Intro to Probabilistic Models PSSMs
description
Transcript of Intro to Probabilistic Models PSSMs
![Page 1: Intro to Probabilistic Models PSSMs](https://reader036.fdocuments.in/reader036/viewer/2022062408/56814457550346895db0f1f6/html5/thumbnails/1.jpg)
Intro to Probabilistic ModelsPSSMs
Computational Genomics,
Lecture 6bPartially based on slides by Metsada Pasmanik-Chor
![Page 2: Intro to Probabilistic Models PSSMs](https://reader036.fdocuments.in/reader036/viewer/2022062408/56814457550346895db0f1f6/html5/thumbnails/2.jpg)
Biological MotivesA large number of biological units with common functions tend to exhibit similarities at the sequence level. These include very short “motives”, such as
gene splice sites, DNA regulatory binding sites, recognized by transcription factors (proteins that bind to the promoter and control gene expression), microRNAs, and all the way to protein families.
Often it is desirable to model such motives, to enable searching for new ones. Probabilistic models are very
useful. Today we deal with PSSM - the simplest.
![Page 3: Intro to Probabilistic Models PSSMs](https://reader036.fdocuments.in/reader036/viewer/2022062408/56814457550346895db0f1f6/html5/thumbnails/3.jpg)
Promoter…
![Page 4: Intro to Probabilistic Models PSSMs](https://reader036.fdocuments.in/reader036/viewer/2022062408/56814457550346895db0f1f6/html5/thumbnails/4.jpg)
Regulation of Genes
GeneRegulatory Element
RNA polymerase(Protein)
Transcription Factor(Protein)
DNA
www.cs.washington.edu/homes/tompa/papers/binding.ppt
![Page 5: Intro to Probabilistic Models PSSMs](https://reader036.fdocuments.in/reader036/viewer/2022062408/56814457550346895db0f1f6/html5/thumbnails/5.jpg)
Gene
RNA polymerase
Transcription Factor(Protein)
Regulatory Element
DNA
Regulation of Genes
![Page 6: Intro to Probabilistic Models PSSMs](https://reader036.fdocuments.in/reader036/viewer/2022062408/56814457550346895db0f1f6/html5/thumbnails/6.jpg)
Gene
RNA polymerase
Transcription Factor
Regulatory Element
DNA
New protein
Regulation of Genes
![Page 7: Intro to Probabilistic Models PSSMs](https://reader036.fdocuments.in/reader036/viewer/2022062408/56814457550346895db0f1f6/html5/thumbnails/7.jpg)
Motif Logo• Motifs can mutate on
less important bases.
• The five motifs at top right have mutations in position 3 and 5.
• Representations called motif logos illustrate the conserved regions of a motif.
http://weblogo.berkeley.eduhttp://fold.stanford.edu/eblocks/acsearch.html
1234567
TGGGGGATGAGAGATGGGGGATGAGAGATGAGGGA
Position:
![Page 8: Intro to Probabilistic Models PSSMs](https://reader036.fdocuments.in/reader036/viewer/2022062408/56814457550346895db0f1f6/html5/thumbnails/8.jpg)
Example: Calmodulin-Binding Motif (calcium-binding proteins)
![Page 9: Intro to Probabilistic Models PSSMs](https://reader036.fdocuments.in/reader036/viewer/2022062408/56814457550346895db0f1f6/html5/thumbnails/9.jpg)
PSSM Starting Point
• A gap-less MSA of known instances of a
given motif. Representing the motif by either:
1. Consensus.
2. Position Specific Scoring Matrix (PSSM).
Consider now a specific “motives server”,
called Consite.
![Page 10: Intro to Probabilistic Models PSSMs](https://reader036.fdocuments.in/reader036/viewer/2022062408/56814457550346895db0f1f6/html5/thumbnails/10.jpg)
![Page 11: Intro to Probabilistic Models PSSMs](https://reader036.fdocuments.in/reader036/viewer/2022062408/56814457550346895db0f1f6/html5/thumbnails/11.jpg)
Sequence logos: Visualizing PSSMs
![Page 12: Intro to Probabilistic Models PSSMs](https://reader036.fdocuments.in/reader036/viewer/2022062408/56814457550346895db0f1f6/html5/thumbnails/12.jpg)
Sequence logos: Visualizing PSSMs (2)