces together. Restriction Enzymes cutRestriction Enzymes cut Ligase “glues”Ligase “glues”
Restriction MappingRestriction Mapping
Makes a DNA fingerprint.Makes a DNA fingerprint. The fragments, cut by restriction enzymes The fragments, cut by restriction enzymes
are RFLP’s or restriction fragment length are RFLP’s or restriction fragment length polymorphisms.polymorphisms.
RFLP’s separate by size.
About LambdaAbout Lambda
Lambda DNA is from a bacteriophageLambda DNA is from a bacteriophage A bacteriophage is a virus which A bacteriophage is a virus which
infects bacteria.infects bacteria. The DNA piece is 48,502 base pairs The DNA piece is 48,502 base pairs
long.long. Within this strand are locations which Within this strand are locations which
can be cut by restriction enzymes.can be cut by restriction enzymes. These are specific locations.These are specific locations.
Uncu
tPst
IEco
RI
Hin
dIII
1 2 3 4
Hind III sample size is known and will serve as the DNA Standard.
Band #
Base pair size
HindIII
1. 23,130
2. 9,416
3. 6,557
4. 4,361
5. 2,322
6. 2,027
Distance mm
Siz
e,
base
pair
s
Use semi-log paper. The size in base pairs is graphed logarithmically.
Can you figure out Can you figure out “whodunit?”“whodunit?”
Use the provided samples and Use the provided samples and give it a shot.give it a shot.
Motive, means, opportunity, DNA Motive, means, opportunity, DNA evidence.evidence.
Thinking About Your ResultsThinking About Your Results
Choose one ethical problem from page Choose one ethical problem from page S123.S123.
Research and write about it.Research and write about it.