QPE A Graphical Editor for Modeling using Queueing Petri Nets Christofer Dutz.
Introduction to the technology behind Next …...Introduction to the technology behind...
Transcript of Introduction to the technology behind Next …...Introduction to the technology behind...
![Page 1: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/1.jpg)
CAG EMEAI | Agilent Restricted | Page 1 Life Sciences & Diagnostics Group | Agilent Technologies | Page 1 S1
Introduction to the
technology behind
Next-Generation Sequencing
Presented By:
Christofer Flood, Ph.D.
June 16th, 2014 Field Application Scientist
Agilent Technologies
![Page 2: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/2.jpg)
CAG EMEAI | Agilent Restricted | Page 2 Life Sciences & Diagnostics Group | Agilent Technologies | Page 2 S1
Topics for Today’s Presentation
The NGS Library Prep Workflow 2
1
3 Whole Genome vs Targeted NGS
4
What is Next-Gen Sequencing?
Reviewing NGS Terminology
Not approved for use in diagnostic
procedures
Data Analysis 5
Agilents NGS Portfolio 6
![Page 3: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/3.jpg)
CAG EMEAI | Agilent Restricted | Page 3 Life Sciences & Diagnostics Group | Agilent Technologies | Page 3 S1
What is Next-Gen Sequencing?
A Brief History
• Frederick Sanger (Sanger Sequencing)
– “First Generation” (circa 1977)
• Radiolabeled Nucleotides
• Sequencing Gels
• Automated Capillary Electrophoresis
– “Second Generation”
• ABI 370 generate 500 Kilobases/day
– Thousands of bases (Kb)
• ABI 3730 generate 2.8 Megabases/day
– Millions of bases (Mb)
• Fluorescence based vs radiolabeling
• Helped drive the Human Genome Project
Not approved for use in diagnostic
procedures
Fluorescently
Labeled Nucleotides
Radio-Labeled
Nucleotides
![Page 4: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/4.jpg)
CAG EMEAI | Agilent Restricted | Page 4 Life Sciences & Diagnostics Group | Agilent Technologies | Page 4 S1
The Cornerstone Driving Next-Gen
Sequencing Technology Research: 10 years
Cost: ~ $3 Billion
Completing The Human Genome…
…Priceless
![Page 5: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/5.jpg)
CAG EMEAI | Agilent Restricted | Page 5 Life Sciences & Diagnostics Group | Agilent Technologies | Page 5 S1
What is Next-Gen Sequencing?
A Brief History • Massively Parallel Sequencing
– “Next-Generation Sequencing” (NGS)
• Does not use Sanger method
• Different Platforms = Different Chemistries
• Very High throughput instruments
– >100 gigabases of DNA sequence/day
• Desktop Sized Sequencing Instruments & Beyond!
– “Next-Next Generation Sequencing”
• Scaled down
• Medium throughput
• Individual Labs vs Core Facilities
• Some food for thought:
– What will sequencing be like 5, 10, 15 years from
now? Not approved for use in diagnostic
procedures
![Page 6: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/6.jpg)
CAG EMEAI | Agilent Restricted | Page 6 Life Sciences & Diagnostics Group | Agilent Technologies | Page 6 S1
Radio-Labeled
Nucleotides Fluorescently
Labeled Nucleotides
What is Next-Gen Sequencing:
Sanger Sequencing vs Next-Gen Sequencing “Single” Read System/Run (i.e. 1 DNA Fragment) “Multi” Read System/Run (i.e. Thousands of Fragments )
Fluorescently labeled nucleotides of many different
DNA fragments being sequenced in parallel
Reference Genome
Sequencing Reads
![Page 7: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/7.jpg)
CAG EMEAI | Agilent Restricted | Page 7 Life Sciences & Diagnostics Group | Agilent Technologies | Page 7 S1
Not approved for use in diagnostic
procedures
2003 2005 2006 2007 2008 2009 2010 2011 2012 2013
~$3B
Completion
of Human
Genome
Project
$1.5M
Launch of 1000
Genomes
Project
Next-Gen Sequencing Cost & Technology
Timeline…
year
cost per genome
Sequencing technology
454
(Roche)
$100M
Genome Analyzer
(Solexa/Illumina)
SOLiD
(Applied Bio)
$40K
HiSeq
SOLiD 5500
$4K $≤1K?
Whole Genomes
Sequenced in a
day!
Ion Proton
$10K $5K
Ion Torrent MiSeq
PacBio
![Page 8: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/8.jpg)
CAG EMEAI | Agilent Restricted | Page 8 Life Sciences & Diagnostics Group | Agilent Technologies | Page 8 S1
454/Roche
Illumina
HiSeq/MiSeq
SOLiD
(Life Tech)
Ion Torrent
Ion Proton
(Life Tech)
Fragment &
add adapters Genome sample
Target Preparation
Next-Gen Sequencing Platforms:
System Overview
Next-generation platforms have common elements and workflow
Target
Amplification
On-bead emulsion
PCR (Clonal)
Array-based “Bridge-PCR”
(Clonal)
On-bead emulsion
PCR (Clonal)
On-bead emulsion
PCR (Clonal)
Sequencing
Format
Bead in defined microwell
Random cluster on surface
Random bead on surface
Beads in defined microwell
Sequencing
Chemistry & Imaging
A,G,C,T cycle controlled fluidics Sequential nucleotide extension
- “pyrosequencing” 1-color bioluminescent imaging
A,G,C,T cycle controlled fluidics Sequential nucleotide extension 4-color fluorescence imaging Flow Cells
A,G,C,T, cycle controlled fluidics Sequential 8mer ligation 4-color fluorescence imaging
A,G,C,T, cycle controlled fluidics Sequential nucleotide extension Detects H+ Ions Semiconductor Chip Sequencing
![Page 9: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/9.jpg)
CAG EMEAI | Agilent Restricted | Page 9 Life Sciences & Diagnostics Group | Agilent Technologies | Page 9 S1
Pacific Biosciences
![Page 10: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/10.jpg)
CAG EMEAI | Agilent Restricted | Page 11 Life Sciences & Diagnostics Group | Agilent Technologies | Page 11 S1
Pacific Biosciences
![Page 11: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/11.jpg)
CAG EMEAI | Agilent Restricted | Page 13 Life Sciences & Diagnostics Group | Agilent Technologies | Page 13 S1
Emerging Technologies
Microscopy/
Camera
Chemistry
Nanopores
pH
![Page 12: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/12.jpg)
CAG EMEAI | Agilent Restricted | Page 15 Life Sciences & Diagnostics Group | Agilent Technologies | Page 15 S1
Nanopore - Exonuclease Sequencing
![Page 13: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/13.jpg)
CAG EMEAI | Agilent Restricted | Page 16 Life Sciences & Diagnostics Group | Agilent Technologies | Page 16 S1
Nanopore - Strand sequencing
![Page 14: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/14.jpg)
CAG EMEAI | Agilent Restricted | Page 17 Life Sciences & Diagnostics Group | Agilent Technologies | Page 17 S1
Great Places to Learn More About Sequencing
Platforms!
1. PubMed – There are TONS of papers out there that
review/compare NGS sequencing platforms
2. Some Favorite Websites:
– www.youtube.com/watch?v=PMIF6zUeKko : Fantastic seminar of
NGS technologies presented by Elaine Mardis, Ph.D., Genome
Institute at Washington University in St. Louis.
– www.SeqAnswers.com : Great message board for learning about &
troubleshooting sequencing related topics.
Not approved for use in diagnostic
procedures
![Page 15: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/15.jpg)
CAG EMEAI | Agilent Restricted | Page 18 Life Sciences & Diagnostics Group | Agilent Technologies | Page 18 S1
What can you do using NGS Technology:
Applications for Basic and Clinical Research
Large amplifications
Large deletions
Point mutations (SNP)
Insertions/Deletions
Inversions
Translocations
Copy number (CNV)
Fusions/splice variants
Gene expression data
Methylation status
• WGS drives initial discovery
• Low throughput
• Medium to low coverage
• Exome: Most popular targeted
sequencing method
• Provide more reads in regions of
most interest
• More efficient than WGS
• Medium to very high coverage
• Sequence cDNA instead of DNA
•Monitors aberrant gene expression
and identifies fusion and/or splicing
events.
• Targeted RNA-seq can add further
sensitivity to identify rare transcripts
• Sequencing the epigenome can identify
aberrations that promote disease pathogenesis
Types of Variants
Detectable using NGS Whole
Genome Exome
&
Targeted
DNA-seq
Transcriptome
Targeted RNA-seq
miRNA-seq
Targeted
Bi-Sulfite
Seq
![Page 16: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/16.jpg)
CAG EMEAI | Agilent Restricted | Page 19 Life Sciences & Diagnostics Group | Agilent Technologies | Page 19 S1
Topics for Today’s Presentation
The NGS Library Prep Workflow 2
1
3 Whole Genome vs Targeted NGS
4
What is Next-Gen Sequencing?
Reviewing NGS Terminology
Not approved for use in diagnostic
procedures
Data Analysis 5
Agilents NGS Portfolio 6
![Page 17: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/17.jpg)
CAG EMEAI | Agilent Restricted | Page 20 Life Sciences & Diagnostics Group | Agilent Technologies | Page 20 S1
Overview of the NGS Workflow
Can be a 2 step or 3 step process…
Library Prep
Sequencing
Library Prep
Target Enrichment (subset of the initial library)
Sequencing
Whole Genome
Whole Transcriptome
All Exons
Smaller # of Genes/Regions (i.e. Sequencing Panels)
![Page 18: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/18.jpg)
CAG EMEAI | Agilent Restricted | Page 21 Life Sciences & Diagnostics Group | Agilent Technologies | Page 21 S1
Learning the NGS Workflow:
Generating a Sequencing Library
1. Library - A collection of DNA or cDNA fragments prepared for
sequencing by a performing a series of enzymatic steps. These
steps are commonly referred to as the Library Prep.
Not approved for use in diagnostic
procedures
Isolate gDNA
Shearing/Fragmentation 1. Sonication (Covaris)
2. Restriction Enzymes
3. Transposons
4. Chemical/Heat (RNA-seq)
End Repair • Generate blunt
end fragments
A-Tailing • Add an “A” base to
3’ end of each
strand
A
A
Adapter Ligation • Adapters are short DNA oligos
that contain the primer sites
used by the sequencer to
generate the sequencing read
• Adapters can also contain short
6-8bp sequences called
indexes or barcodes
• Incorporating barcodes allows
different samples to be
combined in the same
sequencing run (multiplexing)
A
A T T
T
Y-Shaped
Sequencing Adapters
PCR • Using PCR primers
complementary to the
adapters, DNA fragments with
properly ligated adapters are
selected for and amplified
![Page 19: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/19.jpg)
CAG EMEAI | Agilent Restricted | Page 22 Life Sciences & Diagnostics Group | Agilent Technologies | Page 22 S1
Transposons library prep
![Page 20: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/20.jpg)
CAG EMEAI | Agilent Restricted | Page 23 Life Sciences & Diagnostics Group | Agilent Technologies | Page 23 S1
Agilent’s BioAnalyzer/Tapestation are frequently
used for Quality Control of Sequencing Libraries
Preps
Electropherogram (i.e. trace) for a Standard Library
Before or After Undergoing Target Enrichment
Agilent SureSelect
Illumina TruSeq
KAPA
NEB
NuGen etc… Over-loaded: Dilute and re-run
Over-Amplified: Reduce PCR
![Page 21: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/21.jpg)
CAG EMEAI | Agilent Restricted | Page 24 Life Sciences & Diagnostics Group | Agilent Technologies | Page 24 S1
Different Library Preps Generate Different
BioAnalyzer Traces
TruSeq Small RNA Library Prep (adapted from Illumina Protocol)
TruSeq Custom Amplicon Library (adapted from Illumina protocol)
Agilent Haloplex Library Prep Agilent SureSelect Library Prep
![Page 22: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/22.jpg)
CAG EMEAI | Agilent Restricted | Page 26 Life Sciences & Diagnostics Group | Agilent Technologies | Page 26 S1
Topics for Today’s Presentation
The NGS Library Prep Workflow 2
1
3 Whole Genome vs Targeted NGS
4
What is Next-Gen Sequencing?
Reviewing NGS Terminology
Not approved for use in diagnostic
procedures
Data Analysis 5
Agilents NGS Portfolio 6
![Page 23: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/23.jpg)
CAG EMEAI | Agilent Restricted | Page 27 Life Sciences & Diagnostics Group | Agilent Technologies | Page 27 S1
So you’ve made a library….now what?
Sequence It! Perform Target Enrichment
![Page 24: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/24.jpg)
CAG EMEAI | Agilent Restricted | Page 28 Life Sciences & Diagnostics Group | Agilent Technologies | Page 28 S1
Target Enrichment: It’s just like fishing…
Why perform target enrichment?
1. Sequence only your desired regions of
interest (Exons, gene panels, intergenic
regions etc...)!
2. Sequence more samples per lane/run
(i.e. Multiplex)
3. Save time and money
4. Faster time to results = Smaller datasets
5. Identify variants in samples with increased
reliability and accuracy:
More Reads in regions of interest =
Higher Depth of Coverage
![Page 25: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/25.jpg)
CAG EMEAI | Agilent Restricted | Page 29 Life Sciences & Diagnostics Group | Agilent Technologies | Page 29 S1
Target Enrichment Maximizes Your
Sequencing Efficiency x Desired Depth of Coverage = Required Seq Depth/Sample
Human Genome
3Gb x 30 = 90Gb
Illumina HiSeq 2000 37Gb/lane
~ 3 lanes per sample!
$$$$$
Illumina HiSeq FlowCell
Genome Size
Sequencing cost
~$4,500
![Page 26: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/26.jpg)
CAG EMEAI | Agilent Restricted | Page 30 Life Sciences & Diagnostics Group | Agilent Technologies | Page 30 S1
Target Enrichment Maximizes Your
Sequencing Efficiency x Desired Depth of Coverage = Required Seq Depth/Sample
Human Genome
3Gb x 30 = 90Gb
Illumina HiSeq 2000 37Gb/lane
Illumina HiSeq FlowCell
Target Size
v
Target = 50Mb x 100 = 5Gb
Target = 5Mb x 100 = 500Mb
Target = 500Kb x 100 = 50Mb
Target = 50Kb x 100 = 5Mb
Develop designs/panels for
any sequencing capacity:
- High Throughput or Desktop
Exome cost ~$1,500
![Page 27: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/27.jpg)
CAG EMEAI | Agilent Restricted | Page 31 Life Sciences & Diagnostics Group | Agilent Technologies | Page 31 S1
General Methods of Target Enrichment:
What is the basic concept?
1. Pull out the genes/regions of interest that you care about sequencing
A. Capture the regions using biotinylated baits: - In-solution hybrid capture
B. Use primers to selectively amplify the genes/regions you want to sequence: - Amplicon sequencing
2. Regions that are captured/amplified from initial library (i.e. pre-capture library) undergo additional amplification and processing creating a post-capture library
3. Off to sequencing!
(Adapted from www.sciencemag.org/cgi/content/full/291/5507/1221/F1)
![Page 28: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/28.jpg)
CAG EMEAI | Agilent Restricted | Page 32 Life Sciences & Diagnostics Group | Agilent Technologies | Page 32 S1
Learning the NGS Workflow: General
Comparisons of Target Enrichment Methods
In-Solution Hybridization Capture Amplicon Sequencing
gDNA
- Micrograms
- Hundreds of nanograms
- Tens of nanograms ?
gDNA
- Tens of nanograms
- And less…
Typically Faster
(no hyb required)
Typically Slower
hyb time range:
3-72hrs
More Robust Data:
- Many unique reads
- Can find large variety
of DNA aberrations
Good but Limited Data:
- Few/No unique reads
- Best for small/point
mutations
![Page 29: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/29.jpg)
CAG EMEAI | Agilent Restricted | Page 36 Life Sciences & Diagnostics Group | Agilent Technologies | Page 36 S1
Topics for Today’s Presentation
The NGS Library Prep Workflow 2
1
3 Whole Genome vs Targeted NGS
4
What is Next-Gen Sequencing?
Reviewing NGS Terminology
Not approved for use in diagnostic
procedures
Data Analysis 5
Agilents NGS Portfolio 6
![Page 30: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/30.jpg)
CAG EMEAI | Agilent Restricted | Page 37 Life Sciences & Diagnostics Group | Agilent Technologies | Page 37 S1
Understanding Reads…
Types of Reads, Lengths of Reads, Depths of Reads
• Single-End Reads: Provide sequence from one end of a DNA insert
• Paired-End Reads: Provide sequence from both ends of a DNA insert.
– Provides improved alignment of sequencing data
– Better detection of chromosomal rearrangements: insertions/deletions/translocations and
fusions.
• Mate Pair Reads: Similar to paired-end but both reads come from a single strand of
the DNA insert and the distance between the reads is often much greater.
DNA Insert of Unknown Sequence
Figure Adapted from: tucf-genomics.tufts.edu
Figure Adapted from: GeneSpring NGS User Manual
![Page 31: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/31.jpg)
CAG EMEAI | Agilent Restricted | Page 38 Life Sciences & Diagnostics Group | Agilent Technologies | Page 38 S1
Understanding Reads…
Types of Reads, Lengths of Reads, Depths of Reads
Figure Adapted from Ambry Genetics
• Short reads – Illumina, Ion Torrent/Proton, SOLiD • <100bp (ex. 1 x 36bp, 2 x 50bp, 1 x 75bp)
• Medium reads – Illumina, Torrent/Proton, Roche 454 • >100bp but <1000bp (ex. 2 x 100bp, 2 x 150bp, 1 x 400bp, 1x 600bp)
• Long Reads – Roche 454, Pacific Biosciences (PacBio) • >1000bp (ex. 1x1000bp, >10,000bp (Avg. 3000-5000bp))
Read lengths vary across sequencing platforms:
![Page 32: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/32.jpg)
CAG EMEAI | Agilent Restricted | Page 39 Life Sciences & Diagnostics Group | Agilent Technologies | Page 39 S1
Understanding Reads…
Types of Reads, Lengths of Reads, Depths of Reads
Reference
Genome
Aligned
Sequencing
Reads
6x
Depth 10x Depth 12x Depth Figure Adapted from Ambry Genetics
![Page 33: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/33.jpg)
CAG EMEAI | Agilent Restricted | Page 40 Life Sciences & Diagnostics Group | Agilent Technologies | Page 40 S1
Topics for Today’s Presentation
The NGS Library Prep Workflow 2
1
3 Whole Genome vs Targeted NGS
4
What is Next-Gen Sequencing?
Reviewing NGS Terminology
Not approved for use in diagnostic
procedures
Data Analysis 5
Agilents NGS Portfolio 6
![Page 34: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/34.jpg)
CAG EMEAI | Agilent Restricted | Page 41 Life Sciences & Diagnostics Group | Agilent Technologies | Page 41 S1
NGS 101 Data Analysis Teaser: What
happens after the library is sequenced?
Confidentiality Label
41
41
“Raw” Data
Files
Control
Software
De-multiplex
(Reads + Quality)
Trimming &
Aligning Tools
Reads
aligned to
genome
GeneSpring
SureCall, Partek,
Open source tools
FASTQs BAM/SAM
Files
FASTQs
Primary Secondary Tertiary
BAM/SAM Files Mutations/Variants Identified
![Page 35: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/35.jpg)
CAG EMEAI | Agilent Restricted | Page 42 Life Sciences & Diagnostics Group | Agilent Technologies | Page 42 S1
Primary Analysis
More Details
Sequence =
A,C,T,G,N + Qual
Score/base
Sequencer Control Output
1) Demultiplex (separate reads based on barcode/index)
2) Trim Adapters
3) Filter bad reads (too short, too many N’s)
@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
![Page 36: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/36.jpg)
CAG EMEAI | Agilent Restricted | Page 43 Life Sciences & Diagnostics Group | Agilent Technologies | Page 43 S1
Primary Analysis
Overview
• Sole responsibility of the sequencing platform vendor
• Converts physical signals to base calls as well as a quality
score
• Quality score: measure of confidence in the base call
FASTQ file
![Page 37: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/37.jpg)
CAG EMEAI | Agilent Restricted | Page 44 Life Sciences & Diagnostics Group | Agilent Technologies | Page 44 S1
Freeware vs. Commercial Software
Freeware
(+) Price ($0)
(-) Support
(-) List-based (no graphics)
(+) Pipeline
Commercial
(-) Price
(+) Support
(+) Interactive
(+) Workflows
Ease of Use
Skill
Set
R
Commercial
Galaxy Command
Line
![Page 38: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/38.jpg)
CAG EMEAI | Agilent Restricted | Page 45 Life Sciences & Diagnostics Group | Agilent Technologies | Page 45 S1
Summary - It Takes a Village
Plan experiment
Obtain samples
Isolate DNA/RNA
Core Facility
Service Bureau
Alignment
Analysis
![Page 39: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/39.jpg)
CAG EMEAI | Agilent Restricted | Page 46 Life Sciences & Diagnostics Group | Agilent Technologies | Page 46 S1
Topics for Today’s Presentation
The NGS Library Prep Workflow 2
1
3 Whole Genome vs Targeted NGS
4
What is Next-Gen Sequencing?
Reviewing NGS Terminology
Not approved for use in diagnostic
procedures
Data Analysis 5
Agilents NGS Portfolio 6
![Page 40: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/40.jpg)
CAG EMEAI | Agilent Restricted | Page 47 Life Sciences & Diagnostics Group | Agilent Technologies | Page 47 S1
Enabling a Clinical Research Workflow
SEQUEN
CE 1 day
3
ENRIC
H <1 day
2
DESIGN
~10 mins
1 4
ANALYZE
~1 hour
For Research Use Only.
Not for use in diagnostic procedures
![Page 41: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/41.jpg)
CAG EMEAI | Agilent Restricted | Page 48 Life Sciences & Diagnostics Group | Agilent Technologies | Page 48 S1
SureSelect - Most Complete Enrichment
Solution
All Exon
Designs
Custom
Solutions
Targeted
Panels
All
Exon
V5
Human
Methyl-
Seq
Custom
DNA
Automation Chrm.
X
Human
Kinom
e
Non
Human
Exomes
Custom
RNA
All
Exon
V5+UTR
s
SureSelect XT
Illumina
SureSelect XT
SOLiD
SureSelect XT2
Illumina
+ Library
Prep
Post-capture Pre-capture
![Page 42: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/42.jpg)
CAG EMEAI | Agilent Restricted | Page 49 Life Sciences & Diagnostics Group | Agilent Technologies | Page 49 S1
For Research Use Only.
Not for use in diagnostic procedures
SureSelectQXT
More from Less Same Day Sample to Sequencing
Accelerated answers with 90-min hyb
Same Day Sample to Sequencing
![Page 43: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/43.jpg)
CAG EMEAI | Agilent Restricted | Page 50 Life Sciences & Diagnostics Group | Agilent Technologies | Page 50 S1
SureSelectQXT Sample to data in as little as 24 to 36 hours
*MiSeq, HiSeq systems
< 7 hours ~12.5*-27** hours
DATA in
24-36 hrs Transposase-
based
Library Prep
90-minute Hybridization
Sequence *MiSeq and **HiSeq
systems
• FAST, EASY and CONVENIENT:
30 min hands-on time for library prep
3.5h overall hands-on time
No special equipment required for fragmentation
• 50ng SAMPLE INPUT
NO MECHANICAL SHEARING
![Page 44: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/44.jpg)
CAG EMEAI | Agilent Restricted | Page 51 Life Sciences & Diagnostics Group | Agilent Technologies | Page 51 S1
Library Prep Enrichment Sequence
SureSelectQXT The Fastest Enrichment Workflow
1 2 3 4 5
Competitor I
Competitor N
WORK DAYS
Agilent
SureSelectQXT
• ~4 day worfklow, 72h hyb
• 1ug input
• 1.5 day workflow, 5 hrs hands-on time: 2x capture and wash
• 50ng input
• Same day workflow, 90-min hyb, 3.5 hrs hands-on time
• 50ng input
![Page 45: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/45.jpg)
CAG EMEAI | Agilent Restricted | Page 52 Life Sciences & Diagnostics Group | Agilent Technologies | Page 52 S1
HaloPlex Workflow
A Simple & Fast 4-step protocol
Sample is fragmented using
restriction enzymes
2. Hybridize
probes
3. Purify and
ligate targets
4. Amplify
targeted
fragments
Probe library is added and
hybridized to the targeted
fragments making them form a
Halo shape.
Probe/Fragment hybrids are
retrieved with magnetic
streptavidin beads. The circular
molecules are then closed by
ligation Only circular DNA targets are
amplified. Sample barcodes are
introduced. Final product is
ready for sequencing
1. Digest DNA 1
2
3
4
![Page 46: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/46.jpg)
CAG EMEAI | Agilent Restricted | Page 53 Life Sciences & Diagnostics Group | Agilent Technologies | Page 53 S1
Agilent Technologies Knows NGS 101 & More…
Offering Complete Solutions for NGS Workflows
The Gold Standard for Sample QC
2100 Bioanalyzer Instrument & Kits
2200 TapeStation Instrument & Kits
NGS Analysis Software
GeneSpring NGS
SureCall
Validation Technologies
qPCR- Mx system & Brilliant reagents
Microarrays- CGH, CGH+SNP,
Gene Expression & miRNA
The Leader in NGS Target Enrichment
SureDesign
SureSelect
HaloPlex
Bravo Automation
![Page 47: Introduction to the technology behind Next …...Introduction to the technology behind Next-Generation Sequencing Presented By: Christofer Flood, Ph.D. June 16th, 2014 Field Application](https://reader034.fdocuments.in/reader034/viewer/2022050419/5f8ed59db8e760701a1290a0/html5/thumbnails/47.jpg)
CAG EMEAI | Agilent Restricted | Page 54 Life Sciences & Diagnostics Group | Agilent Technologies | Page 54 S1
Agilent Support
Sales Agent Genomics
Local Support
Agilent Global Support
Field Application Scientist
Contact Us