Investigating the Genetics and Physiology of Naphthenic ...

University of Calgary

PRISM: University of Calgary's Digital Repository

Graduate Studies The Vault: Electronic Theses and Dissertations

2020-05-12

Investigating the Genetics and Physiology of

Naphthenic Acid Remediation in Plants

Wong, Jeremy Jordon

Wong, J. J. (2020). Investigating the Genetics and Physiology of Naphthenic Acid Remediation in

Plants (Unpublished master's thesis). University of Calgary, Calgary, AB.

http://hdl.handle.net/1880/112053

master thesis

University of Calgary graduate students retain copyright ownership and moral rights for their

thesis. You may use this material in any way that is permitted by the Copyright Act or through

licensing that has been assigned to the document. For uses that are not allowable under

copyright legislation or licensing, you are required to seek permission.

Downloaded from PRISM: https://prism.ucalgary.ca

UNIVERSITY OF CALGARY

Investigating the Genetics and Physiology of Naphthenic Acid Remediation in Plants

by

Jeremy Jordon Wong

A THESIS

SUBMITTED TO THE FACULTY OF GRADUATE STUDIES

IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE

DEGREE OF MASTER OF SCIENCE

GRADUATE PROGRAM IN BIOLOGICAL SCIENCES

CALGARY, ALBERTA

MAY, 2020

© Jeremy Jordon Wong 2020

ii

Abstract

Surface mining of bitumen in the Northern Alberta oil sands produces large volumes of oil sands

process-affected water (OSPW). OSPW is toxic to many living organisms, and this toxicity is

primarily attributed to a class of organic compounds collectively known as naphthenic acids

(NAs). Remediation of NAs is required to meet future water release criteria. This thesis research

was aimed at identifying plant genes that are involved in NA tolerance using a novel genetic

screen, as well as providing insights into the physiological capacity of plants to take up and

possibly biotransform NAs. Six NA tolerant mutants were identified, and the altered region of

the genome was identified for four of the mutants. Experiments using labeled NAs were carried

out on a native grass species to determine NA uptake efficiency and distribution in roots and

shoots. This research provides a framework for identifying NA tolerance genes and quantifying

the uptake and biotransformation of NAs in plants.

iii

Acknowledgements

I would like to thank my supervisor, Dr. Douglas Muench, for his endless support in

supervising me as both an undergraduate and a graduate student. He provided me with a great

opportunity to pursue interesting research. He was always there to teach, guide and encourage

me throughout these past five years. Thanks to my committee member, Dr. Marcus Samuel for

allowing me to get my initial exposure to research, as well as guiding my graduate research.

Thanks to my committee member, Dr. Raymond Turner, for sharing his fresh insights regarding

my research direction. I would also like to thank Dr. Ed Yeung for advising me throughout my

undergraduate and graduate programs. Thank you to my external examiner, Dr. David Bird, for

taking the time to be part of my examination committee.

Thanks to all of the members of the Muench lab I have had the pleasure of working with

these past years. In particular, thanks to Mitchell Alberts for sharing his vast knowledge of this

project. His direct contributions that made this thesis possible and he was always there to talk

about anything. I would like to thank Steven Olsen for being so welcoming and having the

patience to introduce to me to the project, and Dr. Gillian Dean for her help in guiding my

undergraduate research. Thanks Dilini, Chris, Xin, Chi, Johanna, Jacob, Adam and Sylvia. I

couldn’t have asked for better lab mates.

Thanks to Abhi, Siyu, Logan, Joseph, Connor, Matija, Neil, Amy, Sabine and Jamshed

for the countless times you have all helped me throughout these years.

I would like to thank my parents, Edie and Augustine, and my brother, Christopher, for

all of their support. Lastly, thank you Belinda for always being there for me. You always knew

how to brighten my day when it got challenging and I couldn’t have done it without you.

iv

Table of Contents

Abstract ............................................................................................................................... ii

Acknowledgements ............................................................................................................ iii

Table of Contents ............................................................................................................... iv

List of Tables ..................................................................................................................... vi

List of Figures and Illustrations ........................................................................................ vii

List of Symbols, Abbreviations and Nomenclature ........................................................... ix

CHAPTER ONE: INTRODUCTION ..................................................................................1

1.1 The Northern Alberta Oil Sands ................................................................................1

1.2 Oil sands process-affected water ...............................................................................2

1.2.1 The composition of OSPW ................................................................................2

1.2.2 Toxicity of OSPW and naphthenic acids...........................................................4

1.3 Conventional non-biological NA remediation approaches ........................................7

1.4 Phytoremediation .......................................................................................................8

1.4.1 Benefits to phytoremediation ............................................................................8

1.4.2 Phytoextraction ..................................................................................................8

1.4.3 Phytodegradation/Rhizodegradation .................................................................9

1.4.4 Phytostabilization ............................................................................................11

1.4.5 Phytovolatilization ...........................................................................................11

1.4.6 Rhizofiltration/Phytofiltration .........................................................................12

1.5 Bioremediation approaches to NA degradation .......................................................13

1.5.1 Microbial and algal NA remediation ...............................................................13

1.5.2 Plant-mediated degradation .............................................................................14

1.6 Species under research .............................................................................................15

1.6.1 Arabidopsis ......................................................................................................15

1.6.2 Elymus trachycaulus ........................................................................................16

1.7 Hypothesis and objectives .......................................................................................17

CHAPTER TWO: MATERIALS AND METHODS ........................................................18

2.1 Plant material ...........................................................................................................18

2.1.1 Arabidopsis and slender wheatgrass ................................................................18

2.2 Arabidopsis genetic screen ......................................................................................18

2.2.1 NA and herbicide resistance growth plates .....................................................18

2.2.2 Genetic screen .................................................................................................19

2.3 DNA extraction methods .........................................................................................20

2.4 TAIL-PCR ...............................................................................................................22

2.5 Targeted gene sequencing for T-DNA insertion analysis ........................................26

2.6 Gene expression studies using Reverse Transcription Quantitative PCR ...............28

2.6.1 RNA extraction ................................................................................................28

2.6.2 cDNA synthesis ...............................................................................................28

2.6.3 RT-qPCR .........................................................................................................29

2.7 Sterile plant growth methodology ............................................................................31

2.7.1 Streptomycin agar plates and Falcon tube preparation ....................................31

2.7.2 Growth of sterile wheatgrass ...........................................................................31

2.7.3 Plant sterility testing using YES, TSA and LB plates .....................................33

v

2.7.4 Radiolabeled 14C-NA uptake..........................................................................33

CHAPTER THREE: CHARACTERIZATION OF NAPHTHENIC ACID TOLERANT

ARABIDOPSIS ACTIVATION-TAGGED MUTANTS.........................................36

3.1 Introduction ..............................................................................................................36

3.2 Results ......................................................................................................................39

3.2.1 Screen summary and characterization of the selected NA tolerant Arabidopsis

lines ..................................................................................................................39

3.2.2 PCR genotyping using genomic DNA ............................................................44

3.2.3 Characterization of the T-DNA insertion sites using TAIL-PCR ...................46

3.2.4 Characterization of mutants using targeted gene sequencing ..........................49

3.2.5 Reverse-Transcription Quantitative PCR analysis to determine gene expression

levels of genes flanking the T-DNA insertions................................................65

3.3 Discussion ................................................................................................................71

CHAPTER FOUR: VISUALIZATION OF RADIOACTIVELY LABELLED NA UPTAKE

IN SLENDER WHEATGRASS (ELYMUS TRACHYCAULUS) .............................77

4.1 Introduction ..............................................................................................................77

4.2 Results ......................................................................................................................78

4.2.1 Radioactive NAs used in these experiments ...................................................78

4.2.2 Generation of microbe-free slender wheatgrass seedlings ..............................79

4.2.3 Visualization of NA uptake in slender wheatgrass ..........................................81

4.2.4 Semi-quantitative analysis of NA uptake in slender wheatgrass .....................84

4.3 Discussion ................................................................................................................87

4.3.1 Acknowledgement ...........................................................................................91

CHAPTER FIVE: DISCUSSION AND FUTURE DIRECTIONS ...................................92

5.1 Overall synopsis of the research ..............................................................................92

5.2 Future Directions .....................................................................................................94

5.2.1 Mutant identification and the molecular mechanisms responsible for mutant NA

tolerance ...........................................................................................................94

5.2.2 Radioactive NA studies ...................................................................................95

REFERENCES ..................................................................................................................98

APPENDIX ......................................................................................................................111

vi

List of Tables

Table 2.1: Primers used in TAIL-PCR and heritability analysis. ................................................. 24

Table 2.2: Single Reaction for Primary TAIL-PCR ..................................................................... 25

Table 2.3: Single Reaction for Secondary TAIL-PCR ................................................................. 25

Table 2.4: Single Reaction for Tertiary TAIL-PCR ..................................................................... 25

Table 2.5: Primers used for RT-qPCR .......................................................................................... 30

Table 2.6: Half-strength Hoagland solution.................................................................................. 34

Table 3.1: Percent growth on AdCA and DH2NA of lines that passed the secondary screen ...... 41

Table 3.2: Percentage of seeds demonstrating strong growth phenotypes on NA, Basta and

0.5X MS agar plates. ............................................................................................................. 43

Table 3.3: Percentage of seeds demonstrating strong growth phenotypes on Basta and 0.5X

MS agar plates. ...................................................................................................................... 45

Table 3.4: Summary of the Basta PCR results and comparison to Basta assay. ........................... 48

Table 3.5: Primers used to estimate the location of the T-DNA truncation in CS23152 A2-1. ... 61

Table 3.6: Primers used in targeted gene sequencing to determine T-DNA insertion sites. ........ 62

Table 3.7: Summary of targeted gene sequencing data obtained from CS23152 A2-1 to

determine truncation site. ...................................................................................................... 64


determine truncation site. ...................................................................................................... 64

Table 3.9: Summary of the T-DNA Insertion sites in NA tolerant Arabidopsis .......................... 66

vii

List of Figures and Illustrations

Figure 1.1: Examples of classical naphthenic acids........................................................................ 3

Figure 1.2: Distribution of NAs obtained from an OSPW sample. ................................................ 4

Figure 2.1: The pSKI015 vector used to generate libraries of activation-tagged lines of

Arabidopsis. .......................................................................................................................... 19

Figure 2.2: Overview of the activation-tag genetic screen procedure. ......................................... 21

Figure 2.3: Diagram illustrating TAIL-PCR. ................................................................................ 24

Figure 2.4: Diagram illustrating the targeted gene sequencing workflow to determine the T-

DNA insertion sites in selected mutant Arabidopsis lines. ................................................... 27

Figure 2.5: Schematic diagram of slender wheatgrass growth in sterile hydroponic NA uptake

experiments. .......................................................................................................................... 32

Figure 3.1: Structures of AdCA and DH2NA. .............................................................................. 38

Figure 3.2: Example of positive primary screen and secondary screens. ..................................... 40

Figure 3.3: CTAB DNA preparations carried out on 20 seedlings for each listed mutant. .......... 47

Figure 3.4: Confirmation of the presence of the Basta marker in the genomic DNA of

progeny from mutants using PCR. ........................................................................................ 48

Figure 3.5: TAIL-PCR reactions for CS23838 D1. ...................................................................... 50

Figure 3.6: Sequence of the T-DNA insertion site in the GL-2 gene intron in line CS23838

D1-3. ..................................................................................................................................... 51

Figure 3.7: Unknown TAIL-PCR products. ................................................................................. 52

Figure 3.8: CS23838 D1-3 T-DNA insertion locus determined using targeted gene

sequencing. ............................................................................................................................ 54

Figure 3.9: CS23152 A1-6 T-DNA insertion locus determined using targeted gene

sequencing. ............................................................................................................................ 55

Figure 3.10: The first of three T-DNA insertion loci in CS23127 A1-2 determined using

targeted gene sequencing. ..................................................................................................... 56

Figure 3.11: The second of three T-DNA insertion loci in CS23127 A1-2 determined using


Figure 3.12: The third of three T-DNA insertion loci in CS23127 A1-2 determined using


viii


sequencing. ............................................................................................................................ 59

Figure 3.14: Determining the approximate location of the truncation in CS23152 A2-1. ........... 61

Figure 3.15: Map of the primers used in targeted gene sequencing to determine the truncation

site of the T-DNA in CS23152 A2-1. ................................................................................... 63

Figure 3.16: Map of the primers used in targeted gene sequencing to determine the truncation

site of the T-DNA in CS31166 A1-1. ................................................................................... 63

Figure 3.17: Schematic summary of T-DNA insertion sites in genomic DNA of NA-tolerant

mutants. ................................................................................................................................. 67

Figure 3.18: RT-qPCR analysis of genes flanking the T-DNA insertion in mutant CS23127

A1-2 ...................................................................................................................................... 69


A1-20-3. ................................................................................................................................ 70

Figure 3.20: RT-qPCR analysis of genes flanking the T-DNA insertion in CS23152 A1-20-3. . 71

Figure 4.1: Structures of the five NAs used in the wheatgrass uptake experiments. .................... 79

Figure 4.2: Verification of seed extract sterility using TSA and YES plates. ............................. 80

Figure 4.3: Verification of seed extract sterility using LB plates. ............................................... 81

Figure 4.4: Phosphor images depicting the uptake of 14C-HA and 14C-DA by slender

wheatgrass. ............................................................................................................................ 82

Figure 4.5: Phosphor image depicting the uptake of CPCA, CHCA and AdCA in slender

wheatgrass. ............................................................................................................................ 83

Figure 4.6: Distribution of total radioactive counts in slender wheatgrass roots, shoots and

nutrient solution. ................................................................................................................... 85

Figure 4.7: Percentage of radioisotope remaining with and without wheatgrass in the sample

tubes. ..................................................................................................................................... 86

Figure 4.8: Mean translocation factor of radiolabeled NA uptake in sterile slender

wheatgrass. ............................................................................................................................ 87

ix

List of Symbols, Abbreviations and Nomenclature

Symbol Definition

ABC ATP-Binding Cassette

AdCA 1-Adamantanecarboxylic acid

AD Arbitrary Degenerate

AEO Acid-Extractable Organic

AOP Advanced Oxidation Process

APRR2 Pseudo-Response Regulator 2

BTEX Benzene, Toluene, Ethyl Benzene, Xylene

CaMV Cauliflower Mosaic Virus

CHCA Cyclohexanecarboxylic Acid

CHWE Clark Hot Water Extraction

CML9 Calmodulin-like Protein 9

Col-2 Columbia-2

Col-7 Columbia-7

CPCA Cyclopentanecarboxylic Acid

CYP Cytochrome P450

DA Decanoic Acid

DH2NA Decadro-2-naphthoic acid

DMSO Dimethyl Sulfoxide

dNTP Deoxynucleoside triphosphate

EDTA Ethylenediaminetetraacetic acid

ESI Electrospray Ionization

FTICR-MS Fourier Transform Ion Cyclotron Resonance Mass Spectrometry

GST Glutathione S-Transferase

HA Hexanoic Acid

HIPP25 Heavy Metal Associated Isoprenylated Plant Protein 25

HMA Heavy-Metal Binding Domain

LB Left Border

LC50 Lethal Concentration

LUH Leunig Homolog

MES 2-(N-morpholino)ethanesulfonic acid

M-MLV RT Moloney Murine Leukemia Virus Reverse Transcriptase

MS Murashige and Skoog

NA Naphthenic Acid

NaOH Sodium Hydroxide

NO3- Nitrate

OSPW Oil Sands Process-Affected Water

PAH Polycyclic Aromatic Hydrocarbon

PHC Petroleum Hydrocarbon

pKa Acid Dissociation Constant

PMEI6 Pectin Methylesterase Inhibitor 6

RT-qPCR Reverse-Transcription Quantitative PCR

RB Right Border

x

RDX Hexahydro-1,3,5-trinitro-1,3,5-triazine

SAGD Steam Assisted Gravity Drainage

SAM S-adenosyl-L-methionine-dependent methyltransferases protein

SRPB S-ribonuclease binding protein family protein

TAIL-PCR Thermal Asymmetric Interlaced PCR

T-DNA Transfer-DNA

TE-8 Tris-EDTA pH 8.0

TNT 2,4,6-trinitrotoluene

TSA Tryptic Soy Agar

UGT UDP-Dependent Glycosyltransferase

UTR Untranslated Region

UV Ultraviolet

v/v Volume Percent

YES Yeast Extract Sugar

1

Chapter One: Introduction

1.1 The Northern Alberta Oil Sands

The Northern Alberta oil sands represents the third largest oil reserve in the world,

surpassed only by the reserves present in Venezuela and Saudi Arabia. The Alberta oil sands are

comprised of three regions (Athabasca, Peace River and Cold Lake) that cover an area greater

than 142,000 km2. These three deposits contain an estimated 1.7 trillion barrels of crude bitumen,

~170 billion barrels of which are extractable using current techniques (OSDC, 2016; CAPP,

2019). Two methods are used to extract bitumen from the oil sands. In situ extraction involves

steam assisted gravity drainage (SAGD), where steam is injected into reserves that are too deep

to be mined. Steam injection lowers the viscosity of bitumen, causing it to drain into the lower

wellbore. The emulsion of water and bitumen is pumped to the surface where the water is

separated from the bitumen. Roughly 80% of the extractable bitumen in the Alberta oil sands is

accessible using SAGD (CAPP, 2019). Surface mining of oil sands is another extraction process

that is used exclusively in the Alberta oil sands and is used to extract bitumen to a depth of 70

metres from the surface. Approximately 20% of Alberta oil sands bitumen is recoverable by

mining approaches (CAPP, 2019). The Clark Hot Water Extraction process is used to recover

bitumen from mined ore using hot water and caustic soda (Allen, 2008). The added salts promote

the release of surfactants and improves the release of bitumen. Surface mining is a water-

intensive process. The net use of water is approximately two barrels of water per barrel of

bitumen (CAPP, 2019). This oil sands process-affected water (OSPW) is stored in tailings

storage facilities, often referred to as tailings ponds.

Tailings ponds and their associated structures span an estimated area of 220 km2 (CAPP,

2019), and the volume of OSPW is in excess of 1 billion m3 (Mahaffey and Dubé, 2016). A strict

2

zero-discharge policy for OSPW is enforced by the Government of Alberta (OAP, 2010).

Seepage of OSPW into groundwater, erosion of soil surrounding tailings ponds, and accidental

spills have the potential to cause detrimental effects on downstream ecosystems (Fennell and

Arciszewski, 2019). Volatile organic compounds, reduced sulphur compounds, and methane can

be released from the surface tailings ponds and contribute to air pollution emissions (Small et al.,

2015).

1.2 Oil sands process-affected water

1.2.1 The composition of OSPW

OSPW contains residual bitumen, sand, clay, salts, metals, and organic components. The

organic components consist of polycyclic aromatic hydrocarbons (PAHs), BTEX (benzene,

toluene, ethyl benzene, xylenes) compounds, phenols and naphthenic acids (NAs). NAs are the

primary contributors to OSPW toxicity, though polar neutral compounds also contribute to

toxicity (Morandi et al., 2015). NAs are a class of alkyl-substituted acyclic and cyclic aliphatic

carboxylic acids that follow the general formula CnH2n+ZO2, where n represents the number of

carbon atoms and Z is a negative even integer that represents hydrogen deficiency due to cyclic

structures (Clemente and Fedorak, 2005). These classical NAs typically have molecular masses

in the range of 120-700 and contain 9 to 20 carbon atoms (Zhang et al., 2011) (Figure 1.1 and

Figure 1.2). The acid extractable organic (AEO) fraction from OSPW contains additional organic

compounds that possess sulfur and nitrogen heteroatoms and oxy-naphthenic acids (oxy-NAs)

(Grewer et al., 2010; Bowman et al., 2019). Oxy-NAs have the general formula of CnH2n+ZOx,

where X = 3, 4, or 5. These NAs have undergone mild oxidation, thus can be used as a marker

3

Figure 1.1: Examples of classical naphthenic acids. R refers to an alkyl chain, Z refers to the

hydrogen deficiency and m is the number of CH2 units. Whitby, 2010.

for partial degradation (Wang et al., 2013).

NAs likely originated from incomplete aerobic biodegradation of petroleum

hydrocarbons (Grewer et al., 2010; Kannel and Gan, 2012). The composition of the NA fraction

of OSPW is affected by the age of the tailings. The lower molecular weight NAs represent a

higher percentage of the NA fraction in fresh OSPW, compared to complex NAs that have

increased alkyl branching. Conversely, aged OSPW contains a higher ratio of complex NAs to

low molecular weight NAs (Frank et al., 2008). Low molecular weight NAs are more susceptible

to degradation by microbes, while the more complex NAs are recalcitrant. Cyclization results in

higher NA recalcitrance (Han et al., 2008).

4

Figure 1.2: Distribution of NAs obtained from an OSPW sample. GC-MS was used to

categorize NAs. The x-axis represents the carbon number; the y-axis represents the percentage of

NA in the sample; the z-axis represents the hydrogen deficiency. Clemente and Fedorak, 2005.

1.2.2 Toxicity of OSPW and naphthenic acids

NAs have chronic and acute toxicity effects on fish, plants, algae and other organisms

(Leishman et al., 2013; Marentette et al., 2015; Li et al., 2017). The concentration, complexity

and variety of NAs in OSPW varies between samples, although a higher concentration of NA

does not necessarily reflect higher toxicity. OSPW demonstrates acute toxicity to animals such as

rainbow trout (LC50 < 10% v/v) and rats (LC50 = 3.0 g/kg of body weight) (Headley and

McMartin, 2004; Whitby, 2010). Developmental changes in fathead minnow resulting from AEO

exposure range from cardiovascular abnormalities to fin wrinkling, as well as increased embryo

5

mortality rates (Marentette et al., 2015). In vitro assays have also been used to investigate the

toxicity of OSPW. Microtox bioassays, which measure bioluminescence of the bacterium Vibrio

fischeri, demonstrated that fresh OSPW is less toxic (IC50 24%-67% v/v) than naturally aged

OSPW (IC50 64%-100% v/v) (Li et al., 2017). More recently, a biomimetic assay that allows for

quantification of toxicity resulting from OSPW organic compounds has been developed

(Redman et al., 2018). These assays use solid phase microextraction fibers coated in

polydimethylsiloxane that organic compounds partition onto, thereby mimicking partitioning of

NAs into lipid membranes. In tandem with toxicity studies using aquatic organisms and known

organic acids, this assay provides an accurate measure of OSPW toxicity.

NAs also have a negative effect on plant growth. When exposed to increasing NA

concentrations that ranged from 0 mg/L to 300 mg/L, aspen seedlings demonstrated lower

photosynthetic rates, leaf chlorophyll concentration, root O2 uptake and leaf expansion ratios

(Kamaluddin and Zwiazek, 2002). Water conductance in plants, as well as germination rates of

seeds, are also negatively impacted by NAs (Apostol et al., 2004). Ionization states of NAs have

significant effects on toxicity. In a study using cattail (Typha latifolia), common reed

(Phragmites australis) and bulrush (Scirpus acutus), plants were exposed to 30 mg/L and 60

mg/L of AEO treatment at pH 5.0 or 7.8 (Armstrong et al., 2009). The pKa for NAs ranges from

5.0-6.0, making the NAs primarily nonionized at pH 5.0 and primarily ionized at pH 7.8

(Headley and McMartin, 2004). After 30 days of treatment, there was a significant decrease in

fresh weight in all three plant species at both NA concentrations for the pH 5.0 treatment

(Armstrong et al., 2009). For the pH 7.8 treatments, the only significant decrease was observed

in common reed at 60 mg/L AEO treatment. A study examining the growth effects of NAs on the

model plant Arabidopsis thaliana (Arabidopsis) also demonstrated that nonionized NAs are more

6

phytotoxic than the ionized forms (Leishman et al., 2013). Primary root length of 17 day-old

Arabidopsis seedlings was significantly impaired when grown on NA-containing plates at pH 5.0

compared to seedlings grown at pH 7.8.

The surfactant properties of NAs are thought to contribute to cellular toxicity. The

amphipathic (hydrophobic and hydrophilic) properties of NAs may allow them to disrupt the

lipid bilayer of the cell membrane in a process known as narcosis. This alters the surface tension,

fluidity and thickness of membranes (Frank et al., 2009). Increases in complexity and size of

NAs are correlated with an increase in toxicity. This may be attributed to larger regions of

hydrophobicity integrating more easily into the cellular membrane, and larger molecules being

physically more disruptive. Additionally, since the more complex NAs tend to be more

recalcitrant, the most toxic NAs are the most difficult to degrade (Johnson et al., 2011; Demeter

et al., 2015). In their nonionized form, NAs are non-polar (thus lipid-soluble) which seems to

allow them to be more readily absorbed by plant roots. Exposure of plant epidermal cells to NAs

results in a disrupted structure of several membrane-bound organelles, implying the destructive

effects of NAs on membrane integrity and function (Alberts et al., 2019). In addition, an ion-trap

mechanism (Briggs et al., 1998) may explain the increase in toxicity of NAs. In this model, non-

ionized NAs in a low pH extracellular environment can easily enter cellular membranes. At high

concentration, these membrane-associated NAs could move into the cell cytosol. The higher

cytosolic pH environment causes NAs to convert to their ionized form, thereby trapping the NAs

in the cytosol and altering internal cellular processes (Armstrong et al., 2009).

7

1.3 Conventional non-biological NA remediation approaches

Non-biological methods of NA remediation of OSPW include advanced oxidation

processes (AOP), flocculation, adsorption and membrane filtration (Quinlan and Tam, 2015).

Advanced oxidation involves the production of highly reactive organic radicals (most commonly

hydroxyl radicals) which oxidize organic compounds, including NAs and phenols (Qin et al.,

2019). Radicals can be generated by UV irradiating photocatalysts such as TiO2 and HOCl.

Ozonation and gamma irradiation provide alternative methods of producing radicals. A

disadvantage to using AOPs includes incomplete degradation of compounds, which may

potentially lead to the production of more toxic compounds. Another drawback is that UV

radiation cannot penetrate deep into OSPW (Kannel and Gan, 2012). Additionally, when

deployed on a large scale, photolysis is expensive to operate (Oller et al., 2011).

Flocculation is an industrial method that can be used to remediate OSPW. This process

involves the addition of coagulants, such as aluminium sulphate, to produce small particles that

result from electrostatic interactions between the coagulant and the NAs, which then

conglomerate into a larger floc and settle (Wu et al., 2019). Similar to AOPs, a constant supply

of costly chemicals must be provided for continuous NA remediation. Membrane filtration is an

NA remediation approach that utilizes a filter to either physically or electrostatically separate

organic compounds from OSPW (Quinlan and Tam, 2015). However, maintenance of the filters

would be intensive and challenging to use on an industrial scale. Removal of NAs using

adsorption involves the addition of small granules of activated carbon or biochar to OSPW. Due

to the high surface area of the activated carbon, this results in high NA adsorption efficiency

(Mohamed et al., 2008). Drawbacks to this approach include the large expenses required to

8

produce activated carbon with sufficiently high surface area to be effective (Quinlan and Tam,

2015).

1.4 Phytoremediation

1.4.1 Benefits to phytoremediation

Phytoremediation provides an environmentally friendly and cost-effective method of

removing contaminants. Phytoremediation of contaminated sites often involves re-vegetation

with a diverse community of native plant species resulting in the removal of contaminants

through metabolism, sequestration or volatilization. Plants provide erosion control, promote soil

fertility by providing nutrients for other plants, and enrich microbial communities with root

exudates (Doty et al., 2017; Gerhardt et al., 2017; Frédette et al., 2019). The passive nature of

phytoremediation makes it a desirable remediation approach. Once plant communities are

established, the upkeep required to maintain the system is minimal.

1.4.2 Phytoextraction

Phytoextraction is a phytoremediation process in which plants take up dissolved

contaminants surrounding their roots and sequester them in above-ground tissues such as leaves

(Touceda-González et al., 2017). Sites contaminated with metals are more commonly remediated

using phytoextraction, as the metals cannot undergo further degradation. Phytoextraction

requires harvesting of plant tissues, incineration and replanting additional material to effectively

remediate contaminated regions (Mahar et al., 2016). Hyperaccumulator plants can take up large

quantities of metals without suffering from phytotoxic effects. Naturally occurring chelating

agents, such as phytochelatins (Cobbett, 2000), are synthesized by plants in the presence of

heavy metal ions. Phytochelatins increase the availability of metal ions, though it is possible to

9

supplement soils with additional chelating agents such as EDTA to enhance this effect. Chelators

work by binding to the metal ions to form a chelate-metal complex. This reduces the electrostatic

forces between the negatively charged surface of soil particles and the positively charged metal

ion, and allows for increased uptake into the plant roots. The chelate-metal complexes are then

transported from the roots to the shoots by metal transporters, such as HEAVY METAL

ATPASE 4 (HMA4) (Hanikenne et al., 2008). HMA4 transports zinc and cadmium and is

expressed in xylem cells in the presence of heavy metals. Expression of HMA4 promotes

expression of zinc deficiency response genes such as ZIP4 and IRT3 in the roots of the plant,

which in turn promote root-to-shoot translocation of the chelate-metal complex.

1.4.3 Phytodegradation/Rhizodegradation

Phytodegradation is a phytoremediation strategy by which plants take up contaminants

from the soil and, using plant metabolic pathways, degrade the contaminants. Plants secrete

nutrients from their roots to cultivate different types of bacteria and fungi. These rhizospheric

microorganisms can also contribute to contaminant degradation in a process known as

rhizodegradation (Newman and Reynolds, 2004; Doty et al., 2017; Repas et al., 2017). Both

phytodegradation and rhizodegradation are suited for remediating sites that have been

contaminated with organic compounds. For example, both strategies can remediate areas

contaminated with petroleum hydrocarbons (PHCs) that are derived from crude oil.

Metabolism of foreign compounds (xenobiotics) in plants involves three different phases:

transformation, conjugation and compartmentalization (Reichenauer and Germida, 2008;

Abhilash et al., 2009). Transformation of xenobiotics involves oxidation, reduction or hydrolysis

to make the xenobiotic polar and more water soluble. The cytochrome P450 (CYP) enzyme

family is most commonly involved in this process. These enzymes function as monooxygenases

10

by adding an oxygen atom to hydrophobic molecules (Bernhardt, 2006). The purpose of

transformation is to increase the reactivity of the xenobiotic so it can be conjugated to other

molecules in the conjugation phase, where the xenobiotic is conjugated to a sugar or peptide.

This converts the xenobiotic to a form that is less phytotoxic and more efficiently transported

during the compartmentalization phase. Enzymes such as glutathione S-transferases (GSTs) and

UDP-dependent glycosyltransferases (UGTs) are involved in conjugation. GSTs bind

xenobiotics to the tripeptide glutathione, and UGTs bind xenobiotics to UDP-glucose (Abhilash

et al., 2009). Once conjugated, the xenobiotics are compartmentalized to either the vacuole for

storage, or can be deposited elsewhere, including the cell wall (Reichenauer and Germida, 2008).

The use of plants to remediate soils contaminated with petroleum hydrocarbons (PHCs)

may be direct through plant cellular metabolic pathways, but more often by providing an

environment for microorganisms to thrive. Plants improve soil quality by regulating soil pH, as

well as secreting amino acids and carbohydrates to promote microbial growth. They also provide

soil moisture and gas exchange. Conversely, microbes contribute symbiotically to

phytoremediation by promoting plant growth or metabolizing contaminants directly (Hall et al.,

2011). Bacterial species that are commonly associated with PAH remediation include

Pseudomonas aeruginosa and Pseudomonas fluorescens, as well as species of Mycobacterium,

Haemophilus and Rhodococcus (Bisht et al., 2015). Analysis of PAH degradation in a mesocosm

study using Orychophragmus violaceus amended with Rhodococcus ruber EM1 demonstrated

significantly higher PAH degradation (greater than 50% increase) relative to non-augmented

treatment (Kong et al., 2018). Reverse-transcription quantitative PCR (RT-qPCR) results from

this study showed that PAH ring-hydroxylating dioxygenase genes in Rhodococcus were

11

upregulated up to four times higher in the plant-associated Rhodococcus treatment compared to

Rhodococcus alone.

1.4.4 Phytostabilization

Phytostabilization is a phytoremediation strategy in which plants are used to sequester

contaminants in the environment. Here, plants immobilize the contaminants in the rhizosphere,

which can prevent contaminants from spreading in the environment (Mahar et al., 2016).

Exudates in the rhizosphere can reduce the availability of metals through adsorption, while roots

physically prevent erosion (Mendez and Maier, 2008). Species used in phytostabilization must

also tolerate harsh growth conditions and the compound(s) of interest, as sites tend to have few

nutrients, high salt levels and extreme pH levels (Mendez and Maier, 2008). Plant species that

produce large amounts of biomass, along with extensive, dense root systems are ideal

phystabilization candidates. A study examining the ability of 51 different plant species in treating

a manganese mining site via phytostabilization led to the identification of eight species

(including Alternanthera philoxeroides, Artemesia princeps, Bidens frondosa) that were ideal

candidates for phytostabilization (Yang et al., 2014). These species significantly accumulated

lower concentrations of Cd, Mn, Pb and Zn (bioconcentration factor < 1) showing that they

excluded metals from entering from the environment. These species were also able to rapidly re-

vegetate sites with poor fertility.

1.4.5 Phytovolatilization

During phytovolatilization, plants take up contaminants from the soil, and through

transpiration, release them into the air. Phytovolatilization relies on dilution of organic and

inorganic contaminants into the air. While organic compounds are more commonly remediated

with this strategy, arsenic and mercury have been volatilized from plants (Sakakibara, 2010).

12

Volatile, hydrophobic organic compounds such as chlorinated ethenes and BTEX compounds

have been efficiently removed from soil using phytovolatilization (Imfeld et al., 2009). There are

two different categories of phytovolatilization. Direct phytovolatilization occurs when

contaminants are taken up from the soil into the roots, and are eventually translocated through

vascular tissues and expelled through leaves via stomata or the trunk through lenticels and the

periderm (Limmer and Burken, 2016). Indirect phytovolatilization is the result of plant roots

increasing the flux of volatile contaminants through water movement induced by roots. This

affects soil permeability and gas flux which can allow compounds to volatilize through the soil

(Limmer and Burken, 2016). Both direct and indirect phytovolatilization are affected by

environmental factors such as pressure and precipitation.

1.4.6 Rhizofiltration/Phytofiltration

Rhizofiltration (or phytofiltration) involves the sequestration of contaminants from

aquatic environments in the root system (Vishnoi and Srivastava, 2008). Whereas

phytoextraction refers to soil-based remediation, rhizofiltration is wetlands-based. Rhizofiltration

is frequently used to remove metal contaminants from water, though it can be applied to organic

compound remediation as well (Vymazal, 2013). In constructed wetlands, macrophytes

contribute to the metabolism of contaminants as well as providing a physical infrastructure that

contributes to the remediation of water. Above-ground plant tissues can reduce wind speeds

which accelerates the rate at which sedimentation occurs, as well as providing subsurface

structures on which microorganisms can grow (Vymazal, 2013). The root tissue also physically

filters the wastewater to prevent movement of particulate matter. Species that are commonly

used in free-water surface constructed wetlands include Phragmites spp., Typha spp., Scirpus

spp. and Juncus spp. (Wu et al., 2015).

13

1.5 Bioremediation approaches to NA degradation

1.5.1 Microbial and algal NA remediation

β-oxidation, α-oxidation, and aromatization pathways are potential mechanisms that

microbes use to degrade NAs (Whitby, 2010). β-oxidation is a catabolic process whereby fatty

acid molecules are split into acetyl-CoA and a fatty acid molecule that has two fewer carbons.

While β-oxidation is primarily associated with fatty acid catabolism, the structural similarities

shared between NAs and fatty acids (both have a long carbon chain and carboxyl group) allow

NAs to be used as a substrate of β-oxidation. Removal of the two carbons yields a shorter NA

that can be further oxidized through another cycle of β-oxidation. This process continues until

the last product cannot be catabolized by β-oxidation. An alternative pathway would then be

required to further metabolize the compound. Bacteria may also use α-oxidation, which removes

a single carbon to make substrates amenable for further degradation using β-oxidation (Rontani

and Bonin, 1992). Degradation of NAs through aromatization involves the transformation of an

alicyclic ring into an aromatic intermediate, which is then cleaved, resulting in breakage of the

ring structure (Blakley, 1974). The ability of aerobic microbes to degrade model lower molecular

weight NAs has been well-documented, though larger more highly branched NAs are more

recalcitrant and therefore more difficult to degrade (Holowenko et al., 2002; Clemente et al.,

2004; Demeter et al., 2015). While NAs obtained from OSPW pose a higher degree of difficulty

to metabolize than commercial NA mixtures, these commercial mixtures have been used to

identify microbial species that have NA degradative abilities (Scott et al., 2005).

Along with bacteria, algae are also present in OSPW. Algal species have previously been

shown to tolerate NA concentrations > 100 mg/L (Quesnel et al., 2011). Algae have the ability to

degrade labile NAs such as cyclohexanebutyric acid and cyclohexanepropionic acid via the β-

14

oxidation pathway, resulting in the production of cyclohexaneacetic acid and

cyclohexanecarboxylic acid (Quesnel et al., 2011). In another study, bioreactors containing

aerobic, endogenous OSPW bacterial populations have also been used successfully to degrade a

wide variety of NAs, though failing to significantly degrade 1-adamantanecarboxylic acid

(AdCA) (Demeter et al., 2015). More recently, algal-bacterial microbial communities were

shown to degrade AdCA levels by up to 80% over 90 days (Paulssen and Gieg, 2019). The

microbial communities were primarily algae, comprising 90% of the relative sequence

abundance and only 10% was associated with bacteria. Analysis by 18S rRNA gene sequencing

indicated that Chlorellales and Acutodesmus were abundant in these communities, with each

comprising approximately half of the algal population (Paulssen and Gieg, 2019). Degradation of

AdCA using OSPW-derived bacteria (with no algal component) has recently been demonstrated,

with 50%-71% of the AdCA being degraded after 33 days (Folwell et al., 2020).

1.5.2 Plant-mediated degradation

While phytoremediation of NAs is not well characterized, reports that demonstrate its

potential have been published. Treatment of cattail plants with 60 mg/L of nonionized NA

solution demonstrated a shift in relative NA abundance after 30 days of treatment, compared to

an unplanted control (Armstrong et al., 2009). Single-ring and double-ring NA treatments of

cattail resulted in a significant difference in NA dissipation from solution. Following treatment,

the hydroponic medium showed a decrease in toxicity, as per Daphnia magna mortality assays.

This suggested that plants can detoxify NAs either directly through metabolism or sequestration,

or indirectly through associations with microbes.

Plants have a host of metabolic pathways that could be potentially be used for NA

detoxification. They can degrade herbicides through the use of cytochrome P450 enzymes

15

(Siminszky, 2006) as well as many organic compounds, such as 1,2-Dichloroethane and BTEX

compounds (Mena-Benitez et al., 2008; Mosaddegh et al., 2014). Plants could contribute to NA

degradation indirectly by providing an environment that is suitable for the growth of plant-

associated bacteria to degrade NAs. Tailings have poor nutrient availability, are highly saline and

possess high pH, thereby resulting in adverse conditions for plant growth (Lefrançois et al.,

2010). Phytomicrobial degradation of hydrocarbons has been demonstrated in several oil sands

reclamation studies. Microbes associated with sweet clover (Melilotus albus) and annual barley

(Hordeum vulgare) obtained from oil sands reclamation sites were analyzed for CYP153

(cytochrome p450 hydroxlase), alkB (alkane monooxygenase), and nah (naphthalene

dioxygenase) transcript abundance, as these are hydrocarbon degrading genes (Mitter et al.,

2020). Here, 42 culturable isolates had high expression of at least one of these genes, with the

highest number of isolates belonging to Pseudomonas, Pantoea and Enterobacter spp.

Inoculation of plants with microbes can also have positive effects on plant growth, soil quality

and ultimately, remediation efficiency. A field trial compared the hydrocarbon remediation

efficiency of Frankia-inoculated alder with non-inoculated alder grown on tailings (Lefrançois et

al., 2010). Inoculation led to increases in soil organic matter and decreases in soil pH and sodium

content. While the biomass of the two treatments was similar after two years, hydrocarbon

mineralization was higher in the Frankia treatment than the control.

1.6 Species under research

1.6.1 Arabidopsis

Arabidopsis is an ideal plant species for use in NA phytoremediation research. Its short

life cycle, diminutive size and fully sequenced genome make it amenable to genetic and

16

genomics studies. The Arabidopsis genome contains approximately 25,000 genes and is thought

to encode over 100,000 proteins through post-translational modification and alternative splicing

(Cobbett and Meagher, 2002). Arabidopsis can survive in a wide range of environmental and

geographical conditions, and the genetic basis behind its adaptability can be leveraged to

research phytoremediation (Bevan and Walsh, 2005). Arabidopsis has successfully been used for

phytoremediation research to identify genes involved in metal chelation, organic contaminant

metabolism and vacuolar transport of metal ions. The vast availability of mutant Arabidopsis

repositories (primarily with T-DNA and transposon insertions) makes forward genetics studies

possible (Bevan and Walsh, 2005). Characterization of Arabidopsis mutants that tolerate NAs

could lead to the identification of genes involved in NA metabolism or sequestration. This

knowledge could then be applied to species that are viable for field-scale phytoremediation trials

by screening for native plants that have high expression levels of these genes.

1.6.2 Elymus trachycaulus

Multiple species of native plants can be deployed to remediate NAs, as they each can

contribute to remediation in unique ways. One field species, Elymus trachycaulus (slender

wheatgrass), is a grass species native to northern Alberta that is commonly found in oil sands

reclamation sites. Slender wheatgrass is primarily used to mitigate erosion in reclaimed sites as it

can quickly revegetate soils with low fertility (Luna Wolter and Naeth, 2014). It possesses high

tolerance for salinity and PAHs and has successfully been grown on tailings (Renault et al.,

2004; Zhang and Zwiazek, 2018). Therefore, this species represents a good candidate for

implementation in NA remediation strategies.

17

1.7 Hypothesis and objectives

The central hypothesis for this research project is that plants have the ability to take up

NAs through their root systems, and once in their cells can biotransform NAs using transporter

systems and metabolic pathways that are not well characterized.

The specific objectives of this research are to:

1) Characterize activation-tagged lines of Arabidopsis with NA growth tolerance and

identify the genes that are responsible for this tolerance.

2) Establish protocols to visualize NA uptake and translocation using 14C-radiolabeled NAs.

18

Chapter Two: Materials and Methods

2.1 Plant material

2.1.1 Arabidopsis and slender wheatgrass

The wild-type Arabidopsis thaliana ecotypes Col-2 and Col-7 were used as controls.

Activation-tagged Arabidopsis lines were obtained from the Arabidopsis Biological Resource

Centre (ABRC, Ohio State University). CS21995 (86 pools of 100 lines), CS21991 (82 pools of

96 lines), CS21999 (85 pools of 10 lines) and CS23153 (62 pools of 100 lines) (Weigel et al.,

2000). CS31100 (208 pools of 100-300 lines) (Sedbrook et al., 2004). The CS21995, CS21991,

CS21999 and CS23153 pools were in the Columbia-7 (Col-7) background, while the CS31100

lines were in the Columbia-2 (Col-2) background (Weigel et al., 2000). The T-DNA region

between the left and right borders that was inserted into these lines contains the glufosinate

(Basta) resistance gene and CaMV 35S enhancer tetramer (Figure 2.1). Slender wheatgrass

(Elymus trachycaulus) seeds were a gift from Amanda Schoonmaker (Northern Alberta Institute

of Technology).

2.2 Arabidopsis genetic screen

2.2.1 NA and herbicide resistance growth plates

Agar plates contained 55-60 mg/L of AdCA or 30 mg/L of DH2NA. Petri plates

containing these NAs were prepared by mixing a 2X concentrated solution of 0.5X MS, 1%

sucrose and 0.7% phytoagar (PhytoTechnology Laboratories) (pH 5.0) with a 2X concentrated

NA solution buffered in 10 mM MES (pH 5.0). A volume of 30 mL of the combined agar and

NA mixture was poured into each plate.

19

Figure 2.1: The pSKI015 vector used to generate libraries of activation-tagged lines of

Arabidopsis. The region between the left border (LB) and right border (RB) inserts randomly

into the genome in transgenic plants. The vector encodes the Basta resistance gene and the

CaMV 35S enhancer tetramer.

Basta plates were used to determine segregation ratios for the NA tolerant phenotype.

Filter sterilized 1000x Basta stock solution was added to 0.5X MS, 1% sucrose, 0.7% phytoagar

resulting in a final Basta concentration of 15 mg/L. A volume of 30 mL of this solution was

added to each of the petri dishes. Seedlings that tested positive on the secondary NA screen were

assayed on Basta plates for 10 days with a photoperiod of 16 hours at 23°C after which the

number of tolerant and non-tolerant seedlings were tallied.

2.2.2 Genetic screen

Arabidopsis seeds were surface sterilized using a two-step ethanol wash. Seeds were

mixed in 1 mL of 70% ethanol on an orbital shaker for 10 minutes. The ethanol was decanted,

and the ethanol wash was repeated for 5 minutes. Seeds were dried in a laminar flow hood on a

sheet of filter paper sterilized with 70% ethanol. A total of 250 seeds were distributed on each

20

plate. An average of four to five seeds were screened from each transgenic line. The number of

plates used varied depending on the pool size. The seeds were stratified in the dark at 4°C for

two days. Plates were then placed horizontally in a growth chamber under a 16 hour light:8 hour

dark photoperiod at 23 °C.

The screening procedure is outlined in Figure 2.2. The primary screen on NA plates was

over a two week period. The presence of green true leaves and roots were used to identify seeds

that passed the primary screen. Seedlings that possessed only a single, green cotyledon were

considered negative. Selected seedlings were then transferred to soil and allowed to grow for an

additional four weeks to obtain mature seed. Once seeds had matured, all lines were passed

through a secondary screen on both AdCA and DH2NA agar plates as described above, and the

same criteria were used to determine if seedlings possessed naphthenic acid tolerance.

2.3 DNA extraction methods

Three methods were used to extract genomic DNA from Arabidopsis. Genomic DNA

used for TAIL-PCR was purified using the Qiagen DNeasy Plant Mini Kit. For the next

generation sequencing T-DNA insertion analysis approach (performed by Genome Quebec

Sequencing Service), the Qiagen DNeasy Plant Maxi Kit was used. CTAB DNA extraction was

used to obtain DNA for standard PCR reactions. The CTAB extraction buffer was prepared using

10% CTAB, 0.5 M NaCl, 0.5 M EDTA (pH 8.0), 1 M Tris-Cl (pH 8.0), PVP, β-

mercapthoethanol (Clarke, 2009). For each DNA preparation, a small leaf was placed in a 1.5

mL Eppendorf tube along with 250 μL of extraction buffer and was ground with a small plastic

microcentrifuge pestle attached to a hand drill. The tubes were incubated at 65°C for 30 minutes,

21

Figure 2.2: Overview of the activation-tag genetic screen procedure.

22

after which 250 μL of chloroform was added to the tube and vortexed. The tubes were

centrifuged at 12,000 rpm in a microcentrifuge for 5 minutes at 4°C and placed on ice.

Approximately 200 μL of the aqueous phase (top) of the tube was transferred into a clean 1.5 mL

microcentrifuge tube and the organic phase was discarded. The addition of 150 uL of cold

isopropanol followed, and the solution was vortexed and incubated at room temperature for 10

minutes. The samples were centrifuged at 12,000 rpm for 15 minutes at 4°C, and resulted in the

appearance of a small white pellet. The isopropanol was decanted and 300 μL of cold 75%

ethanol was added to the tube, followed by centrifugation for an additional five minutes at

12,000 rpm at 4°C. The ethanol was aspirated using a vacuum to allow the residual ethanol to

evaporate. The pellet was resuspended in 50 μL of TE pH 8 (1 M Tris-Cl and 0.5 M EDTA, pH

8.0) and stored at -20°C.

2.4 TAIL-PCR

Thermal asymmetric interlaced PCR (TAIL-PCR) was the first technique that was used to

identify the T-DNA insertion site in NA tolerant Arabidopsis lines. This technique (outlined in

Figure 2.3) uses three sequential PCR reactions, where the products of the previous reaction are

used as the template for the next reaction. TAIL-PCR uses two types of primer. Pooled arbitrary

degenerate primers (AD primers) anneal throughout in the plant genome, while left border (LB

primers) are specific to the left border of the T-DNA insertion (Table 2.1). The primary TAIL-

PCR reaction produces many non-specific products, while the subsequent reactions are used to

further select for the product associated with the T-DNA insertion. The LB primers are nested,

which results in the tertiary TAIL-PCR product being approximately 50 base pairs shorter than

the secondary TAIL-PCR product.

23

The primary TAIL-PCR program consisted of several steps: incubation at 94°C for 3

minutes; five cycles of 94°C for 30 seconds, 62°C for 1 minute and 72°C for 2 minutes and 30

seconds; two cycles of 94°C for 30 seconds, 25°C for 3 minutes, and 72°C for 2 minutes and 30

seconds; 15 cycles of 94°C for 10 seconds, 68°C for 1 minutes, 72°C for 2 minutes and 30

seconds, 94°C for 10 seconds, 68°C for 1 minutes, 72°C for 2 minutes and 30 seconds, 94°C for

10 seconds, 44°C for 1 minutes, 72°C for 2 minutes and 30 seconds; 72°C for 5 minutes.

Reagents used are documented in Table 2.2. The secondary TAIL-PCR program was: 94°C for 3

minutes, followed by five cycles of 94°C for 10 seconds, 64°C for 1 minute, and 72°C for 2

minutes and 30 seconds; 15 cycles of 94°C for 10 seconds, 64°C for 1 minute, 72°C for 2

minutes and 30 seconds, 94°C for 10 seconds, 64°C for 1 minute, 72°C for 2 minutes and 30

seconds, 94°C for 10 seconds, 44°C for 1 minute, and 72°C for 2 minutes and 30 seconds. This

was followed by five cycles of 94°C for 10 seconds, 44°C for 1 minute, and 72°C for 3 minutes;

72°C for 5 minutes. Reagents used are documented in Table 2.3. The tertiary TAIL-PCR

program was: 94°C for 3 minutes; 20 cycles of 94°C for 10 seconds, 44°C for 1 minute, and

72°C for 2 minutes; 72°C for 5 minutes. Reagents used are documented in Table 2.4.

Secondary and tertiary TAIL-PCR products were visualized on a 0.8% agarose gel in 1x

TAE. The gel was run at 110V for approximately 25 minutes and stained with Gel Red (Sigma-

Aldrich). Primary TAIL-PCR does not produce specific PCR products so they cannot normally

be visualized on an agarose gel. Selected agarose gel bands from the secondary and tertiary PCR

samples were excised, the DNA purified (QIAquick Gel Extraction Kit, Qiagen), and the DNA

sequenced at the University of Calgary Core DNA Service.

24

Figure 2.3: Diagram illustrating TAIL-PCR. Each of the three TAIL-PCR reactions uses

pooled AD primers which bind throughout the genome as well as a LB primer that binds to the

left border of the T-DNA insertion. Subsequent TAIL-PCR reactions amplify off the products

from the previous reaction using another LB primer which is closer to the left border. This

results in a PCR product that is approximately 50 bp shorter than from the previous reaction.

Table 2.1: Primers used in TAIL-PCR and heritability analysis.

Primer Name 5’ to 3’ Primer Sequence

TAIL Degen1 NGT CGA SWG ANA WGA A

TAIL Degen2 TGW GNA GSA NCA SAG A

TAIL Degen3 AGW GNA GWA NCA WAG G

TAIL Degen4 WGT GNA GWA NCA NAG A

LB1 ATACGACGGATCGTAATTTGTC

LB2 TAATAACGCTGCGGACATCTAC

LB3 TTGACC-ATCATACTCATTGCTG

BASTA 1 FWD GGGAGACGTACACGGTTGAC

BASTA 1 REV ACATCGAGACAAGCACGGTC

25

Table 2.2: Single Reaction for Primary TAIL-PCR

Reagent 1x Reaction Volume (μL) Final Concentration

ddH2O 9.4

10x PCR Buffer 2.0 1x

10 mM dNTP 0.4 0.2 mM

50 mM MgCl2 0.6 1.5 mM

10 μM LB1 Primer 0.4 0.2 μM

4x AD-Pool Primer 5.0 1x

Taq Polymerase 0.2

DNA Template 2.0

Total Volume 20 μL

Table 2.3: Single Reaction for Secondary TAIL-PCR


ddH2O 11.4


10 mM dNTP 0.4 0.2 mM

50 mM MgCl2 0.6 1.5 mM



Taq Polymerase 0.2

1:100 dilution of Primary

TAIL-PCR Product

2.0

Total Volume 20 μL

Table 2.4: Single Reaction for Tertiary TAIL-PCR


ddH2O 10.4


10 mM dNTP 0.4 0.2 mM

50 mM MgCl2 0.6 1.5 mM



Taq Polymerase 0.2

1:50 dilution of Secondary

TAIL-PCR Product

2.0

Total Volume 20 μL

26

2.5 Targeted gene sequencing for T-DNA insertion analysis

The targeted gene sequencing analysis protocol is summarized in Figure 2.4. For the

mutants of interest, Basta plates were used to identify plants that possessed the T-DNA insertion.

This enables only plants in a heterozygous or homozygous background to be identified and used

in this analysis (described in section 2.2.1). Approximately 1 gram of leaf tissue was removed

from mature plants that contained the Basta gene, and was snap-frozen in liquid nitrogen and

stored at -80°C. DNA samples were prepared from the leaf tissue were using the DNeasy Plant

Maxi Kit (Qiagen). Approximately 150 ng of each DNA sample was used to generate an

Illumina shotgun library (performed by Genome Quebec Sequencing Centre). PCR reactions

using the shotgun libraries were carried out using Illumina primer P2 and primers containing

sequences unique to the pSKI015 vector and a tag sequence. The products of this PCR reaction

were used as the template for the barcoding reaction (using sample-specific barcodes) as well as

for appending Illumina adapters. The barcoding products were then pooled in equimolar amounts

and run on the MiSeq sequencer (Illumina). The MiSeq output was processed using Galaxy to

remove the pSKI015 sequence. The read1 (R1) FASTQ files were uploaded as fastqsanger files.

The adapter sequence at the 3’ end of the fragments was removed with the Clip tool, resulting in

the removal of all sequences after the following sequence:

AGATCGGAAGAGCACACGTCTG. The Trimmomatic tool was used to trim bases belonging

to the pSKI015 vector. The number of bases trimmed was determined by comparing the

sequences of some reads with the vector. The FASTQ file was converted to a FASTA file,

removing the quality calls, and the sequences were copied into an Excel file and alphabetized. As

the Illumina shotgun library is produced by mechanically shearing the genomic DNA, the sizes

27

Figure 2.4: Diagram illustrating the targeted gene sequencing workflow to determine the

T-DNA insertion sites in selected mutant Arabidopsis lines. Clusters of related sequence are

indicative of potential insertion sites.

DNA PCR 1: Primer P2 and

T-DNA specific primer

PCR 2: Ligation of

adapters, addition of

barcodes

AB

AB

ABC

ABC

ABCD

ABCD

ABCD

ABCDE

ABCDE

ABCDEF

ABCDEFG

ABCDEFG

ABCDEFG

ABCDEFGH

ABCDEFGH

ABCDEFGHI

ABCDEFGHIJ

…

ABCDEFGHIJKLMNOPQRSTUVWXYZ

Mechanical Shearing

and Adenylation

Run on MiSeq

Process reads: Remove

pSKI015 region, trim

sequence homologous to

Illumina adapter

Sort reads in alphabetical

order to obtain clusters of

sequence

28

of the fragments vary. Clustering of similar sequences of increasing length in the Excel file

indicate the presence of an insertion site (see Appendix 1).

2.6 Gene expression studies using Reverse Transcription Quantitative PCR (RT-qPCR)

2.6.1 RNA extraction

Two methods were used to obtain mutant leaf and root tissues. For leaf tissue, to ensure

that plants used for RNA extraction contained the T-DNA insertion, seeds were screened for the

presence of the T-DNA insertion on Basta plates (as described in Section 2.2.2). This step was

required as some of the mutant Arabidopsis lines tested were heterozygous. Seedlings that passed

the Basta screen were transferred to soil and grown for two to four weeks until the leaves were

mature. For root tissue, the Basta screen was not required, as we had previously confirmed that

CS23152 A1-20-3 was homozygous for the T-DNA insertion. HIPP25 is highly expressed in root

tissues (Klepikova et al., 2016) so it was important to use root tissue from these samples.

Approximately 250 seeds were plated on 0.5X MS, 1% sucrose agar plates (pH 5.8) in a line and

were grown vertically for two weeks in the growth chamber, and the roots harvested. Upon

harvesting, plant tissues were snap-frozen and stored at -80°C. Leaf and root tissues were ground

in liquid nitrogen and processed using the Spectrum Plant Total RNA Kit (Sigma-Aldrich). The

On-Column DNAse Digestion kit (Sigma-Aldrich) was used to remove any traces of DNA. The

RNA quality was observed by gel electrophoresis to visualize the 28S and 18S rRNA. Total

RNA concentration was determined spectrophotometrically (Nanodrop 1000, Thermo-Fisher).

The RNA was aliquoted and stored at -80°C.

2.6.2 cDNA synthesis

Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) was used to

generate cDNA from RNA. For each preparation, 500 ng of RNA, 2 μL of 10X random primers,

29

1 μL of 10 mM dNTP mix was added to a sterilized PCR tube, which was then topped up to 12

μL with sterile ddH2O. The tube was incubated at 65°C for 5 minutes and was chilled on ice. 4

μL of 5X First-Strand buffer, 2 μL of 0.1M DTT and 1 μL of RNaseOUT Recombinant

Ribonuclease Inhibitor (40 u/μL, Fisher Scientific) was added to the tube, which was mixed

gently by stirring with a pipette. The tube was incubated at 37°C for 2 minutes. 1 μL (or 200

units) or M-MLV RT was added to the tube and mixed gently by pipetting up and down. The

tube was incubated at 25°C for 10 minutes and was followed by an incubation at 37°C for 50

minutes. The reaction was inactivated by heating the tube to 70°C for 15 minutes. cDNA was

stored at -20°C until needed.

2.6.3 RT-qPCR

Primers were designed for genes situated on either side of the T-DNA insertion for each

mutant that was characterized (Table 2.5). NCBI Primer-BLAST was used to generate the

primers, and several criteria were used to select appropriate primers. Both primers were required

to have a melting temperature of 60°C, at least one primer must span an exon-exon junction, and

the product size should be 70-150 bp long. Actin-7 gene primers were used as the internal

control for the experiments. Before preparing the reagents for the RT-qPCR reactions, the layout

of 96 well MicroAmp fast optical reaction plate was mapped using the StepOnePlus Real-Time

PCR System (Applied Biosystems). The ΔΔCT method was used to calculate the fold changes in

the reactions. Two biological replicates were used in leaf tissue RT-qPCR assays, and one was

used in root tissue RT-qPCR. Three technical replicates were used for each reaction.

Each 20 μL RT-qPCR reaction consisted of 10 μL of Power SYBR Green Master Mix

(ThermoFisher), 0.5 μL of cDNA, 0.4 μL of forward primer, 0.4 μL of reverse primer and 8.7 μL

of sterile ddH2O. A Power SYBR Green PCR Master Mix was added to each well. Primer master

30

mixes were made for each primer pair (Table 2.5), and 0.8 μL was added to the appropriate

wells. The cDNA template (0.5 μL) was added last to the wells. MicroAmp Optical Adhesive

Film (Applied Biosystems) sealed the wells. The 96 well plate was centrifuged at 3000 RPM for

3 minutes in a swinging bucket rotor centrifuge and placed in the StepOnePlus Real-Time PCR

System (Applied Biosystems). The qPCR program used was as follows: 95°C for 20 seconds,

then 40 cycles of 95°C for 3 seconds then 60°C for 30 seconds.

A two-tailed, Welch t-test with two degrees of freedom and a 95% confidence interval

was performed on CS32152 A1-20-3 and CS23127 A1-2 leaf tissue samples to verify if gene

expression in the mutants was higher than in the Col-7 control.

Table 2.5: Primers used for RT-qPCR


ACT7 FWD GAACTGGAATGGTGAAGGCTGGTT

ACT7 REV AGTGTGCCTAGGACGACCAACAAT

APPR2 P1 FWD CCAGGAGCGATTCCACCTTT

APPR2 P1 REV ACCGCTCACCGTTGGATAAG

APPR2 P2 FWD CTGAAGCACTCTCTGCGGTT

APPR2 P2 REV GCACCAAGCGCTATGCATTT

SAM P1 FWD GACCGCAAACGAGGGAACAT

SAM P1 REV AGGACTCTGCGATTCCCTCT

SAM P2 FWD AACCACGAAGCACAAGTCCA

SAM P2 REV ATGTTCCCTCGTTTGCGGTC

HIPP25-1 FWD TGGGTGTTCTTGATCACGTCTCT

HIPP25-1 REV CCCTCACATCCACCGTCTGT

HIPP25-2 FWD AGTCTACAGACGGTGGATGTGA

HIPP25-2 REV TGAGCATTTGGCTCGATGGT

SRBP-1 FWD TCGGAATCGGTAACGATCAGTCT

SRBP-1 REV CACATATCTCAACCTCTCGTTCTGT

SRBP-2 FWD TCGGAATCGGTAACGATCAGTCTT

SRBP-2 REV CTCAACCTCTCGTTCTGTATTTTGA

31

2.7 Sterile plant growth methodology

2.7.1 Streptomycin agar plates and Falcon tube preparation

A 1000X stock solution of streptomycin (100 mg/mL) was filter sterilized and aliquoted

into 1.5 mL microcentrifuge tubes and stored in the -20° freezer until needed. Petri plates

containing 0.5X MS, 1% sucrose, 0.7% phytoagar (pH 5.8) and 10 mg/L streptomycin were

prepared for sterile seed germination. Using the same streptomycin agar solution, a 1-inch ring of

agar was applied to the entire circumference of 50 mL polypropylene Falcon tubes (Fisher

Scientific) using a sterile 10 mL serological pipette such that the bottom of the agar reached the

12.5 mL marker on the tube. The tubes were placed horizontally to allow the agar to pool and

set, which provided a region in which sterile, germinated wheatgrass seeds could be readily

adhered for growth under sterile conditions. The agar containing tubes were dark stored at 4°C.

2.7.2 Growth of sterile wheatgrass

Approximately 12 slender wheatgrass seeds were placed in 1.5 mL microcentrifuge tubes

and placed in a microcentrifuge rack with the lids open. In the fume hood, the rack was placed in

a large Tupperware container with a 100 mL beaker containing 80 mL of commercial bleach.

The Tupperware lid was placed ajar on the Tupperware container so that the beaker was

accessible. Using a 5 mL serological pipette and an electric pipettor, 5 mL of 12.1 M HCl

solution was dispensed into the bleach, producing chlorine gas. The container was immediately

sealed with the lid to contain the gas. After two hours of exposure (while still in the fume hood)

the lid was removed for approximately 10 seconds to allow the chlorine gas to escape and the

lids to the microcentrifuge tubes were closed to prevent contamination. The seeds were placed on

10 mg/L streptomycin agar plates, stratified for two days at 4°C, then moved to the growth

chamber with a 16-hour photoperiod and were grown at 23°C for 10 days. Once seeds had

32

germinated, five seedlings were adhered to the side of each streptomycin agar Falcon tube using

sterilized forceps. To allow the roots to grow down the side of the tube and through the agar, the

Falcon tubes were placed in a rack which was angled at 40-45° and the tubes were rotated such

that the roots would grow along the Falcon tube wall. Root growth without hydroponic solution

(i.e., growth into air) promoted root growth and root hair development. The same growth

chamber parameters were used, and the wheatgrass seedlings were grown for approximately two

weeks or until sufficient root growth was attained (Figure 2.5).

Figure 2.5: Schematic diagram of slender wheatgrass growth in sterile hydroponic NA

uptake experiments. Seeds were exposed to gas sterilization and were germinated on 0.5X MS

plates (pH 5.8) containing 100 µg/mL streptomycin for 10 days. Germinated seedlings were

transferred to sterile 50 mL Falcon Tubes containing a ring of agar (pH 5.8) containing 100

µg/mL streptomycin. Sterile 0.5X strength Hoagland solution (pH 5.0) was added to the tubes

after roots and shoots were sufficiently developed.

0.5X Strength Hoagland

Solution

(pH 5.0)

Streptomycin Agar Ring

(pH 5.0)

33

2.7.3 Plant sterility testing using YES, TSA and LB plates

Yeast extract sucrose (YES), tryptic soy agar (TSA) and LB plates were prepared to

verify whether the sterilized seeds contained microorganisms that may have survived the

sterilization process. Various microbes are culturable on different types of media, necessitating

the use of more than one type of media. YES plates contained 2 g of yeast extract, 10 g of

sucrose, 0.5 g of KH2PO4, 0.25 g MgSO4 and 7.5 g of agar pH 6.2. TSA plates contained 7.5 g of

tryptone, 2.5 g of peptic digest of soybean meal, 2.5 g of NaCl and 7.5 g of agar pH 7.3. LB

plates contained 5 g of tryptone, 5 g of NaCl, 2.5 g of yeast extract and 7.5 g of agar pH 7.0. The

plates were then stored at 4°C.

Seedlings used for sterility assays were collected at the same time as seedlings were

transferred from the streptomycin agar plates to the 50 mL Falcon tubes. Eppendorf

micropestles, 1.5 mL microcentrifuge tubes, and ddH2O were sterilized by autoclaving. In a

laminar flow hood, a seedling was placed into each microcentrifuge tube and 200 μL of sterilized

ddH2O was added. The seed was ground using the micropestle for 30 seconds, and 100 uL of the

solution was pipetted (using filtered tips) onto the YES and TSA plates. The solution was spread

over the plates using an ethanol sterilized spreader. A water control was used. For the LB assay,

serial dilutions of seed extract were plated: undiluted, 1:10, 1:100, 1:1000 and 1:10000 dilutions

were used. The plates were incubated at 30°C for 72 hours and were checked daily for growth.

2.7.4 Radiolabeled 14C-NA uptake

After approximately 10 days of seedling growth (or when roots were sufficiently

developed) in sterile Falcon tubes, 10 mL of sterile half-strength Hoagland solution (pH 5.0,

Table 2.6) was added to the tubes. 14C-NA stock solutions were added directly to the Hoagland

solution. For hexanoic acid, decanoic acid, cyclopentanecarboxylic acid and

34

Table 2.6: Half-strength Hoagland solution

Solutions Volume per 1L

1.0 M NH4H2PO4 0.5 mL

1.0 M KNO3 3 mL

1.0 M Ca(NO3)2 2 mL

1.0 M MgSO4 1 mL

Micronutrient solution (1 L)

1 mL

- 1.43 g H3BO3

- 0.905 g MnCl2·4H2O

- 0.11 g ZnSO4·7H2O

- 0.04 g CuSO4·5H2O

- 0.01 H2MoO4·H2O

100 mM Fe-EDTA 0.25 mL

cyclohexanecarboxylic acid treatments, 1 µL of 3.7 MBq/mL stock was added. 4 µL of 1.3

MBq/mL 1-adamantanecarboxylic acid stock solution was added for the AdCA treatment. Falcon

tubes were wrapped in aluminium foil at their base, placed into racks in the growth chamber, and

agitated on an orbital shaker for 11 days. After completion of the growth period, two wheatgrass

plants were removed from the Falcon tube, their roots rinsed with water, and the plants were

subsequently dried in a gel dryer (Bio-Rad) at 55°C under mild vacuum for two hours, followed

by exposure overnight to a phosphor screen. The remaining three plants were stored at -80oC.

Phosphor image signal intensity was referenced against the following radioactive CPCA

standards: 67 Bq, 33 Bq, 17 Bq, 8 Bq, 4 Bq and 2 Bq.

35

The radioactive counts in the Hoagland solution at the beginning and end of the

experiment were quantified by scintillation counting. Quantification of the radioactive counts

from the plant phosphor images was carried out using ImageJ (Schneider et al., 2012). A

spreadsheet that converts histogram readings of pixel intensities to becquerels (Bq) was provided

courtesy of Mitchell Alberts. 14C CPCA standards were used to convert the gray values into Bq.

Radioactive counts determined for shoots and roots of the wheatgrass were taken individually

and averaged to calculate the total counts for five seedlings in each 50 mL Falcon tube.

36

Chapter Three: Characterization of Naphthenic Acid Tolerant Arabidopsis Activation-

Tagged Mutants

3.1 Introduction

Genetic screens have been used to characterize genes and identify desirable phenotypes

in plants. There are two types of genetic screen. Forward genetic screens identify a specific

phenotype and then determine the genes responsible for the phenotype. Conversely, reverse

screens involve disruption of a known gene to observe a change in phenotype (Alonso and Ecker,

2006; Ajjawi et al., 2010). The model plant, Arabidopsis, has been widely used to study plant

genetics. An array of tools, such as Agrobacterium-mediated T-DNA transformation and

transposon mutagenesis have been used to create mutant libraries that can be screened for

phenotypes and mutant gene identification (Weigel et al., 2000; Sedbrook et al., 2004). Insertion

of an Agrobacterium-derived T-DNA into the plant genome does not occur uniformly, as there is

a bias towards actively transcribed regions of the genome (Schneeberger et al., 2005). Within

these gene-coding regions, T-DNA insertions are more likely to occur in intergenic regions as

opposed to within genes. However, when inserted into genes, insertions are more likely to be

found in the 5’ non-coding, 3’ non-coding and promoter regions, as opposed to within introns

and exons (Alonso et al., 2003). On average, there are 1.5 T-DNA insertions per transformed

Arabidopsis line (Alonso and Ecker, 2006). This requires that a large number of mutants be

screened to allow for sufficient coverage of the approximately 25,000 genes in the Arabidopsis

genome.

Arabidopsis T-DNA mutants can be used to study both gain-of-function or loss-of-

function mutations. In the case of loss-of-function mutants, the T-DNA typically inserts into the

coding region of gene, resulting in gene inactivation. Gain of function mutations can occur in the

37

form of enhanced gene expression. To identify gain-of-function mutants, transformation vectors

containing cauliflower mosaic virus (CaMV) 35S enhancers can be used to produce activation

tagged lines. The enhancer increases the expression of genes up to 3.6 kb away from the

integration site, both upstream and downstream from the gene (Weigel et al., 2000). Unlike the

constitutive 35S promoter which causes ectopic expression of genes that are not normally

expressed, the 35S enhancer only increases expression of genes that are endogenously expressed

(Hull et al., 2000; Weigel et al., 2000). Activation tagged libraries are publicly available through

the Arabidopsis Biological Resource Center (ABRC). The seeds of these libraries are divided

into pools to increase screening efficiency. By pooling a large number of lines collectively, this

decreases the amount of sample handling and sample tube number. Additionally, positive

mutants can be recovered by revisiting the appropriate pool if any issues arise.

Previous work conducted in the Muench lab demonstrated that wild-type Arabidopsis,

when exposed to various NAs and the AEO fraction of OSPW, exhibited reduced growth

phenotypes (Leishman et al., 2013). Impaired root and shoot growth increased with increasing

concentrations of OSPW treatment, whereas seed germination was not impaired significantly

with OSPW exposure up to 75%. At lower pH, NAs were more toxic to Arabidopsis growth, as

was shown previously in other plant species (Armstrong et al., 2009). A forward genetic screen

approach was later performed using Arabidopsis T-DNA activation tagged lines to identify

mutants that demonstrated germination and seedling growth on media containing high

concentrations of NA (J. Wong, PLBI 530 Undergraduate Research Project, University of

Calgary). The aim of this screen was to identify plant genes that confer tolerance to NAs and that

could biotransform NAs and be applied to phytoremediation strategies. In this screen, 20,000

38

activation-tagged Arabidopsis lines were exposed separately to two NA types: 1-

adamantanecarboxylic acid (AdCA) and decahydro-2-naphthoic acid (DH2NA) (Figure 3.1).

Figure 3.1: Structures of AdCA and DH2NA. 1-adamantanecarboxylic acid (left) has a

diamondoid ring arrangement. Decahydro-2-naphthoic acid (right) is a two-ring NA.

AdCA, a model NA, has been identified in the AEO fraction isolated from oil sands process-

affected water (OSPW). DH2NA, a surrogate NA, has not been confirmed as a component of

OSPW but served as a representative two-ringed NA for this screen. Tolerant lines were

identified in a primary screen, and the selfed progeny from the primary screen were subjected to

a secondary screen on both NA types to verify the NA tolerant phenotype. Six mutant lines

emerged as NA tolerant from this secondary screen.

In this chapter, results relating to the characterization of these mutants are presented. The

inheritance pattern of these mutants was studied, and several approaches were used to identify

the sites of the T-DNA insertion. The expression effects that the T-DNA insertion exerted on

adjacent genes was also analyzed.

39

3.2 Results

3.2.1 Screen summary and characterization of the selected NA tolerant Arabidopsis lines

The 20,000 activation-tagged lines of Arabidopsis that were previously screened on 0.5X

MS agar plates containing either AdCA or DH2NA yielded six lines that were NA tolerant. In

summary, AdCA screening plates contained 60 mg/L of this model NA, while DH2NA plates

contained 30 mg/L of this surrogate NA. After two weeks of growth at a photoperiod of 16

hours, enhanced growth phenotypes such as increased cotyledon growth, root growth, green

leaves and the presence of true leaves were used to identify NA tolerant mutants. Mutants were

compared to either Col-2 or Col-7 wild-type Arabidopsis ecotypes, depending on the genetic

background of a given pool. Of the 20,000 lines screened, 151 individual plants were recovered

from the primary screen. The seeds produced from the primary screen mutants were subjected to

a secondary screen to verify that the NA tolerance was genetically heritable and not the result of

leakiness through the primary screen (Figure 3.2). The criteria used in the primary screen were

also used to identify tolerant seedlings in the secondary screen. In the secondary screen, seeds

from all lines were grown on separate AdCA and DH2NA plates to determine if tolerance to one

NA also conferred tolerance to the other. Of the 151 individuals that passed the primary screen,

six NA tolerant mutant lines (CS23120 A3, CS23127 A1, CS23152 A1, CS23152 A2, CS23838

D1, CS31166 A1) were obtained. Naming of mutants was based on their corresponding pool

name, followed by the initial of the compound that they were successfully screened on (denoted

by A for AdCA and D for DH2NA), followed by a number to differentiate the identity of tolerant

individuals that were obtained from the same pool of seeds. Subsequent numbers in the code

(e.g., -1, -2, -3, etc.) identified the individual progeny line that was derived from the secondary

screened plants. Of the six NA tolerant mutant lines that were identified in this screen, four were

40

Figure 3.2: Example of positive primary screen and secondary screens. A: Seedlings circled

in blue were selected based on the presence of roots and green true leaves. Seedlings in red were

not selected as they only exhibited cotyledon growth and did not possess true leaves. B: Growth

of progeny on the NA plate shows that a genetic basis in NA tolerance.

B

A

41

tolerant to both NAs (Table 3.1). The two remaining mutants were tolerant for growth to only

AdCA (Table 3.1).

Table 3.1: Percent growth* on AdCA and DH2NA of lines that passed the secondary screen

Mutant Percent growth on AdCA Percent growth on DH2NA

CS23120 A3 34% 30%

CS23127 A1 10% 0%

CS23152 A1 15% 32%

CS23152 A2 27% 22%

CS23838 D1 50% 30%

CS31166 A1 14% 0%

*Percent growth refers the number of seedlings possessing cotyledons and true leaves.

These mutants were further characterized in this thesis research. The progeny of the

positive mutant lines from the secondary screen were then screened on the NA from which they

were first identified, as well as on Basta-containing agar plates to determine if the lines were

homozygous or heterozygous for the T-DNA insertion (Table 3.2). Basta was used because the

expressivity of the NA-tolerant phenotype was generally reduced on the NA plates. Basta

tolerance provided a more reliable determination of the presence or absence of the T-DNA

insertion than did NA tolerance. Wild type Col-7 seedling growth was not observed on plates

containing AdCA, DH2NA or Basta, whereas growth on control MS plates ranged from 93.9% to

97.0% (Table 3.2).

Several of the mutant progeny lines were tested on NA and Basta plates to determine the

inheritance patterns of the T-DNA insertions in these lines. All five of the tested CS23152 A2-

progeny lines demonstrated tolerance to AdCA with a range of 39.4% to 56.9% of the plants

42

showing growth phenotypes. However, these lines had a 0% survival rate on Basta plates,

indicating that the Basta gene expression within the T-DNA insertion was lost in this line. Three

of the CS23838 D1 progeny lines had DH2NA growth rates ranging from 28.6% to 34.2% and

had Basta rates of 52.9% to 63.8%, whereas CS23838 D1-1 did not demonstrate DH2NA or

Basta resistance. Three of the CS23127 A1 progeny lines showed AdCA growth rates of 30.5%

to 53.2% and Basta resistance rates of 62.1% to 66.1%, whereas CS23127 A1-3 did not tolerate

AdCA or Basta. Growth rates on MS plates were low for CS23127 A1-2 and CS23127 A1-5

likely due to seeds not being fully mature when harvested. All four of the CS23120 A3 progeny

lines had similar levels of AdCA and Basta tolerance, with growth rates of 60.6% to 69.5% and

91.5% to 98.8%, respectively. Three of the CS23152 A1 progeny lines grew on AdCa and Basta

with growth rates of 51.5% to 59.5% on AdCa and 64.7% to 71.4% on Basta. CS23152 A1-8 did

not grow on either AdCA or Basta. Three of the CS31166 A1 progeny lines tolerated AdCA and

Basta, with growth rates ranging from 46.5% to 57.8% and 64.0% to 67.9% respectively.

CS31166 A1-5 did not tolerate AdCA nor Basta as 1.9% of the seeds grew on AdCA and 0%

grew on Basta.

Additional lines were screened on Basta plates only to provide more insight into the

zygosity of the secondary screen-derived lines (Table 3.3). Of ten CS23152 A1 progeny lines,

five demonstrated high frequency of tolerance to Basta, with growth rates ranging from 93.0% to

98.6%. Three of the lines had lower tolerance frequencies, (72.3% to 75.4%), and two lines did

not demonstrate tolerance to Basta. The two CS23152 A2 progeny lines that were screened did

not tolerate growth on Basta, similar to the previous five lines that were screened (Table 3.2).

Both CS23120 A3 progeny lines showed 100% growth rates on Basta. Two of the three CS23127

A1 progeny lines showed Basta growth rates of 59.8% and 64.7%, while CS23127 A1-3 did not

43

Table 3.2: Percentage of seeds demonstrating strong growth phenotypes on NA, Basta and

0.5X MS agar plates.

Plant ID NA Positive %* Basta Positive % MS Positive % Zygosity

Col-7 (on DH) 0.00 0.00 97.00 -/-

Col-7 (on AdCA) 0.00 0.00 93.91 -/-

CS23152 A2-1** 50.68 0.00 97.17 ?

CS23152 A2-2 56.93 0.00 93.68 ?

CS23152 A2-3 44.44 0.00 92.08 ?

CS23152 A2-4 40.24 0.00 93.75 ?

CS23152 A2-9 39.44 0.00 92.55 ?

CS23838 D1-1 3.70 3.77 97.00 -/-

CS23838 D1-3 34.15 63.83 98.82 +/-

CS23838 D1-4 32.65 52.94 99.05 +/-

CS23838 D1-5 28.57 55.06 94.21 +/-

CS23127 A1-2 30.47 66.15 74.38 +/-

CS23127 A1-5 53.24 67.21 79.71 +/-

CS23127 A1-3 0.00 0.00 96.97 -/-

CS23127 A1-6 52.55 62.16 93.58 +/-

CS23120 A3-3*** 60.61 96.77 96.43 +/+

CS23120 A3-4 65.81 98.80 95.65 +/+

CS23120 A3-9 69.50 96.88 98.08 +/+

CS23120 A3-10 66.47 91.45 96.08 +/+

CS23152 A1-3 51.48 65.52 95.88 +/-

CS23152 A1-5 53.24 71.43 97.03 +/-

CS23152 A1-6 59.54 64.71 94.53 +/-

CS23152 A1-8 0.00 0.00 100.00 -/-

CS31166 A1-1 57.76 64.00 94.90 +/-

CS31166 A1-3 52.10 63.39 97.06 +/-

CS31166 A1-4 46.51 67.92 88.18 +/-

CS31166 A1-5 1.90 0.00 94.74 -/-

* Seeds were screened on the NA on which the mutant on which it was recovered from initially.

** Highlighted in yellow are lines that likely have a truncated T-DNA insertion.

*** Highlighted in green are lines that appear to be homozygous for the T-DNA insertion.

44

grow. Three of the CS23838 D1 progeny lines tolerated Basta with growth rates ranging from

90.5% to 100%. CS31166 A1-2 had a 73.1% growth rate on Basta.

Overall, the NA and Basta growth assays assisted in elucidating the relationship between

NA tolerance and genetic heritability of the T-DNA insertion. With a single exception, the

percentage of NA tolerant seeds of a line is consistently lower than the percentage that grow on

Basta. The Basta segregation ratios provide insight regarding the heritability of the T-DNA

insertion. If approximately 100% of the seeds are positive on Basta plates, then the line is

homozygous for the insertion. Heterozygous plants screened on Basta will exhibit close to a 3:1

ratio of positive to negative seeds. The only exception observed was in the CS23152 A2 progeny

lines as they failed to produce any Basta tolerant offspring but also demonstrate NA tolerance.

Based on this data, the predicted inheritance pattern of each of the lines is shown in Table 3.2

and Table 3.3.

3.2.2 PCR genotyping using genomic DNA

Amplification of the Basta resistance gene using genomic DNA templates from the

selected mutant lines was also used as a marker to determine the zygosity of the T-DNA

insertion in the mutants. The expected product size for the Basta specific primer pair was 201 bp

(see Methods, Table 2.1). Lines in which all the progeny produced this PCR product were

considered homozygous for the T-DNA insertion. If PCR products were not produced in

approximately one-quarter reactions, then the line is likely heterozygous for the T-DNA

insertion. DNA was extracted from 20 two-week old progeny seedlings from lines CS23120 A3-

4, CS23127 A1-2, CS23152 A1-20-3, CS23152 A2-1, CS23838 D1-3 and CS31166 A1-1. The

45

Table 3.3: Percentage of seeds demonstrating strong growth phenotypes on Basta and 0.5X

MS agar plates.

Plant ID Basta Positive % MS Positive % Zygosity

Col-2 0.00 97.33 -/-

Col-7 1.54 100.00 -/-

CS23152 A1-11 0.00 90.22 -/-

CS23152 A1-12 75.23 99.03 +/-

CS23152 A1-13 72.34 94.96 +/-

CS23152 A1-14 98.57 99.24 +/+

CS23152 A1-15 0.00 96.72 -/-

CS23152 A1-16 95.65 97.81 +/+

CS23152 A1-17 94.87 91.67 +/+

CS23152 A1-18 93.02 92.13 +/+

CS23152 A1-19 75.42 95.36 +/-

CS23152 A1-20 98.11 98.46 +/+

CS23152 A2-2 0.00 97.08 ?

CS23152 A2-5 0.00 100.00 ?

CS23120 A3-2 100.00 100.00 +/+

CS23120 A3-5 100.00 100.00 +/+

CS23127 A1-1 64.66 75.93 +/-

CS23127 A1-3 0.00 47.89 -/-

CS23127 A1-6 59.79 55.38 ?

CS23838 D1-1 90.54 83.33 +/+

CS23838 D1-2 100.00 98.68 +/+

CS23838 D1-4 92.68 94.38 +/+

CS31166 A1-2 73.08 100.00 +/-

46

success of DNA preparations varied between lines (Figure 3.3). PCR was performed only with

the successful DNA preparation samples.

Two of the tested mutants (CS23120 A3-4 and CS23120 A1-20-3) were determined to be

homozygous, as all of the PCR reactions showed the expected band size (Figure 3.4). This is

consistent with the results from the Basta growth assays where 98.8% and 98.1% of the

respective line demonstrated Basta resistance (Table 3.2 and Table 3.3). CS23127 A1-2,

CS31166 A1-1 and CS23838 D1-3 appeared heterozygous for the insertion. The PCR

genotyping results obtained from these matched the results obtained from the Basta screen.

CS23127 A1-2 seedlings were 78.9% positive by PCR testing, while 66.2% were positive on

Basta. CS31166 A1-1 seedlings were 75% positive with PCR genotyping, while 64.0% were

positive on Basta. Finally, CS23838 D1-3 seedlings were 88.9% positive with PCR genotyping,

while 63.8% were positive on Basta (Table 3.2 and 3.3). None of the CS23152 A2-1 seedlings

produced the PCR product, which is consistent with the Basta growth assays (Table 3.2 and

Table 3.3). A summary of the results is provided in Table 3.4.

3.2.3 Characterization of the T-DNA insertion sites using TAIL-PCR

TAIL-PCR was the first technique used to determine the T-DNA insertion sites in the

mutants. A successful TAIL-PCR reaction is characterized by an approximately 50 base pair

decrease in size of tertiary TAIL-PCR products relative to the secondary TAIL-PCR products.

This is because the tertiary TAIL-PCR reaction included a nested primer (LB3) that anneals to

the products produced by the secondary TAIL PCR reaction (see Methods, Figure 2.3). All six

mutants that were recovered from the secondary screen were characterized in the TAIL-PCR

47

Figure 3.3: CTAB DNA preparations carried out on 20 seedlings for each listed mutant.

The uppermost band is genomic DNA. The middle band is 28S rRNA and the lowest band is 18S

rRNA. Red asterisks identify samples with unsuccessful PCR reactions.

* * *

*

* * * *

* * * *

* * * *

CS23120 A3-4

CS23127 A1-2

CS23152 A2-1

CS23152 A1-20-3

CS23838 D1-3

CS31166 A1-1

-10 kbp

-10 kbp

-10 kbp

-10 kbp

-10 kbp

-10 kbp

48

Figure 3.4: Confirmation of the presence of the Basta marker in the genomic DNA of

progeny from mutants using PCR. The Basta PCR products at the expected size (201 bp) are

shown. Red asterisks identify samples that lacked the 201 bp PCR product.

Table 3.4: Summary of the Basta PCR results and comparison to Basta assay.

Plant ID Positive Negative

Percent

Positive

(PCR)

Percent

Positive

(Basta plate)

Predicted

Zygosity

CS23120 A3-4 17 0 100 98.8 Homozygous

CS23127 A1-2 14 5 73.4 66.2 Heterozygous

CS23152 A1-20-3 20 0 100 98.1 Homozygous

CS23152 A2-1 0 16 0 0 Unknown

CS31166 A1-1 12 4 75.0 64.0 Heterozygous

CS23838 D1-3 14 2 87.5 63.8 Heterozygous

* * * * *

* * * * * * * * * * * * * * * *

*

*

* * * *

*

CS23120 A3-4

CS23127 A1-2 CS23152 A1-20-3 CS23152 A2-1 CS31166 A1-1 CS23838 D1-3

49

assays. Despite multiple attempts, only one mutant (CS23838 D1) was successfully characterized

with this technique. Two distinct PCR products were amplified in the secondary and tertiary

PCR reactions using genomic DNA from this line (Figure 3.5). The pairwise band shifts of these

three pairs of products were approximately 50 nucleotides in size. Sanger sequencing of the 700

bp and 450 bp tertiary products both revealed that the T-DNA insertion in CS23838 D1 was

within intron 3 of the GLABRA2 homeobox gene (GL2, AT1G79840) (Figure 3.6).

Repeated attempts at TAIL-PCR with the other mutants were not successful. Reactions

using different lines (CS23120 A3, CS23127 A1, CS23152 A1 and CS31166 A1) resulted in the

consistent amplification of an unknown 1000 bp product (Figure 3.7). Sanger sequencing of the

product was unsuccessful. DMSO (2% and 5%) was added to the reactions to determine if any

additional products were produced in an effort to increase the binding specificity of the primers.

No additional products were found, although the unknown 1000 bp product persisted with 2%

DMSO increasing the intensity of the bands. The addition of 5% DMSO increased the specificity

of the reaction for the 1000 bp band (Figure 3.7).

3.2.4 Characterization of mutants using targeted gene sequencing

With limited success in identifying the T-DNA insertion sites in all but one mutant using

TAIL-PCR, a targeted gene sequencing technique was attempted. In summary, this approach

uses Illumina massively parallel sequencing to generate reads specific to the T-DNA insertion

and the adjacent genomic DNA. This requires the use of a custom primer that anneals to the

vector sequence and contains a tag sequence that allows for the addition of Illumina adapters.

Primers selected for this purpose are situated close to the left border of the T-DNA insertion to

allow for sequencing into the flanking genomic sequence. This results in hundreds to thousands

50

Figure 3.5: TAIL-PCR reactions for CS23838 D1. Agarose gel (2%) showing two secondary

and tertiary TAIL PCR products (red and blue bands, respectively). The red and blue labelled

bands from the tertiary sample were extracted and sequenced. Note the characteristic 50 base

pair decrease in size between the TAIL-2 and TAIL-3 reactions.

100 bp -

500 bp -

750 bp -

- -

- -

51

3’-

TTGACCTGGCGAGGGGCCAGCCCTAGTTGCTTGCTCAGCTGCTGTCTTTGCTTCTCGTCCGGATGTGGTGTCT

CTTTGAATAGCctgcaacgtcctcaaattcagacatttctaaaagatgaaaatctttacatgcaactgaaccc

taactaggcatatgtatactattactgatcagctttaattgtgatgaaacaaattaacactttattgtttaag

cctttatatacgttataacgcgcatgtacctacagtcatgtcaggagaagacggggaataataacgagtaagc

gtccgaaaccatataagcgcattgaaactaatgctggatcatatatcatcgatcggcaatatatttgtatgaa

tacatcatctaagtatatatatgtatgtgaaattaatggagaattgaaggtgcgtaattgagaattgctcttc

aacgcaagacaccttctccttcttccactaattaagtactacag...ATTACTCTTTCTTTTCCTCCATATTG

ACCATCATACTCATTGCTGATCCATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATGAAtatatacc

gaagaaagggattaaaatcataattacttataaaacatcaagaaatatgagcaccggaaaaaacaactaatga

atgtttcttgatagaagctagccctaatgaatcggaatcccctaattaagtgttttaatttgtgaagcataat

tattaagtttatacttattaaaaagtggggtggggggtttaattagttagctaggtaaggatggaataattat

atcgaacgtacGCTTCCATGTGTCTGATCTGATCGGTGGTGTGACGATGATACTTCTTCCTCTTTCTCTTATT

AGTGCCCTTGTTTCCAGCTGCGCCGTCCTCCTCTTCCTCCTCCTCATCGTCGTGATCCTCACCCTCCAAATCC

TCCTCTGATCTGGATCTCGTGGGTCCTGAGTTCTCGCTGCTCATCTCCACAGTGCGATCCTCATCGTCAACTA

CTCTTCTGCCCAGGAAATCCTCCTCAGGGTTGGTGCTGCCGGAGGATGCATTCCGGAATATCCCAGCctgtat

atattcctatctccattaaaatcaagacatatatataatatatgtttatgtgagagctagcaagtacatgtat

gtagaaaagagagagtagtatacGAGAGATAGAGAGAGGGCTGGAGAGGAGAAAAAGTCTTTGGTGGGTTGTT

TGGAAGACATGTCGACGGCCATTGACATACAAATCCTGTCCCTAGCTAGCTTCTTTGcttaattatgatctct

tccctcttctcctcgcactccttcttccttatatattatctctctttttttctttcttctttaattacttata

caccaaaatgtactttcaattaatatataagctaagatcgatatatatatatatatatatatatatagcctct

tcaattccaatgatacatatatatataagcggtcgtttttcagatatttcttccatttctctactgctcttga

cttttaggtgcttcttttataattaattagttttaattaattaatacctattatattattatatttagtcctt

ttacggttttatatattttggctatacttcaatccgacAATTGAGTAGTTTAAAACATGGCCAGCTACAGCAT

TGGCAGCCATCGATCGACTTCATttttcttcttaatattcgatttttaatatatacatatatatatgatgagc

aaaattcaaatttgaattatggaaaatatatcagccttccaatttcagctactaactttaatatgaattatgt

-5’

Legend:

T-DNA Insertion Sequence Match Translational start/end

UTR Intron Exon

Figure 3.6: Sequence of the T-DNA insertion site in the GL-2 gene intron in line CS23838

D1-3. Sequencing results from the 450 bp product read through the T-DNA sequence (red

highlight) and into the flanking GL-2 gene sequence (yellow highlight). For simplicity, the T-

DNA sequence shown is incomplete, and only shows part of the left border sequence. Introns

(purple letters), exons (orange letters), 5’ untranslated region (red letters) and the translation start

codon (blue highlight) are identified. The GL-2 sequence shown is reading off of the antisense

strand. The black arrow indicates the directionality of the sense strand.

GL2 (AT1G79840)

52

Figure 3.7: Unknown TAIL-PCR products. PCR products appear to be approximately 900-

1000 bp in size and can appear with different templates. Upon Sanger sequencing, results do not

end in discernable sequence.

H2O

CS23120 A3

CS23127 A1

- 1000 bp

- 1000 bp

- 1000 bp

CS31166 A1

CS23152 A1 - 1000 bp

- 1000 bp

53

of reads of differing lengths that have overlapping sequences. Clustering of these reads indicates

the presence of an insertion site.

The insertion sites of four of the six mutant lines were successfully identified using the

targeted gene sequencing technique. The previously characterized CS23838 D1-3 line that was

shown by TAIL-PCR to contain the insertion within the GL-2 gene was used as a positive

control to test the reliability of this method. The targeted gene sequencing approach successfully

identified the insertion site in intron 3 of GL2 as was obtained for the TAIL-PCR approach

(compare Figure 3.6 and Figure 3.8). The identification of T-DNA insertion loci using targeted

gene sequencing was also successful for lines CS23152 A1-6, CS23120 A3-4 and CS23127 A1-

2. CS23152 A1-6 contained a single T-DNA insertion in the intergenic region between the

Heavy Metal Associated Isoprenylated Plant Protein 25 (HIPP25, AT4G35060.1) gene and the

S-ribonuclease binding protein family protein gene (SRBP, AT4G35070.1) (Figure 3.9). The

insertion was situated approximately 1000 bp from the start of the 5’ UTR of the HIPP25 gene

and 6000 bp from the end of the 3’ UTR of S-ribonuclease binding protein family protein gene.

Three distinct T-DNA insertions were found in CS23127 A1-2. The first insertion was located 29

bp from the 3’ UTR of a S-adenosyl-L-methionine-dependent methyltransferase (SAM) gene

(AT4G18030.1) and 4563 bp from the 5’ UTR of, the Pseudo-Response Regulator 2 (APRR2)

gene (AT4G18020.1) (Figure 3.10). The second insertion site was situated in exon 1 of

DUF1421, or formin-like gene (AT4G28300.1) (Figure 3.11). The third T-DNA insertion

occurred in exon 13 of the ATGRIP gene (AT5G66030.1) (Figure 3.12). CS23120 A3-4

contained a single T-DNA insertion that had been integrated into the intron 11 of a Leunig

Homolog gene (AT2G32700.7) (Figure 3.13).

54

3’-

TTGACCTGGCGAGGGGCCAGCCCTAGTTGCTTGCTCAGCTGCTGTCTTTGCTTCTCGTCCGGATGTGGTGTCT

CTTTGAATAGCctgcaacgtcctcaaattcagacatttctaaaagatgaaaatctttacatgcaactgaaccc

taactaggcatatgtatactattactgatcagctttaattgtgatgaaacaaattaacactttattgtttaag

cctttatatacgttataacgcgcatgtacctacagtcatgtcaggagaagacggggaataataacgagtaagc

gtccgaaaccatataagcgcattgaaactaatgctggatcatatatcatcgatcggcaatatatttgtatgaa

tacatcatctaagtatatatatgtatgtgaaattaatggagaattgaaggtgcgtaattgagaattgctcttc

aacgcaagacaccttctccttcttccactaattaagtactacag...TGAAtatataccgaagaaagggatta

aaatcataattacttataaaacatcaagaaatatgagcaccggaaaaaacaactaatgaatgtttcttgatag

aagctagccctaatgaatcggaatcccctaattaagtgttttaatttgtgaagcataattattaagtttatac

ttattaaaaagtggggtggggggtttaattagttagctaggtaaggatggaataattatatcgaacgtacGCT

TCCATGTGTCTGATCTGATCGGTGGTGTGACGATGATACTTCTTCCTCTTTCTCTTATTAGTGCCCTTGTTTC

CAGCTGCGCCGTCCTCCTCTTCCTCCTCCTCATCGTCGTGATCCTCACCCTCCAAATCCTCCTCTGATCTGGA

TCTCGTGGGTCCTGAGTTCTCGCTGCTCATCTCCACAGTGCGATCCTCATCGTCAACTACTCTTCTGCCCAGG

AAATCCTCCTCAGGGTTGGTGCTGCCGGAGGATGCATTCCGGAATATCCCAGCctgtatatattcctatctcc

attaaaatcaagacatatatataatatatgtttatgtgagagctagcaagtacatgtatgtagaaaagagaga

gtagtatacGAGAGATAGAGAGAGGGCTGGAGAGGAGAAAAAGTCTTTGGTGGGTTGTTTGGAAGACATGTCG

ACGGCCATTGACATACAAATCCTGTCCCTAGCTAGCTTCTTTGcttaattatgatctcttccctcttctcctc

gcactccttcttccttatatattatctctctttttttctttcttctttaattacttatacaccaaaatgtact

ttcaattaatatataagctaagatcgatatatatatatatatatatatatatagcctcttcaattccaatgat

acatatatatataagcggtcgtttttcagatatttcttccatttctctactgctcttgacttttaggtgcttc

ttttataattaattagttttaattaattaatacctattatattattatatttagtccttttacggttttatat

attttggctatacttcaatccgacAATTGAGTAGTTTAAAACATGGCCAGCTACAGCATTGGCAGCCATCGAT

CGACTTCATttttcttcttaatattcgatttttaatatatacatatatatatgatgagcaaaattcaaatttg

aattatggaaaatatatcagccttccaatttcagctactaactttaatatgaattatgttggaatgatataaa

-5’

Legend:


UTR Intron Exon

Figure 3.8: CS23838 D1-3 T-DNA insertion locus determined using targeted gene

sequencing. Targeted gene sequencing product read through the T-DNA sequence (red

highlight) and into the flanking GL-2 gene sequence (yellow highlight). For simplicity, the T-



codon (blue highlight) are identified. The GL-2 sequence shown is reading off of the antisense

strand. The black arrow indicates the directionality of the sense strand.

GL2 (AT1G79840)

55

3’-

acatttttttcactcgttcttatcttaaatacattcgtgatggaaacataaacaaacatcaacatccaaacac

aaaaaataatcccagtaaaaaaaaattaaaccaaaaaaaaaaaacaTCACATAACAACACAAGCGGAGGCGTT

CTCGTCGCTAAACGCCGTAGTATAACGAACCTCAGTGGAGCTAGCACGTGCGAGACGTGACACATGTGGATCA

TACTCGGTGTTCCTAACGTACCCAGTCGGGGCTCTGTTATCGTAAACACCAGACGCGTAAGGATGAGCCACAA

CGTCGTAAGGAACGAAAGGATATAGCTCTGCTCTTTTACCGGTTCGGTGAATGATACGAGCCACCACTTTGTT

TGGTTCAACGTACCCAACCACTGTCACTTTCTGAGCATTTGGCTCGATGGTTACATCTCTTATTCCTCTCATT

CCTTCTAAAGCTCTCCTTACTTTCCTCTCGCATCCTTCACAATCTATCAAAACCCTCACATCCACCGTctagt

attttccaaccacaacatattataataaggatttgattataaataaacgtaattatgaatggatgcagaattt

aattacCTGTAGACTTTTGTGTCTCTTGGAGCTTCCATGAGAACAATCGAAATATTCAGAGACGTGATCAAGA

ACACCCATttttcttgtttcttggtttcttctttcttttggtttggcgaaaaaagttagactctatatgttga

gatatatgatatgattttctttttttgttattgtcaacataaaaattgagtttaaaatgttgaaaatacgacc

taccaaactctataagtagttttcgaccatatatttagttattatatgctgatattttgtatcaaccttcagt

-5’

// 1049 bp

gcatattttgatcatgttttctgtgtagaaattttgtgagagtcaaccacaccatcaaatttaatggccaaaa

tccaagttcatgtaatttgctcgaatattgttatgtttagaaagagtgtcggtcctctgaaaccccaaacaaa

cg...TGAATATATCCtgatttactgattttcatgcacttttctcttttgaaacctaacattagttggaaata

aaaagcccaacattcggtagaattcactattcagacgagtaagccttgataatgggcccatattagtgaaatc

aaggactgctaggcccaatgtatacaaggttatagctttacaaccttgaattctcaatttttgggctttaacc

agtgtatagacttaatattgatatgaaccaaacctcttctgaatcatattctacaaattatattggaacatca

// 5999 bp

5’-

atatatcgtgcagaggttacatgcattgtacaattttgttgtcccgagaaacaagcggatcagagacaaaatc

agagtcggtttcctgctttttgattcctctttattaatcagcaaagatcgattccacttctcctctctctctc

tctctctgttctttaatttagagagaaaaaataagcattcttccttctctgttttcgagcgggaaattctgga

gATGGCTATACAAGCGCAGTTGAATTACAACGCTCCGAATGCGAATCAAATCGGTTTTGGTGGGTCCGAGTTT

TCTTTGATCAACAACAATGGCGTTATCGGAATCGGTAACGATCAGTCTTATCTTGTCAATAATCTCCAGTTGC

AGAAAGATTTCAACCAACATGCTCTGTTTCATCATCAGCATCATCAACAACAACAGTCTCCTTCTCAAAGCTT

TTTAGCTGCTCAGATGGAGAAACAGAAGCAAGAGATCGATCAGTTCATCAAAATACAGgttcgttatttcgta

atccaaaccaatttttcatcgaaagtttcggtttttaagacgtgggtactgataaagattcaaccttttttgc

tttgttgataacagAACGAGAGGTTGAGATATGTGTTGCAAGAACAGAGGAAGCGAGAAATGGAGATGATTTT

-3’

Legend:


UTR Intron Exon



highlight) and into the intergenic region between HIPP25 and SPB (yellow highlight). For

simplicity, the T-DNA sequence shown is incomplete, and only shows part of the left border

sequence. Introns (purple letters), exons (orange letters), 5’ untranslated region (red letters) and

the translation start codon (blue highlight) are identified. The sequence shown is reading off of

the sense strand. Numbers indicate the quantity of nucleotides omitted in the intergenic regions.

The black arrow indicates the directionality of the sense strand.

HIPP25 (AT4G35060.1)

SRBP (AT4G35070.1)

56

3’- GGATGAGGTTGATGTTTTGAATGATGTGAGGAAGATCGTTGATGGAATGAGATGGGATACTAAGTTAATGGAT

CATGAAGACGGTCCTCTCGTGCCGGAGAAGATTCTTGTCGCCACGAAGCAGTATTGGGTAGCCGGCGACGATG

GAAACAATTCTCCGTCGTCTTCTAATAGTGAAGAAGAATAAaacaaaaacaaaaaactcctcaggtattgtag

ttacagtccctgtactttacattttttaccagatttgactacgaacttttgttaagatcaattaaacccaaat

tccttctttttcctttgttactcttatgattgagtttgttttttctttctttctttcaggttactaagcttga

agtgtagatctattttacaacatctggaaaattcttatcaaaaaaggaaggaatcagaatttccattaaagaa

aggtgtcaaaaaaaagttgtaaaactatatagtagtgatcaagacgaatatgtgcatttatgttttatttttg

ttccctagtttttaattttatttttttgaaggaagaaaaaattagttccatgtgtttttgcaagatagttgaa

accttggacgcttgttatgtatgatgcgatcttgacattttttaataacagttattttaaataaatttatgat

ataaacggaaacttctagatagttttaaataacataaaattagtagaa...TGAATATATCCTGCAAAACCaa

tatcaataacagttcgatgacattattgtagggaaattgattcatatgtgggtcgctattgtacgtaaatgga

tactactgttttggaagaaagctatagttgtcatgggtcaccttttgtctcatgactctcatcatacatttat

agattacatatttacattatcataacattttacacatattgatataactatctctaataaaaaaaaaacacaa

tctaactttatagcacataagtattaaacataatgaatttatccccaacagt

-5’

// 4312 bp

5’-

Aggtttagattttttcttgtattgttataggaaattaatcctatatattgattaataaagacaaaaataataa

ttaatccttatctcttttttcctctaacctcagttaacctttatcttagtaagactttttattctctttatct

ctgtgcataacccaatgacaagaacaacactagtcaccaacttattataactcttcatccattttctctctct

caaagtcaccccccaaatttttttatttttttttttaactttgaatgtgactcaggatagagagagggcgaga

cagataaagagagcttgaggaaggatttaagcagatctgcaagaaacactctctcaggtaaggtgagaactct

aaaatatgaatttactcatttgacttctgaattgtgaaagtttgtttgtttggttttaaatttccaaagcttt

tcttttgatcaattacatgttcattgcatgtgatgtgagcatgatctcttatctggatataagatcttctcct

tcttctgcttatggaaagaaaaaaacatcagttttatcgaaagtgcaacttatgatttgatcacaattctttt

tctctctgggtatatatctctctctcaatttccctaaattctagggatttgcctttctccttcattagttgtc

ataagcctatgttttagtatttgttaaaggtcattagtctgtgttgttaagttaactaatcactgcatgcacg

agttaaacaacactaaactaataatatattcactcttaaatgattcaaaagctttgttagatttcatggcatg

gtggtccactctttataaataacaaaatcaagttcctcatgaattattcttatctcatcaataatacacacac

cttttgaatatttacttttcttgtatctttattctgtctaatttttttgtttattctattcatttcccctttt

tttattaataaaatctagccagtgtttactttttttccgtagaatcaaaccggcggcgacagtgacggcggcg

aaaagcggcggtgttggccgcaaaaacgatgcaaaaccagctATGGTCATTACCGCTAACGATTTATCAAAAT

GGGAAAATTTTCCTAAAGGACTTAAGGTTCTTCTTCTCCTCAACGGCTGTGACAGCGACG

-3’

Legend:


UTR Intron Exon

Figure 3.10: The first of three T-DNA insertion loci in CS23127 A1-2 determined using

targeted gene sequencing. Targeted gene sequencing product read through the T-DNA

sequence (red highlight) and into the intergenic region between APRR2 and SAM (yellow

highlight). For simplicity, the T-DNA sequence shown is incomplete, and only shows part of the

left border sequence. Introns (purple letters), exons (orange letters), 5’ untranslated region (red

letters) and the translation start codon (blue highlight) are identified. The sequence shown is

reading off of the antisense strand. Numbers indicate the quantity of nucleotides omitted in the

intergenic regions. The black arrow indicates the directionality of the sense strand.

SAM (AT4G18030.1)

APRR2 (AT4G18020.1)

57

3’-

attaattttcacaatctatataaaacaaaagtgaagtaaagaaagcagcaaatcattgataagagattttggg

ttcaagaaaaacattgaaagtaacacatacacaaataataaggctttttaaagaaatataaattgagtcttat

aacaatacacaacagacccaatctattgggcccaataaaactagggcctctatagagtaacgcaaagaggagg

aggaagaggaagcacagttttattttgaaagatacacaagtagaggggagccatggcaTCACCATCCTCTGGG

AGGTCCTCCTGAGGACTGCCCACTCAATCTGTCGAGGAGGGTGTTGAAGTCGATGGGTTGGCCACTCTCTTCC

ATCCGCTGAATAACAGCCATGACATGGTCTCCTCTGAAACCCATGCTCACTAGCTTCTCTATCAGTTCACCGT

ATTTTGATCTCAACACAGGTGGTGCACCAATGTTACCGCCACCTGCCTGGTGCGGCTGGGGAGAGTATCCACC

ACCTTGTGGACCTTGCAAGTAATGGGCTTGCTGCTGCTGCTGCTGCGGCTGAGGTGGTGGGTATTGCATTCGC

CCACCTTCATACATGGCATTGGCATACCCGGAAGGAGGAGGAGGTCCTGAGGGTAGATACCCATCGCCAGTCT

GGGGGCTGTAAGACATCTTTGTCTGCTGAGGAGGAGCCTGTGGTGGTGGTGCAGCACCGTATCCGTAAGCTTG

CATAGACTGTTGAGGAGGTCCAGAGTATGGTGATTGCATCTGCATGCTGCTTGGCAACGATTCTACTGGCGGT

TGGTTGCCTGGTGGTGCAGGCGAGTATGTTGGGTAGCCTCCACTTGACTGTGGCCTGGCTTGTGGTTGGGGTG

GCCAGTTTTGCTGGTACTGCGGGAATGACTGAGTTTGGGCTGAGCTTGGGTGAGATGGAGCAGGAGGTGGGGG

CATGAACTGACTCTGCGCTGGTGGTGCTTGAAGTTGTGATGGTGGAGTAGAAACGGGCACCGGTGCAGGTGTG

TTTTGAAGCTGTGTAGGAGGAGGAGGCATGTAATACTGATGTTGTTGTGGCTGTGGCTGCGGCTGCACCTGTG

GCTGTGGGGCTATTTGGTGAGGCAAAGCAAGTGCAAGCTGCTGGTTGTGTGCATCAGAGGTGTTCTCGCTCTT

CTTAGGCTCTGGAACAGGAGTGGCGACACGGTCCTCACCATGTTGAGAGTGAGACGACGAAGATGACTCTTTC

TGCACAAGTTGTAGCTTCGCTAGCTCTTTCTGAGTATCTGCTAGCTCTTGTTTGTCTCTAAGAATCTGGACAG

ACCTATGCACctacaacagaacatccatggtcaattactgatcagagttttacaaactaaaattaacaaaaag

gattaaaaacattgcataacaataacaaacCTCTTGAAGATGTTTGTCGAGAGATCTAAGCTTCACATCGGCA

TCCTCATGTGCATGAGTCAACTCCGATCTCATTTCTCCAATGGTCTTATCAAGGTTGTAGCAGTAGAGTTCAA

GCTGAGACAAGCGTGAACTGAGGCCTTCAAGAAAGCGCATCATGTTATCAGCATACATCTTCATGGTCCTTTC

GACAGTGTCAGTAATGTCTTGGCTCAAAGAATCCTCTGGTGGACTGTAAGAGCTTGTAGGGAAAACCGAAGAC

CTTGCCATCCTTGTTTTATGGAATTCctacaagcaaaaaaatgaaacaataaacaaagactcgctcagtatat

ctgatcaaaagtggatgaaattttcttccaattgaaaataaggaggacaagcacagcttaacaagctctagtt

ccaagtcagattcatagctaaggcgtttccacagaacatagctcctcataagtcacaaccaacatagaaataa

ctagctaaattagctcaacactaagaggactagttcgatattgactcctcgaaattgtttttacacgtatctc

tgagcaaaccacaaatcaaaactctagattcccaaaaatcaaacaaaaatcgccgatcgagcaaaatacccga

acctaaaaaaaggaagaaaagggtaaatcagtgtggttaacCTTGTTGGAGTTGGAAGCAGCGATCGCAGGAT

CGGAGTGAG...TGAATATATCCTGACCATTAGAGGAGTCTTGGTTGGTGTAGTCATCATAAGAGCAAAGGAT

ATCATCGGAGCCAAAATCGAAACCTTTGGATCCTGAGTTGACCCGACCCGAAGATCCAGACGCCATtgaatcc

gaagactgaaaaccagattgagaaaaaagaatcgaaagaaggaaatctcgctttttagattaagtcttgggaa

aaaagcaaaagcgtggttcttcgttttcttcgaacctttgagaaaacgcaagcaaagagagaagcaagcagga

aaaaaacgtttgttttctctttattatatttttgctttttaatttgtttattacatattatatttttgctttt

-5’

Legend:


UTR Intron Exon

Figure 3.11: The second of three T-DNA insertion loci in CS23127 A1-2 determined using


sequence (red highlight) and into exon 1 of DUF1421 (yellow highlight). For simplicity, the T-



codon (blue highlight) are identified. The sequence shown is reading off of the antisense strand.

Numbers indicate the quantity of nucleotides omitted in the intergenic regions. The black arrow

indicates the directionality of the sense strand.

DUF1421 (AT4G28300.1)

58

3’-

Tgagacccgttcaaattgattccgtacataacggttgaccaataacaacaagtcgacgaccgttattattata

ctatctttgtagttaattttgcgttgacttttttagtttcattaattccgataatcagcggttttctgcatga

ttacaatagactccattaaaaatggcccaacaactcaattcagtggcttatcctttctttacatctggacaaa

aagtgttttcttgacttttagtgttcattacacaaaaacgaaggacttaaacacaatgtcgtatgtatgtgta

tgtatcttggcccaaaagaatgtgtccagtgcccacccgaCTATGAAAACGAGAATCTTGAGAAGACTGATAG

ACCTGAACCCTCACTTGCCGGACTTGGAGTCGCCTCTGTTGTTGTTGCCGCTGTTGTTGAGCTATGGTAGGCT

TGCTGACACTTCTGGATCTCCTCTGGACTGAACTGCAGCAACATCCCCACTACAGGTAGTAAAGCCTCCACTT

CACctgcaattatcacaagttaatttac

// 2079 bp

agaaccaaaagaaaactatgtacCTCTTCTCTTGCACCTTTGAGTTCCGCATCTTTTGTGCTTAGTATCTGGG

TCTGCATGGACATTTCAGATCCCAGCTGACctgacaatttatatgaatgaaatgtctatagtccatagacaaa

agtaaaacataactagattagttcaacgtttatgaactccgtcaattacTTCTCATTT...TGAATATAGCCA

CTTCGATTTCGGCCTGTAAGTAGTTGCTTTCAGCGATTTCCAGTTTAGATTTAAGGGCATCGCATGAAGCTTC

CCAAGTCTCCTTTTCCTTTTCctaaaggaacaaaaaaaaatcatggcttctatgaattacaacaaaagaaaat

agaggaatttatatggccaaacaaatagaaactctaaacatgctgtctgatgacagactgacgccttagatca

tgtttacaattatctatacgcactcctatattcattccctggttaaaaccatgctagtaaatctgctaaatga

tggaaatcatttgacgagtagtatgcaaaacaatgtcttagaatatacgaatgggcaacaataacgaaggaca

aatgacagttggcatcagagagtcctgcgaatccatctttaaacattccacttacATTCTCTGATTTAAGGTG

// 1268 bp

GTCCAGGTCGGCATATTTCTCGTCGCGCTCTTTGATTTCCTGGTCCAGTTTCTGTTCAActacaccaacaatg

taatagcacaagttgagaaaaggcaaacactggttccggtcaatgaatgagcaaatagaaaagatggcttctg

acCTTGGGAAAACTTAGAGGAGTATTCTTGGGATTTAGCATCAGCCTCAGAGTATGCTTCCCTTAGATGCTCA

AGAGCTTGCTCAGCTGCAACTCGAGTTTGTTTTTCCACATCAATTTCTCTGCTCAATGATGCGACCTGTTCTT

GAAGTTGTTTCAGCTGAGCAGAGTCCGCTTCCACTTGCTCAGCTTTCTGGAGAGACCTACCTTGCGCTACCTC

ATCCTTGAGTCCCTCAAATTGGGATCTGAGAAAGTCATTTTCTAATCTCAGTTCAGCAATCATTTGGAGTAGC

TGATCACCATTTTCTGTCAGAGTCTCGTTGGAGGCATCATTTAACTCTTTATCTTCTTTGATCACATGGCTCT

CCTCTTCTTCTCCAACCACATCAGATTCCTTGTCTTCGGACATcttggcagagcagatgtcagaaagatgaac

ccagacactcaagagagcgacgacaactagtaagcgcaaaatcgggatttgaatcaacaatcaaaagagaaag

gagtcaagtcgtgaaattcgaataaaccagcaaaagcaacgcaaggagaagagagatttgaatgtaatcagtg

ccagagaagaagcttaccttgaggtgagggattagagaagagtgtggaggcagagagagagaggtcacaaaca

-5’

Legend:


UTR Intron Exon

Figure 3.12: The third of three T-DNA insertion loci in CS23127 A1-2 determined using


sequence (red highlight) and into exon 13 of ATGRIP (yellow highlight). For simplicity, the T-



codon (blue highlight) are identified. The sequence shown is reading off of the sense strand.

Numbers indicate the quantity of nucleotides omitted in the intergenic regions. The black arrow

indicates the directionality of the sense strand.

ATGRIP (AT5G66030.1)

59

3’-

Aatgtatgcagtgtcattataagatattcgtaaagagaccttaaaaacaagcgtttggctgattataagaaat

tattattcaacaatgtagttggtctagagaaattacttacatctctctttcactctaaacactagagatcaaa

acaacgaagtaaagaagtaggatcattagacaaagattggaaatatcacaagtctctttgcttttgacataaa

caaacccaatttaaaaaaaaaaccaacttattaatgtaacattaaaaaaaaaaaaaaaattagacccaaaaaa

agtcctgagctctctgctatttcttcttttttccttttcttttcagacgaacatagaaatatttCTACTTCCA

AATCTTTACGGATTTGTCATGACTTGCAGACGCAACCACTCCCGTCGAAGGCGACTGAGCCAAGGCAGAGATC

ACACACTCGTGGCCTGCTACCGTCATACATTTGTTCTCCATTGTGTTCCACAGCTCTATAGCctgtcacagat

tcgtttaccaaagttaaaacaactgaga

// 1463 bp

CTCCATCATCTTGGGACAAAAATGATTCTACATTATCTTCTAGAGCTCCCACATCTCCAAACTGGTCCATGTC

ATCCTGCAGctattaattcttgtcataagaaagctgaaagaaacacggccccatgggatataaaaaaaatatt

caagctgctaagaaagca...ATATcttgtttcacacaacacaactgcatgctgtatccagatgttattggag

gaaaactagattgtcgttatcattcttctgagaaattaagaaacatacCAGTTGATTTGCTGATGATGCAAGA

CCACCGATCCCATCAGAACCATACATCATTGGCCCTTTTGGCATGCTATTCACATGGTGCATGTTACCAGCTA

TAGCAACTCCATCAACAGGGGTATGCGTTGACGGAGTCGATGGCTGTGAGTTGGATGGGCCAACAGTGTTTCC

TGTCCCTGTGCTGTTAGCAGGACCAGAAGAGGAAGGCCCTTTTCTTTTGCGGTTGTTctatcagatacacgaa

aaggaagttgtggctcaatcatctcagacactaaagaatatattcagttggttaaaaccacatgcttgataag

acttgagggattggatccacataaaagtacCT

// 2233 bp

TATGTAAACATCAAGCctacaaaaacacaaagatatcaaagtaaggaattgaaaaaaaataagcttttattga

atacaaaattaacttacATCTTGTCAGCTTCCCAATTACTCTGAGCCATagcttcagcccaagatcgagctgc

tataaaaggaattcaaatcttcaatccaaagaaatgatatgaactcagaataattcgattgttttaataaaca

gacactaacctgaataaaagcccaaacaaataaatatcaagtagatcagaaccctaattcgatcttcagatat

cagtaaatttaaagatcaagcattgctgctacacatacagagaaaatataaagaaatcgacaaggttaaattg

cttatacgcgaacatgacttttggaattcgttgaattgatatagaaagtaatcgaattcacatacctgacgga

tcacaattgaaaaggaaaaaaaagaatctagggttcttgagagattacagtgaattgtaatcagctgtaagtt

aagagtaaatcgatcatgaaacagctggaagagagagatagatcagattgatgagtttggagagatcatcgga

tgtttggtttgatgcttagctttaggattcga

-5’

Legend:


UTR Intron Exon



highlight) and into intron 10 of LUH (yellow highlight). For simplicity, the T-DNA sequence

shown is incomplete, and only shows part of the left border sequence. Introns (purple letters),

exons (orange letters), 5’ untranslated region (red letters) and the translation start codon (blue

highlight) are identified. The sequence shown is reading off of the antisense strand. Numbers

indicate the quantity of nucleotides omitted in the intergenic regions. The black arrow indicates

the directionality of the sense strand.

LUH (AT2G32700.7)

60

Multiple attempts were made at identifying the CS23152 A2-1 and CS31166 A1-1 T-DNA

insertion sites, without success. Both mutants appear to have truncations in the T-DNA insertion,

as primers closer to the left border of the T-DNA did not yield any Arabidopsis sequence reads.

The CS23152 A2-1 mutant lacked Basta resistance (Table 3.2, Table 3.3 and Figure 3.4),

indicating that a portion of the T-DNA sequence was deleted.

A series of PCR primer pairs were produced in an attempt to identify the boundary of the

truncation in CS23152 A2-1 (Table 3.5). These primer pairs were used in PCR reactions using

the CS23152 A2-1 genomic DNA as a template. Primers were designed to anneal downstream

from where the Basta resistance gene would normally have been located. The presence of a PCR

product would indicate that the region spanned by the primers was still present in the T-DNA

sequence. L1 and L2 primer pairs would anneal approximately 600 bp downstream of where the

Basta gene would have been located, M1 and M2 primer pairs would anneal approximately 2000

bp downstream, and S1 and S2 primer pairs would anneal approximately 3300 bp downstream

(Table 3.5). CS23152 A1-6 was used as the positive control (Figure 3.14). All three regions

successfully produced a PCR product under at least one of the Mg2+ conditions. Reactions with

2.5 mM Mg2+ allowed for the production of M1, M2 and S2 products, though there was an

unknown 1100 bp PCR product produced with primer pair S1. Increasing the concentration of

Mg2+ to 3.5 mM led to the amplification of the expected product with primers L1 and M1. With

CS23152 A2-1, only the region 2000 bp downstream was successfully amplified while the 600

bp and 3300bp downstream products were not. Both M1 and M2 primer pairs produced the

expected product at 2.5 mM Mg2+ and 3.5 mM Mg2+. Amplification of the 2000 bp region

downstream of Basta confirms that this segment of genomic DNA had not been lost indicating

61

Table 3.5: Primers used to estimate the location of the T-DNA truncation in CS23152 A2-1.

Primer Name 5’ to 3’ sequence

L1 FWD GACCGTGCTTGTCTCGATGTA

L2 FWD TAGTGGTTGACGATGGTGCAG

L REV TTTTCTTGTGGCCGTCTTTGTT

M1 FWD GTGTAGGTCGTTCGCTCCAA

M1 REV GCGTCAGACCCCGTAGAAAA

M2 FWD AGTTCGGTGTAGGTCGTTCG

M2 REV GTTCCACTGAGCGTCAGACC

S1 FWD AGTGCCACCTGGGAAATTGT

S1 REV TCGCCCTTTGACGTTGGAG

S2 FWD AGGGTTATTGTCTCATGAGCGG

S2 REV GCCGATTTCGGCCTATTGGT

Figure 3.14: Determining the approximate location of the truncation in CS23152 A2-1.

Panels A and B used CS23152 A1-6 as a template as a positive control. Panels C and D used

CS23152 A2-1 as the template. L1 and L2 primers anneal approximately 600 bp from the Basta

resistance gene, M1 and M2 primers roughly 2000 bp downstream, and S1 and S2 roughly 3300

bp downstream. Expected product sizes were as follows: L1 - 613 bp, L2 - 594 bp, M1 - 401 bp,

M2 - 417 bp, S1 - 207 bp and S2 - 184 bp.

B

C D

CS23152 A1-6

CS23152 A2-1

3.5 mM Mg2+ 2.5 mM Mg2+

L2 M1 M2 S1 S2 L1

L2 M1 M2 S1 S2 L1

L2 M1 M2 S1 S2 L1

L2 M1 M2 S1 S2 L1

A

500 bp -

200 bp -

500 bp -

200 bp -

62

that the truncation had likely occurred between the Basta resistance gene and the region 2000 bp

downstream.

Targeted gene sequencing was revisited once the approximate region of the truncations

were identified. Five primers annealing between the Basta resistance gene and the region 2000

bp downstream (confirmed by primers M1 and M2) were designed to identify the truncation in

CS23152 A2-1 (Table 3.6 and Figure 3.15). Conversely, most CS31166 A1-1 progeny do

possess Basta resistance, demonstrating that the Basta resistance gene is still part of the T-DNA

insertion. Five additional primers annealing between the left border and Basta resistance gene

were designed to identify the region where the truncation had occurred in CS31166 A1-1 (Table

3.6 and Figure 3.16). A summary of targeted gene sequencing data obtained from CS23152 A2-1

and CS31166 A1-1 to determine truncation site is found in Table 3.7 and 3.8.

Table 3.6: Primers used in targeted gene sequencing to determine T-DNA insertion sites.


pSKI015LB ACACTGACGACATGGTTCTACATGTAGATTTCCCGGACATGA

A2-1 P1 ACACTGACGACATGGTTCTACACGTGACGTAAGTATCCGAGTCA

A2-1 P2 ACACTGACGACATGGTTCTACATGGCGTTCCCCTTTTGCATT

A2-1 P3 ACACTGACGACATGGTTCTACATACCGCCTTTGAGTGAGCTG

A2-1 P4 ACACTGACGACATGGTTCTACATTCGCCACCTCTGACTTGAG

A2-1 P5 ACACTGACGACATGGTTCTACATTACCGGATAAGGCGCAGC

A1-1 P1 ACACTGACGACATGGTTCTACACGCCTATAAATACGACGGATCG

A1-1 P2 ACACTGACGACATGGTTCTACAGCAGGCATGCAAGCTTATCG

A1-1 P4 ACACTGACGACATGGTTCTACAGGCAGAACCGGTCAAACCTA

A1-1 P5 ACACTGACGACATGGTTCTACATCCGTTCAATTTACTGATTGTACCC

A1-1 P6 ACACTGACGACATGGTTCTACATCACCGAGATGTGATGACCC

63

Figure 3.15: Map of the primers used in targeted gene sequencing to determine the

truncation site of the T-DNA in CS23152 A2-1. Basta has been truncated in this mutant and

the missing region highlighted in red. Primer pSKI015LB was used as a negative control (not

depicted in diagram). Illumina primer P2 was used for each reaction. M1 PCR product was

amplified using CS23152 A2-1 as a template to establish boundaries where the truncation may

have occurred.

Figure 3.16: Map of the primers used in targeted gene sequencing to determine the

truncation site of the T-DNA in CS31166 A1-1. Illumina primer P2 was used for each reaction.

64

To analyze the read data produced by these primers, the number of reads containing the

primer sequence and the expected downstream sequence were compared (Tables 3.7 and 3.8).

Reads were categorized into four different groups; those with the primer sequence, reads with the

primer sequence and the next two expected nucleotides, reads with the primer sequence and the

next four expected nucleotides and reads with the primer sequence and the next six nucleotides

We would expect to see a similar number of sequences in each category if sequencing was

successful.


determine truncation site.

Primer Primer Sequence # of Reads

with Primer

# of Reads

with Primer

+ next 2 bp

# of Reads

with Primer

+ next 4 bp

# of Reads

with Primer

+ next 6 bp

pSKI015LB TGTAGATTTCCCGGACATGA 61967 4745 56 16

Primer 1 CGTGACGTAAGTATCCGAGTCA 43143 582 53 43

Primer 2 TGGCGTTCCCCTTTTGCATT N/A N/A N/A N/A

Primer 3 TACCGCCTTTGAGTGAGCTG 13748 1888 16 9

Primer 4 TTCGCCACCTCTGACTTGAG 12201 136 37 35

Primer 5 TTACCGGATAAGGCGCAGC 30067 1051 341 126


determine truncation site.

Primer Primer Sequence # of Reads

with Primer

# of Reads

with Primer

+ next 2 bp

# of Reads

with Primer

+ next 4 bp

# of Reads

with Primer

+ next 6 bp

pSKI015LB TGTAGATTTCCCGGACATGA 6816 185 2 0

Primer 1 CGCCTATAAATACGACGGATCG 70773 310 9 0

Primer 2 GCAGGCATGCAAGCTTATCG 28468 497 1 0

Primer 4 GGCAGAACCGGTCAAACCTA N/A N/A N/A N/A

Primer 5 TCCGTTCAATTTACTGATTGTACCC 54065 518 4 0

Primer 6 TCACCGAGATGTGATGACCC 89716 216 25 0

65

Due to the decrease in the number of reads with the expected primer and downstream

sequence, this attempt at determining the truncation sites for both mutants was not successful.

For CS23152 A1-2, we should not obtain any sequence with primer pSKI015LB, as that region

has been removed in this mutant. Results obtained with the other primers yielded a similar

quantity of reads containing the primer and the next six expected base pairs. With CS31166 A1-

1, none of the primer pairs were able to produce any reads containing the primer and the next six

expected base pairs.

Overall, the T-DNA insertion locations for four of the six mutants that we had identified in

the screen using targeted gene sequencing were determined (Table 3.9 and Figure 3.17). Of

those, three homozygous lines were obtained (CS23120 A3-4, CS23152 A1-20-3 and CS23838

D1-2). The Basta resistance assay, TAIL PCR and targeted gene sequencing were carried out on

heterozygous mutant CS23838 D1-3, though we later found CS23838 D1-2, which is a

homozygous sibling. CS23152 A1-2 and CS31166 A1-1, were not successfully characterized

with this technique. The targeted gene sequencing data is presented in Appendix 1.

3.2.5 Reverse-Transcription Quantitative PCR analysis to determine gene expression levels of

genes flanking the T-DNA insertions

Reverse-transcription quantitative PCR (RT-qPCR) was performed to determine if the

expression of genes flanking the T-DNA insertions were upregulated by the CaMV enhancer

tetramer. Primers annealing to Actin-7 mRNA were used as the endogenous control. HIPP25 and

SRBP mRNA levels were quantified in two-week old root and four-week old leaf tissues

obtained from homozygous CS23152 A1-20-3 plants compared to wild type plants. For

66

Table 3.9: Summary of the T-DNA Insertion sites in NA tolerant Arabidopsis

Plant ID

Number of

Predicted

Insertions

Genes Nearby Insertion Zygosity of

Insertions

CS23838

D1-2 1 Intron 3 of Glabra 2 (GL2) (AT1G79840) Homozygous

CS23120

A3-4 1 Intron 10 of Leunig Homolog (LUH) (AT2G32700.7) Homozygous

CS23152

A1-20-3 1

Insertion in intergenic region between HIPP25 and S-

ribonuclease binding protein family protein

Homozygous - ~1000 bp from 5’ UTR of HIPP25

(AT4G35060.1)

- ~ 6000 bp from 3’ UTR of SRBP

(AT4G35070.1)

CS23127

A1-2 3

Insertion 1:

Undetermined

- 29 bp from 3’ UTR of S-adenosyl-L-

methionine-dependent methyltransferases

superfamily protein (SAM) (AT4G18030.1)

- 4563 bp from 5’ UTR of Pseudo-Response

Regulator 2 (APRR2) (AT4G18020.1)

Insertion 2:

- Exon 1 of Arabidopsis thaliana formin-like

protein (DUF1421) (AT4G28300.1)

Insertion 3:

- Exon 13 of ATGRIP (AT5G66030.1)

CS23152

A2-1 Unknown Unknown Undetermined

CS31166

A1-1 Unknown Unknown Heterozygous

67

Figure 3.17: Schematic summary of T-DNA insertion sites in genomic DNA of NA-tolerant

mutants. T-DNAs (red triangles) are shown as insertions into an individual gene or intergenic

region. Introns (I) and exons (E) are shown for intragenic insertions. Arrows show gene

orientation. Linear distance is not equivalent between lines.

heterozygous CS23127 A1-2 plants, APRR2 and SAM gene expression was quantified in four-

week old leaf tissues as well as in Col-7.

Expression of APRR2 and SAM in leaf tissues of CS23127 A1-2 mutants did not appear

higher than in the Col-7 controls (Figure 3.18). The first mutant had APRR2 fold changes of

0.590 (P1) and 0.725 (P2) while the second mutant had fold changes of 0.773 (P1) and 0.739

(P2). Regarding SAM gene expression, the first mutant had fold changes of 0.675 (P1) and 0.567

(P2) while the second mutant had fold changes of 0.611 (P1) and 0.498 (P2). There did not

appear to be any differences in HIPP25 or SRBP gene expression between leaf samples obtained

from Col-7 and two CS23152 A1-20-3 mutants (Figure 3.19). Both the HIPP25 and SRBP

primers yielded extremely similar fold-changes within each individual plant sample. The first

68

CS23152 A1-20-3 mutant had HIPP25 fold changes of 1.589 (P1) and 1.459 (P2) while the

second CS23152 A1-20-3 mutant had fold changes of 1.151 (P1) and 1.065 (P2). In terms of

SRBP gene expression the first mutant had fold changes of 0.677 (P1) and 0.665 (P2) and the

second mutant had fold changes of 2.052 (P1) and 1.514 (P2). In the root tissues HIPP25

expression was lower than in the Col-7 control with fold changes of 0.622 (P1) and 0.534 (P2)

(Figure 3.20). However, there appeared to be a slight downregulation in SRPB in both tested

mutants as fold changes of 0.400 (P1) and 0.360 (P2) were obtained.

It was expected that the presence of the T-DNA insertion in mutant lines would lead to

significant upregulation of genes upstream and downstream of the insertion site when compared

to the wild-type control. This was not the case for either CS23152 A1-20-3 and CS23127 A1-2.

The t-values for APRR2-1, APRR2-2, SAM-1 and SAM-2 were -3.41, -10.74, -3.41 and -3.04,

respectively. These values were lower than t0.05,2 (4.303), indicating that here was no significant

difference in APRR2 and SAM expression between Col-7 and CS23127 A1-2. The t-values for

HIPP25-1, HIPP25-2, SRBP-1 and SRBP-2 were -0.11, 0.03, 0.37 and 0.57, respectively. These

values were lower than t0.05,2 (4.303). There was also no significant difference in HIPP25 and

SRBP expression between Col-7 and CS23152 A1-20-3. Expression of HIPP25 and SRPB in the

root tissues of two-week old homozygous CS23152 A1-20-3 plants appeared to be lower than

what was observed in Col-7, but there were insufficient biological replicates to carry out any

statistical analysis. In general, genes that flanked the T-DNA insertions in our mutants were not

upregulated relative to Col-7, contrary to the expected outcome. The CaMV enhancer tetramer

does not drive gene expression constitutively, but rather increases the endogenous expression of

genes (Weigel et al., 2000). While the plant tissues were selected at developmental stages where

expression of these genes was expected to be elevated, it is possible that gene induction requires

69

stimulus from NA exposure. Additional gene expression analyses with several biological

replicates could be carried out on plants that have been exposed to NAs to determine if elevated

gene expression occurs when exposed to NAs.


A1-2. cDNA was synthesized from four-week old CS23127 A1-2 leaf tissue. Results were

standardized to the endogenous control gene (Actin-7) with Col-7 as the wild-type control. Three

technical replicates were carried out for each sample. Error bars are represented by RQmin and

RQmax, which are the upper and lower limits of the RQ values based on the standard error of the

ΔCt values.

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

1.8

APRR2 P1 APRR2 P2 SAM P1 SAM P2

Rel

ativ

e m

RN

A (

log2

)

Col-7 #1 Col-7 #2 CS23127 A1-2 #1 CS23127 A1-2 #2

70


A1-20-3. cDNA was synthesized from four-week old CS23127 A1-2 leaf tissue. Results were

standardized to the endogenous control Actin-7, and Col-7 was used as the wild-type control.

Three technical replicates were carried out for each sample. Error bars are represented by RQmin

and RQmax which are the upper and lower limits of the RQ values based on the standard error of

the ΔCt values.

0

1

2

3

4

5

6

HIPP25 P1 HIPP25 P2 SRBP P1 SRBP P2

Rel

ativ

e m

RN

A (

log2

)

Col-7 #1 Col-7 #2 152 A1-20-3 #1 152 A1-20-3 #2

71

Figure 3.20: RT-qPCR analysis of genes flanking the T-DNA insertion in CS23152 A1-20-3.

cDNA was synthesized from two-week old root tissue from 200 homozygous CS23152 A1-20-3

seedlings. Results were standardized to the endogenous control Actin-7, and Col-7 was used as

the wild-type control. Three technical replicates were carried out for each sample. Error bars are

represented by RQmin and RQmax, which are the upper and lower limits of the RQ values based on

the standard error of the ΔCt values.

3.3 Discussion

The activation-tagged screen in Arabidopsis successfully identified six mutants that

possessed tolerance to AdCA, five of which were initially identified on AdCA, and one

identified on DH2NA. Three of the five mutants identified on AdCA also showed tolerance to

DH2NA. Phenotypic ratios for NA tolerance were tested to determine the heredity of the T-DNA

insertion. The results of the NA and Basta growth assay (Table 3.2) showed that seedling growth

on AdCA or DH2NA is not effective in determining the presence of the T-DNA insertion. The

0

0.2

0.4

0.6

0.8

1

1.2

1.4

HIPP25 P1 HIPP25 P2 SRBP P1 SRBP P2

Rel

ativ

e m

RN

A (

log2

)

Col-7 152 A1-20-3

72

percentage of plants showing the NA tolerance phenotype appears to be lower than that of

seedlings shown to contain the T-DNA insertion, as determined by PCR. Screening on Basta

plates provided a more accurate representation of the T-DNA insertion, as the Basta selection

efficiency was comparable to the PCR results. Homozygous progeny lines for CS23120 A3,

CS23152 A1 and CS23838 D1 were identified by their high (~95% or higher) Basta growth

percentages. All of the CS23152 A2 progeny lines possessed AdCA tolerance, yet were not able

to grow on Basta plates, presumably due to the loss of the Basta gene in these lines. This was

supported by the inability to obtain targeted gene sequencing data or using standard sequencing

primers. Targeted gene sequencing revealed that CS23127 A1-2 had three insertion sites, yet

both the PCR and screen suggest that this mutant is heterozygous. If each T-DNA insertion were

segregating independently, we would have expected to see Basta resistance close to 100%.

CS23127 A1 progeny lines had the lowest viability on 0.5X MS plates (Table 3.2 and Table 3.3).

While it is possible that the seeds may have been prematurely harvested, one of the three T-DNA

insertions may have a negative effect on seed viability.

TAIL-PCR assays demonstrated that the T-DNA insertion site in CS23838 D1-3 was in

intron 3 of GL2, suggesting that normal splicing would be impaired, thereby resulting in a

knockout mutant. GL2 is a homeodomain transcription factor that is involved in the

differentiation of epidermal cells into trichomes and seed coat epidermal cells (Tominaga-Wada

et al., 2009; Shi et al., 2012; Khosla et al., 2014). GL2 is also required for mucilage biosynthesis,

as gl2 mutants fail to produce mucilage yet possesses higher levels of oil in the seed (Shi et al.,

2012). Mucilage is produced from the accumulation of polysaccharides such as pectin, celluloses

and hemicelluloses in the apoplast of epidermal cells (Saez-Aguayo et al., 2013). When water is

taken up by the seed, the cell wall ruptures and releases these polysaccharides. CS23120 A3-4

73

showed a T-DNA insertion into an intron of the LUH gene, which encodes a transcriptional co-

repressor. Similar to gl2 mutants, release of mucilage in luh mutant seeds is inhibited (Saez-

Aguayo et al., 2013). GL2 and LUH both play key roles in mucilage production and interact with

Pectin Methylesterase Inhibitor6 (PMEI6), a gene that is required for mucilage release ( Saez -

Aguayo et al., 2013). Although not clearly evident, the NA tolerant phenotypes of CS23838 D1-

3 and CS23120 A3-4 may involve one of two mechanisms. Mucilage is an acidic

polysaccharide-rich gel that can increase the water-holding potential of seeds. It is possible that

mucilage enhances NA interactions with the seed, which may lead to an increased effective

dosage. Conversely, mucilage-deficient mutants would have lower effective NA dosage.

Alternatively, since NAs in their nonionized form are more phytotoxic (Headley and McMartin,

2004; Armstrong et al., 2009; Leishman et al., 2013), the low pH of mucilage would result in a

more toxic environment for wild type seeds.

Although the enhancer effect on the expression of adjacent genes was not conclusive in the

mutant lines that had their T-DNA insertion sites identified, discussion on the function of the

genes located nearby the insertion sites is warranted. The T-DNA insertion in CS23152 A1-20-3

was flanked by HIPP25 and SRBP genes, and located ~1050 bp from the 5’ UTR of HIPP25 and

~6000 bp from the 5’ UTR of SRBP. HIPP25 is a plant-specific metallochaperone that is likely

involved in heavy-metal homeostasis (Tehseen et al., 2010). The HIPP family of proteins is

characterized by the presence of an HMA (heavy-metal binding domain) as well as an

isoprenylation motif that allows this protein to modify other proteins through the addition of a

hydrophobic farnesyl unit (De Abreu-Neto et al., 2013). While the exact function of HIPP25 is

unknown, related proteins in the same family have been better characterized. HIPP26 and

HIPP27 have been shown to confer Cd2+ tolerance when overexpressed in planta as well as when

74

engineered in Cd2+ sensitive yeast (Suzuki et al., 2001; Tehseen et al., 2010). The enhanced Cd2+

tolerance is the result of HIPP protein binding to cytosolic Cd2+, thereby preventing its binding to

essential proteins (De Abreu-Neto et al., 2013). Cd2+ toxicity in plants is likely due to its

chemical similarity to Zn2+ and Ca2+, which results in aberrant Cd2+ binding to proteins which, in

turn, inhibits essential cellular processes (De Abreu-Neto et al., 2013). HIPP25p:GUS was highly

expressed in root vasculature, trichomes and flower buds (Tehseen et al., 2010). A metal

transporter could potentially be involved in NA tolerance by co-transporting an NA-metal

complex resulting in the sequestration of NAs in the vacuole, target of NAs for degradation, or

export of NAs out of the cell. Phytochelatins, which are involved in heavy metal tolerance in

plants, are an example of organic compounds that form a complex with metals (Cobbett, 2000).

Perhaps a similar mechanism exists for the HIPP protein in a complex with NAs. The other T-

DNA flanking gene in this mutant, SRBP, has not yet been characterized, although high-

throughput transcriptome sequencing reveals that it is highly expressed early in seed germination

(Klepikova et al., 2016).

Of the three insertions events in CS23127 A1-2, two were in the exons of ATGRIP and

DUF1421, and the third was in the intergenic region between APRR2 and SAM. AtGRIP is a

protein that localizes itself and other proteins to the trans-Golgi network (Zhao and Li, 2014). It

is highly expressed at many developmental stages and in mature roots and leaves. DUF1421

encodes a formin-like protein with unknown function. As the insertion events occurred in the

exons of ATGRIP and DUF1421, we would expect a loss of function in both genes. It is

unknown how these knockouts could contribute NA tolerance in plants. Secretory processes play

an important role in polysaccharide synthesis. Synthesis of cellulose occurs at the plasma

membrane via cellulose synthase which is transported in secretory vesicles from the trans-Golgi

75

network. A knockout in AtGRIP may cause disruption of some components of the secretory

pathway, which could alter the composition of the cell wall and possibly change the way that the

cell perceives NAs.

Many cellular responses are dependent on intracellular calcium levels to regulate microbial

defense, and biotic and abiotic stress. Fluctuations in cytosolic Ca2+ levels, known as calcium

signatures, are detected by Ca2+ sensors and activate specific signalling cascades to induce the

appropriate physiological responses (Lecourieux et al., 2006). APRR2 is a pseudo-response

regulator that interacts with Calmodulin-like Protein 9 (CML9). CML9 expression increases

significantly in plants exposed to salt stress as well as in the presence of abscisic acid (ABA).

Upregulation of APRR2 in CS23127 A1-2 could potentially lead to an expected increase in

resistance in response to abiotic stressors (Leba et al., 2012), although in the CS23127 A1-2 RT-

qPCR analysis, expression of APRR2 was found to be slightly downregulated.

The attempt at designing internal PCR primers to narrow down the possible truncation sites

using targeted gene sequencing was not successful for CS23152 A2-1 and CS31166 A1-1. There

was a high number of reads containing only the primer sequence in both data sets. These reads

likely resulted from the primers annealing to regions with similar nucleotide sequences

throughout the genome, but not the T-DNA insertion. For both CS23152 A2-1 and CS31166 A1-

1, designing other sets of internal T-DNA primers spanning a larger region may be required to

re-establish boundaries for the truncation. This would be followed up by targeted gene

sequencing to identify the truncation site.

Degradation of xenobiotics in plants has been commonly attributed to transformation using

reduction and/or oxidation reactions, conjugation to an endogenous compound, and

compartmentalization into the vacuole or removal from the cell (Reichenauer and Germida,

76

2008; Abhilash et al., 2009). Genes that are commonly involved in this process encode CYPs,

GSTs, UGTs and ABC transporters. Previous microarray work shows that these genes are

upregulated in response to AEO exposure (Widdup et al., 2015). β-oxidation has demonstrated to

degrade linear NAs in algae due to the similarity of these molecules to fatty acids (Quesnel et al.,

2011). However, the genes flanking the T-DNA insertions in each of the characterized mutants

do not appear to be involved in any of these pathways. The identification of mutants and the

insertion sites reported in this thesis chapter suggest that other uncharacterized pathways are

involved in NA tolerance in plants.

77

Chapter Four: Visualization of radioactively labelled NA Uptake in slender wheatgrass

(Elymus trachycaulus)

4.1 Introduction

Establishing phytoremediation as a reliable method of removing contaminants from the

environment is dependent on remediation efficiency as well as understanding how plants process

the contaminants. Plants possess metabolic pathways that degrade, sequester or volatilize many

contaminants (Reichenauer and Germida, 2008). While there is evidence that supports plant

uptake of NAs through the root system (Armstrong et al., 2009), definitive evidence is lacking.

Visualization and semi-quantitative analysis of radioactively labelled contaminant uptake is

possible using phosphor imager autoradiography. This technique visualizes the extent of uptake

into the root system and can to determine if the compounds or their derivatives are translocated

to shoot tissues. This method was previously applied in a study that determined where TNT

(2,4,6-trinitrotoluene) and RDX (hexahydro-1,3,5-trinitro-1,3,5-triazine) and/or their metabolites

were translocated into poplar and switchgrass plants (Brentner et al., 2010).

Degradation of organic compounds by the plant rhizosphere has been well-documented

(Newman and Reynolds, 2004; Doty et al., 2017). Roots can promote microbial growth by

secreting amino acids and organic molecules, as well as regulating soil pH for optimal microbial

growth (Hall et al., 2011). In addition, endophytic microbes found within the roots and stems of

plants can also contribute to the remediation of toxic compounds. Microbes can either directly

metabolize contaminants or may promote plant growth to allow for higher levels of uptake and

metabolism. In one example, in planta degradation of trichloroethylene was significantly

improved by the addition of native endophyte Enterobacter sp. to the poplar tree rhizosphere

(Doty et al., 2017). Treated poplar also had increased trunk diameter, indicating that plant growth

78

was improved. Degradation of NAs by free-living microbes has been documented using -

oxidation and β-oxidation as metabolic pathways to degrade aliphatic and alicyclic carboxylic

acids (Whitby, 2010). In order to determine the extent to which NAs and/or their metabolic

derivatives are taken up and translocated directly by plants without the assistance of microbes, a

sterile hydroponic growth protocol using slender wheatgrass (Elymus trachycaulus) was used in

this thesis research.

4.2 Results

4.2.1 Radioactive NAs used in these experiments

Microbe-free slender wheatgrass seedlings were exposed to one of five radiolabeled NAs

(HA, Hexanoic Acid; DA, Decanoic Acid; CPCA, Cyclopentanecarboxylic acid; CHCA,

Cyclohexanecarboxylic acid; AdCA, Adamantanecarboxylic acid) by exposing their roots to

these isotopes for 11 days in a sterile hydroponic system (see Methods, Figure 2.5). These

compounds were chosen for their structural differences (Figure 4.1). HA and DA are linear NAs

that differ in carbon chain length, while CPCA and CHCA are single-ringed NAs that differ in

ring carbon number. AdCA has a distinct, more complex diamondoid ring structure. Microbial

degradation studies using these compounds has been studied previously (Lai et al., 1996; Del Rio

et al., 2006; Demeter et al., 2015). Linear and single ring NAs have been shown to be efficiently

degraded by bacteria (Smith et al., 2008; Demeter et al., 2015), whereas AdCA was shown to be

recalcitrant to microbial degradation until only recently (Folwell et al., 2020). An algal-bacterial

system was also successful at degrading AdCA over a 90 day period (Paulssen and Gieg, 2019).

Comparing the uptake within and between linear, single-ringed and diamondoid compounds

79

could elucidate which molecules are more easily taken up by the plant, as well as to provide

insight into the ability of the plant to translocate the NA and/or its associated metabolites.

Figure 4.1: Structures of the five NAs used in the wheatgrass uptake experiments. (A)

Hexanoic acid (HA) and (B) decanoic acid (DA) are linear NAs. (C) Cyclopentanecarboxylic

acid and (D) cyclohexanecarboxylic acid are single-ring NAs. (E) 1-adamantanecarboxylic acid

is a diamondoid NA. The carbons associated with the carboxylic acid functional group (indicated

with a red asterisk) are radiolabeled.

4.2.2 Generation of microbe-free slender wheatgrass seedlings

The process of generating sterile wheatgrass seedlings involved gas sterilization of the

seeds followed by germination on agar plates containing 100 µg/mL streptomycin. The

germinated seeds were tested for the absence of microbes using growth assays by plating extracts

on YES, TSA and LB plates (Figure 4.2 and Figure 4.3).

A B

C D E

* *

*

* *

80

Figure 4.2: Verification of seed extract sterility using TSA and YES plates. Seed extract was

obtained from gas sterilized slender wheatgrass seeds grown on 100 µg/mL streptomycin agar

plates (pH 5.8). The mock water (H2O) treatment served as a control to demonstrate that

handling did not result in contamination.

TSA (pH 7.3) YES (pH 6.2)

H2O

Seed Extract

81

Figure 4.3: Verification of seed extract sterility using LB plates. Seed extract was obtained

from gas sterilized slender wheatgrass seeds grown on 100 µg/mL streptomycin agar plates (pH

5.8). The seed extract was plated (A) undiluted or diluted with a ratio of (B) 1:10, (C) 1:100, (D)

1:1000, (E) 1:10000.

4.2.3 Visualization of NA uptake in slender wheatgrass

Phosphor images of slender wheatgrass plants were obtained after 11 days of exposure of

the seedling roots to individual 14C-labelled NAs. Two seedlings were imaged for each of the

replicated 14C-NA treatments. Control seedlings did not receive NAs treatment and did not

display any phosphor image signal (Figure 4.4). Seedlings exposed to the linear NAs (14C-HA

and 14C-DA) showed extensive signal in the roots and shoots, with more extensive labelling in

shoot tissue (Figure 4.4). The youngest and most rapidly growing leaves located near the base of

A B

C D E

82

Figure 4.4: Phosphor images depicting the uptake of 14C-HA and 14C-DA by slender

wheatgrass. The dried plants (left panel) demonstrate the organization of the phosphor imaged

scan of plants grown in liquid medium in the absence or presence of 14C labelled NA (right

panel). Plants were treated without 14C radioactive NA (Control), 14C-hexanoic acid (HA) and 14C-decanoic acid (DA) over a period of 11 days. 14C CPCA reference standards were used to

quantify the radioactive signal in plants. Radioactive measurements were based on the average of

three plants per replicate.

Control

HA

DA

83

Figure 4.5: Phosphor image depicting the uptake of CPCA, CHCA and AdCA in slender

wheatgrass. The dried plants (left panel) demonstrate the organization of the phosphor image

scan of plants grown in liquid medium in the absence or presence of 14C labelled NA (right

panel). Plants were treated with 14C-CPCA, 14C-CHCA and 14C-AdCA over a period of 11 days. 14C CPCA reference standards were used to quantify the radioactive signal in plants. Radioactive

measurements were based on the average of three plants per replicate.

CPCA

CHCA

AdCA

84

the shoot showed the highest level of labelling. In contrast, seedlings treated with the single

ringed NAs (14C-CPCA and 14C-CHCA) showed much higher 14C labelling in root tissue

compared to leaf tissue (Figure 4.5). In AdCA treated seedlings, most of the label accumulated in

root tissue, with only faint signal observed in leaves (Figure 4.5).

4.2.4 Semi-quantitative analysis of NA uptake in slender wheatgrass

Radioactivity counts were estimated for roots and leaves of plants by obtaining pixel

values using ImageJ and converting these values into becquerels based on the radioactive

standards included on each phosphor image scan (see Methods and Materials, Section 2.7.4).

The estimated radioactive counts in roots, shoots, and the portion that remained in the nutrient

solution were compared for all five NA treatments (Figure 4.6). In the single ringed (HA and

DA) treated seedlings, essentially all of the radioisotope was dissipated from the nutrient

solution, while a greater amount of signal was observed in shoots (39% and 33%, respectively)

compared to roots (7% and 8%). More than half (54% and 58%, respectively) of the initial

amount of radioactivity added was unaccounted for. In contrast, the single ringed NA (CPCA

and CHCA) treated seedlings showed most of the radioisotope signal in roots (36% and 44%,

respectively) compared to shoots (13% and 5%), while there was a slight amount of radioactivity

remaining in the nutrient solution (6% and 5%). Similar to the linear NA samples, a large portion

of the radioactive signal in the single ring samples was unaccounted for (45% and 57%). The

AdCA treated seedlings showed an average of 29% of the signal in roots and only a small

amount in shoots (0.2%). A greater amount of radioactivity remained in the nutrient solution

(15%) when compared to the other treatments.

85

Figure 4.6: Distribution of total radioactive counts in slender wheatgrass roots, shoots and

nutrient solution. The unaccounted fraction value was the difference between the total counts

added to the solution at the start of the experiment and the total counts estimated in roots, shoots

and remaining in solution.

To establish a baseline for spontaneous NA loss from the hydroponic solutions over the 11

day treatment period, the percent of isotope remaining in sterile solution was quantified from

treatment systems that did not contain plant material (Figure 4.7). HA, CPCA, CHCA and AdCA

radioactive signal was not substantial, though there was a large decrease in the amount of DA

(38% loss). This dissipation may have resulted from a higher volatilization rate of DA from

solution. These observations were in contrast with the significant decrease in the amount of NA

remaining in the solution in the planted treatments (Figure 4.7).

0

10

20

30

40

50

60

70

80

90

100

HA DA CPCA CHCA AdCA

Act

ivit

y (%

)

Root Shoot Remaining in Solution Unaccounted

86

Figure 4.7: Percentage of radioisotope remaining with and without wheatgrass in the

sample tubes. Radioactivity was measured after 11 days. Three replicates were used for the no

plant treatment. Two replicates were used for the plant treatment. Error bars are ± the standard

error.

The translocation factor metric represents the ability of a plant to distribute compounds

between the root and the shoot. Here, the translocation factor provides information about the

movement of the radioactively labelled carbon without assigning the radioactivity to a specific

compound should the labelled NA be transformed prior to translocation. The mean translocation

factors of HA and DA were high (5.23 and 4.15, respectively), whereas CPCA, CHCA and

AdCA had translocation factors lower than 1 (0.38, 0.13 and 0.003, respectively) (Figure 4.8).

0

20

40

60

80

100

No PlantHA

No PlantDA

No PlantCPCA

No PlantCHCA

No PlantAdCA


% Is

oto

pe

Rem

ain

ing

87

Figure 4.8: Mean translocation factor of radiolabeled NA uptake in sterile slender

wheatgrass. Mean values were obtained using data from three replicates and determined as the

ratio of leaf radioactivity divided by root radioactivity. Error bars are +/- the standard error

obtained from three biological replicates.

4.3 Discussion

Water, nutrients and organic compounds are largely taken up by plants through root hair

cells. From there, transport to the central vascular system occurs via apoplastic or symplastic

pathways (Steudle and Frensch, 1996). Apoplastic transport involves movement of molecules

within the extracellular space, passing between the epidermal and cortical cells until these

molecules reach the endodermis. Adjacent endodermal cells are sealed by the Casparian strip

which prevents further apoplastic transport. Thus, entry into the vascular cylinder requires

symplastic transport, where molecules must enter endodermal cells via the plasma membrane.

0

1

2

3

4

5

6


Tran

slo

cati

on

Fac

tor

88

Molecules can then move from cell to cell through cytoplasmic connections called

plasmodesmata. Transport of nonpolar organic compounds (e.g., PAHs) from root hairs to the

endodermal layer occurs primarily through the apoplast, while more polar organic compounds

(e.g., dinitrobenzene) are more likely to be transported symplastically (Su and Zhu, 2007).

In this study, five 14C-labelled NAs were added individually to nutrient solution exposed to

roots of sterile slender wheatgrass seedlings. Radioactive signal accumulated in the roots and

shoots in different proportions, depending on the class of NA added. Linear NA (HA and DA)

radioactive signal accumulated primarily in shoot tissues, whereas, the distribution of signal in

the singled-ringed NA (CPCA and CHCA) treated seedlings was higher in the roots than the

shoots. Seedlings treated with the diamondoid NA, AdCA, showed almost exclusive root

labelling.

HA and DA are both linear NAs that share similar structural qualities to fatty acids,

including the carboxyl group and long carbon chain that could allow them to be degraded using

multiple rounds of β-oxidation (Whitby, 2010). Although the single-ring NAs are less suitable

for degradation by β-oxidation due to their short side chains, microbial degradation of CPCA and

CHCA has been well-documented (Demeter et al., 2015; Ahad et al., 2018). Microbes are

equipped to use α-oxidation to remove single carbons from the NAs, allowing for β-oxidation to

further degrade the compound (Rontani and Bonin, 1992). The alicyclic ring structures in NAs

can be opened by transforming these structures into an aromatic intermediate, followed by

cleavage (Blakley, 1974; Koma et al., 2004). The ring structure of AdCA is unlikely to be

degraded using β-oxidation due to its complex diamondoid structure. AdCA is known to be

highly recalcitrant and only recently has it been shown to degrade using microbial approaches

under extended time periods (Paulssen and Gieg, 2019; Folwell et al., 2020).

89

Each of the radiolabeled NAs used in the uptake experiments contained a single

radiolabeled carbon in the carboxyl functional group (Figure 4.2). As such, if the radiolabelled

carbon is removed from the carboxyl group, it would enter other metabolic pathways within the

cell. Linear NAs such as HA and DA are more labile than ringed NAs such as CPCA and CHCA

(Demeter et al., 2015), which could allow higher quantities of newly formed radiolabeled

products to travel to the shoot. This could potentially explain the higher translocation factors

observed in HA and DA treated seedlings. HA and DA are both cellular metabolites, so it is not

surprising that they are metabolized when presented exogenously. HA is a cannabinoid precursor

in Cannabis sativa, where hexanoyl-CoA synthetase converts HA to hexanoyl-CoA (and

eventually into THC and CBDA) in the trichomes (Stout et al., 2012). HA was also shown to be

a priming agent involved in rapid plant defense responses (Llorens et al., 2016).The more stable

CPCA and CHCA likely are not degraded with the same efficiency as HA and DA, potentially

resulting in greater accumulation in the root system. AdCA, may be minimally degraded due to

the more stable diamondoid ring structure, resulting in even higher accumulation in the root

compared to the single-ring compounds.

If the labelled NAs that have entered root cells are degraded, the resulting products may be

more amenable to transport to the shoot. For example, β-oxidation of NAs in microbes results in

the production of acetyl-CoA (Whitby, 2010). In the HA and DA treated seedlings, the

accumulation of radioactivity in the shoot tissues appeared to be higher in newly developing

leaves as opposed to older, established leaves (Figure 4.4). Nutrients are preferentially directed

to these newer leaves to promote their rapid growth, and could explain the high radioactive

signal in these young leaves. Evidence for the metabolism of HA in roots was demonstrated in

90

citrus plants, where 13C labeled HA was localized exclusively in the roots (Llorens et al., 2016).

This suggests that only the degradation products of HA can be translocated into the shoot system.

Approximately 45% - 58% of the radioactive signal was unaccounted for at the end of each

treatment. This could be attributed to several factors. First, while the NA solution was only in

contact with the wheatgrass roots, a portion of the NAs could have been taken up by the agar

ring rather than the roots. Alternatively, because the 14C signal is weak, the signal from cells that

were overlaid by other cells could have been blocked from activating the phosphor screen, due to

the low energy of the 14C isotope. Another, more likely reason for this reduced signal is that a

significant amount of the 14C signal may have been lost through transpiration. If complete

metabolism of the NA was taking place, the 14C associated with the degraded NA may have

ended up in carbon dioxide that was dissipated from the tissue or released through the

transpiration stream.

While this experiment provides novel information regarding the uptake and translocation

of NAs or NA metabolites throughout the plant, the mechanisms behind uptake are currently

unknown. Previous work conducted in the Muench lab has demonstrated that NAs have

significant impacts on the subcellular structure and dynamics of plant cells (Alberts et al., 2019).

The morphology of several membrane-bound organelles (i.e., mitochondria, peroxisomes,

endoplasmic reticulum and Golgi bodies) were also drastically altered in their structure when

exposed to NAs. For instance, Golgi stacks lose their characteristic disc-like shape and instead

become punctate. These organelle changes are likely due to the integration of NAs in their

boundary membranes. Plant cell organelles are all in close proximity, thereby potentially

allowing the movement of NAs between organelle membranes. Normal membrane turnover in

the cell would liberate the associated NAs, allowing them to become substrates for degradation.

91

Also, a high concentration gradient of NAs in the surrounding environment would result in an

influx of NAs into the cytosol of the cell, entering through the disrupted regions of the

membrane where they become trapped inside the plant cell. Cytosolic biochemical pathways

may function in NA degradation in this scenario as well.

4.3.1 Acknowledgement

Mitchell Alberts contributed significantly to the results in this chapter by handling all of

the radioactive steps in this research. Mitchell also developed a spreadsheet that converts

histogram readings of pixel intensities to becquerels (Bq), which allowed for semi-quantitative

analysis of radioactive counts in planta. He also tested wheatgrass seedlings for sterility on LB.

92

Chapter Five: Discussion and Future Directions

5.1 Overall synopsis of the research

The remediation of OSPW is an important issue for the oil sands mining industry. While

OSPW contains heavy metals and salts, the primary contributor to its toxicity are NAs, a diverse

class of organic compounds. While more simple, labile NAs can be degraded using microbial

approaches, recalcitrant NAs pose a greater challenge for remediation methods. Plants, being

sessile organisms, have vast biochemical pathways that can be used to adapt to their environment

when exposed to toxic compounds. Phytoremediation provides an attractive, passive method for

removing contaminants from the soil while simultaneously providing benefits such as erosion

protection to the ecosystem and dewatering (El-Gendy et al., 2009; Gerhardt et al., 2017;

Frédette et al., 2019). Because plants have many biochemical pathways to degrade xenobiotics,

this thesis project sought to identify genes that may be involved in NA degradation using the

model plant Arabidopsis, as well as to gain knowledge regarding the uptake and translocation of

NAs using phosphor imager autoradiography of 14C-labelled NAs.

In Chapter Three, six previously identified NA tolerant activation-tagged lines of

Arabidopsis were characterized and their T-DNA insertion loci analyzed. Homozygous lines

were obtained for three mutants (CS23120 A3-4, CS23152 A1-20-3, CS23838 D1-2) and

heterozygous lines for two mutants (CS23127 A1-2, CS31166 A1-1). The zygosity of the

remaining mutant, CS23152 A2-1, was not confirmed as a result of the lost Basta resistance

gene. TAIL-PCR had successfully identified the insertion site for one mutant (CS23838 D1-3).

However, this approach was not successful in identifying the insertion sites in the remaining five

mutant lines. Targeted gene sequencing using massively parallel sequencing was successful in

identifying the T-DNA insertion locations of three additional mutants (CS23120 A3-4, CS23127

93

A1-2 and CS23152 A1-20-3) and was also used to verify the insertion site for CS23838 D1-3.

The insertion sites in CS23152 A2-1 and CS31166 A1-1 were not identified, as the T-DNA

insertions themselves appeared to be truncated. Internal T-DNA primers were used in an attempt

to determine where the truncations occurred, although this was not successful. As the T-DNA

contains an enhancer tetramer which increases endogenous expression of genes upstream and

downstream of the insertion, RT-qPCR was carried out to quantify the changes in expression

found for genes flanking the T-DNA insertions in leaf and root tissues. Expression of APRR2,

SAM, HIPP25 and SRBP in their respective mutants did not show significant differences. Since

the RT-qPCR analysis did not involve sufficient replication, these gene expression assays will

need to be repeated.

In Chapter Four, the uptake of NAs into slender wheatgrass seedlings was visualized using

radiolabeled NAs and phosphor imager autoradiography. These experiments were conducted

under sterile hydroponic conditions to determine the ability of plants alone to take up NAs

without the intervention of microbes. Plant rhizosphere and endophytic microbes are known to

play an important role in the remediation of certain types of organic compounds (Doty et al.,

2017). All of the radiolabelled NAs that were used in this study were removed from solution by

the plant. However, there were visible differences in the localization of the three groups of NAs

or their derived metabolites in these experiments. Exposure to the linear NAs (HA and DA)

resulted in high levels of radioactivity in shoot tissues. Conversely, radioactive signal was more

concentrated in root tissues when seedlings were treated with single-ringed NAs (CPCA and

CHCA) and the diamondoid NA, AdCA. Translocation factors of HA and DA were significantly

higher than the three other NAs. Nearly all of the radioactivity had been removed from the

nutrient solution when seedlings were grown in linear NAs. In contrast, radioactivity remaining

94

in solution in CPCA and CHCA treatments was approximately 5%, whereas AdCA treatments

resulted in approximately 15% of the radioisotope remaining in solution.

This thesis research provided insight into the identification of genes involved in NA

tolerance or degradation in plants. Additionally, with little being known about NA uptake in

plants, phosphor imager autoradiography has allowed us to produce novel information about the

uptake and translocation of NAs within plants. The use of NAs that were structurally variable

allowed us to correlate structural features with rate of uptake and movement throughout the

plant. Alongside previous work conducted in the Muench laboratory on the effect of NAs on the

dynamics of membrane bound organelles in plant cells, this research has provided additional

insight into the mechanisms responsible for plant mediated remediation of OSPW.

5.2 Future Directions

5.2.1 Mutant identification and the molecular mechanisms responsible for mutant NA

tolerance

Further investigation into identifying the genes responsible for conferring NA tolerance

using RT-qPCR expression analysis is required. Additionally, the mutant plants were not

exposed to NAs, which may affect the expression of genes of interest. The enhancer tetramer in

the T-DNA is not constitutive, but rather increases endogenous gene expression (Weigel et al.,

2000). To observe increased expression may require an NA stress response. Carrying out similar

gene expression studies using the AEO fraction, which contains a wide variety of organic and

inorganic contaminants, instead of a single NA, could allow for more accurate expression

responses. Once the affected genes are identified and the T-DNA insertion response is

determined, validation of the enhancer effect could be performed. For example, if the enhancer

95

was shown to significantly elevate the level of expression of the target gene, then validation

would involve producing transgenic plants that overexpress the gene to determine if these plants

also display the NA tolerance phenotype. The ultimate goal of this research is to identify

functional genes for NA tolerance that can be used as marker genes to select native plant

remediation species with enhanced levels of expression for increased remediation ability.

The six mutants that were studied here were identified from a screen of approximately

20,000 independent activation tagged lines. There remains an additional 80,000 lines in the

ABRC repository that could be screened for the identification of additional NA tolerance genes.

This type of extended screen could uncover NA degrading genes that have yet to be identified.

However, screening these additional lines would require a large body of work.

Screening mutants of genes that are involved in the same pathways as one of the six

mutants could provide additional research direction. For example, we could screen a CML9

overexpressor on NAs to determine if the same NA tolerant phenotype we observed in CS23127

A1-2 is present, as APRR2 interacts with CML9 in abiotic stress responses (Leba et al., 2012).

Another potential avenue would be to obtain mutants of genes involved in the mucilage

biosynthesis, such as PMEI6, pathways as two of our mutants had loss-of-function mutants due

to insertions in the introns of LUH and GL2 (Saez-Aguayo et al., 2013).

5.2.2 Radioactive NA studies

There are many different aspects of the phosphor imager autoradiography experiments that

could be explored to gain further knowledge regarding NA uptake in plants. Further research

using radioactive (14C) isotopes of NAs are ongoing or planned in the Muench laboratory.

Increasing the pH of the hydroponic solution would cause the NAs to be primarily in their

96

ionized form, which could potentially have effects on the ability of NAs to enter the root system

and subsequently translocate to the shoot (Headley and McMartin, 2004). Another modification

is to add radiolabeled NAs to the AEO fraction as part of the hydroponic solution. This may

trigger some physiological changes in the plant due to the presence of other non-NA components

of the AEO fraction. This, and performing experiments in soil, would provide a more accurate

representation of NA uptake in the field. Carrying out this experiment under non-sterile

conditions would allow us to see the effect of rhizospheric bacteria on NA degradation. An

extension of this work would be to inoculate the plants with bacterial species that thrive by

tailings ponds. These species are more likely to have adaptations that allow them to metabolize

NAs. Expanding the species of plants, such as willow, could contribute to understanding how

different species can remediate NAs.

Complementary experiments using heavy isotope (13C) labelled NAs would assist in

determining whether the NAs are biotransformed into other compounds upon uptake into plant

cells. This requires the use of high-resolution mass spectrometry approaches to resolve the

labelled NA against the extensive pool of organics that are present in plant cells. Also,

combining the isotopic NA analysis with the NA activation tagged mutants could provide insight

into the metabolic mechanisms for the NA tolerant phenotype in the mutants. While it would be

ideal from a remediation perspective that the mutants are taking up and biotransforming the NAs,

it is also possible that the NAs are not taken up in these mutants.

Successful development of phytoremediation systems to detoxify OSPW in tailings ponds

requires in-depth, fundamental knowledge about NA uptake, transformation, translocation and

storage. This involves metabolic, genetic, genomic, cell biological and physiological approaches

to study NA remediation by plants. The model plant Arabidopsis provides a valuable tool to

97

study the molecular genetic and genomic aspects of remediation that cannot be offered in

effectively in any other plant species. In addition, other creative approaches will provide

additional insight into NA phytoremediation, ultimately contributing to the selection of naturally

occurring native plant species that will perform maximally in the field.

98

References

Abhilash PC, Jamil S, Singh N (2009) Transgenic plants for enhanced biodegradation and

phytoremediation of organic xenobiotics. Biotechnol Adv 27: 474–488

De Abreu-Neto JB, Turchetto-Zolet AC, De Oliveira LFV, Bodanese Zanettini MH,

Margis-Pinheiro M (2013) Heavy metal-associated isoprenylated plant protein (HIPP):

Characterization of a family of proteins exclusive to plants. FEBS J 280: 1604–1616

Ahad JME, Pakdel H, Gammon PR, Siddique T, Kuznetsova A, Savard MM (2018)

Evaluating in situ biodegradation of 13C-labelled naphthenic acids in groundwater near oil

sands tailings ponds. Sci Total Environ 643: 392–399

Ajjawi I, Lu Y, Savage LJ, Bell SM, Last RL (2010) Large-scale reverse genetics in

Arabidopsis: Case studies from the Chloroplast 2010 project. Plant Physiol 152: 529–540

Alberts ME, Chua G, Muench DG (2019) Exposure to naphthenic acids and the acid

extractable organic fraction from oil sands process-affected water alters the subcellular

structure and dynamics of plant cells. Sci Total Environ 651: 2830–2844

Alonso JM, Ecker JR (2006) Moving forward in reverse: Genetic technologies to enable

genome-wide phenomic screens in Arabidopsis. Nat Rev Genet 7: 524–536

Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK,

Zimmerman J, Barajas P, Cheuk R, et al (2003) Genome-wide insertional mutagenesis

of Arabidopsis thaliana. Science 301: 653–657

Apostol KG, Zwiazek JJ, MacKinnon MD (2004) Naphthenic acids affect plant water

conductance but do not alter shoot Na + and Cl - concentrations in jack pine (Pinus

banksiana) seedlings. Plant Soil 263: 183–190

99

Armstrong SA, Headley J V., Peru KM, Germida JJ (2009) Differences in phytotoxicity and

dissipation between ionized and nonionized oil sands naphthenic acids in wetland plants.

Environ Toxicol Chem 28: 2167–2174

Bernhardt R (2006) Cytochromes P450 as versatile biocatalysts. J Biotechnol 124: 128–145

Bevan M, Walsh S (2005) The Arabidopsis genome: a foundation for plant research. Genome

Res 15: 1632–42

Bisht S, Pandey P, Bhargava B, Sharma S, Kumar V, Krishan D (2015) Bioremediation of

polyaromatic hydrocarbons (PAHs) using rhizosphere technology. Brazilian J Microbiol 46:

7–21

Blakley ER (1974) The microbial degradation of cyclohexanecarboxylic acid: a pathway

involving aromatization to form p-hydroxybenzoic acid. Can J Microbiol 20: 1297–1306

Bowman DT, Warren LA, McCarry BE, Slater GF (2019) Profiling of individual naphthenic

acids at a composite tailings reclamation fen by comprehensive two-dimensional gas

chromatography-mass spectrometry. Sci Total Environ 649: 1522–1531

Brentner LB, Mukherji ST, Walsh SA, Schnoor JL (2010) Localization of hexahydro-1,3,5-

trinitro-1,3,5-triazine (RDX) and 2,4,6-trinitrotoluene (TNT) in poplar and switchgrass

plants using phosphor imager autoradiography. Environ Pollut 158: 470–475

Briggs GG, Rigitano RLO, Bromilow RH (1998) Physicochemical factors affecting the uptake

by roots and translocation to shoots of amine bases in Barley. Pestic Sci 54: 8–21

CAPP (2019) Canada’s Oil Sands Fact Book. Accessed from: https://www.capp.ca/wp-

content/uploads/2019/11/Oil_Sands_Fact_Book-349657.pdf.

Clarke J (2009) Cetyltrimethyl ammonium bromide (CTAB) DNA miniprep for plant DNA

isolation. Cold Spring Harb Protoc. doi: 10.1101/pdb.prot5177

100

Clemente JS, Fedorak PM (2005) A review of the occurrence, analyses, toxicity, and

biodegradation of naphthenic acids. Chemosphere 60: 585–600

Clemente JS, Mackinnon MD, Fedorak PM (2004) Aerobic Biodegradation of Two

Commercial Naphthenic Acids Preparations. Environ Sci Technol 38: 1009–1016

Cobbett CS (2000) Phytochelatins and Their Roles in Heavy Metal Detoxification. Plant Physiol

123: 825–832

Cobbett CS, Meagher RB (2002) Arabidopsis and the Genetic Potential for the

Phytoremediation of Toxic Elemental and Organic Pollutants. Arab B 1: e0032

Demeter MA, Lemire JA, Yue G, Ceri H, Turner RJ (2015) Culturing oil sands microbes as

mixed species communities enhances ex situ model naphthenic acid degradation. Front

Microbiol 6: 1–13

Doty SL, Freeman JL, Cohu CM, Burken JG, Firrincieli A, Simon A, Khan Z, Isebrands

JG, Lukas J, Blaylock MJ (2017) Enhanced Degradation of TCE on a Superfund Site

Using Endophyte-Assisted Poplar Tree Phytoremediation. Environ Sci Technol 51: 10050–

10058

El-Gendy AS, Svingos S, Brice D, Garretson JH, Schnoor J (2009) Assessments of the

Efficacy of a Long-Term Application of a Phytoremediation System Using Hybrid Poplar

Trees at Former Oil Tank Farm Sites. Water Environ Res 81: 486–498

Fennell J, Arciszewski TJ (2019) Current knowledge of seepage from oil sands tailings ponds

and its environmental influence in northeastern Alberta. Sci Total Environ 686: 968–985

Folwell BD, McGenity TJ, Whitby C (2020) Diamondoids are not forever: microbial

biotransformation of diamondoid carboxylic acids. Microb Biotechnol 13: 495–508

Frank RA, Fischer K, Kavanagh R, Kent Burnison B, Arsenault G, Headley J V., Peru

101

KM, Van Glen Kraak DER, Solomon KR (2009) Effect of carboxylic acid content on the

acute toxicity of oil sands naphthenic acids. Environ Sci Technol 43: 266–271

Frank RA, Kavanagh R, Kent Burnison B, Arsenault G, Headley J V., Peru KM, Van Der

Kraak G, Solomon KR (2008) Toxicity assessment of collected fractions from an

extracted naphthenic acid mixture. Chemosphere 72: 1309–1314

Frédette C, Labrecque M, Comeau Y, Brisson J (2019) Willows for environmental projects:

A literature review of results on evapotranspiration rate and its driving factors across the

genus Salix. J Environ Manage 246: 526–537

Gerhardt KE, Gerwing PD, Greenberg BM (2017) Opinion: Taking phytoremediation from

proven technology to accepted practice. Plant Sci 256: 170–185

Grewer DM, Young RF, Whittal RM, Fedorak PM (2010) Naphthenic acids and other acid-

extractables in water samples from Alberta: What is being measured? Sci Total Environ

408: 5997–6010

Hall J, Soole K, Bentham R (2011) Hydrocarbon phytoremediation in the family Fabaceae - a

review. Int J Phytoremediation 13: 317–332

Han X, Scott AS, Fedorak PM, Bataineh M, Martin JW (2008) Influence of Molecular

Structure on the Biodegradability of Naphthenic Acids. Environ Sci Technol 40: 1290–1295

Hanikenne M, Talke IN, Haydon MJ, Lanz C, Nolte A, Motte P, Kroymann J, Weigel D,

Krämer U (2008) Evolution of metal hyperaccumulation required cis-regulatory changes

and triplication of HMA4. Nature 453: 391–395

Headley J V., McMartin DW (2004) A review of the occurrence and fate of naphthenic acids in

aquatic environments. J Environ Sci Heal - Part A Toxic/Hazardous Subst Environ Eng 39:

1989–2010

102

Holowenko FM, MacKinnon MD, Fedorak PM (2002) Characterization of naphthenic acids in

oil sands wastewaters by gas chromatography-mass spectrometry. Water Res 36: 2843–

2855

Hull R, Covey SN, Dale P (2000) Genetically modified plants and the 35S promoter: Assessing

the risks and enhancing the debate. Microb Ecol Health Dis 12: 1–5

Imfeld G, Braeckevelt M, Kuschk P, Richnow HH (2009) Monitoring and assessing processes

of organic chemicals removal in constructed wetlands. Chemosphere 74: 349–362

Johnson RJ, Smith BE, Sutton PA, McGenity TJ, Rowland SJ, Whitby C (2011) Microbial

biodegradation of aromatic alkanoic naphthenic acids is affected by the degree of alkyl side

chain branching. ISME J 5: 486–496

Kamaluddin M, Zwiazek JJ (2002) Naphthenic acids inhibit root water transport, gas exchange

and leaf growth in aspen (Populus tremuloides) seedlings. Tree Physiol 22: 1265–1270

Kannel PR, Gan TY (2012) Naphthenic acids degradation and toxicity mitigation in tailings

wastewater systems and aquatic environments: A review. J Environ Sci Heal - Part A

Toxic/Hazardous Subst Environ Eng 47: 1–21

Khosla A, Paper JM, Boehler AP, Bradley AM, Neumann TR, Schrick K (2014) HD-Zip

proteins GL2 and HDG11 have redundant functions in Arabidopsis trichomes, and GL2

activates a positive feedback loop via MYB23. Plant Cell 26: 2184–2200

Kindzierski W, Jin J (2012) Review of Health Effects of Naphthenic Acids: Data Gaps and

Implications for Understanding Human Health Risk. Oil Sands Res. Inf. Netw.

Klepikova A V., Kasianov AS, Gerasimov ES, Logacheva MD, Penin AA (2016) A high

resolution map of the Arabidopsis thaliana developmental transcriptome based on RNA-seq

profiling. Plant J 88: 1058–1070

103

Koma D, Sakashita Y, Kubota K, Fujii Y, Hasumi F, Chung SY, Kubo M (2004)

Degradation pathways of cyclic alkanes in Rhodococcus sp. NDKK48. Appl Microbiol

Biotechnol 66: 92–99

Kong F xin, Sun G dong, Liu Z pei (2018) Degradation of polycyclic aromatic hydrocarbons in

soil mesocosms by microbial/plant bioaugmentation: Performance and mechanism.

Chemosphere 198: 83–91

Lai JWS, Pinto LJ, Kiehlmann E, Bendell-Young LI, Moore MM (1996) Factors that affect

the degradation of naphthenic acids in oil sands wastewater by indigenous microbial

communities. Environ Toxicol Chem 15: 1482–1491

Leba LJ, Perochon A, Cheval C, Ranty B, Galaud JP, Aldon D (2012) CML9, a

multifunctional Arabidopsis thaliana calmodulin-like protein involved in stress responses

and plant growth? Plant Signal Behav 7: 1121–1124

Lecourieux D, Ranjeva R, Pugin A (2006) Calcium in plant defence-signalling pathways:

Tansley review. New Phytol 171: 249–269

Lefrançois E, Quoreshi A, Khasa D, Fung M, Whyte LG, Roy S, Greer CW (2010) Field

performance of alder-Frankia symbionts for the reclamation of oil sands sites. Appl Soil

Ecol 46: 183–191

Leishman C, Widdup EE, Quesnel DM, Chua G, Gieg LM, Samuel MA, Muench DG

(2013) The effect of oil sands process-affected water and naphthenic acids on the

germination and development of Arabidopsis. Chemosphere 93: 380–387

Li C, Fu L, Stafford J, Belosevic M, Gamal El-Din M (2017) The toxicity of oil sands

process-affected water (OSPW): A critical review. Sci Total Environ 601–602: 1785–1802

Limmer M, Burken J (2016) Phytovolatilization of Organic Contaminants. Environ Sci

104

Technol 50: 6632–6643

Limmer MA, Burken JG (2014) Plant Translocation of Organic Compounds: Molecular and

Physicochemical Predictors. Environ Sci Technol Lett 1: 156–161

Llorens E, Camañes G, Lapeña L, García-Agustín P (2016) Priming by hexanoic acid induce

activation of mevalonic and linolenic pathways and promotes the emission of plant

volatiles. Front Plant Sci 7: 1–12

Luna Wolter GL, Naeth MA (2014) Dry Mature Fine Tailings as Oil Sands Reclamation

Substrates for Three Native Grasses. J Environ Qual 43: 1510

Mahaffey A, Dubé M (2016) Review of the composition and toxicity of oil sands process-

affected water. Environ Rev 25: 97–114

Mahar A, Wang P, Ali A, Awasthi MK, Lahori AH, Wang Q, Li R, Zhang Z (2016)

Challenges and opportunities in the phytoremediation of heavy metals contaminated soils:

A review. Ecotoxicol Environ Saf 126: 111–121

Marentette JR, Frank RA, Bartlett AJ, Gillis PL, Hewitt LM, Peru KM, Headley J V.,

Brunswick P, Shang D, Parrott JL (2015) Toxicity of naphthenic acid fraction

components extracted from fresh and aged oil sands process-affected waters, and

commercial naphthenic acid mixtures, to fathead minnow (Pimephales promelas) embryos.

Aquat Toxicol 164: 108–117

Marmiroli M, Pietrini F, Maestri E, Zacchini M, Marmiroli N, Massacci A (2011) Growth,

physiological and molecular traits in Salicaceae trees investigated for phytoremediation of

heavy metals and organics. Tree Physiol 31: 1319–1334

Mena-Benitez GL, Gandia-Herrero F, Graham S, Larson TR, McQueen-Mason SJ, French

CE, Rylott EL, Bruce NC (2008) Engineering a Catabolic Pathway in Plants for the

105

Degradation of 1,2-Dichloroethane. Plant Physiol 147: 1192–1198

Mendez MO, Maier RM (2008) Phytostabilization of mine tailings in arid and semiarid

environments - An emerging remediation technology. Environ Health Perspect 116: 278–

283

Mitter EK, de Freitas JR, Germida JJ (2020) Hydrocarbon-degrading genes in root

endophytic communities on oil sands reclamation covers. Int J Phytoremediation 22: 703–

712

Mohamed MH, Wilson LD, Headley J V., Peru KM (2008) Novel materials for environmental

remediation of tailing pond waters containing naphthenic acids. Process Saf Environ Prot

86: 237–243

Morandi GD, Wiseman SB, Pereira A, Mankidy R, Gault IGM, Martin JW, Giesy JP

(2015) Effects-Directed Analysis of Dissolved Organic Compounds in Oil Sands Process-

Affected Water. Environ Sci Technol 49: 12395–12404

Mosaddegh MH, Jafarian A, Ghasemi A, Mosaddegh A (2014) Phytoremediation of benzene,

toluene, ethylbenzene and xylene contaminated air by D. deremensis and O. microdasys

plants. J Environ Heal Sci Eng 12: 1–7

Newman LA, Reynolds CM (2004) Phytodegradation of organic compounds. Curr Opin

Biotechnol 15: 225–230

OAP (Oil Sands Advisory Panel) (2010) A foundation for the future: building an

environmental monitoring system for the oil sands. Report submitted to the Minister of the

Environment.

Oller I, Malato S, Sánchez-Pérez JA (2011) Combination of Advanced Oxidation Processes

and biological treatments for wastewater decontamination-A review. Sci Total Environ 409:

106

4141–4166

OSDC (2016) Facts about Alberta’s oil sands and its industry. Accessed from:

https://open.alberta.ca/publications/facts-about-alberta-s-oil-sands-and-its-industry

Paulssen JM, Gieg LM (2019) Biodegradation of 1-adamantanecarboxylic acid by algal-

bacterial microbial communities derived from oil sands tailings ponds. Algal Res 41:

101528

Purdy BG, Macdonald SE, Lieffers VJ (2005) Naturally saline boreal communities as models

for reclamation of saline oil sand tailings. Restor Ecol 13: 667–677

Qin R, How ZT, Gamal El-Din M (2019) Photodegradation of naphthenic acids induced by

natural photosensitizer in oil sands process water. Water Res 164: 114913

Quesnel DM, Bhaskar IM, Gieg LM, Chua G (2011) Naphthenic acid biodegradation by the

unicellular alga Dunaliella tertiolecta. Chemosphere 84: 504–511

Quinlan PJ, Tam KC (2015) Water treatment technologies for the remediation of naphthenic

acids in oil sands process-affected water. Chem Eng J 279: 696–714

Redman AD, Parkerton TF, Butler JD, Letinski DJ, Frank RA, Hewitt LM, Bartlett AJ,

Gillis PL, Marentette JR, Parrott JL, et al (2018) Application of the Target Lipid Model

and Passive Samplers to Characterize the Toxicity of Bioavailable Organics in Oil Sands

Process-Affected Water. Environ Sci Technol 52: 8039–8049

Reichenauer TG, Germida JJ (2008) Phytoremediation of organic contaminants in soil and

groundwater. ChemSusChem 1: 708–717

Renault S, Qualizza C, MacKinnon M (2004) Suitability of altai wildrye (Elymus angustus)

and slender wheatgrass (Agropyron trachycaulum) for initial reclamation of saline

composite tailings of oil sands. Environ Pollut 128: 339–349

107

Repas TS, Gillis DM, Boubakir Z, Bao X, Samuels GJ, Kaminskyj SGW (2017) Growing

plants on oily, nutrient-poor soil using a native symbiotic fungus. PLoS One 12: 1–15

Del Rio LF, Hadwin AKM, Pinto LJ, MacKinnon MD, Moore MM (2006) Degradation of

naphthenic acids by sediment micro-organisms. J Appl Microbiol 101: 1049–1061

Rontani JF, Bonin P (1992) Utilization of n-alkyl-substituted cyclohexanes by a marine

Alcaligenes. Chemosphere 24: 1441–1446

Saez-Aguayo S, Ralet MC, Berger A, Botran L, Ropartz D, Marion-Poll A, Northa HM

(2013) PECTIN METHYLESTERASE INHIBITOR6 promotes Arabidopsis mucilage

release by limiting methylesterification of homogalacturonan in seed coat epidermal cells.

Plant Cell 25: 308–323

Sakakibara M (2010) Phytoextraction And Phytovolatilization Of Arsenic From As-

Contaminated Soils By Pteris vittata. Proc. Annu. Int. Conf. Soils, Sediments, Water

Energy 12:

Schneeberger RG, Zhang K, Tatarinova T, Troukhan M, Kwok SF, Drais J, Klinger K,

Orejudos F, Macy K, Bhakta A, et al (2005) Agrobacterium T-DNA integration in

Arabidopsis is correlated with DNA sequence compositions that occur frequently in gene

promoter regions. Funct Integr Genomics 5: 240–253

Schneider CA, Rasband WS, Eliceiri KW (2012) NIH Image to ImageJ: 25 years of image

analysis. Nat Methods 9: 671–675

Scott AC, MacKinnon MD, Fedorak PM (2005) Naphthenic acids in athabasca oil sands

tailings waters are less biodegradable than commercial naphthenic acids. Environ Sci

Technol 39: 8388–8394

Sedbrook JC, Ehrhardt DW, Fisher SE, Scheible WR, Somerville CR (2004) The

108

Arabidopsis SKU6/SPIRAL1 gene encodes a plus end-localized microtubule-interacting

protein involved in directional cell expansion. Plant Cell 16: 1506–1520

Shi L, Katavic V, Yu Y, Kunst L, Haughn G (2012) Arabidopsis glabra2 mutant seeds

deficient in mucilage biosynthesis produce more oil. Plant J 69: 37–46

Siminszky B (2006) Plant cytochrome P450-mediated herbicide metabolism. Phytochem Rev 5:

445–458

Small CC, Cho S, Hashisho Z, Ulrich AC (2015) Emissions from oil sands tailings ponds:

Review of tailings pond parameters and emission estimates. J Pet Sci Eng 127: 490–501

Smith BE, Lewis CA, Belt ST, Whitby C, Rowland SJ (2008) Effects of alkyl chain branching

on the biotransformation of naphthenic acids. Environ Sci Technol 42: 9323–9328

Steudle E, Frensch J (1996) Water transport in plants: Role of the apoplast. Plant Soil 187: 67–

79

Stout JM, Boubakir Z, Ambrose SJ, Purves RW, Page JE (2012) The hexanoyl-CoA

precursor for cannabinoid biosynthesis is formed by an acyl-activating enzyme in Cannabis

sativa trichomes. Plant J 71: 353–365

Su YH, Zhu YG (2007) Transport mechanisms for the uptake of organic compounds by rice

(Oryza sativa) roots. Environ Pollut 148: 94–100

Suzuki N, Koizumi N, Sano H (2001) Screening of cadmium-responsive genes in Arabidopsis

thaliana. Plant, Cell Environ 24: 1177–1188

Tehseen M, Cairns N, Sherson S, Cobbett CS (2010) Metallochaperone-like genes in

Arabidopsis thaliana. Metallomics 2: 556–564

Tominaga-Wada R, Iwata M, Sugiyama J, Kotake T, Ishida T, Yokoyama R, Nishitani K,

Okada K, Wada T (2009) The GLABRA2 homeodomain protein directly regulates CESA5

109

and XTH17 gene expression in Arabidopsis roots. Plant J 60: 564–574

Touceda-González M, Prieto-Fernández, Renella G, Giagnoni L, Sessitsch A, Brader G,

Kumpiene J, Dimitriou I, Eriksson J, Friesl-Hanl W, et al (2017) Microbial community

structure and activity in trace element-contaminated soils phytomanaged by Gentle

Remediation Options (GRO). Environ Pollut 231: 237–251

Vervaeke P, Luyssaert S, Mertens J, Meers E, Tack FMG, Lust N (2003) Phytoremediation

prospects of willow stands on contaminated sediment: A field trial. Environ Pollut 126:

275–282

Vishnoi SR, Srivastava PN (2008) Phytoremediation - Green for environmental clean.

Taal2007 12th World Lake Conf 342005: 1016–1021

Vymazal J (2013) Emergent plants used in free water surface constructed wetlands: A review.

Ecol Eng 61: 582–592

Wang B, Wan Y, Gao Y, Yang M, Hu J (2013) Determination and characterization of oxy-

naphthenic acids in oilfield wastewater. Environ Sci Technol 47: 9545–9554

Weigel D, Ahn JH, Blázquez MA, Borevitz JO, Christensen SK, Fankhauser C, Ferrándiz

C, Kardailsky I, Malancharuvil EJ, Neff MM, et al (2000) Activation Tagging in

Arabidopsis. Plant Physiol 122: 1003–1014

Whitby C (2010) Microbial naphthenic Acid degradation., 1st ed. Adv Appl Microbiol. doi:

10.1016/S0065-2164(10)70003-4

Widdup EE, Chatfield-Reed K, Henry D, Chua G, Samuel MA, Muench DG (2015)

Identification of detoxification pathways in plants that are regulated in response to treatment

with organic compounds isolated from oil sands process-affected water. Chemosphere 139:

47–53

110

Wu C, De Visscher A, Gates ID (2019) On naphthenic acids removal from crude oil and oil

sands process-affected water. Fuel 253: 1229–1246

Wu H, Zhang J, Ngo HH, Guo W, Hu Z, Liang S, Fan J, Liu H (2015) A review on the

sustainability of constructed wetlands for wastewater treatment: Design and operation.

Bioresour Technol 175: 594–601

Yang S, Liang S, Yi L, Xu B, Cao J, Guo Y, Zhou Y (2014) Heavy metal accumulation and

phytostabilization potential of dominant plant species growing on manganese mine tailings.

Front Environ Sci Eng 8: 394–404

Zhang W-Q, Zwiazek J (2018) Hydraulic Redistribution in Slender Wheatgrass (Elymus

trachycaulus Link Malte) and Yellow Sweet Clover (Melilotus officinalis L.): Potential

Benefits for Land Reclamation. Agronomy 8: 308

Zhang X, Wiseman S, Yu H, Liu H, Giesy JP, Hecker M (2011) Assessing the toxicity of

naphthenic acids using a microbial genome wide live cell reporter array system. Environ Sci

Technol 45: 1984–1991

Zhao L, Li Y (2014) The C-terminus of AtGRIP is crucial for its self-association and for

targeting to golgi stacks in Arabidopsis. PLoS One 9: 1–6

111

Appendix

Appendix 1:

Processed and sorted sequence reads for Illumina targeted gene sequencing. See attached Excel

and Word files for sequence data.

Mutant Source

CS23120 A3-4 A3-4-4p1.xlsx

A3-4-4p2.xlsx

CS23127 A1-2 A1-2.xlsx

CS23152 A1-6 Index_1.A1-6_B.xlsx

CS23152 A2-1 CS23152 A2-1 Truncation.docx

CS23838 D1-3 Index_4.D1-3_B.xlsx

CS31166 A1-1 CS31166 A1-1 Truncation.docx

ELSEVIER LICENSE

TERMS AND CONDITIONS

Apr 29, 2020

This Agreement between University of Calgary -- Jeremy Wong ("You") and Elsevier

("Elsevier") consists of your license details and the terms and conditions provided by

Elsevier and Copyright Clearance Center.

License Number 4815551201561

License date Apr 24, 2020

Licensed Content Publisher Elsevier

Licensed Content Publication Elsevier Books

Licensed Content Title Advances in Applied Microbiology

Licensed Content Author Corinne Whitby

Licensed Content Date Jan 1, 2010

Licensed Content Pages 33

Start Page 93

End Page 125

Type of Use reuse in a thesis/dissertation

Portion figures/tables/illustrations

Number of figures/tables/illustrations 1

Format both print and electronic

Are you the author of this Elsevier

chapter? No

Will you be translating? No

Title Investigating the Genetics and Physiology of


Institution name University of Calgary

Expected presentation date Apr 2020

Portions Figure 3.2

Requestor Location


2500 University Dr NW

Calgary, AB T2N 1N4

Canada

Attn: University of Calgary

Publisher Tax ID GB 494 6272 12

Total 0.00 USD

Terms and Conditions

INTRODUCTION

1. The publisher for this copyrighted material is Elsevier. By clicking "accept" in

connection with completing this licensing transaction, you agree that the following terms

and conditions apply to this transaction (along with the Billing and Payment terms and

conditions established by Copyright Clearance Center, Inc. ("CCC"), at the time that you

opened your Rightslink account and that are available at any time at

http://myaccount.copyright.com).

GENERAL TERMS

2. Elsevier hereby grants you permission to reproduce the aforementioned material subject

to the terms and conditions indicated.

3. Acknowledgement: If any part of the material to be used (for example, figures) has

appeared in our publication with credit or acknowledgement to another source, permission

must also be sought from that source. If such permission is not obtained then that material

may not be included in your publication/copies. Suitable acknowledgement to the source

must be made, either as a footnote or in a reference list at the end of your publication, as

follows:

"Reprinted from Publication title, Vol /edition number, Author(s), Title of article / title of

chapter, Pages No., Copyright (Year), with permission from Elsevier [OR APPLICABLE

SOCIETY COPYRIGHT OWNER]." Also Lancet special credit - "Reprinted from The

Lancet, Vol. number, Author(s), Title of article, Pages No., Copyright (Year), with

permission from Elsevier."

4. Reproduction of this material is confined to the purpose and/or media for which

permission is hereby given.

5. Altering/Modifying Material: Not Permitted. However figures and illustrations may be

altered/adapted minimally to serve your work. Any other abbreviations, additions, deletions

and/or any other alterations shall be made only with prior written authorization of Elsevier

Ltd. (Please contact Elsevier at [email protected]). No modifications can be made

to any Lancet figures/tables and they must be reproduced in full.

6. If the permission fee for the requested use of our material is waived in this instance,

please be advised that your future requests for Elsevier materials may attract a fee.

7. Reservation of Rights: Publisher reserves all rights not specifically granted in the

combination of (i) the license details provided by you and accepted in the course of this

licensing transaction, (ii) these terms and conditions and (iii) CCC's Billing and Payment

terms and conditions.

8. License Contingent Upon Payment: While you may exercise the rights licensed

immediately upon issuance of the license at the end of the licensing process for the

http://myaccount.copyright.com/

mailto:[email protected]

transaction, provided that you have disclosed complete and accurate details of your

proposed use, no license is finally effective unless and until full payment is received from

you (either by publisher or by CCC) as provided in CCC's Billing and Payment terms and

conditions. If full payment is not received on a timely basis, then any license preliminarily

granted shall be deemed automatically revoked and shall be void as if never

granted. Further, in the event that you breach any of these terms and conditions or any of

CCC's Billing and Payment terms and conditions, the license is automatically revoked and

shall be void as if never granted. Use of materials as described in a revoked license, as

well as any use of the materials beyond the scope of an unrevoked license, may constitute

copyright infringement and publisher reserves the right to take any and all action to protect

its copyright in the materials.

9. Warranties: Publisher makes no representations or warranties with respect to the licensed

material.

10. Indemnity: You hereby indemnify and agree to hold harmless publisher and CCC, and

their respective officers, directors, employees and agents, from and against any and all

claims arising out of your use of the licensed material other than as specifically authorized

pursuant to this license.

11. No Transfer of License: This license is personal to you and may not be sublicensed,

assigned, or transferred by you to any other person without publisher's written permission.

12. No Amendment Except in Writing: This license may not be amended except in a

writing signed by both parties (or, in the case of publisher, by CCC on publisher's behalf).

13. Objection to Contrary Terms: Publisher hereby objects to any terms contained in any

purchase order, acknowledgment, check endorsement or other writing prepared by you,

which terms are inconsistent with these terms and conditions or CCC's Billing and

Payment terms and conditions. These terms and conditions, together with CCC's Billing

and Payment terms and conditions (which are incorporated herein), comprise the entire

agreement between you and publisher (and CCC) concerning this licensing transaction. In

the event of any conflict between your obligations established by these terms and

conditions and those established by CCC's Billing and Payment terms and conditions, these

terms and conditions shall control.

14. Revocation: Elsevier or Copyright Clearance Center may deny the permissions

described in this License at their sole discretion, for any reason or no reason, with a full

refund payable to you. Notice of such denial will be made using the contact information

provided by you. Failure to receive such notice will not alter or invalidate the denial. In

no event will Elsevier or Copyright Clearance Center be responsible or liable for any costs,

expenses or damage incurred by you as a result of a denial of your permission request,

other than a refund of the amount(s) paid by you to Elsevier and/or Copyright Clearance

Center for denied permissions.

LIMITED LICENSE

The following terms and conditions apply only to specific license types:

15. Translation: This permission is granted for non-exclusive world English rights only

unless your license was granted for translation rights. If you licensed translation rights you

may only translate this content into the languages you requested. A professional translator

must perform all translations and reproduce the content word for word preserving the

integrity of the article.

16. Posting licensed content on any Website: The following terms and conditions apply

as follows: Licensing material from an Elsevier journal: All content posted to the web site

must maintain the copyright information line on the bottom of each image; A hyper-text

must be included to the Homepage of the journal from which you are licensing at

http://www.sciencedirect.com/science/journal/xxxxx or the Elsevier homepage for books at

http://www.elsevier.com; Central Storage: This license does not include permission for a

scanned version of the material to be stored in a central repository such as that provided by

Heron/XanEdu.

Licensing material from an Elsevier book: A hyper-text link must be included to the

Elsevier homepage at http://www.elsevier.com . All content posted to the web site must

maintain the copyright information line on the bottom of each image.

Posting licensed content on Electronic reserve: In addition to the above the following

clauses are applicable: The web site must be password-protected and made available only

to bona fide students registered on a relevant course. This permission is granted for 1 year

only. You may obtain a new license for future website posting.

17. For journal authors: the following clauses are applicable in addition to the above:

Preprints:

A preprint is an author's own write-up of research results and analysis, it has not been peer-

reviewed, nor has it had any other value added to it by a publisher (such as formatting,

copyright, technical enhancement etc.).

Authors can share their preprints anywhere at any time. Preprints should not be added to or

enhanced in any way in order to appear more like, or to substitute for, the final versions of

articles however authors can update their preprints on arXiv or RePEc with their Accepted

Author Manuscript (see below).

If accepted for publication, we encourage authors to link from the preprint to their formal

publication via its DOI. Millions of researchers have access to the formal publications on

ScienceDirect, and so links will help users to find, access, cite and use the best available

http://www.sciencedirect.com/science/journal/xxxxx

http://www.elsevier.com/


version. Please note that Cell Press, The Lancet and some society-owned have different

preprint policies. Information on these policies is available on the journal homepage.

Accepted Author Manuscripts: An accepted author manuscript is the manuscript of an

article that has been accepted for publication and which typically includes author-

incorporated changes suggested during submission, peer review and editor-author

communications.

Authors can share their accepted author manuscript:

• immediately

o via their non-commercial person homepage or blog

o by updating a preprint in arXiv or RePEc with the accepted manuscript

o via their research institute or institutional repository for internal institutional

uses or as part of an invitation-only research collaboration work-group

o directly by providing copies to their students or to research collaborators for

their personal use

o for private scholarly sharing as part of an invitation-only work group on

commercial sites with which Elsevier has an agreement

• After the embargo period

o via non-commercial hosting platforms such as their institutional repository

o via commercial sites with which Elsevier has an agreement

In all cases accepted manuscripts should:

• link to the formal publication via its DOI

• bear a CC-BY-NC-ND license - this is easy to do

• if aggregated with other manuscripts, for example in a repository or other site, be

shared in alignment with our hosting policy not be added to or enhanced in any way

to appear more like, or to substitute for, the published journal article.

Published journal article (JPA): A published journal article (PJA) is the definitive final

record of published research that appears or will appear in the journal and embodies all

value-adding publishing activities including peer review co-ordination, copy-editing,

formatting, (if relevant) pagination and online enrichment.

Policies for sharing publishing journal articles differ for subscription and gold open access

articles:

Subscription Articles: If you are an author, please share a link to your article rather than

the full-text. Millions of researchers have access to the formal publications on

ScienceDirect, and so links will help your users to find, access, cite, and use the best

available version.

Theses and dissertations which contain embedded PJAs as part of the formal submission

can be posted publicly by the awarding institution with DOI links back to the formal

publications on ScienceDirect.

If you are affiliated with a library that subscribes to ScienceDirect you have additional

private sharing rights for others' research accessed under that agreement. This includes use

for classroom teaching and internal training at the institution (including use in course packs

and courseware programs), and inclusion of the article for grant funding purposes.

Gold Open Access Articles: May be shared according to the author-selected end-user

license and should contain a CrossMark logo, the end user license, and a DOI link to the

formal publication on ScienceDirect.

Please refer to Elsevier's posting policy for further information.

18. For book authors the following clauses are applicable in addition to the

above: Authors are permitted to place a brief summary of their work online only. You are

not allowed to download and post the published electronic version of your chapter, nor may

you scan the printed edition to create an electronic version. Posting to a repository:

Authors are permitted to post a summary of their chapter only in their institution's

repository.

19. Thesis/Dissertation: If your license is for use in a thesis/dissertation your thesis may

be submitted to your institution in either print or electronic form. Should your thesis be

published commercially, please reapply for permission. These requirements include

permission for the Library and Archives of Canada to supply single copies, on demand, of

the complete thesis and include permission for Proquest/UMI to supply single copies, on

demand, of the complete thesis. Should your thesis be published commercially, please

reapply for permission. Theses and dissertations which contain embedded PJAs as part of

the formal submission can be posted publicly by the awarding institution with DOI links

back to the formal publications on ScienceDirect.

Elsevier Open Access Terms and Conditions

You can publish open access with Elsevier in hundreds of open access journals or in nearly

2000 established subscription journals that support open access publishing. Permitted third

party re-use of these open access articles is defined by the author's choice of Creative

Commons user license. See our open access license policy for more information.

Terms & Conditions applicable to all Open Access articles published with Elsevier:

http://www.crossref.org/crossmark/index.html

http://www.elsevier.com/about/open-access/open-access-policies/article-posting-policy

http://www.elsevier.com/about/open-access/open-access-policies/oa-license-policy

Any reuse of the article must not represent the author as endorsing the adaptation of the

article nor should the article be modified in such a way as to damage the author's honour or

reputation. If any changes have been made, such changes must be clearly indicated.

The author(s) must be appropriately credited and we ask that you include the end user

license and a DOI link to the formal publication on ScienceDirect.

If any part of the material to be used (for example, figures) has appeared in our publication

with credit or acknowledgement to another source it is the responsibility of the user to

ensure their reuse complies with the terms and conditions determined by the rights holder.

Additional Terms & Conditions applicable to each Creative Commons user license:

CC BY: The CC-BY license allows users to copy, to create extracts, abstracts and new

works from the Article, to alter and revise the Article and to make commercial use of the

Article (including reuse and/or resale of the Article by commercial entities), provided the

user gives appropriate credit (with a link to the formal publication through the relevant

DOI), provides a link to the license, indicates if changes were made and the licensor is not

represented as endorsing the use made of the work. The full details of the license are

available at http://creativecommons.org/licenses/by/4.0.

CC BY NC SA: The CC BY-NC-SA license allows users to copy, to create extracts,

abstracts and new works from the Article, to alter and revise the Article, provided this is

not done for commercial purposes, and that the user gives appropriate credit (with a link to

the formal publication through the relevant DOI), provides a link to the license, indicates if

changes were made and the licensor is not represented as endorsing the use made of the

work. Further, any new works must be made available on the same conditions. The full

details of the license are available at http://creativecommons.org/licenses/by-nc-sa/4.0.

CC BY NC ND: The CC BY-NC-ND license allows users to copy and distribute the

Article, provided this is not done for commercial purposes and further does not permit

distribution of the Article if it is changed or edited in any way, and provided the user gives

appropriate credit (with a link to the formal publication through the relevant DOI),

provides a link to the license, and that the licensor is not represented as endorsing the use

made of the work. The full details of the license are available at

http://creativecommons.org/licenses/by-nc-nd/4.0. Any commercial reuse of Open Access

articles published with a CC BY NC SA or CC BY NC ND license requires permission

from Elsevier and will be subject to a fee.

Commercial reuse includes:

• Associating advertising with the full text of the Article

• Charging fees for document delivery or access

• Article aggregation

• Systematic distribution via e-mail lists or share buttons

http://creativecommons.org/licenses/by/4.0

http://creativecommons.org/licenses/by-nc-sa/4.0

http://creativecommons.org/licenses/by-nc-nd/4.0

Posting or linking by commercial companies for use by customers of those companies.

20. Other Conditions:

v1.9

Questions? [email protected] or +1-855-239-3415 (toll free in the US) or

+1-978-646-2777.


ELSEVIER LICENSE

TERMS AND CONDITIONS

Apr 29, 2020

This Agreement between University of Calgary -- Jeremy Wong ("You") and Elsevier

("Elsevier") consists of your license details and the terms and conditions provided by

Elsevier and Copyright Clearance Center.

License Number 4815551104567

License date Apr 24, 2020

Licensed Content Publisher Elsevier

Licensed Content Publication Chemosphere

Licensed Content Title A review of the occurrence, analyses, toxicity, and

biodegradation of naphthenic acids

Licensed Content Author Joyce S. Clemente,Phillip M. Fedorak

Licensed Content Date Jul 1, 2005

Licensed Content Volume 60

Licensed Content Issue 5

Licensed Content Pages 16

Start Page 585

End Page 600

Type of Use reuse in a thesis/dissertation

Portion figures/tables/illustrations

Number of figures/tables/illustrations 1

Format both print and electronic

Are you the author of this Elsevier

article? No

Will you be translating? No

Title Investigating the Genetics and Physiology of


Institution name University of Calgary

Expected presentation date Apr 2020

Portions Figure 3

Requestor Location


2500 University Dr NW

Calgary, AB T2N 1N4

Canada

Attn: University of Calgary

Publisher Tax ID GB 494 6272 12

Total 0.00 USD

Terms and Conditions

INTRODUCTION

1. The publisher for this copyrighted material is Elsevier. By clicking "accept" in

connection with completing this licensing transaction, you agree that the following terms

and conditions apply to this transaction (along with the Billing and Payment terms and

conditions established by Copyright Clearance Center, Inc. ("CCC"), at the time that you

opened your Rightslink account and that are available at any time at

http://myaccount.copyright.com).

GENERAL TERMS

2. Elsevier hereby grants you permission to reproduce the aforementioned material subject

to the terms and conditions indicated.

3. Acknowledgement: If any part of the material to be used (for example, figures) has

appeared in our publication with credit or acknowledgement to another source, permission

must also be sought from that source. If such permission is not obtained then that material

may not be included in your publication/copies. Suitable acknowledgement to the source

must be made, either as a footnote or in a reference list at the end of your publication, as

follows:

"Reprinted from Publication title, Vol /edition number, Author(s), Title of article / title of

chapter, Pages No., Copyright (Year), with permission from Elsevier [OR APPLICABLE

SOCIETY COPYRIGHT OWNER]." Also Lancet special credit - "Reprinted from The

Lancet, Vol. number, Author(s), Title of article, Pages No., Copyright (Year), with

permission from Elsevier."

4. Reproduction of this material is confined to the purpose and/or media for which

permission is hereby given.

5. Altering/Modifying Material: Not Permitted. However figures and illustrations may be

altered/adapted minimally to serve your work. Any other abbreviations, additions, deletions

and/or any other alterations shall be made only with prior written authorization of Elsevier

Ltd. (Please contact Elsevier at [email protected]). No modifications can be made

to any Lancet figures/tables and they must be reproduced in full.

6. If the permission fee for the requested use of our material is waived in this instance,

please be advised that your future requests for Elsevier materials may attract a fee.

7. Reservation of Rights: Publisher reserves all rights not specifically granted in the

combination of (i) the license details provided by you and accepted in the course of this

http://myaccount.copyright.com/


licensing transaction, (ii) these terms and conditions and (iii) CCC's Billing and Payment

terms and conditions.

8. License Contingent Upon Payment: While you may exercise the rights licensed

immediately upon issuance of the license at the end of the licensing process for the

transaction, provided that you have disclosed complete and accurate details of your

proposed use, no license is finally effective unless and until full payment is received from

you (either by publisher or by CCC) as provided in CCC's Billing and Payment terms and

conditions. If full payment is not received on a timely basis, then any license preliminarily

granted shall be deemed automatically revoked and shall be void as if never

granted. Further, in the event that you breach any of these terms and conditions or any of

CCC's Billing and Payment terms and conditions, the license is automatically revoked and

shall be void as if never granted. Use of materials as described in a revoked license, as

well as any use of the materials beyond the scope of an unrevoked license, may constitute

copyright infringement and publisher reserves the right to take any and all action to protect

its copyright in the materials.

9. Warranties: Publisher makes no representations or warranties with respect to the licensed

material.

10. Indemnity: You hereby indemnify and agree to hold harmless publisher and CCC, and

their respective officers, directors, employees and agents, from and against any and all

claims arising out of your use of the licensed material other than as specifically authorized

pursuant to this license.

11. No Transfer of License: This license is personal to you and may not be sublicensed,

assigned, or transferred by you to any other person without publisher's written permission.

12. No Amendment Except in Writing: This license may not be amended except in a

writing signed by both parties (or, in the case of publisher, by CCC on publisher's behalf).

13. Objection to Contrary Terms: Publisher hereby objects to any terms contained in any

purchase order, acknowledgment, check endorsement or other writing prepared by you,

which terms are inconsistent with these terms and conditions or CCC's Billing and

Payment terms and conditions. These terms and conditions, together with CCC's Billing

and Payment terms and conditions (which are incorporated herein), comprise the entire

agreement between you and publisher (and CCC) concerning this licensing transaction. In

the event of any conflict between your obligations established by these terms and

conditions and those established by CCC's Billing and Payment terms and conditions, these

terms and conditions shall control.

14. Revocation: Elsevier or Copyright Clearance Center may deny the permissions

described in this License at their sole discretion, for any reason or no reason, with a full

refund payable to you. Notice of such denial will be made using the contact information

provided by you. Failure to receive such notice will not alter or invalidate the denial. In

no event will Elsevier or Copyright Clearance Center be responsible or liable for any costs,

expenses or damage incurred by you as a result of a denial of your permission request,

other than a refund of the amount(s) paid by you to Elsevier and/or Copyright Clearance

Center for denied permissions.

LIMITED LICENSE

The following terms and conditions apply only to specific license types:

15. Translation: This permission is granted for non-exclusive world English rights only

unless your license was granted for translation rights. If you licensed translation rights you

may only translate this content into the languages you requested. A professional translator

must perform all translations and reproduce the content word for word preserving the

integrity of the article.

16. Posting licensed content on any Website: The following terms and conditions apply

as follows: Licensing material from an Elsevier journal: All content posted to the web site

must maintain the copyright information line on the bottom of each image; A hyper-text

must be included to the Homepage of the journal from which you are licensing at

http://www.sciencedirect.com/science/journal/xxxxx or the Elsevier homepage for books at

http://www.elsevier.com; Central Storage: This license does not include permission for a

scanned version of the material to be stored in a central repository such as that provided by

Heron/XanEdu.

Licensing material from an Elsevier book: A hyper-text link must be included to the

Elsevier homepage at http://www.elsevier.com . All content posted to the web site must

maintain the copyright information line on the bottom of each image.

Posting licensed content on Electronic reserve: In addition to the above the following

clauses are applicable: The web site must be password-protected and made available only

to bona fide students registered on a relevant course. This permission is granted for 1 year

only. You may obtain a new license for future website posting.

17. For journal authors: the following clauses are applicable in addition to the above:

Preprints:

A preprint is an author's own write-up of research results and analysis, it has not been peer-

reviewed, nor has it had any other value added to it by a publisher (such as formatting,

copyright, technical enhancement etc.).

Authors can share their preprints anywhere at any time. Preprints should not be added to or

enhanced in any way in order to appear more like, or to substitute for, the final versions of

articles however authors can update their preprints on arXiv or RePEc with their Accepted

Author Manuscript (see below).

http://www.sciencedirect.com/science/journal/xxxxx



If accepted for publication, we encourage authors to link from the preprint to their formal

publication via its DOI. Millions of researchers have access to the formal publications on

ScienceDirect, and so links will help users to find, access, cite and use the best available

version. Please note that Cell Press, The Lancet and some society-owned have different

preprint policies. Information on these policies is available on the journal homepage.

Accepted Author Manuscripts: An accepted author manuscript is the manuscript of an

article that has been accepted for publication and which typically includes author-

incorporated changes suggested during submission, peer review and editor-author

communications.

Authors can share their accepted author manuscript:

• immediately

o via their non-commercial person homepage or blog

o by updating a preprint in arXiv or RePEc with the accepted manuscript

o via their research institute or institutional repository for internal institutional

uses or as part of an invitation-only research collaboration work-group

o directly by providing copies to their students or to research collaborators for

their personal use

o for private scholarly sharing as part of an invitation-only work group on

commercial sites with which Elsevier has an agreement

• After the embargo period

o via non-commercial hosting platforms such as their institutional repository

o via commercial sites with which Elsevier has an agreement

In all cases accepted manuscripts should:

• link to the formal publication via its DOI

• bear a CC-BY-NC-ND license - this is easy to do

• if aggregated with other manuscripts, for example in a repository or other site, be

shared in alignment with our hosting policy not be added to or enhanced in any way

to appear more like, or to substitute for, the published journal article.

Published journal article (JPA): A published journal article (PJA) is the definitive final

record of published research that appears or will appear in the journal and embodies all

value-adding publishing activities including peer review co-ordination, copy-editing,

formatting, (if relevant) pagination and online enrichment.

Policies for sharing publishing journal articles differ for subscription and gold open access

articles:

Subscription Articles: If you are an author, please share a link to your article rather than

the full-text. Millions of researchers have access to the formal publications on

ScienceDirect, and so links will help your users to find, access, cite, and use the best

available version.

Theses and dissertations which contain embedded PJAs as part of the formal submission

can be posted publicly by the awarding institution with DOI links back to the formal

publications on ScienceDirect.

If you are affiliated with a library that subscribes to ScienceDirect you have additional

private sharing rights for others' research accessed under that agreement. This includes use

for classroom teaching and internal training at the institution (including use in course packs

and courseware programs), and inclusion of the article for grant funding purposes.

Gold Open Access Articles: May be shared according to the author-selected end-user

license and should contain a CrossMark logo, the end user license, and a DOI link to the

formal publication on ScienceDirect.

Please refer to Elsevier's posting policy for further information.

18. For book authors the following clauses are applicable in addition to the

above: Authors are permitted to place a brief summary of their work online only. You are

not allowed to download and post the published electronic version of your chapter, nor may

you scan the printed edition to create an electronic version. Posting to a repository:

Authors are permitted to post a summary of their chapter only in their institution's

repository.

19. Thesis/Dissertation: If your license is for use in a thesis/dissertation your thesis may

be submitted to your institution in either print or electronic form. Should your thesis be

published commercially, please reapply for permission. These requirements include

permission for the Library and Archives of Canada to supply single copies, on demand, of

the complete thesis and include permission for Proquest/UMI to supply single copies, on

demand, of the complete thesis. Should your thesis be published commercially, please

reapply for permission. Theses and dissertations which contain embedded PJAs as part of

the formal submission can be posted publicly by the awarding institution with DOI links

back to the formal publications on ScienceDirect.

Elsevier Open Access Terms and Conditions

You can publish open access with Elsevier in hundreds of open access journals or in nearly

2000 established subscription journals that support open access publishing. Permitted third

party re-use of these open access articles is defined by the author's choice of Creative

Commons user license. See our open access license policy for more information.

Terms & Conditions applicable to all Open Access articles published with Elsevier:

http://www.crossref.org/crossmark/index.html

http://www.elsevier.com/about/open-access/open-access-policies/article-posting-policy

http://www.elsevier.com/about/open-access/open-access-policies/oa-license-policy

Any reuse of the article must not represent the author as endorsing the adaptation of the

article nor should the article be modified in such a way as to damage the author's honour or

reputation. If any changes have been made, such changes must be clearly indicated.

The author(s) must be appropriately credited and we ask that you include the end user

license and a DOI link to the formal publication on ScienceDirect.

If any part of the material to be used (for example, figures) has appeared in our publication

with credit or acknowledgement to another source it is the responsibility of the user to

ensure their reuse complies with the terms and conditions determined by the rights holder.

Additional Terms & Conditions applicable to each Creative Commons user license:

CC BY: The CC-BY license allows users to copy, to create extracts, abstracts and new

works from the Article, to alter and revise the Article and to make commercial use of the

Article (including reuse and/or resale of the Article by commercial entities), provided the

user gives appropriate credit (with a link to the formal publication through the relevant

DOI), provides a link to the license, indicates if changes were made and the licensor is not

represented as endorsing the use made of the work. The full details of the license are

available at http://creativecommons.org/licenses/by/4.0.

CC BY NC SA: The CC BY-NC-SA license allows users to copy, to create extracts,

abstracts and new works from the Article, to alter and revise the Article, provided this is

not done for commercial purposes, and that the user gives appropriate credit (with a link to

the formal publication through the relevant DOI), provides a link to the license, indicates if

changes were made and the licensor is not represented as endorsing the use made of the

work. Further, any new works must be made available on the same conditions. The full

details of the license are available at http://creativecommons.org/licenses/by-nc-sa/4.0.

CC BY NC ND: The CC BY-NC-ND license allows users to copy and distribute the

Article, provided this is not done for commercial purposes and further does not permit

distribution of the Article if it is changed or edited in any way, and provided the user gives

appropriate credit (with a link to the formal publication through the relevant DOI),

provides a link to the license, and that the licensor is not represented as endorsing the use

made of the work. The full details of the license are available at

http://creativecommons.org/licenses/by-nc-nd/4.0. Any commercial reuse of Open Access

articles published with a CC BY NC SA or CC BY NC ND license requires permission

from Elsevier and will be subject to a fee.

Commercial reuse includes:

• Associating advertising with the full text of the Article

• Charging fees for document delivery or access

• Article aggregation

• Systematic distribution via e-mail lists or share buttons

http://creativecommons.org/licenses/by/4.0

http://creativecommons.org/licenses/by-nc-sa/4.0

http://creativecommons.org/licenses/by-nc-nd/4.0

Posting or linking by commercial companies for use by customers of those companies.

20. Other Conditions:

v1.9

Questions? [email protected] or +1-855-239-3415 (toll free in the US) or

+1-978-646-2777.


Investigating the Genetics and Physiology of Naphthenic ...

Documents

Transcript of Investigating the Genetics and Physiology of Naphthenic ...