International Buffalo Information Center (IBIC)ibic.lib.ku.ac.th/e-Bulletin/33-2.pdfInternational...

International Buffalo Information Center (IBIC)BUFFALO BULLETIN

ISSN : 0125-6726

Aims

IBIC is a specialized information center on water buffalo. Established in 1981 by Kasetsart University (Thailand) with an initial fi nancial support from the International Development Research Center (IDRC) of Canada. IBIC aims at being the buffalo information center of buffalo research community through out the world.

Main Objectives

1. To be world source on buffalo information 2. To provide literature search and photocopy services 3. To disseminate information in newsletter 4. To publish occasional publications such as an inventory of ongoing research projects

Buffalo Bulletin is published quarterly in March, June, September and December. Contributions on any aspect of research or development, progress reports of projects and news on buffalo will be considered for publication in the bulletin. Manuscripts must be written in English and follow the instruction for authors which describe at inside of the back cover.

Publisher International Buffalo Information Center, Offi ce of the University Library, Kasetsart University Online availible http://ibic.lib.ku.ac.th/e-Bulletin

Advisory Board Prof. Dr. Charan Chantalakhana Thailand Prof. Dr. John Lindsay Falvey Faculty of Veterinary and Agricultural Science, University of Melbourne, Australia Prof. Dr. Metha Wanapat Department of Animal Science, Faculty of Agriculture, Khon Kaen University, Thailand Mr. Antonio Borghese International Buffalo Federation, Italy Dr. Aree Thunkijjanukij International Buffalo Information Center, Offi ce of the University Library, Kasetsart University, Thailand Miss Wanphen Srijankul International Buffalo Information Center, Offi ce of the University Library, Kasetsart University, Thailand

Editorial Member Dr. Pakapan Skunmun Thailand Dr. Kalaya Bunyanuwat Department of Livestock Development, Thailand Prof. Dr. Federico Infascelli Department of Veterinary Medicine and Animal Science, University of Naples Federico II, Italy

Dr. Rafat Al Jassim School of Agriculture and Food Sciences, Faculty of Science, The University of Queensland, Australia Prof. Dr. Nguyen Van Thu Department of Animal Sciences, Faculty of Agriculture and Applied Biology, Can Tho University, Vietnam Prof. K. Sarjan Rao Department of Livestock Production and Management, College of Veterinary Science, India Prof. Dr. Masroor Ellahi Babar Virtual University of Pakistan, Pakistan Asst. Prof. Dr. Asif Nadeem Institute of Biochemistry and Biotechnology, University of Veterinary and Animal Sciences, Pakistan Prof. Dr. Raul Franzolin Departamento de Zootecnia, Universidade de São Paulo, Brazil

Editor Dr. Sunpetch Sophon Faculty of Veterinary Medicine, Mahanakorn of Technology, Thailand

Journal Manager Mr. Chalermdej Taterian International Buffalo Information Center, Offi ce of the University Library, Kasetsart University, Thailand

Assistant Journal Manager Miss Jirawadee Wiratto International Buffalo Information Center, Offi ce of the University Library, Kasetsart University, Thailand

BUFFALO BULLEITNIBIC, KASETSART UNIVERSITY,

P.O. BOX 1084, BANGKOK 10903, THAILAND E-mail : [email protected] Tel : 66-2-9428616 ext. 344 Fax : 66-2-9406688

Buffalo Bulletin (June 2014) Vol.33 No.2

CONTENTS

Page

Case Report

Management of post partum complete uterine prolapse in a Gir cow and a Jaffrabadi buffaloS.N. Ghodasara, H.H. Savsani, A.R. Ahlawat and P.U. Gajbhiye....................................................143

Post-partum uterine prolapse in a Murrah buffalo- A case reportChetna Gangwar, Ashok Kumar, Alok Kumar and Atul Saxena.......................................................146

Vegetative valvular endocarditis in an Indian buffaloG. Selvam, M. Swamy, Y. Verma, C.M. Karthik and R.S. Arya.........................................................149

Short communication

Antigenicity of caseinophosphopeptides prepared from buffalo caseinPrerna Saini, Bimlesh Mann, Anuradha Kumari, Parbhakar Padghan and Rajesh Kumar............................................................................................................................153

Review Article

A report of a brucellosis outbreak from central IndiaSunant K. Raval, Joice P. Joseph, Aatur Shah, R.S. Joshi and B.B. Bhanderi.................................159

Original Article

Cloning and sequencing of gc gene of bovine herpesvirus 1 (BHV1) from buffalo bull semenSupriya Pal, Mayur K. Jhala, Pranay Kumar and Chaitanya G. Joshi...........................................164

Studies on the temperament of Murrah buffaloes with various udder and teat shapes and its effect on milk yieldR.M.V. Prasad and P. Jaya Laxmi....................................................................................................170


CONTENTS

Page

Original Article

Plasma disposition and urinary excretion of levofl oxacin following a single intravenous administration in buffalo calvesData Ram and Vinod Kumar Dumka.............................................................................................177

Effect of treatment with or without estradiol after ovsynch protocols at timed AI on the pregnancy rate in lactating buffaloes semen cryopreservationM.S. Akhtar, S. Ullah, L.A. Lodhi, Z.I. Qureshi and I. Ahmad.......................................................184

Studies on the prevalence and diagnosis of subclinical iodine defi ciency in buffaloes (Bubalus bubalis)C.S. Randhawa, S.S. Randhawa, Swaran S. Randhawa and K. Dua.............................................192

Effect of strategic nutrient supplementation on the reproductive performance of anoestrus buffaloes in the Malwa region of Madhya PradeshNagendra Patil, R.K. Jain and Vishal Mudgal..............................................................................199

Prevalence of coagulase gene positive Staphylococcus aureus bovine mastitis in three distinct geoclimatic regions of IndiaB.D. Sahu, R. Mukherjee, Ajay Kumar, Amit Kumar and Jyoti Sahu..............................................208

Milk leukocyte adhesion molecules in response to Curcuma longa plus α -tocopherol and selenium in mastitic riverine buffaloesReena Mukherjee, R.K. Jadhav, Nitika Sharma, B.D. Sahu and U.K. De......................................215

EFfect of two different doses of FSH-P (Folltropin-V) on superovulation in Berari (Nagpuri) buffaloes (Bubalus bubalis) and their surgical resolution in Surguja, Chhattisgarh (India)A.R. Ratnaparkhi, C.H. Pawshe, S.K. Sahatpure, S.A. Chede, A.P. Gawande, M.S. Patil and R.P. Kolhe......................................................................................221


CONTENTS

Page

Original Article

Effect of GnRH and PGF2α administration in early post partum period on fertility potential of buffaloesM.V. Ingawale, S.A. Bakshi, H.S. Birade, S.R. Chinchkar and S.U. Gulavane..............................228

Effect of pre-partum supplementation of vitamin E to Murrah buffaloes on lymphocyte function of calvesA.K. Singh, S. Pandita, R.C. Upadhyay and G. Chandra..............................................................233


143

Case Report

ABSTRACT

Case reports of complete uterine prolapsed in a Gir cattle and a Jaffrabadi buffalo are presented. The complete uterine prolapsed cow and buffalo with inability to stand were treated. Applying gentle pushing and meticulous pressure on the prolapsed uterine mass repositioned the uterine horns normally in both, and both the animals were treated for prevention of uterine infection with antibiotics, anti-infl ammatory and antihistaminic drugs. Both the animals recovered completely without any future reproductive complication.

Keywords: Prolapse, hypocalcaemia, uterus, reproductive complication

INTRODUCTION

Among the reproductive disorders, complete uterine prolapse is always an extremely serious condition in any farm animal. A prolapsed uterus is highly prone to mechanical injury and/or trauma and environmental contamination, and this may lead to increased maternal morbidity and even to the death of the animal owing to trauma, laceration, subsequent hemorrhage, tissue necrosis, bacterial contamination, some time urinary incontinence, hypocalcaemia, stress incontinence and shock (Jana and Ghose, 2004), and therefore,

it requires early attention, prompt and effi cient management and proper treatment to overcome further serious complications in reproductive performance of the animal in the future The present clinical case studies are on incidence of post partum complete uterine prolapse in an indigenous pluriparous post parturient cow and buffalo and its successful obstetrical and therapeutic management.

Case History And Observation Case-I A seven-year-old gir cow in its 4th lactation attended (Cattle Breeding Farm, J.A.U., Junagadh) was treated for the correction of complete uterine prolapse and for its inability to stand, and for prevention of uterine infection.

Case-II A six-year-old Jafferabadi buffalo in its 2nd lactation was treated for the correction of the uterine prolapsed, for its inability to stand and for prevention of uterine infection.

It was reported that both the animals cow and buffalo had given normal birth to healthy male and female calves, respectively, and both the animals expelled the placenta normally within 6-8 hr post calving, but after the placenta had been expelled, a uterine mass started protruding from the vulvar lips, and in the cow,during the night (16-18 h post calving), the whole uterus had prolapsed out whereas in the case of the buffalo, the whole uterus had prolapsed out in early morning (28-30

MANAGEMENT OF POST PARTUM COMPLETE UTERINE PROLAPSE IN A GIR COW AND A JAFFRABADI BUFFALO

S.N. Ghodasara, H.H. Savsani, A.R. Ahlawat and P.U. Gajbhiye

Cattle Breeding Farm, Junagadh Agricultural University, Junagadh-368 002, India


144

h post calving). The cow could not rise up even after mechanical supports were applied, while the buffalo was able to rise with assistance and keep standing in such a way that the hind quarters remained in upward position. In the case of the cow, gynecological examination led to the diagnosis of the condition as post parturient paresis and complete uterine prolapse, whereas in the buffalo, examination led to the diagnosis of the condition as complete uterine prolapse. Respiration and pulse were normal, but the animals were hypothermic (98oF in the cow and 98.5oF in the buffalo). Both the animals were alert, but were not taking food or water nor passing urine.

Treatment The everted uteri were washed gently with 1% potassium parmanganate solution with detachment of placenta and removal of all debris and dead tissues and prolapse masses were lifted upward to pass the urine. Gently application of 50 gm of nolapse powder (Virbac) on the prolapsed mass was made, followed by waiting for 10-15 minutes. With gentle pushing and meticulous pressure, the prolapse mass was pushed inside with half closed hand into the pelvic cavity and both the uterine horns were repositioned normallyThe vulvar lips with were cleaned with 1% potassium permanganate solution and vaginal passaries viz., Furea (Intas Pharmaceutical) 2 boli were placed in each horn of the uterus in each animal. Horizontal metrees suture were taken at the vulvar lips in both the animals to overcome further complication. As the rectal temperature of both the animals indicated hypothermic, hypocalcaemic, uterine inertia and loss of energy due to calving stress, immediate slow intravenous administration of 20 I.U. of oxytocine along with lactomag 450 ml (Intas Pharmaceuticals Limited) a combination

of calcium gluconate, magnesium hypophosphite and anhydrous dextrose followed by intravenous administration of 450 ml of 25% dextrose (Wockstrose 25%, Wockhardt) to combat energy loss due to calving stress. A course of antibiotic i.e. two shots of long acting oxytetracycline hydrochloride (Terramycine L.A., pfi zer) 5 mg/kg of body weight were injected intramuscularly at 48 h intervals and non steroidal anti infl ammatory meloxicam (Zobid-M, Sarabhai Zydus) were administered intramuscularly 0.5 mg/kg of body weight for the 1st day followed by 0.2 mg/kg of body weight for the subsequent 3 days. The supportive treatment was given to both the animals with antihistaminic (Cadistin, Sarabhai Zydus) 10 ml total dose for 3 days and vitamin B-complex with liver extract (Balamyl, Sarabhai Zydus) 10 ml total dose for the subsequent fi ve days.

RESULT AND DISCUSSION

Both the animals (the cow and the buffalo) rose after 3-4 h of treatment on their own and fed normally feeding. On the 5th day the sutures were removed. Both the animals recovered completely without any future reproductive complication.

Arthur et al. (1996) stated that uterine prolases are associated with the onset of uterine inertia during the 3rd stage of labor when a portion of detached afterbirth occupies the birth canal and protrudes from the vulva. In the present prolapses, intravenous administration of calcium and magnesium corrected the hypothermia due to hypocalcaemia and gave tonicity to perinial muscular tissue which helped to withhold the prolapse uterine mass, simultaneously oxytocin provided tonicity and slight contraction to the smooth uterine musculature which helped in


145

repositioning it normally and corrected uterine inertia. Parentral as well as intrauterine antibiotic therapy were instituted to control and combat possible bacterial infection and to establish uterine hygiene for future reproduction and performance. Anti-infl ammatories, analgesics and antihistaminic are helpful to correct pain and infl ammation, and vitamin B-complex and liver tonic plays important role in correction of off feeding occurs due to long antibiotic therapy Both the cases (the cow and the buffalo) recovered successfully without further complication of prolapse and hypocalcaemic paresis for 3 months of post therapeutic observation. Among reproductive disorders, prolapse of reproductive organs occurs as a common gestational accident. Post partum uterine prolapse is more common than the prepartum prolapse (Roberts, 1971) mainly because of increase in intra abdominal pressure, uterine inertia and loss of muscular tonicity. Post partum uterine prolapse most often occurs immediately after parturition and occasionally up to several hours afterwards (Arthur et al., 1996; Robert, 1971). The relaxation of pelvic ligaments due to the perous nature of the cow along with straining and lack of uterine tonicity as described by Wani et al. (2000) and the increase in intra abdominal pressure, uterine inertia and loss of muscular tonicity as desribed by Arthur et al. (1996) might be the cause of uterine prolapse in this case.

REFERENCES

Arthur, G.H., D.E. Noakes and H. Pearson. 1996. In Veterinary Reproduction and Obstetrics (Theriogenology), 6th ed. Bailliere and Tindal, London, 302-307, 384-389.

Jana, D. and M. Ghosh. 2004. Management of prepartum cervical prolapse in indigenous she buffalo-A case report. Intas Polivet, 5: 147-148.

Roberts, S.J. 1971. Veterinary Obstetrics and Genital Disease (Theriogenology), 2nd ed. CBS Publishers and Distributors, New Delhi, India. 189-196.

Wani, N.A., G.M. Wani and M.Z. Khan. 2000. Uterine prolapse in sheep and its management. Indian J. Anim. Reproduction, 21: 80.


146

ABSTRACT

The present communication reports a case of uterine prolapse in a pluriparous Murrah buffalo and its successful treatment by reposition at proper anatomical site and treatment.

Keywords: uterine prolapse, Murrah buffalo, clinical management

INTRODUCTION

A prolapse of the uterus is effectively the whole of the uterus turning inside out and hanging out of the vulva of the buffalo (Roberts, 1971). Prolapse of the uterus is a common complication of the third stage of labour in the buffaloes (Joseph et al., 2001). Compared to the vaginal prolapse, the uterine prolapse is larger, longer (usually hanging down to the hocks when standing), more deep red in color and covered with the “buttons” where the placenta was attached (Figure 1) (Arthur et al., 1996). There seem to be two age groups that are susceptible to this condition, heifers and older buffaloes. When heifers suffer from a prolapse it is due to the uterine muscle becoming exhausted from the calving process. When the calf is fi nally expelled, the uterus fl ops out with the calf. In older buffaloes, it is often associated with milk fever.

The uterus like the other muscles in the body, requires calcium to contract. In a buffalo with milk fever, the uterus fails to contract as the calf is being passed and again fl ops out with the calf. To avoid problems with uterine prolapses, try to decrease the potential for the buffaloes being affected by the predisposing factor above. A uterine prolapse is considered a medical emergency; therefore, this condition is life threatening. If the affected buffalo is not treated quickly, she could go into shock or die from blood loss. A veterinarian should be contacted for assistance with this procedure. If the uterus is pushed back improperly, it could result in internal bleeding and death of the buffalo.

CASE HISTORY AND OBSERVATION

A ten-year-old Murrah buffalo in fi fth parity was presented to the College of Veterinary Science and Animal Husbandry, DUVASU, Mathura with a history of a normal parturition. A normal female calf had been born six hours before. The uterine horn was prolapsed along with the fetal membrane. The buffalo was healthy and in a standing position. The prolapsed mass was hanging from the vulva. The rectal temperature was recorded to be 101°F. Eye mucous membrane was congested. The placental cotyledons were attached to the maternal

POST-PARTUM UTERINE PROLAPSE IN A MURRAH BUFFALO- A CASE REPORT

Chetna Gangwar*, Ashok Kumar, Alok Kumar and Atul Saxena

Department of Animal Reproduction and Gynaecology, College of Veterinary Science and Animal Husbandry, DUVASU, Mathura, U.P., India, *E-mail: [email protected]

Case Report


147

Figure 1. Showing uterine prolapse in buffalo.

Figure 2. Showing clinical management of uterine prolapse.

Figure 3. Showing clinical management of uterine prolapse.


148

coruncles. Severe bleeding was noticed. The newborn was apparently healthy and trying to suckle her mother.

CLINICAL MANAGEMENT

Considering the severity of the case and theowner’s agreement, the prolapsed mass was washed carefully with warm saline. Epidural anesthesia was given with 2% Xylocane to prevent straining. The fetal membranes were detached manually with fi ngertips from the maternal coruncles avoiding bleeding. Then the uterine mass was again washed with saline and fi nally with 1:1000 potassium permanganate solution. Then it was replaced to its normal anatomical position. To prevent further complications, intra-uterine antibiotic treatment was also done. Then the purse string suture with sterile shoe laces around anterior vagina was done (Figures 2 and 3). A truss was applied to prevent recurrence due to tenasmus. The animal was treated with antibiotic, anti-infl ammatory, antihistaminic, analgesic i/m and i/v fl uid therapy. The same treatment was followed for three days and vaginal suture was removed after one week. The animal became healthy with plenty of milk production and normal fertility.

DISCUSSION

The usual sequel of uterine prolapse is haemorrhage, shock, septic metritis, peritonitis, infertility or death. Sometimes in delayed cases, partial contraction of cervix interferes with proper repositioning, resulting in recurrence of prolapse. But in this case, after detaching the fetal membranes, the prolapsed mass became lighter

and less voluminous, so it was easy to reposite as described by Bhoi and Parekar (2009) . Moreover we applied a truss, so even in the presence of a tenasmus, the recurrence was noticed. Uterine prolapse is predisposed to a violent tenasmus and retension of fetal membrane in this case as reported by Roberts (1971).

REFERENCES

Arthur, G.H., D.E. Noakes, H. Peterson and T.J. Parkinson. 1996. Veterinary Reproduction and Obstetrics, 7th ed. WB Saunders Company Ltd., London, England.

Bhoi, D.B. and S.S. Parekar. 2009. Post-Partum Uterine Prolapse in a Non-descript Buffalo. Veterinary World, 2(4):149.

Joseph, C., K. Kulasekar, S. Balasubramanian, D. Kathiresan, C. Veerapandian and S.R. Pattabiraman. 2001. An unusual complication of post-partum uterine prolapse in a she buffalo-a case report. Indian Vet. J., 78: 57-58.

Roberts, S.J. 1971. Veterinary Obstetrics and Genital Diseases, 2nd ed. C.B.S. Publisher and distributors, Delhi. India. 308-313.


149

ABSTRACT

Vegetative valvular endocarditis is one of the rare primary cardiac diseases in bovines. Among bovines, the incidence of this condition in Indian buffaloes is poorly reported. The present communication describes the gross and histopathological alterations in the case of vegetative valvular endocarditis observed in a 5-year-old she buffalo.

Keywords: buffalo, vegetative valvular endocarditis, pathological alterations

INTRODUCTION

Cardiac diseases in bovines are one of the easily overlooked veterinary cases (Maillard et al., 2007) and the diagnosis is normally made almost at the terminal stage with poor prognosis (Reef et al., 2008). Vegetative valvular endocarditis is rare (Healy, 1996) but one of the primary cardiac diseases that is usually caused by systemic or local infections by bacteria that colonize and injure the valvular endothelium. Although the left atrio-

ventricular valves are most commonly affected in other species, in bovines this condition is frequently observed in the right atrio-ventricular valve (Jones et al., 1997). Since the incidence of this disease is very rare in buffaloes among bovines, the present communication will serve as a valuable record regarding the incidence and pathological alterations noted.

CASE HISTORY, GROSS AND HISTOPATHOLOGY

The animal had the clinical history of progressive emaciation, dullness, depression, reduced milk yield, exercise intolerance, dyspnea with grunt, chronic moderate pyrexia and death. On autopsy, the carcass had pin-point to ecchymotic hemorrhages on subcutaneous tissues and visceral surfaces. The heart was enlarged and the endocardium of the cardiac ventricles had suffusive hemorrhage. The cusps of right atrio-ventricular valves had irregular, yellow, loosely adhering, friable masses causing stenosis of the valvular space (Figure 1). The cortex of the kidney revealed, well demarcated, raised, round,

VEGETATIVE VALVULAR ENDOCARDITIS IN AN INDIAN BUFFALO

G. Selvam1, M. Swamy2, Y. Verma2, C.M. Karthik3 and R.S. Arya4

1Department of Pathology, International Institute of Biotechnology and Toxicology, Padappai - 601 301, Kanchipuram District, Tamil Nadu, India, E-mail: [email protected] of Veterinary Pathology, Jawaharlal Nehru Krishi Vishwa Vidyalaya, Jabalpur, Madhya Pradesh - 482 001, India3Veterinary Dispensary, Thandalaputhur, Musiri Division, Trichy District, India4Department of Veterinary Pathology, Indian Veterinary Research Institute, Izat Nagar, Bareilley, India

Case Report


150

Figure 1. Photograph of heart shows vegetative valvular endocarditis in right-atrio ventricular valve. Arrow points caulifl ower like vegetative growth.

Figure 2. Photograph of lung shows embolic pneumonia and purulent exudates on cut section (arrows).


151

Figure 3. Microphotograph of right-atrio ventricular valve shows thrombosis, highly basophilic clumps of bacterial colonies (arrows) and ongoing suppurative infl ammation on the valve (arrow heads). ×400 H&E.

pin-point, miliary white foci bilaterally. The lung was wet, heavy and pale with multifocal irregular fl at red foci and on cut surface showed purulent material on major airways of all lobes (Figure 1). On microscopical examination, the kidneys revealed, diffuse pyelonephritis bilaterally. Severe neutrophilic infi ltration in interstitium and pelvis, tubular dilatation, focal to multifocal tubular necrosis, hemorrhage, interstitial edema and micro-cavities containing degenerating neutrophils (abscess) were observed in the cortex, medulla and pelvis of the kidneys. Severe pulmonary edema with suppurative infl ammation in airways, obliteration of functional alveolar space with purulent exudates and thickening of alveolar walls was observed in lungs. Histopathology of the affected valve showed, severe suppurative infl ammation and peri-vavular cuffi ng of thrombotic mass. The thrombotic mass was seeded with multifocal bacterial colonies

surrounded by multiple concentric layers of eosinophilic fi brin material (Figure 3).

DIAGNOSIS AND DISCUSSION

Valvular endocarditis in animals can be caused by two ways: primary adhesion of the micro organisms to the valvular endocardium or their entrapment to the pre-developed valvular thrombi (Jones et al., 1997). In bovines, the causative organism includes Arcanobacter pyogenes -the most frequently isolated organism from these lesions (Vleet and Ferrans, 2007), Streptococcus sp., members of Enterobacteriaceae and Bartonella bovis (Maillard et al., 2007). The pathogenesis includes focal injury to the endothelial valve, turbulent cardiac blood fl ow admixed with the pathogenic bacteria, adherence and colonization of


152

the bacteria in the injured site, induction of acute infl ammation and resultant hypercoagulability of the blood in that particular focus leading to the formation and growth of thrombus. Continuous proliferation of the microorganisms leads to further organization of fi brin that gives rise to caulifl ower like growths around the cusps of valves. Thus this condition is called vegetative valvular endocarditis (Jones et al., 1997). In this present case the gross and histopathology of lung indicated, the presence of embolic pneumonia, which in bovines, usually results from the right side valvular endocarditis and dissemination of the septic emboli through hematogenous route (Vleet and Ferrans, 2007a). This type of dissemination also leads to formation of micro to large abscesses in multiple organs like kidney, spleen, liver etc., which is otherwise called as embolic shower.

The gross and histopathology fi ndings observed in this case were in accordance with the description presented by previous workers and thus this present case is diagnosed as vegetative valvular endocarditis.

REFERENCES

Healy, A.M. 1996. Endocarditis in cattle: A review of 22 cases. Irish Vet. J., 49: 43-48.

Jones, T.C., R.D. Hunt and N.W. King. 1997. Veterinary Pathology, 6th ed. Williams and Wilkins, Maryland, USA. 1392p.

Maillard, R., E. Petiot, B. Chomel, C. Lacroux, F. Schelcher, M.V. Taussat, N. Haddad and H.J. Boulouis. 2007. Endocarditis in cattle caused by Bartonella bovis. Emerging Infectious Diseases, 13(9): 1383-1385.

Reef, V.B. and S.M. McGuirk. 2008. Diseases of the cardiovascular system, p. 453-489. In

Smith, B.P. (ed.) Large Animal Internal Medicine, 4th ed. Elsevier-Saunders St. Louis, Missouri.

Vleet, J.F.V. and V.J. Ferrans. 2007. Cardiovascular System, p. 559-580. In McGavin, M.D. and J.F. Zachary (eds.) Pathologic Basis of Veterinary Disease, 4th ed. 1476p.

Vleet, J.F.V. and V.J. Ferrans. 2007a. Respiratory System, p. 463-558. In McGavin, M.D. and J.F. Zachary (eds.) Pathologic Basis of Veterinary Disease, 4th ed. 1476p.


153

ABSTRACT

In the present study, the antigenicity of caseinophosphopeptides (CPPs) enriched from the hydrolysis of buffalo casein with trypsin and neutrase was studied using a mouse model system. Relative levels of specifi c IgE and IgG made in respone to intraperitoneal sensitization to CPPs enriched samples were determined using indirect ELISA. It was found that the CPPs enriched samples prepared from both the enzymes, i.e. trypsin and neutrase, were less antigenic as compared to intact protein, i.e. sodium caseinate. Among the CPPs enriched samples, the antigencity of trypsin samples was less than that of neutrase samples. The results suggested that these CPPs enriched samples can be used as a food ingredient for food designed for hypoallergenic persons.

Keywords: buffaloes, Bubalus bubalis, caseinophosphopeptides, CPPs, antigenicity

INTRODUCTION

Food allergy is defi ned as an adverse clinical reaction due to an immune–mediated hypersensitivity response resulting from the ingestion of a food. Cow milk protein allergy represents the most frequent food allergy in

infancy ranging between 2 and 7.5% of the infant population. Clinical challenges frequently reveal that patients who are allergic to milk react to the multiple protein fractions found in bovine milk (Savilahti and Kuitunen, 1992). Otani (1992) stated that minimum number of antigenic determinant sites for αs1-CN, β-CN and κ-CN were 6, 6 and 4 respectively. The milk proteins mainly responsible for the allergy are α- and β-casein, followed by β-lactoglobulin and α-lactoalbumin to a lesser extent (Docena et al., 1996; Bernard et al., 1998; Jarvinen et al., 2001). Milk from other species, such as goat milk and sheep milk, has shown a high degree of cross reactivity (Spuergin et al., 1997; Bellioni-Businco et al., 1999). Milk from buffalo is a common drinking milk in many developing countries and is the main component of buffalo mozzarella eaten throughout the world. In vitro studies demonstrate a similar proteomic make-up and suggest antibody cross reactivity between cow milk and water buffalo milk proteins (Restani et al., 2002; D’Auria et al., 2005).Similarly, one human study showed a high degree of skin test positivity to water buffalo milk in patients with cow milk allergy (Katz et al., 2008). However, Sheehan and Phipatanakul (2004) described the fi rst report of a child with cow milk allergy who is able to tolerate water buffalo milk.

Further the protein hydrolysates are widely used as milk substitutes for children with bovine

ANTIGENICITY OF CASEINOPHOSPHOPEPTIDES PREPARED FROM BUFFALO CASEIN

Prerna Saini, Bimlesh Mann*, Anuradha Kumari, Parbhakar Padghan and Rajesh Kumar

Dairy Chemistry Division, National Dairy Research Institute, Karnal (Haryana)-132 001 India, *E-mail: [email protected]

Short Communication


154

milk allergy. Enzymatic hydrolysis is considered a desirable treatment for reducing the antigencity of milk caseins. The allergencity of casein hydrolysates that have been prepared using a single or a mixture of proteases that have specifi c cleavage sites have been reported (Boza et al., 1994; Nakamura et al., 1993; Mahmoud et al., 1993, Otani et al., 1990 and Takase et al., 1979). Cordle (1994) reported that the allergencity declines with decreasing molecular weight, especially between 10000 and 2500 daltons. A number of biological active peptides have been identifi ed in the casein hydrolysates. Among these the caseinophosphopeptides have been reported as mineral binding peptides which have a potential use as a food ingredient. Selective precipitation or enrichment of the phosphopeptides results in removal of potential antigens. Therefore, it is worth examining whether casein phosphopeptides are hypoallergenic. The main aim of the study was to compare the allergenicity of caseinophosphopeptides (CPPs) enriched products prepared from buffalo milk casein using membrane processing and selective precipitation method with two enzymes. The allergic potential of the proteins is generally evaluated as a function of serological responses i.e. IgG and IgE antibody production. The role of IgE in type I immediate a hypersensitivity allergic reaction is well understood in the scientifi c literature. It is also strongly agreed in the scientifi c literature that allergic reactions may occur independent of antigenic specifi c IgE. High affi nity receptors for IgG, on human mast cells and basophils are activated in immediate hypersensitivity reactions. IgG-mediated immediate hypersensitivity, also known as IgG-mediated anaphylaxis, is not a new concept in allergy research. So in the present study, the allergenic activity as a function of the ability of proteins to provoke IgG and IgE antibody response in a mouse

model was studied by peritoneally injecting mice with sodium caseinate, phosphopeptides enriched ingredients and ova albumin with adjuvant (AlO3). A sandwich ELISA was used to determine levels of IgG and IgE in the blood.

MATERIALS AND METHODS

Preparation of samples Sodium caseinate prepared from buffalo milk was hydrolysed by two commercial enzymes, i.e. trypsin and neutrase, under optimized conditions (Saini, 2012). After hydrolysis the pH of the solution was adjusted to 4.6 and supernatant was collected after centrifugation. Then the pH of supernatant was adjusted to neutral and the solution was incubated at room temperature after adding calcium chloride 1.1%. After incubation, CPPs was enriched from the solution by using two methods: ethanol precipitation and ultrafi ltration. A total of three samples were prepared; samples prepared with trypsin hydrolysates were named as trypsin CPPs i.e. TC (ethanol precipitation), trypsin retentate i.e. TU (ultrafi ltration) and the sample from neutrase hydrolysed was named as neutrase retentate i.e. NU (ultrafi ltration).

Intraperitoneal immunization for allergic response Swiss albino male mice weighing 25-30 g each were taken from the Small Animal House, NDRI, Karnal, India. They were maintained on standard pellet diet and had access to tap water ad libitum. They were housed in groups of eight mice per cage and kept in polypropylene cages with stainless steel wire-bar lids, using a rice husk as a bedding material, under a 12 h light/dark cycle at room temperature of 22-24°C. Mice were then


155

acclimatized to the environment for one-week prior to the experiment. Animals were randomly assigned to one of six groups of eight mice each as given below:Group 1: Control group injected with adjuvant in

phosphate buffer saline (PBS) (pH 7.4)Group 2: Group injected intraperitonially with

ovalbumin + adjuvant in PBS (AlO3) Group 3: Group injected intraperitonially with TU

+ adjuvant in PBS (AlO3)Group 4: Group injected intraperitonially with TC+

adjuvant in PBS (AlO3) Group 5: Group injected intraperitonially with NU

+ adjuvant in PBS (AlO3)Group 6: Group injected intraperitonially with Na

caseinate + adjuvant in PBS (AlO3)

The mouse groups were immunized on the fi rst day and a booster dose was given on the 15th day of the experiment. Seven days after the fi nal injection, blood samples were collected aseptically by exsanguinations (cardiac puncture). Serum samples were prepared, diluted with PBS and used for antigen-specifi c IgE and IgG assay.

Immunoglobulin assayThe total IgE and IgG in serum was

determined using an ELISA kit (Koma Biotech, Korea). The operating procedures were strictly followed as provided by the manufacturer. The principle of the ELISA kit was to employ the quantitative sandwich enzyme immunoassay technique. Polystyrene ELISA plates were coated overnight at 4°C with 100 μL of coating antibody (provided with kit) diluted in 50 mM carbonate-bicarbonate buffer, pH 9.6. After washing at 25°C with PBS containing 0.05% Tween 20, pH 7.4; the plates were post-coated with 200 μL bovine serum albumin (1%) in PBS, pH 7.4 for 1 h at

25°C. The plates were washed again with PBS containing 0.05% Tween 20, pH 7.4. Serum (100 μL) of optimal dilution (100-fold dilution for IgE, 2000-fold dilution for IgG) was added to each well, and plates were incubated for 1hr at 25°C. After washing the plates as above, 100 μL of optimally diluted detection antibody specifi c for IgE and IgG (provided with kit) were added to each well and the plates were incubated for 1 h at 25°C. After incubation, the wells were aspirated to remove liquid and the plate was washed as above. Finally, 100 μL of colour development solution was added to each well and incubated at room temperature for a proper colour development. (5-10 minutes). After suffi cient colour development, 100 μL stop solution (2M H2SO4) was added to each well and the absorbance was measured at 450 nm using an ELISA plate recorder. Finally, 100 μL of 3, 3’, 5, 5’ tetramethyldiamine benzidine was added to each well and incubated at 25°C for a proper colour development. (5-20 minutes). After suffi cient colour development, the reaction was stopped by addition of 100 μL of 2M H2SO4 to each well and the absorbance was measured at 450 nm using an ELISA plate recorder (TECAM Infi niteF200 Pro,).

RESULTS AND DISCUSSION

At 3 weeks postinjection, no signifi cant difference (p≤0.05) was found in the level of serum IgE among the mouse groups injected with CPPs samples (TU, TC and NU) as compared to the control. Figure 1 shows the level of serum IgE towards peritoneally injected CPPs samples and ovalbumin. Whereas it is observed that serum IgE level in the group injected with Na caseinate (280.7±19.6 ng/ml) was signifi cantly higher as compared to the control but signifi cantly lower


156

than that of the ova+ve group (570.4±24.7 ng/ml). Among the CPPs samples the highest IgE level was observed in the NU sample (186.3±16.6 ng/ml) as compare to TU (170.6±12.9 ng/ml) and TC (178.5±11.8 ng/ml).

The level of serum IgG towards peritoneally injected CPPs samples and ovalbumin is given in Figure 2. At 3 weeks postinjection, IgG level in blood serum of mouse groups injected with CPPs samples did not differ signifi cantly as compared to the control group (245.5±14.6 μg/ml). The serum IgG level of the group injected with Na caseinate (300.8±18.7 μg/ml) differed signifi cantly from the control group and the ova+ve group (568.3±22.8 μg/ml). The highest value for IgG level was observed in the NU sample (266.5±15.6 μg/ml) as compared TU (255.6±10.8 μg/ml) and TC (247.2±12.7 μg/ml).

In this study, the levels of IgG in blood samples of mice was higher as compared to that of IgE induced by all the protein and peptides samples (Figures 1 and 2). There may be the possible explanation as reported by Wood and Wreghitt (1990) and Park and Allen (2000). The serum IgG may compete for antigen binding sites in the indirect ELISA assays or any IgE that was initially increased in the serum was suppressed by IgG, after circulating IgG secretion increased.

All the three caseinophosphopeptides enriched products i.e. TU, TC and NU showed signifi cantly lower values for IgE and IgG as compared to that of Na caseinate and ovaalbumin. The levels of IgE and IgG in all these three products remained similar to that of the control. This clearly indicates that the fragments of casein (CPPs) are signifi cantly less or non immunogenic than sodium caseinates. The reduction in antigenicity of the caseinophosphopeptides may be due to removal of antigenic peptides from these

products by ultrafi ltration (TU, NU) and selective precipitation (TC). Similar fi ndings were reported by Park and Allen (2000), that the tryptic αs-casein phosphopeptides induced signifi cantly less IgG than the intact proteins or whole tryptic hydrolysates. They concluded that protein hydrolysis and subsequent purifi cation of phosphopeptides using ultrafi ltration might reduce the immune response.

Otani et al. (2000) observed that mice fed a caseinphosphopeptides added diet did not show enhanced IgG antibody level. Heddleson et al. (1997) also reported that specifi c antibody levels for the IgE in rats peritoneally injected with casein phosphopeptides rarely exceeded those of unimmunized rats, indicating that the allergenicity of casein phosphopeptides was inert when compared to native β-casein and skim milk proteins.

The present results suggest that the caseinophosphopeptides enriched products prepared from buffalo milk can be used in infant formulas and other functional foods to enhance mineral absorption and with reduced immunogenicity.

REFERENCES

Bellioni-Businco, B., R. Paganelli, P. Lucenti, P.G. Giampietro, H. Perborn and L. Businco. 1999. Allergenicity of goat’s milk in children with cow’s milk allergy. J. Allergy Clin. Immunol., 103(6): 1191-1194.

Bernard, H., C. Créminon, M. Yvon, J.M. Wal. 1998. Specifi city of the human IgE response to the different purifi ed caseins in allergy to cow milk proteins. Int. Arch. Allergy Immunol., 115: 235-244.

Boza, J.J., J. Jimenez, O. Martinez, D. Suarez and A. Gil. 1994. Nutritional value and antigenicity of two milk protein hydrolysates in rats and


157

Figure 1. Graphs showing the IgE antibody level in blood serum of the control mouse group and groups injected with ovaalbumin, Na caseinate and different CPPs preparations (TU, TC and NU) (The values expressed as means ± SEM for eight mice per group. The values with different small letters superscripts differ signifi cantly at 5% level of signifi cance (P≤ 0.05), CD= 18.7).

Figure 2. Graphs showing the IgE antibody level in blood serum of the control mouse group and groups injected with ovalbumin, Na caseinate and different CPPs preparations (TU, TC and NU) (The values expressed as means ± SEM for eight mice per group. The values with different small letters superscripts differ signifi cantly at 5% level of signifi cance (P≤ 0.05), CD= 23.34).


158

guinea pigs. J. Nutr., 124: 1978-1996. Cordle, C.T. 1994. Control of food allergies using

protein hydrolysates. Food Technol., 48: 72-76.

D’Auria, E., C. Agostoni and M. Giovannini. 2005. Proteomic evaluation of milk from different mammalian species as a substitute for breast milk. Acta Paediatr., 94(12): 1708-1713.

Docena, G.H., R. Fernandez, F.G. Chirdo and C.A. Fossati. 1996. Identifi cation of casein as the major allergenic and antigenic protein of cow milk. Allergy, 51: 412-416.

Heddleson, R.A., O. Park and J.C. Allen. 1997. Immunogencity of Casein phosphopeptides derived from tryptic hydrolysis of β-casein. J. Dairy Sci., 80: 1971-1976.

Jarvinen, K.M., P. Chatchatee, L. Bardina, K. Beyer and H.A. Sampson. 2001. IgE and IgG binding epitopes on alpha-lactalbumin and betalactoglobulin in cow milk allergy. Int. Arch. Allergy Immunol., 126: 111-118.

Katz, Y., M.R. Goldberg, G. Zadik-Mnuhin, M. Leshno and E. Heyman. 2008. Cross-sensitization between milk proteins: reactivity to a “kosher” epitope?. Isr. Med. Assoc. J., 10(1): 85-88.

Mahmoud, M.I., W.T. Malone and C.T. Cordle. 1992. Enzymatic hydrolysis of casein: Effect of degree of hydrolysis on antigenicity and physical properties. J. Food. Sci., 57: 1223-1229.

Nakamura, T., Y. Synukunobe, T. Sakurai and T. Idota. 1993. Enzymatic production of hypoallergenic peptides from casein. Milchwissenschaft, 48: 11-14.

Otani, H., X.Y. Dong and A. Hosono. 1990. Preparation of low-immunogenic peptide fragment from cow milk casein. Milchwissenschaft, 45: 217-220.

Otani, H. 1992. Milk products and immunogenicity.

In Nakazawa, Y. and A. Hosono (eds.) Functions of Fermented Milk. Elsevier Sci. Publ., New York, USA. 395.

Otani, H., Y. Kihara and M. Park. 2000. The immunoenhancing property of a dietary casein phosphopeptide preparation in mice. Food Agric. Immunol., 12: 165-173.

Park, O.J. and J.C. Allen. 2000. Antigencity of casein phosphopeptides prepared with immobilized glutamic acid-specifi c endopeptidase or trypsin. Nutr. Res., 20(3): 359-370.

Restani, P., B. Beretta, A. Fiocchi, C. Ballabio and C.L. Galli. 2002. Cross-reactivity between mammalian proteins. Ann. Allergy Asthma Immunol., 89(6): 11-15.

Saini, P. 2012. Production and Characterization of caseinophosphopeptides from buffalo casein. Ph.D. Thesis, NDRI, India.

Savilahti, E. and M. Kuitunen. 1992. Allergenicity of cow milk proteins. J. Pediatr., 121(5): S12.

Sheehan, W.J. and W. Phipatanakul. 2009. Tolerance to water buffalo milk in a child with cow milk allergy. Ann. Allergy Asthma Immunol., 102(4): 349.

Spuergin, P., M. Walter, E. Schiltz, K. Deichmann, J. Forster and H. Mueller. 1997. Allergenicity of alpha-caseins from cow, sheep, and goat. Allergy, 52(3): 293-298.

Takase, M., Y. Fukuwatari, K. Kawase, I. Kiyosawa, K. Ogasa, S. Suzuki and T. Kuroume. 1979. Antigenicity of casein enzymatic hydrolysate. J. Dairy Sci., 62: 1570-1576.

Wood, H.C. and T.G. Wreghitt. 1990. Techniques, p. 7-21. In Wreghitt, T.G. and P. Morgan-Capner (ed.) ELBA in the Clinical Microbiology Laboratory, Chapt 1. Public Health Laboratory Service: London.


159

ABSTRACT

During an outbreak of brucellosis in Chikhodra village of Gujarat, India, a study was performed to fi nd the seroprevalence of brucellosis in two farms in the affected area. All animals (104) were screened using the rose bengal plate agglutination test. Thirtyfour (32.69%) animals were found serologically positive for this test and positive samples were subjected to standard tube agglutination test for fi nding antibody titer against brucellosis. Twentyeight animals had titer >320 IU; titer values of 160 and 80 IU were present in two animals each. Hematological values were compared statistically between seropositive and a control group. It was found that there was a statistical reduction of leukocytes, platelets and mean corpuscular volume in affected animals compared to control animals.

Keywords: brucellosis, rose bengal plate agglutination test, standard tube agglutination test, hematology, seroprevalence

INTRODUCTION

Brucellosis is named after Sir David Bruce, who in 1886 isolated the causative agent from a soldier in Malta, where the disease caused

considerable morbidity and mortality among British military personnel. This disease occurs in cattle in most parts of the world. Brucellosis was fi rst recognized in India in 1942. It occurs in cows, buffaloes, sheep, goats, pigs, dogs, and humans. Economic losses due to this disease are considerable in an agrarian country such as India. Outbreaks occur in heifers; older cows become infected but do not abort. Etiological agent is a facultative intracellular organism, and persistent infection is a characteristic feature of this disease. Since it is a zoonotic disease, prevalence of this infection among cattle is dangerous to human beings also. The important aim of this study was to fi nd out the overall seroprevalence of brucellosis in two farms which were found positive for milk ring test.


This study was carried out during an outbreak of brucellosis (July 2010) at Chikhodra village in Anand district of Gujarat, India. Milk samples from two farms where this study was carried out were already proved positive for the milk ring test. Blood samples were collected from all animals in these farms. Serum was separated from those samples and was subjected to heat treatment to avoid nonspecifi c reactions (56oC for 30 minutes).

A REPORT OF A BRUCELLOSIS OUTBREAK FROM CENTRAL INDIA

Sunant K. Raval, Joice P. Joseph*, Aatur Shah, R.S. Joshi and B.B. Bhanderi

Department of Veterinary Medicine, College of Veterinary Science and Animal Husbandry, Anand Agricultural University, Anand-388 001, Gujarat, India, *E-mail: [email protected]

Review Article


160

Rose Bengal Plate Agglutination Test All the procedures were carried out as described by Morgan et al. (1978). Before performing the test, the antigen and sera were brought to room temperature. One drop of serum (30 μl) was putt on a glass slide using a micropipette. The antigen bottle was shaken well to ensure homogeneous suspension and one drop of antigen (30 μl) was added to the serum on the slide. The serum and antigen were then mixed quickly using separate spreader for each serum sample. The slide was held over a white surface and rocked gently from side to side for 4 to 5 minutes. Samples showing defi nite clumping were considered positive for brucellosis. In negative samples, the mixture remained homogenous without formation of any clumps.

Standard Tube Agglutination Test The standard tube agglutination test (STAT) was performed according to Alton et al. (1975). All sera samples were tested as fi ve dilutions. Five tubes were placed in a rack. Phenol saline 0.8 ml was taken in fi rst tube and 0.5 ml in all other tubes. Serum 0.2 ml was added in the fi rst tube and mixed well and 0.5 ml of diluted serum was transferred to the second tube and mixed thoroughly. Then, 0.5 ml from the second tube was transferred to the third tube. This process was continued up to the fi fth tube, and 0.5 ml was discarded from the last tube after mixing. To each tube Brucella abortus antigen 0.5 ml was added and was mixed thoroughly. This provided a fi nal dilution of 1:10, 1:20, 1:40, 1:80 and 1:160 etc. A control tube was set up to simulate 50 percent clearing by mixing 0.50 ml antigen with 1.50 ml of phenol saline in an agglutination tube. All the tubes were then incubated at 37oC for 20 h. Results were read after incubation. The reciprocal of the highest serum dilution showing 50 percent

or more agglutination (50 % clearing) was taken as the titer of the serum. The titer so obtained was converted into International Unit (I.U.) of Brucella antibody activity by multiplying with 2 as recommended by the joint FAO/WHO expert committee on Brucellosis.

Hematology Hematological parameters such as hemoglobin (Hb), total erythrocyte count (TEC), total leukocyte count (TLC), differential leukocyte count (DLC), packed cell volume (PCV), platelets count (PLT), mean corpuscular volume (MCV) and mean corpuscular hemoglobin concentration (MCHC) were measured from K3EDTA added blood samples using a Medonic CA 620 (Merck) blood auto analyzer.

Statistical analysis Hematological values were analyzed by standard statistical procedure described by Snedecor and Cochran (1992) and were expressed as mean (± SE).


Serological examinations Out of 104 serum samples tested using the rose bengal plate agglutination test (RBPT), thirtyfour were found positive. Those samples found positive for RBPT were subjected to STAT to fi nd the titer of antibody against Brucella infection in the affected animals. Results of STAT are as shown in Table 1. Antibody detection in paired serum samples is not recommended during an outbreak because of the length of time required to confi rm a diagnosis (Radostits et al., 2006). The rose bengal test is an


161

inexpensive as well as quick test. It is an excellent test for large-scale screening of serum samples for brucellosis. Even though it gives highly sensitive results, it is not a highly specifi c test. So positive results of RBPT has to be confi rmed using some other tests. In this study, positive results of RBPT were further confi rmed using STAT. All samples found positive by RBPT were confi rmed by STAT except one which was negative for this test. Combined results of RBPT and STAT are shown in Table 2.

Hematology The mean hematological values of infected and control group are as shown on Table 3. Mean corpuscular volume, platelet count and total leukocyte count of the infected group were signifi cantly decreased (P<0.05) compared to the control group. Figure1 depicts the percentage of animals suffering from different hematological conditions. Even though hematological studies of brucellosis in human are adequate in number, there are very few in cattle. Results of this study showed that mean corpuscular volume, platelet count and total leukocyte count of the infected group signifi cantly decreased (P<0.05) compared to control group. Similar observation has been reported in human brucellosis also (Crosby et al., 1984). Other nonsignifi cant conditions noted in the affected animals such as leukocytosis, anemia, lymphocytopenia and pancytopenia were also observed in human beings by many scientists (Crosby et al., 1984; Kadri et al., 2003). Lymphopenia has been recorded in Brucella infected camels also (El-Boshy et al., 2009). Multiple possible mechanisms are responsible for thrombocytopenia and leukocytopenia in brucellosis (Crosby et al., 1984).

Hemophagocytosis, disseminated intravascular coagulation, direct damage of bacteria to platelets, granulomatous lesions of the bone marrow, bone marrow suppression, hypersplenism, and immune-mediated damage are thought to be the major reasons for abnormal hematology. Krauss (2003) pointed hemophagocytic lymphohistiocytosis as the reason for leucopenia, thrombocytopenia and anemia. Increase and decrease of total leukocyte count in blood may depend on the stage of infection in animals. Pancytopenia in brucellosis is also multifactorial in origin and is attributed to hypersplenism and bone marrow involvement (Abdi-Liae et al., 2007). Marked pancytopenia or isolated defi cits can be attributed to diffuse intravascular coagulation, hemophagocytosis, or immunologically mediated cellular destruction (Pappas et al., 2005). Bacteremia occurring while brucellosis explains granulocytosis noted in some affected animals. In the later stages of the infection, lymph nodes may develop chronic granulomatous lymphadenitis, leading to lymphoid depletion (Radostits et al., 2006). This may result in lymphocytopenia in many of the affected animals. The herd characteristics and the results of the fi rst herd test may be used as predictors of the potential presence or absence of Brucella abortus in herds with reactors to the tube agglutination test. The presence of only single suspicious reactor on the fi rst test is a reliable predictor of lack of infection. The presence of one or more positive reactors on the fi rst herd test is a reliable predictor of the presence of infection. Presence of more seropositive animals indicates high prevalence of brucellosis in these two farms.


162

Table 1. Results of the standard tube agglutination test.

Titer (IU) No. of animals Interpretation of titer>320 28 Positive160 2 Positive80 2 Positive40 1 Doubtful20 1 Negative

Table 2. Combined results of the rose bengal plate agglutination test and the standard tube agglutination test.

Test Total Serologically Positive Doubtful Serologically

NegativePercentage of

Seroprevalence

RBPT 104 34 - - 32.69%STAT 34 32 1 1 30.77%

Table 3. Hematological values of infected and control animals.

Parameters Brucellosis positive animals Control animalsTEC (Millions / μl) 6.07 ± 0.31 6.10 ± 0.26MCV (cμ μ) 44.60 ± 0.85* 46.99 ± 0.75PLT (Thousand / μl) 115.76 ± 13.13* 128.82 ± 16.63TLC (Thousand / μl) 6.13 ± 0.70* 7.36 ± 0.72Hb (g%) 9.41 ± 0.50 9.78 ± 0.34MCH (μμg) 15.50 ± 0.25 16.15 ± 0.25MCHC (%) 34.81 ± 0.20 34.32 ± 0.20Lymphocyte (%) 43.73 ± 3.42 45.53 ± 5.11Mid cells (%) 11.50 ± 0.95 10.32 ± 0.92Granulocytes (%) 44.76 ± 3.53 43.56 ± 4.71

*P<0.05 Signifi cant parameter.


163

Figure 1. Percentage of animals suffering from different hematological conditions.

REFERENCES

Alton, G.G., L.M. Jones and D.E. Pietx. 1975. Laboratory Techniques in Brucellosis, 2nd

ed. FAO / WHO, Geneva.Abdi-Liae, Z., A. Soudbakhsh, S. Jafari, S. Emadi

and K. Tomaj. 2007. Haematological manifestations of brucellosis. Acta. Med. Iranica., 45: 145-148.

Crosby, E., L. Llosa, M.M. Quesada, C. Carrillo, and E. Gotuzzo. 1984. Hematologic changes in brucellosis. J. Infect. Dis., 150: 419-424.

El-Boshy, M., H. Abbas, S. El-Khodery and S. Osman. 2009. Cytokine response and clinicopathological fi ndings in Brucella infected camels (Camelus dromedarius). Veterinarni Medicina., 54: 25-32.

Kadri, S.M., M. Tanvir, N.D. Chowdhary, G. Hassan and B. Gaash. 2003. Case report-Pancytopenia in Brucellosis case investigated for pyrexia of unknown origin. JK-Practitioner., 10: 222-223.

Krauss, H. 2003. Zoonoses: Infectious Diseases Transmissible from Animals to Humans American Society for Microbiology Press, Washington. 186p.

Morgan, W.J.B., D.T. Mackinnon, K.P.W. Gill, S.G.M. Gower and P.I.W. Norris. 1978. Brucellosis Diagnosis: Standard Laboratory Techniques Report Series No. 1, Weybridge, England.

Pappas, G., N. Akritidis, M. Bosilkovski and E. Tsianos. 2005. Brucellosis. N. Engl. J. Med., 352: 2325-2336.

Radostits, O.M., C.C. Gay, K.W. Hinchcliff and P.D. Constable. 2006. Veterinary Medicine; A Textbook of the Diseases of Cattle, Horses, Sheep, Pigs and Goats, 10th ed. Saunders, Edinburgh. 963p.

Snedecor, G.W. and W.G. Cochran. 1985. Statistical Methods, 7th ed. The Iowa State University Press, Ames, Iowa, USA. 313p.


164

ABSTRACT

The present study was aimed to characterize the local fi eld bovine herpesvirus 1 (BHV1) by cloning and sequencing of the glycoprotein C (gC) gene segment of BHV1, amplifi ed by the polymerase chain reaction (PCR). The PCR product of 173 bp of a representative positive semen sample was cloned using the pTZ57R/T vector supplied with the InsT/Aclone™ PCR product cloning kit. The cloned white colonies were confi rmed by M13 PCR, which yielded an expected amplifi ed product of 327 bp. The cloned PCR product of the fi eld BHV1 gC gene was sequenced and then analysed by in silico analysis. The consensus sequence of 168 bp obtained was compared with the six published GenBank sequences, and it was found that the fi eld BHV1 from Gujarat showed a range of homology (89% to 92%) with maximum identity (92%) with the BHV1 of three European and one North American isolates. The sequence obtained showed deletions at two positions i.e. 40 and 70 nucleotides and point mutations at seven different positions (2, 61, 116, 134, 143, 151 and 155) as compared to the six published sequences. Such alterations in the sequence indicated frameshift mutations in the gC gene region, with the corresponding alteration in amino acid (aa) sequence.

Keywords: buffalo bull, Bubalus bubalis, semen, cloning, bovine herpesvirus 1, BHV1

INTRODUCTION

Bovine herpesvirus 1 (BHV1) is associated with a variety of clinical diseases, including infectious bovine rhinotracheitis, conjunctivitis, reproductive disorders, encephalitis, and generalized systemic infections. BHV1 is a member of the genus Varicellovirus in the sub-family Alphaherpesvirinae, which belongs to the family Herpesviridae. It is an enveloped virus having an icosahedral nucleocapsid consisting of 162 capsomeres. The BHV1 genome is a single linear double stranded DNA having a total size of 135-140 kilobase pairs (kbp) (Mayfi eld et al., 1983).

BHV1 can establish a latent infection like other alphaherpesviruses (Gibbs and Rweyemamu, 1977) in the nerve ganglia of infected but clinically normal animals after the primary infection despite the development of neutralizing antibody (Pastoret et al., 1979). This kind of infection persists for the whole lifespan of an infected animal and therefore, such animals should be regarded as virus carriers and as a potential source of infection. Latent

CLONING AND SEQUENCING OF GC GENE OF BOVINE HERPESVIRUS 1 (BHV1) FROM BUFFALO BULL SEMEN

Supriya Pal1 , Mayur K. Jhala1, Pranay Kumar1,* and Chaitanya G. Joshi2

1Department of Veterinary Microbiology, College of Veterinary Science and Animal Husbandry, Anand Agricultural University, Anand - 388001 (Gujarat), India, *E-mail: [email protected] of Animal Biotechnology, College of Veterinary Science and Animal Husbandry, Anand Agricultural University, Anand - 388001 (Gujarat), India

Original Article


165

infections are especially important in bulls, because these animals shed the virus in semen during both clinical and sub-clinical infections. Use of BHV1 infected bulls or their semen for AI can transfer the infection to the female population.

Schroeder and Moys recognized the IBR disease in the United States during the 1950s for the fi rst time. In India, the fi rst case of BHV1 infection was reported by Mehrotra et al. (1976) from cases of keratoconjunctivitis amongst crossbred calves at an organized cattle herd in Uttar Pradesh. Various workers have characterized BHV1 by sequencing the targeted genes. Sequencing provides an authentic tool to genetically characterize the target genes and the virus, thus providing valuable information on comparative variation among the viruses. The various glycoproteins present on the envelope of BHV1 play important role in the viral pathogenesis and the immunity. Some of these like gB and gD, are essential for viral replication while others are non-essential. BHV-1 codes for four non essential genes, viz. gC, gG, gI and gE (Kamiyoshi et al., 2008). Glycoprotein C (gC) has been found important for the attachment of the virus (Liang et al., 1991) and inducing neutralizing antibody response (Denis et al., 1994) in the host. It has been targeted earlier for various studies (Fitzpatrick et al., 1989; Brower et al., 2008; Anita et al. 2010; Lojkic et al., 2011). In the present study, the target gC gene was cloned and sequenced to characterize the Indian isolate of BHV1 from semen samples of breeding bulls.


Cloning of gC gene in pTZ57R vectorThe amplifi ed PCR product (173 bp),

using gC gene based primers described previously

by Engelenburg et al. (1993), from a representative buffalo bull semen samples (of the 20 samples found positive by PCR out of the 52 buffalo semen samples processed) of an AI centre was purifi ed using a Perfectprep® PCR cleanup kit (Eppendorf, Germany). The bulls kept on the AI centre had history of poor semen quality, and the females of the surrounding population had problem of repeat breeding and infertility. Purifi ed PCR product was ligated in pTZ57R vector using an InsT/Aclone™ cloning kit (MBI Fermentas) and the vector containing the insert was propagated in E.coli hosts (DH5-α). The vector carries an ampicillin resistance gene (bla) as selectable marker for transformed cells. Thirty-fi ve μl of 2% X-gal solution and eight μl of 20% IPTG solution were pipetted on to a pre-made 90-mm LB agar plates containing Ampicillin (50 μg/ml). The solutions were spread with the help of a sterile bent glass rod. The plates were incubated at 37°C until all the fl uid disappeared. Each of the individual colonies obtained following the transformation procedure were picked up and streaked in a regular pattern on the X-gal/IPTG plate. The plates were incubated at 37°C for 12-15 h. Growth on those sectors showing white colonies was selected for further screening and confi rmation of recombinant clones carrying the correct insert was done by M13 PCR using M13 primers. The amplifi ed PCR products were checked on 2% agarose gel, and clones which showed the amplifi cation of 327 bp DNA fragment were considered as positive clones carrying the desired insert of the gC gene. The recombinants obtained were selected and grown in large quantity for plasmid extraction using a Fastplasmid® Mini Kit (Eppendorf, Germany).

Sequencing of gC Gene SegmentThe concentration of the purifi ed gC gene


166

PCR product using plasmid DNA was determined and was subjected to automated DNA sequencing on an ABI PRISM® 310 Genetic Analyzer (Applied Biosystems, USA). Sequencing was carried out using a BigDye® Terminator v3.1 Cycle sequencing kit (Applied Biosystems, USA) following the manufacturer’s instructions. The sequences obtained in forward and reverse orientations were assembled by using BioEdit software. The consensus sequence of the gC gene obtained was aligned with known sequences of BHV1 available in GenBank using NCBI BLAST and CLUSTAL W (1.82) software. The PCR product used for sequencing was obtained directly from the fi eld virus (named as Raj/ibr/Guj) without isolating the virus in cell culture.


Cloning of gC gene of BHV1Cloning of the targeted gene has been

preferred prior to sequencing because cloning of the product facilitates sequencing allowing the use of primers in the vector, thus enabling us to determine the sequence of the whole insert without losing the sequence information of the initial stretch of the amplicon. Therefore, in this study, the PCR amplifi ed product from a representative sample was purifi ed and ligated to pTZ57R/T vector, having T overhang, supplied with the InsT/Aclone™ PCR product cloning kit. This vector has been reported to facilitate cloning of PCR product having A overhang (generated by Taq DNA polymerase). The ligated mixture was used to transform E. Coli (DH5-α) and the transformants were screened by blue white selection on X-gal/IPTG/LB agar plates containing ampicillin. After 12-15 h incubation, blue and white colonies were seen on the plates. All

the white colonies which might contain the insert were streaked on a fresh plate for further analysis. The white colonies were screened for the presence of correct the PCR product by colony PCR using M13 primers. Colony PCR revealed the expected 327 bp product in the transformed colonies.

A similar approach had also been adapted by Rai et al. (2002) for cloning the PCR product of 520 bp sequence of gC gene of BHV1 using plasmid vector. Fuchs et al. (1999) cloned the PCR products obtained with strain LA of BHV1 as the template into the plasmid vector pCRII using the TA cloning kit.

Sequencing of gC gene of BHV1The currated sequence obtained by using

forward and reverse primers were assembled using the BioEdit software programme and a consensus sequence of 168 bp was obtained. This consensus sequence was then further used for alignment with the published sequence of BHV1 in GenBank using NCBI BLAST and CLUSTAL W (1.82) software.

Fuchs et al. (1999) used a similar approach for sequencing the gC gene of strain LA of BHV1 isolated from blood. They cloned the strain LA DNA and used the purifi ed plasmid for DNA sequencing by automatic sequencing (model 377; Applied Biosystems, Weiterstadt, Germany) by using a dye terminator cycle sequencing kit (Applied Biosystems, Perkin-Elmer Corp., Weiterstadt, Germany). Sequence data were analyzed with the Wisconsin Package (version 9.1; Genetics Computer Group, Madison, Wis.) and BLAST.

Kholy and Abdelrahman (2006) directly sequenced the PCR amplicons of the Egyptian vaccinal Abu-Hammad strain of BHV1 gD gene in both directions with the same primers as those used to generate the PCR amplicons. Sequencing was carried out in an ABI PRISM system using


167

the dideoxy chain-termination method, which is based on the incorporation of fl uorescent-labelled dideoxynucleotide terminators. The nucleotide sequences were aligned using the Clustal W (1.82) program from the European Bioinformatics Institute as done in the present study.

Brower et al. (2008) targeted and sequenced gC gene for the detection of BHV-1 in the brain tissues (an atypical manifestation of BHV-1) of aborted fetuses and differentiate it from BHV-5, which has 85% homology with BHV-1 throughout genome. But, these two differ considerably in some regions, viz. the thymidine kinase, gC and gE genes.

Lojkic et al. (2011) detected the BHV-1 infection in three dairy herds by gC gene based PCR and analysed the sequence of the gC gene of one isolate from each farm. On phylogenetic analysis based on gC gene sequence, the isolates were clustered with BHV-1.1.

The DNA sequence (168 bp) of the amplifi ed gC region of BHV1 obtained in this study was deposited in GenBank under accession no. EU086706.

Sequence analysis The nucleic acid sequences obtained

were aligned with known sequences BHV1CGEN (Accesion no. AJ004801), BVH1LFT31 (Accession no. Z54206), HSBGPG3A (Accesion no. M27491), AY052397 (Accesion no. AY052397), AF135441 (Accesion no. AF135441) and BHV1GC (Accesion no. Z49223) of BHV1 published in GenBank. The sequence alignment of the fi eld BHV1 (named Raj/ibr/Guj) sample with the published sequences is presented in Figure 1.

Nucleotide (nt) sequence alignment of the gC region of the fi eld BHV1 and published sequences showed variable percentages of homology (89% to

92%) (Table 1). The three European BHV1 isolates (BHV1CGEN, BVHILFT31 and AF135441) and a North American isolate (HSBGPG3A) showed 92% homology with the fi eld BHV1 (Raj/ibr/Guj), which was the maximum level of similarity. Lesser homology of 90% and 89% was observed with AY052397 (a South American isolate) and BHV1GC (a European isolate).

In contrast to present study, Fuchs et al. (1999) found homology of 100% between the amplifi ed gC gene (LA strain) and the published sequence HSBGPG3A (accession no. M27491). Compared to the gC sequence of BHV1GC (accession no. Z49223), 10 base differences (leading to four different amino acids) accounted for 98.1% homology with the LA strain. Similarly, the homology was 89% due to 17 bp differences in the present study including deletions at two positions between the sequence obtained in the present study (Raj/ibr/Guj) and the BHV1GC (accession no. Z49223).

Comparison of the sequence of the amplifi ed gC region of the fi eld BHV1 with the published sequences showed deletions at 40 and 70 nucleotides, which indicate point deletion mutations at these places suggesting genetic variation in the gC gene of the fi eld BHV1 of Gujarat. Out of the seven sequences subjected under multiple alignment, fi ve sequences including the sequence (Raj/ibr/Guj) obtained in the present study [the other four being HSBGPG3A (Accesion no. M27491), AF135441 (Accesion no. AF135441), BHV1GC (Accesion no. Z49223) and AY052397 (Accesion no. AY052397)] revealed deletions from positions 90-93, 105-111 and 137-138. While these positions showed the properly aligned nucleotides in a conserved way among the two other sequences viz. BHV1CGEN (Accesion no. AJ004801) and BVH1LFT31 (Accession no. Z54206). Moreover,


168

the sequence obtained in the present study revealed point mutations at seven positions, i.e. at positions 2, 61, 116, 134, 143, 151 and 155, where A, C, C, C, G, T and C replaced G, A, A, G, C, G and A, which were found conserved in all the other six sequences. Such a situation of nt variations possibly indicates a frameshift mutation in the gene region, which can result in considerable amino acid (aa) variations.

The nt sequence obtained in the present study was translated into amino acid sequence by using Expasy software program. Out of three frames obtained, frame 1 was chosen for getting aa sequence as it yielded corresponding proper stretch of aa with proper alignment with the reference sequences, which was then further analyzed for alignment with the published aa sequences of BHV1 in GenBank using NCBI BLAST and CLUSTAL W (1.82) software.

The deduced aa sequence of the gC region of fi eld BHV1 was compared with the published aa sequences obtained from the same six sequences BHV1CGEN (Accesion no. AJ004801), BVH1LFT31 (Accession no. Z54206), HSBGPG3A (Accesion no. M27491), AF135441 (Accesion no. AF135441), AY052397 (Accesion no. AY052397) and BHV1GC (Accesion no. Z49223). The reference sequences BHV1CGEN, BVH1LFT31 and AF135441 of the European region and HSBGPG3A of the North American region scored the highest gC sequence identity (79%) with the aa sequence of the gC region of fi eld BHV1, followed by the European isolate BHV1GC (76%) and the South American isolate AY052397 (75%). The deduced aa sequence alignment with the published aa sequences is presented in Figure 2. In spite of high gC nt sequence identity (92%) between the fi eld BHV1 and reference BHV1CGEN, BVH1LFT31, HSBGPG3A and AF135441 sequences, a lower deduced aa homology (79%) was observed.

Similarly, lower aa homology percentages were recorded between the fi eld BHV1 and the other reference sequences studied. This could be attributed to the occurrence of possible frameshift mutations as discussed earlier. Both nt and deduced aa sequence alignments revealed variable degrees of sequence homology between the fi eld BHV1 and published sequences.

In a similar study carried out by Kholy and Abdelrahman (2006), frameshift mutations were observed at nt 509 and 615 of the Egyptian BHV1 gD gene. Both nt and aa sequence alignments revealed variable degrees of sequence similarity with other alphaherpesviruses. Thus, the genetic variations, in the fi eld BHV1, resulted due to possible frameshift mutations in the gC gene regions indicate antigenic differences between the Indian fi eld virus and BHV1strains from other parts of world.

ACKNOWLEDGEMNETS

The authors are thankful to Professor and head, Department of Animal Biotechnology, College of Veterinary Science and A.H, Anand, for providing necessary facilities to carry out the present work.

REFERENCES

Anita, D., A. Anita and G. Savuta. 2010. Detection of Bovine Herpesvirus Type 1 by PCR Assay. Bulletin UASVM, Veterinary Medicine 67(2): 23-27.

Brower, A., K.M. Homb, P. Bochsler, R. Porter, K. Woods, S. Ubl, D. Krueger, F. Cigel, and K. Toohey-Kurth. 2008. Encephalitis in aborted bovine fetuses associated with


169

Bovine herpesvirus 1 infection. J. Vet. Diagn. Invest., 20: 297-303.

Denis, M., J. Kaashoek, J.T. van Oirschot, P.P. Pastoret and E. Thiry. 1994. Quantitative assessment of the specifi c CD4+T lymphocyte proliferative response in bovine herpesvirus 1 immune cattle. Vet. Immunol. Immunopathol., 42: 275-286.

Engelenburg, F.A.C.V., R.K. Maes, J.T. van Oirschot and F.A.M. Rijsewijk. 1993. Development of a rapid and sensitive polymerase chain reaction assay for detection of bovine herpesvirus type 1 in bovine semen. J. Clin. Microbiol., 31: 3129-3135.

Fitzpatrick, D.R., T. Zamb, M.D. Parker, S. Hurk, L.A. Babiuk and M.J.P. Lawman. 1988. Expression of Bovine herpesvirus 1 glycoproteins gl and glll in transfected murine cells. J. Virol., 62: 4239-4248.

Fuchs, M., H. Peter, J. Detterer and J.R. Hanns. 1999. Detection of Bovine herpesvirus type 1 in blood from naturally infected cattle by using a sensitive PCR that discriminates between wild-type virus and virus lacking glycoprotein E. J. Clin. Microbiol., 37: 2498-2507.

Gibbs, E.P.J and M.M. Rweyemamu. 1977. Bovine herpesviruses. Part I. Commonwealth Bureau of Animal Health. Vet. Bull., 47: 317-343.

Kamiyoshi, T., K. Murakami, M. Konishi, Y. Izumi and H. Sentsui. 2008. The presence of a deletion sequence in the BHV-1 UL49 homolog in a live attenuated vaccine for infectious bovine rhinotracheitis (IBR). Vaccine., 26: 477-485.

Kholy, A.A. and K.A. Abdelrahman. 2006. Genetic characterization of the Egyptian vaccinal strain Abu-Hammad of bovine

herpesvirus-1. Rev. Sci. Tech. Off. Int. Epiz., 25: 1081-1095.

Liang, X. P., L. A. Babiuk, S. Hurk, D. R. Fitzpatrick and T.J. Zamb. 1991. Bovine herpesvirus 1 attachment to permissive cells is mediated by its major glycoproteins gI, gIII, and gIV. J. Virol., 65: 1124-1132.

Lojkic, I., Ž. Čac, T. Keros, T. Bedekovic, J. Balatinec and B. Roic. 2011. Phylogenetic analysis of bovine herpesvirus 1 isolated in Croatia. Vet. Arhiv., 81: 299-306.

Mayfi eld, J.E., P.I. Good, H.J. Vanoort, A.R. Campbell and D.E. Reed. 1983. Cloning and cleavage site mapping of DNA from bovine herpesvirus 1 (Cooper strain). J. Virol., 47: 259-264.

Mehrotra, M.L., B.S. Rajya and S. Kumar. 1976. Infectious bovine rhinotracheitis (IBR) keratoconjunctivities in calves. Indian J. Vet. Path., 1: 70-73.

Pastoret, P.P., P. Jelleur, A. Aguilar-Setien, P. Leroy, A. Schwers, M. Godart and F. Schoenaers. 1979. Effet de la dexamethasone sur le titre et la taille des plages du virus de la rhinotrachéite infectieuse bovine (Bovine herpesvirus 1, IBR). Ann. Med. Vet., 123: 397-402.

Rai, N., P. Kaushik, R.S. Kataria, A.K. Tiwari and A. Rai. 2002. Molecular cloning and restriction enzyme analysis of bovine herpesvirus-1 DNA fragment amplifi ed by polymerase chain reaction. Ind. J. Comp. Microbiol. Immunol. Infect. Dis., 23: 17-19.

Schroeder, R.J. and M.D. Moys. 1954. An acute upper respiratory infection of dairy cattle. J. Am. Vet. Med. Assoc., 125: 471-472.


170

ABSTRACT

A total of 200 buffaloes were utilized to study the temperament in Murrah buffaloes with various udder and teat shapes and its effect on the milk yield. Majority of the buffaloes with all udder shapes and with conical, pear-, cylindrical and funnel-shaped teats were with docile temperament. Slightly restless and restless temperaments were more frequent in buffaloes with bottle-shaped teats. However, there was no signifi cant variation in the frequencies of buffaloes with different temperament scores among various udder teat shape categories. There were no signifi cant differences among the temperament groups for various udder and teat measurements studied. The average milk yield in docile, slightly restless, restless, aggressive and nervous categories were 6.70 ± 0.15, 6.50 ± 0.34, 5.70 ± 0.26, 4.90 ± 0.30 and 4.60 ± 0.34 kg, respectively. It may be concluded that udder and teat morphology has no infl uence on the temperament but that temperament has an infl uence on milk yield and so buffaloes with docile temperament must be preferred for use in breeding programmes.

Keywords: temperament, udder shape, teat shape, Murrah buffaloes

INTRODUCTION

Temperament of buffaloes is important from the management point of view, and it also plays a role in infl uencing the milk yield. There were many studies on the temperament of cows but literature on temperament of buffaloes is very scant. Similarly, there are very few studies on the udder and teat morphology of buffaloes. Hence, the present study was taken up to understand the temperament of Murrah buffaloes in relation to udder and teat morphology and its effect on milk yield under rural conditions of India.


The study was carried out in the Krishna and West Godavari districts of Andhra Pradesh. A total of 200 Murrah buffaloes were utilized for the study.Description of Temperament Score

Subjective scoring was done on a 1-5 scale by the investigator through visual assessment of the animal’s reactivity during milking. Buffaloes were classifi ed into fi ve categories based on the

STUDIES ON THE TEMPERAMENT OF MURRAH BUFFALOES WITH VARIOUS UDDER AND TEAT SHAPES AND ITS EFFECT ON MILK YIELD

R.M.V. Prasad1 and P. Jaya Laxmi2

1Department of Livestock Production and Management, NTR College of Veterinary Science, Gannavaram A.P. - 521 102, India2Department of Animal Genetics and Breeding, NTR College of Veterinary Science, Gannavaram A.P.- 521 102, India, E-mail: [email protected]

Original Article


171

milking temperament as docile (1), slightly restless (2), restless (3), aggressive (4) and nervous (5), respectively as per Tulloh (1961) and (Dogra 2002). The particulars observed for recording the temperament score of Murrah buffaloes are presented in Table 1.

Statistical analysis Simple tabular technique of analysis using

statistical tools such as frequencies and percentages was used to present the prevalence of various temperaments and udder and teat shapes in Murrah buffaloes. The chi-square test of contingency was used to study if there is any signifi cant variation in the temperament of buffaloes according to the udder and teat shapes (that is to test if the frequency of animals with different temperament scores vary signifi cantly among the udder and teat shape categories).

To test the signifi cance of variation in milk yield among different temperament groups, analysis of variance with temperament as the source of variation was used (F- test). The means were compared for the signifi cant difference (P<0.05) using Duncan’s multiple range test. The data obtained on various udder and teat parameters and milk yield were analyzed using an SPSS statistical package (version 15.0.1).


Temperament in relation to udder and teat morphology

It was observed from the study that majority of the buffaloes with all udder shapes belonged to the docile category. The numbers of buffaloes in the nervous category were very few, indicating the attitude of the farmers and also the farm

manager preferring animals with calm behaviour. It was further observed through chi-square test of contingency that there was no signifi cant variation in the frequencies of animals with different temperament scores among different udder shape categories (Table 2).

Regarding the teat shape, majority of animals with conical-, pear-, cylindrical and funnel- shaped teats were of docile temperament. In the case of the bottle-shaped teat category, maximum percentage of buffaloes were in slightly restless and restless categories of temperament with no animals in the nervous group. However, the chi-square test of contingency revealed that there was no signifi cant variation in the frequencies of animals with different temperament scores among various teat shape categories (Table 3).

Thus, it may be understood that temperament is not infl uenced by udder and teat shapes of buffaloes.

Regarding the mean udder measurements, udder width was lowest in docile buffaloes (49.16 ± 0.43 cm) followed by those in the nervous, aggressive, slightly restless and restless categories. The udder length was also lowest in docile buffaloes followed by those in the nervous, aggressive, restless and slightly restless categories. The udder depth was lowest in slightly restless animals (15.45 ± 0.23 cm) followed by buffaloes in the docile, nervous, restless and aggressive categories (Table 5). The average teat length and diameter were lowest in slightly restless animals (Table 6). However, in view of the non-signifi cant differences among the temperament groups for the various udder and teat measurements studied, udder and teat dimensions did not appear to infl uence the temperament in Murrah buffaloes. Lack of literature on these aspects necessitates further studies in this regard to fi nd out if there is any relationship between the


172

Table 1. Particulars observed for recording the temperament score in Murrah buffaloes during milking.

Particulars Class ScoreVery quiet; never gives any trouble, extremely docile during milking and preparation, the “ideal” milker Docile 1

Stands quietly, not bothered by preparation or milking, but may move frequently, shifting weight from side to side, may fl ick tail occasionally, gives very little trouble.

Slightly restless 2

Generally quiet, but moves around a lot; may lift feet occasionally during preparation or milking, but does not kick, fl icks tail frequently or appears restless occasionally.

Restless 3

Appears very restless during preparation or milking; kicks at handler occasionally; steps from side to side a great deal; quivers when a hand is placed on her.

Aggressive 4

Appears very restless during preparation or milking , kicks the handler and struggles violently, occasionally, quivers when hand is placed over the back

Nervous 5

Table 2. Frequency and percentage of different temperament scores in Murrah buffaloes with different

udder shapes.

Udder ShapeTemperament ( Score)

Total Docile (1)

Slightly restless (2)

Restless(3)

Aggressive(4)

Nervous(5)

Bowl59

(48.36%)25

(20.49%)19

(15.57%)13

(10.65%)6

(4.91%)122

Globular26

(76.47%)1

(2.94)5

(14.70%)1

(2.94%)1

(2.94%)34

Goaty13

(72.22%)0

(0.00%)2

(11.11%)2

(11.11%)1

(5.55%)18

Pendulous9

(34.61%)6

(23.07%)5

(19.23%)3

(11.53%)3

(11.53%)26

overall107

(53.50%)32

(16.00%)31

(15.50%)19

(9.50%)11

(5.50%)200


173

Table 3. Frequency and percentage of different temperament scores in Murrah buffaloes with different teat shapes.

Teat shapeTEMPERAMENT (Score)

TotalDocile(1)

Slightly restless (2)

Restless(3)

Aggressive(4)

Nervous(5)

Conical 13(59.09)

3(13.63)

4(18.18)

1(4.54)

1(4.54) 22

Bottle 5(22.72)

8(36.36)

8(36.36)

1(4.54)

0(0.00) 22

Pear 24(60.00)

3(7.50)

5(12.50)

5(12.50)

3(7.50) 40

Cylindrical 55(57.29)

15(15.62)

11(11.45)

9(9.37)

6(6.25) 96

Funnel 10(50.00)

3(15.00)

3(15.00)

3(15.00)

1(5.00) 20

Total 107(53.50)

32(16.00)

31(15.50)

19(9.50)

11(5.50) 200

Table 4. Average daily milk yield (kg) in Murrah buffaloes with different temperaments.

Temperament Docile Slightly restless Restless Aggressive Nervous

Average daily milk yield*(Mean + S.E)

6.70+0.15a 6.50+0.34a 5.70+0.26b 4.90+0.30c 4.60+0.34d

N 107 32 31 19 11 * Means with similar superscripts do not differ signifi cantly.


174

Tabl

e 6.

Mea

n te

at d

imen

sion

s (cm

) in

Mur

rah

buffa

loes

with

diff

eren

t tem

pera

men

t sco

res.

Tem

pera

men

t sc

ore

Teat

Len

gth

Aver

age

teat

le

ngth

Teat

Dia

met

erAv

erag

e te

at

diam

eter

Lef

t for

eR

ight

fore

Lef

t hin

dR

ight

hin

dL

eft f

ore

Rig

ht fo

reL

eft h

ind

Rig

ht h

ind

Doc

ile7.

13 ±

0.1

77.

18 ±

0.1

87.

81 ±

0.2

07.

83 ±

0.1

97.

48 ±

0.1

82.

63 ±

0.0

32.

71 ±

0.0

32.

82 ±

0.0

42.

94 ±

0.0

42.

78 ±

0.3

2Sl

ight

ly

rest

less

6.74

± 0

.35

7.04

± 0

.41

7.70

± 0

.44

7.55

± 0

.42

7.26

± 0

.39

2.64

± 0

.07

2.65

± 0

.09

2.70

± 0

.09

2.76

± 0

.10

2.69

± 0

.08

Res

tless

8.18

± 0.

438.

60 ±

0.4

69.

38 ±

0.5

79.

05 ±

0.5

08.

81±

0.47

2.65

± 0

.73

2.71

± 0

.08

2.78

± 0

.09

2.87

± 0

.10

2.75

± 0

.08

Agg

ress

ive

8.00

± 0

.56

8.09

± 0

.54

9.16

± 0

.69

8.74

± 0

.55

8.50

± 0.

562.

76 ±

0.0

82.

83 ±

0.0

92.

90 ±

0.1

12.

99 ±

0.1

22.

87 ±

0.0

9N

ervo

us8.

33 ±

0.9

28.

34 ±

0.9

09.

03 ±

1.0

08.

90 ±

0.9

48.

65±

0.93

2.76

± 0

.12

2.71

± 0

.17

2.79

± 0

.15

2.79

± 0

.19

2.76

± 0

.14

Ove

r al

l7.

37 ±

0.1

57.

53 ±

0.1

68.

23 ±

0.1

88.

12 ±

0.1

77.

81±

0.16

2.65

± 0

.02

2.71

± 0

.03

2.80

± 0

.03

2.89

± 0

.04

2.76

± 0

.03

Tabl

e 5.

Mea

n ud

der d

imen

sion

s and

dis

tanc

e be

twee

n th

e te

ats (

cm) i

n M

urra

h bu

ffalo

es w

ith d

iffer

ent t

empe

ram

ent s

core

s.

Tem

pera

men

t sc

ore

n%

of

To

tal N

o.U

dder

wid

thU

dder

leng

thU

dder

dep

thD

ista

nce

betw

een

fron

t te

ats

Dis

tanc

e be

twee

n hi

nd

teat

s

Dis

tanc

e be

twee

n fr

ont

and

hind

teat

sD

ocile

107

53.5

49.1

6 ±0

.43

53.4

0 ±0

.47

15.5

2 ±0

.13

8.70

±0.

228.

69 ±

0.24

8.71

±0.

21Sl

ight

ly r

estle

ss32

16.0

52.0

6 ±0

.84

55.4

9 ±0

.65

15.4

5 ±0

.23

8.53

±0.

408.

21 ±

0.42

8.04

±0.

27R

estle

ss31

15.5

53.6

9 ±1

.02

55.0

9 ±0

.80

15.6

8 ±0

.25

8.49

±0.

438.

66 ±

0.49

9.24

±0.

37A

ggre

ssiv

e19

9.5

51.3

8 ±1

.16

54.5

6 ±1

.25

16.0

5 ±0

.27

8.96

±0.

549.

10 ±

0.56

10.0

6 ±0

.56

Ner

vous

115.

550

.80

±1.5

854

.45

±1.6

915

.60

±0.4

17.

84 ±

0.51

8.25

±0.

509.

33 ±

0.65

Ove

rall

200

100

50.6

3 ±0

.36

54.1

6 ±0

.33

15.5

9 ±0

.09

8.62

±0.

168.

62 ±

0.17

8.85

±0.

15


175

temperament and udder and teat morphology in buffaloes.

Temperament in relation to the average daily milk yield

The average daily milk yields in the docile, slight restless, restless, aggressive and nervous categories were 6.70 ± 0.15, 6.50 ± 0.34, 5.70 ± 0.26, 4.90 ± 0.30 and 4.60 ± 0.34 kg, respectively (Table 4). Thus, the docile and slightly restless buffaloes had signifi cantly higher daily milk yield when compared to the other categories. These fi ndings were in conformity with fi ndings of Mishra et al. (1975), Dash et al. (1976), Nayak and Mishra (1984), Gupta et al. (1985), Dogra et al. (2002), Bharadwaj et al. (2007) and Lallawmkimi and Mahendra Singh (2009).

The difference in the temperament of buffaloes observed could be because of the individual variability in an animal’s physical, hormonal and neuronal characteristics (Kilgour,1975). The descending order of milk yield from docile to slightly restless, restless, aggressive and nervous cows could be because of the fact that under optimum conditions of milking the docile ones did not hold up any milk, while the other categories held up milk due to secretion of adrenalin. Thus a negative correlation existed between the temperament score and the average daily milk yield which is in conformity with Nayak and Mishra (1984).

The temperament of animals is generally considered innate and is the result of the animal’s physical and nervous organization (Dickson, 1970) but is also affected by external factors (Gangwar, 1982). Thus proper handling and management are important for temperament and higher milk yield. Rushen et al. (1999) also stressed that proper care and handling by people responsible for the cows are

important to avoid fear in cows. It may therefore be understood that both genetic and managemental factors are important for the temperament of buffaloes.

It may be concluded from the study that temperament is not infl uenced by udder and teat morphology but that temperament has an infl uence on the milk yield of Murrah buffaloes and so animals with docile temperament must be preferred for use in breeding programmes.

REFERENCES

Bharadwaj, A., V.B. Dixit, R.K. Sethi and S. Khanna. 2007. Association of breed characteristics with milk production in Murrah buffaloes. Indian J. Anim. Sci., 77: 1011-1016.

Dash, P.C., S.B. Basu and K.N.S. Sharma. 1976. Effect of frequency of milking in Murrah buffaloes. Indian J. Dairy Sci., 29: 113-116.

Dickson, D.P., G.R. Barr, L.P. Johnson and D.A. Wieckert. 1970. Social dominance and temperament of Holstein cows. J. Dairy Sci., 53: 904-907.

Dogra, P.K., O.S. Parmar and S.C. Gupta. 2002. The effects of machine milking on Murrah buffaloes milking temperament. Buffalo Journal, 18: 109-115.

Gangwar, P.C. 1982. The effects of seasons on behaviour during milking in buffaloes (Bos bubalis). Int. J. Biometeorol., 26: 147-151.

Gupta, S.C., M.C. Handa and G. Sahoo.1985. Dairy temperament of buffaloes in relation to their milking ability. Indian Journal of Animal Production Management, 1: 116-119.

Kilgour, R. 1975. Open-fi eld test as an assessment of temperament in dairy cows. Anim. Behav.,


176

23: 615 - 624. Lallawmkimi, M.C. and Mahendra Singh 2009.

Milking behaviour of Murrah buffaloes during hand and machine milking. Indian Vet. J., 86: 171-173.

Mishra, R.R., R.S. Chauhan and S.C. Gupta. 1975. Studies of dairy temperament of Karan Swiss cows. Indian J. Dairy Sci., 28: 85-88.

Nayak, S. and M. Mishra. 1984. Dairy temperament of Red-Sindhi, Crossbred cows and Murrah buffaloes in relation to their milking ability and composition. Indian J. Dairy Sci., 37: 20-23.

Rushen, J., A.M.B. De Passille and I. Munksgaard. 1999. Fear of people by cows and effects on milk yield, behaviour, and heart rate at milking. J. Dairy Sci., 82: 720-727.

Tulloh, N.M. 1961. Behaviour of cattle in yards. II. A study of temperament. Anim. Behav., 9(1-2): 25-30.


177

ABSTRACT

Disposition kinetics and urinary excretion of levofl oxacin was investigated after a single intravenous dose of 3 mg.kg-1 in male buffalo calves. The drug concentration was estimated in plasma and urine by microbiological assay using E. coli as the test organism. Disposition kinetic parameters were determined using a two-compartment open model and an appropriate dosage schedule was computed. Drug levels above MIC in plasma were detected up to 10 h. Levofl oxacin was rapidly distributed from blood to the tissue compartment as evidenced by high values of the distribution rate constant (7.46 ± 0.28 h-1) and the micro rate constant of transfer of drug from the central to the peripheral compartment (4.88 ± 0.21 h-1). The elimination half-life, AUC and volume of distribution were 2.56 ± 0.09 h, 10.5 ± 0.11 μg.h.ml-1 and 1.08 ± 0.05 L.kg-1, respectively. Approximately 25% of the microbiological activity of the administered levofl oxacin was recovered in the urine of calves within 24 h. On the basis of disposition kinetic parameters, an appropriate intravenous dosage regimen for levofl oxacin in buffalo calves would be 3.0 mg.kg-1 to be repeated at 12 h intervals. The observations on urinary excretion indicated that levofl oxacin may be effective against urinary tract infections in buffalo species.

Keywords: buffalo calves, dosage, levofl oxacin, disposition, urinary excretion

INTRODUCTION

Fluoroquinolone antibacterials are being increasingly employed in veterinary medicine for the treatment of mild to severe bacterial infections. Levofl oxacin, a second generation fl uoroquinolone, is very effective in the treatment of infections of upper and lower respiratory tract, genitourinary system, skin and soft tissue and possesses excellent activity against gram-positive, gram-negative and anaerobic bacteria. The pharmacokinetics of levofl oxacin has been investigated in man (Chulavatnatol et al., 1999), rabbits (Destache et al., 2001) and calves (Dumka and Srivastava, 2007; Dumka et al., 2008). However, there is meager information available on the pharmacokinetics of levofl oxacin in buffalo species barring two studies after extravascular administration (Ram et al., 2008, 2010).

In view of the marked species variation in the kinetic data of antimicrobial drugs, the present study was undertaken to determine the pharmacokinetics, urinary excretion and an appropriate dosage regimen of levofl oxacin in buffalo calves following its single intravenous administration.

PLASMA DISPOSITION AND URINARY EXCRETION OF LEVOFLOXACIN FOLLOWING A SINGLE INTRAVENOUS ADMINISTRATION

IN BUFFALO CALVES

Data Ram and Vinod Kumar Dumka*

Department of Pharmacology and Toxicology, College of Veterinary Science, Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana-141 004, India, *E-mail: [email protected]

Original Article


178


The study was conducted on six healthy male buffalo calves of non-descript breed, ranging between 1-1.5 years of age and weighing 82-148 kg. The animals were kept in an animal shed under standard conditions and had access to green fodder and water ad libitum. The experimental protocol followed ethical guidelines on the proper care and use of animals and was approved by the institutional animal ethics committee. Levofl oxacin was administered at the dose of 3 mg.kg-1 body weight into the left jugular vein.

For the disposition study, the animals were kept in metabolic stalls of standard size designed in such a way that whole amount of urine excreted naturally by the animals within a period is automatically collected without contamination or spillage in the containers placed beneath the stalls. Blood samples (5 ml) were withdrawn from the contralateral jugular vein into heparinized glass centrifuge tubes before and at 1, 2.5, 5, 10, 15, 30 minutes and 1, 2, 4, 6, 8, 10, 12, 16 and 24 h after administration of the drug. Plasma was separated by centrifugation at 1300 g. Urine samples were also collected simultaneously from the same animals at time intervals of 2, 4, 6, 8, 10, 12, 16 and 24 h after administration of the drug. The volume of total urine voided and collected in the container was measured for each animal, and after fi ltration, 10 ml samples were taken for analysis.

The concentration of levofl oxacin in plasma and urine samples was estimated by a microbiological assay technique using Escherichia coli (ATCC 10536) as the test organism. This method estimated the level of drug and its active metabolites having antibacterial activity. The assay could detect a minimum of 0.1 μg.ml-1 of levofl oxacin (Figure 1). Disposition parameters

were calculated manually by regression analysis.


Evaluation of the results revealed that the disposition pattern of levofl oxacin best fi tted a two-compartment open model (Figure 1). Consistent to our fi ndings, the disposition curve of levofl oxacin in calves (Dumka and Srivastava, 2007) and other fl uoroquinolones, danofl oxacin in buffalo calves and ofl oxacin in calves, followed a two-compartment open model after intravenous administration (Gaur et al., 2004; Gosal et al., 2008).

The disposition parameters of levofl oxacin in buffalo calves are presented in Table 1. Levofl oxacin was rapidly transferred from the central to the peripheral compartment in buffalo calves, as is evident from the short t1/2α and high value of K12. In support of the present fi ndings, a short t1/2α of 0.059 h and high value of K12 (7.43 h-1)

has been reported after intravenous administration of levofl oxacin in calves (Dumka and Srivastava, 2007). The high value of P/C ratio (4.58 ± 0.2) and apparent volume of distribution further suggested extensive drug distribution. High values of P/C ratio have also been reported for gatifl oxacin (10.1) and danofl oxacin (3.06) in buffalo calves and ofl oxacin in calves (4.12) following their intravenous administration (Gaur et al., 2004; Gosal et al., 2008; Raipuria et al., 2007 ). The large Vdarea established in this study (1.08 ± 0.05 L.kg-1) is in agreement with the fi nding in cross bred calves (1.38 L.kg-1) and man (0.94 L.kg-1) following intravenous injection of levofl oxacin (Langtry and Lamb 1998; Dumka et al., 2008). Further, large volume of distribution of another fl uoroquinolone used in veterinary medicine, danofl oxacin was reported to be 1.42 L.kg-1 in goats and 4.35 L.kg-1


179

Table 1. Disposition parameters of levofl oxacin in buffalo calves following a single intravenous administration (n=6).

Parameter Unit Mean ± SECp0 μg.ml-1 15.9 ±0.44A μg.ml-1 13.5 ± 0.39B μg.ml-1 2.29 ± 0.09α h-1 7.46 ± 0.28β h 0.272 ± 0.009

t1/2α h 0.093 ± 0.003t1/2β h 2.56 ± 0.09K12 h-1 4.88 ± 0.21K21 h-1 1.35 ± 0.07

AUC μg.h.ml-1 10.5 ± 0.11Vdarea L.kg-1 1.08 ± 0.05ClB ml.kg-1h-1 286.6 ± 2.74Kel h-1 1.51 ± 0.03

MRT h 3.07 ± 0.09td h 12.6 ± 0.41

P/C ratio 4.58 ± 0.2

α and A = distribution rate constant from central to peripheral compartment and the zero time intercept of distribution phase, respectively; AUC = area under the plasma-concentration time curve; B and β = zero time intercept of the elimination phase and elimination rate constant, respectively; ClB = total body clearance of drug; Cp0 = plasma drug concentration at time zero after intravenous dose; K12 and K21 = micro rate constants of drug transfer from central to peripheral and from peripheral to central compartment, respectively; Kel = rate constant for elimination of drug from central compartment; MRT = mean residence time; P/C = ratio of drug present in peripheral to central compartment; t1/2α = distribution half life; t1/2β = elimination half life; td = duration of therapeutic effect; Vd(area) = apparent volume of distribution.


180

0.1

1

10

100

0 2 4 6 8 10 12

Time (h)

Mea

n pl

asm

a le

voflo

xaci

n co

nc. (μg

/ml)

= 7.46

B = 2.29

A = 13.5

β=0.272

0

5

10

15

20

25

0 0.1 0.2 0.3 0.4 0.5 0.6

Levofloxacin concentration (μg/ml)

Zone

of i

nhib

ition

(mm

)

Figure 1. Standard curve of levofl oxacin in plasma of buffalo calves. Each point represents the mean of the results from 14 assays.

Figure 2. Semilogarithmic plot of plasma concentration-time profi le of levofl oxacin following its single intravenous injection of 3 mg.kg-1 body weight in buffalo calves.


181

0

20

40

60

80

100

120

140

160

0-2 2-4 4-6 6-8 8-10 10-12 12-16 16-24

Time (h)

Cum

ulat

ive

% o

f Tot

al D

ose

0

5

10

15

20

25

30

Urin

e C

onc.

(μg/

ml)

Cumulative % of Total Dose Urine conc. (μg/ml)

Figure 3. Urinary recovery of levofl oxacin in buffalo calves following its single intravenous dose of 3 mg.kg-1 body weight.

in buffalo calves after intravenous administration (Atef et al., 2001; Sappal et al., 2009). The high value of AUC (10.5 ± 0.11 μg.h-1ml) was in agreement with the AUC of levofl oxacin reported in man (55.3 μg.h-1ml), rabbits (29.7±6.3 μg.h-1ml) and calves (12.7 μg.h-1ml) [2, 4, 5]. High values of AUC after iv administration have also been reported for other fl uoroquinolones as 26.55 μg.h-

1ml for ofl oxacin in calves (Gaur et al. 2004), 17.1 μg.h-1ml for gatifl oxacin in buffalo calves (Raipuria et al., 2007) and 29.6 μg.h-1ml for danofl oxacin in goats (Atef et al., 2001).

The total body clearance of levofl oxacin in the present study was 286.6 ± 2.74 ml.kg-1h-1. This fi nding is in agreement with the values of ClB

reported for levofl oxacin (317.2 ml.kg-1h-1) and ofl oxacin (189.9 ml.kg-1h-1) after iv administration in calves (Gaur et al., 2004; Dumka and Srivastava, 2007). The elimination half-life of levofl oxacin in buffalo calves calculated in this study (2.56 ± 0.09 h) was longer than its corresponding value of 1.61

h in cross bred calves (Dumka and Srivastava, 2007); however, it was shorter than the t1/2β of 10.4 h reported for gatifl oxacin in buffalo calves (Raipuria et al., 2007), 4.01 h, 4.24 h and 5.37 h for danofl oxain in goats, buffalo calves and camels, respectively (Atef et al., 2001; Aliabadi et al., 2003; Sappal et al., 2009) and 26.27 h for ofl oxacin in calves (Gaur et al., 2004).

The concentration of levofl oxacin-equivalent inhibitory units in the urine of buffalo calves was very high in this study. High urinary concentrations of danofl oxacin (2.37 μg.ml-1) and gatifl oxacin (2.6 μg.ml-1) have also been reported 24 h post intravenous dosing in buffalo calves (Raipuria et al., 2007; Sappal et al., 2009). Approximately 25% of the microbiological activity of the administered levofl oxacin was recovered in the urine of buffalo calves within 24 h. This fi nding was less than the urinary recovery of 38.4% of the total dose of levofl oxacin in cross bred calves (Dumka et al., 2008) but more than 19.7% of


182

gatifl oxacin (Raipuria et al., 2007) and 4.53% of danofl oxacin (Gosal et al., 2008) in buffalo calves within the fi rst 24 h of intravenous administration.

The results indicated that levofl oxacin may be effective against urinary tract infections in buffalo species. Under fi eld conditions, for most bacteria sensitive to levofl oxacin, an appropriate intravenous dosage regimen for levofl oxacin, would be 3 mg.kg-1 repeated at 12 h intervals for the treatment of infections caused by levofl oxacin susceptible bacteria in buffalo calves (Table 2).

REFERENCES Aliabadi, F.S., B.H. Ali, B.F. Landoni and P.

Lees. 2003. Pharmacokinetics and PK-PD modeling of danofl oxacin on camel serum and tissue cage fl uids. Vet. J., 165: 98-100.

Atef, M., A.Y. El-Gendi, Aziza, M.M. Amer and A.M. El-Aty. 2001. Some pharmacokinetic data for danofl oxacin in healthy goats. Vet. Res. Commun., 25: 367-377.

Chulavatnatol, S., B. Chindavijak, A. Vibhagool, W. Wananukul, C. Sriapha and C. Sirisangtragul. 1999. Pharmacokinetics of levofl oxacin in healthy Thai male volunteers. J. Med. Assoc. Thai., 82: 1127-1135.

Destache, C.J., C.B. Pakiz, C. Larsen, H. Owens and A.K. Dash. 2001. Cerebrospinal fl uid penetration and pharmacokinetics of levofl oxacin in an experimental rabbit meningitis model. J. Antimicrob. Chemother., 47: 611-615.

Dumka, V.K. and A.K. Srivastava. 2007. Disposition kinetics, urinary excretion and dosage regimen of levofl oxacin formulation following single intravenous administration in cross bred calves. Vet. Res. Commun., 31:

873-879. Dumka, V.K., H. Singh and A.K. Srivastava. 2008.

Disposition kinetics and urinary excretion of levofl oxacin on concomitant administration with meloxicam in cross bred calves. Environ. Toxicol. Pharmacol., 26: 56-60.

Gaur, A., S.P.S. Saini, S.K. Garg, R.K. Chaudhary and A.K. Srivastava. 2004. Pharmacokinetics of ofl oxacin after a single intravenous bolus dose in neonatal calves. J. Vet. Pharmacol. Ther., 27: 115-117.

Gosal, N.S., S. Rampal, S. Goyal and R.K. Chaudhary. 2008. Modifi cation of the pharmacokinetics and dosage of danofl oxacin by endotoxin-induced fever in buffalo calves. Indian J. Anim. Sci., 78: 727-730.

Langtry, H.D. and H.M. Lamb. 1998. Levofl oxacin. Its use in infections of the respiratory tract, skin, soft tissues and urinary tract. Drugs, 56: 487-515.

Raipuria, M., V.K. Dumka and H.S. Sandhu. 2007. Plasma concentrations, pharmacokinetics and urinary excretion of gatifl oxacin after single intravenous injection in buffalo calves. Vet. Res. Commun., 31: 3343-3347.

Ram, D., V.K. Dumka, H.S. Sandhu and M. Raipuria. 2010. Pharmacokinetics and dosage regimen of levofl oxacin in buffalo calves after single subcutaneous administration Vet. Arhiv., 80: 195-203.

Ram, D., V.K. Dumka, S.K. Sharma and H.S. Sandhu. 2008. Intramuscular pharmacokinetics, dosage regimen and in vitro plasma protein binding of levofl oxacin in buffalo calves. Iranian J. Vet. Res., 9: 121-126.

Sappal, R., R.K. Chaudhary, H.S. Sandhu and P.K. Sidhu. 2009. Pharmacokinetics, urinary excretion and plasma protein binding


183

of danofl oxacin following intravenous administration in buffalo calves (Bubalus bubalis). Vet. Res. Commun., 33: 659-667.


184

ABSTRACT

The present study was conducted on forty lactating Nili-Ravi buffaloes to compare the reproductive performance by treating with GnRH and PGF2α for synchronization of estrus, ovulation and pregnancy per artifi cial insemination with or without supplemental estradiol. All buffaloes received 25 mg PGF2α at 51 days in milk (DIM) for pre-synchronization of estrus cycles. After 13 days of PGF2α injection, buffaloes were given one of four treatments; Group A (n=10) were given an intramuscular injection of 100 μg of GnRH followed by an injection of PGF2α 7 days later and a fi nal injection of GnRH at timed artifi cial insemination (AI) 48 h after the PGF2α injection. Group B (n=10) were given the same treatment as that given to Group A buffaloes but with an injection of 1 mg of estradiol 24 h after the PGF2α injection. Group C (n=10) were given an intramuscular injection of 100 μg of GnRH followed by an injection of PGF2α 7 days later and a fi nal injection of GnRH at timed artifi cial insemination (AI) 72 h after the PGF2α injection. Group D (n=10) were given the same treatment as that given to Group C buffaloes but with an injection of 1 mg of estradiol 24 h after the PGF2α injection. Blood samples (10 ml) were collected from all buffaloes 7 days before and

again at the fi rst GnRH of the BuffSynch protocols, at 48 and 72 h after the PGF2α injection of the BuffSynch and at 7 days after the fi nal GnRH of synchronization protocols. Estrus was observed in 65% (13/20) of the buffaloes after the BuffSynch72 (Groups C and D) compared with 45% (09/20) buffaloes in the BuffSynch48 (Groups Aand B). Of the buffaloes which were treated with estradiol, 70% (14/20) displayed estrus as compared to 40% (08/20) of the buffaloes which were not treated with estradiol. Irrespective of treatments, a preponderance of buffaloes observed in estrus was identifi ed 72 h after injection of PGF2α. It is obvious that estrus expression increased after estradiol treatment however merely at 72 h or 48 h after estradiol injection. Among different treatment groups, pregnancy per AI at 40 and 68 days after artifi cial insemination did not differ. At 40 days after artifi cial insemination, pregnancy per AI rates were 45.0% for BuffSynch48 (Groups A and B) and BuffSynch72 (Groups C and D), whereas 45.0% for buffaloes with (Groups B and D) or without (Groups A and C) receiving estradiol treatment. It was concluded that lactating buffaloes exposed to presynchronized timed artifi cial insemination program with variable interval of proestrus before GnRH, in which artifi cial insemination was done at the time of fi nal GnRH injection, practiced

EFFECT OF TREATMENT WITH OR WITHOUT ESTRADIOL AFTER OVSYNCH PROTOCOLS AT TIMED AI ON THE PREGNANCY RATE IN LACTATING BUFFALOES

M.S. Akhtar1, S. Ullah2, L.A. Lodhi3, Z.I. Qureshi3 and I. Ahmad3

Original Article

1Faculty of Veterinary Sciences, Bahauddin Zakariya University, Multan, Pakistan, E-mail: [email protected] of Animal Sciences, Allama Iqbal Open University, Islamabad, Pakistan 3Faculty of Veterinary Sciences, University of Agriculture, Faisalabad, Pakistan


185

analogous pregnancy per artifi cial insemination. It is important that prolonging the period of proestrus and treating buffaloes with estradiol show estrus mainly at 72 h after PGF2α but did not increase fertility.

Keywords: buffalo, synchronization, GnRH, estradiol

INTRODUCTION

The reproductive effi ciency of farm animals, which denotes the maximum effective use of their reproductive capacity, is of considerable practical and economic signifi cance to farmers. Buffalo reproduction is an important issue, which has been the focus of many studies. Reproductive management of buffaloes has always been a challenge. Silent estrus is perhaps the most important factor leading to poor reproductive effi ciency in buffaloes (Kanai and Shimizu, 1983). As the signs of estrus in buffaloes are less obvious than in cattle, the estrus detection accuracy is one of the major problems limiting the use of artifi cial insemination (AI) in this species.

Various estrus synchronization protocols have been tried among many other reproductive technologies for improving the fertility of buffaloes. A novel synchronization protocol named Ovsynch was developed in cows; this requires a three-injection schedule (GnRH-PGF2α-GnRH) for synchronization of ovulation. The technique was successfully carried out in cycling buffaloes (Paul and Prakash, 2005) for synchronization of ovulation and fi xed timed artifi cial insemination (AI). Ovsynch is a timed artifi cial insemination (AI) program that reduces days open and increases pregnancy rates by allowing for control of fi rst

and subsequent inseminations. It has now been a trend to administer GnRH and/ or PGF2α in early postpartum cows and buffaloes in order to hasten early resumption of cyclic ovarian activity and thereby to increase the reproductive effi ciency. The gonadotropin releasing hormone (GnRH) and prostaglandin (PGF2α) method of estrous synchronization has proven to be very successful in synchronizing estrus in cattle and buffaloes. Studies by Pursley et al. (1995) verifi ed that, administration of GnRH after PGF2α injection increases the rate of synchronized ovulation in cattle. It has been observed that when PGF2α is administered on palpation of functional carpus leutum, about 60-70% of treated animals, were detected in estrus within 4 days post PGF2α injection.

Synchronization of ovulation with 1 mg of estradiol cypionate increased pregnancy per artifi cial insemination (AI) compared with artifi cial insemination (AI) after a synchronized estrus (Cerri et al., 2004). It is practical to suggest that methods that increase estradiol concentrations and expression of estrus in timed artifi cial insemination (AI) protocols might improve fertility of dairy cows. This may be particularly important for the high-producing dairy cow, which seems to lack suffi cient blood concentrations of estradiol to induce estrus, ovulation, and uterine priming because of inherently high metabolism and clearance of steroid hormones. No such studies have been undertaken in buffalo.

It is hypothesized that extending the period of proestrus and delaying the time of artifi cial insemination (AI) from 48 to 72 h after induced luteolysis would increase plasma concentrations of estradiol, expression of estrus, and fertility of buffalo. It is also hypothesized that supplemental estradiol would further enhance these responses, primarily in buffaloes receiving timed artifi cial


186

insemination (AI) at 48 h after induced luteolysis. The present study was therefore conducted to compare the reproductive performance of lactating Nili-Ravi buffalos treated with GnRH and PGF2α for synchronization of estrus, ovulation and pregnancy per artifi cial insemination with or without supplemental estradiol.


The study was carried out on lactating Nili-Ravi buffaloes at the Buffalo Research Institute, Pattoki, District Kasur. Forty Nili-Ravi buffaloes of above 50 days post-partum were divided into four (n=10) groups (A, B, C, D). All buffaloes received 25 mg PGF2α at 51 days in milk (DIM) for pre-synchronization of estrus cycles. Thirteen days after the PGF2α injection, buffaloes were given one of four treatments;

BuffSynch48Group A (n=10) were given an intramuscular injection of 100 μg of GnRH followed by an injection of PGF2α 7 days later and a fi nal injection of GnRH at timed artifi cial insemination (AI) 48 h after the PGF2α injection.Group B (n=10) were given the same treatment as that given to Group A buffaloes but with an injection of 1 mg of estradiol 24 h after the PGF2α injection.

BuffSynch72Group C (n=10) were given an intramuscular injection of 100 μg of GnRH followed by an injection of PGF2α 7 days later and a fi nal injection of GnRH at timed artifi cial insemination (AI) 72 h after the PGF2α injection.Group D (n=10) were given the same treatment

as that given to Group C buffaloes but with an injection of 1 mg of estradiol 24 h after the PGF2α injection.

A buffalo which stood to be mounted by a penile deviated bull was considered to be in estrus. The artifi cial insemination (AI) was done once in the morning after the PGF2α injection

Blood Sampling for Progesterone AnalysisBlood samples (10 ml) were collected

from all buffaloes 7 days before and again at the fi rst GnRH of the BuffSynch protocols, at 48 and 72 h after the PGF2α injection of the BuffSynch and at 7 days after the fi nal GnRH of synchronization protocols, respectively. Blood samples were collected at 48 and 72 h after the PGF2α injection of the BuffSynch protocols (Group A, B, C, D), which corresponded to 24 and 48 h after treatment with estradiol, respectively. Samples were immediately transported to the laboratory within 1 h of collection. Progesterone was determined through ELISA by using a commercially available kit (BioCheck, Inc, Lot. RN-34859).

Pregnancy DiagnosisAll buffaloes were examined for pregnancy

by rectal palpation of the uterus and its contents for detection of an embryonic vesicle at 40 ± 1 day after artifi cial insemination (AI), and pregnant buffaloes were reexamined 4 week later at 68 ± 1 days. Pregnancy per artifi cial insemination (AI) is defi ned as the number of pregnant buffaloes divided by the number of inseminated buffaloes within each treatment at 40 and 68 days after artifi cial insemination (AI).

Statistical analysisThe data thus obtained were analyzed

statistically by using the Z-test. (Steel and Torrie,


187

1980).

RESULTS

By postponing the time of artifi cial insemination from 48 to 72 h, the estrus expression increased. Similarly by treating buffaloes with estradiol increased the estrus expression. Estrus was observed in 65% (13/20) of the buffaloes after the BuffSynch72 (Groups C and D) compared with 45% (09/20) the buffaloes in the BuffSynch48 (Groups A and B). Of the buffaloes which were treated with estradiol, 70% (14/20) displayed estrus as compared to 40% (08/20) of those which were not treated with estradiol. Irrespective of treatment, a preponderance of the buffaloes observed in estrus was identifi ed 72 h after injection of PGF2α. It is obvious that estrus expression increased after estradiol treatment however merely at 72 h or 48 h after estradiol injection. Short-cycling buffaloes were not affected by BuffSynch or estradiol treatment (Table 1). Among different treatment

groups, pregnancy per AI at 40 and 68 days after artifi cial insemination did not differ. At 40 days after artifi cial insemination, pregnancy per AI rates were 45.0% for BuffSynch48 (Groups A and B) and BuffSynch72 (Groups C and D), whereas pregnancy per AI rates were 45.0% for buffaloes receiving (Groups B and D) or not receiving (Groups A and C) estradiol treatment (Table 1). Between 40 and 68 days of gestation, none of the buffaloes lost pregnancy.

DISCUSSION

Scheduled artifi cial insemination programs are commonly used aimed at reproductive management of dairy cattle to confi rm insemination of suitable cows (Caraviello et al., 2006). In lactating dairy cows, Pursley et al. (1998) evaluated the effect of the interval between GnRH and the time of artifi cial insemination. The pregnancy rate per artifi cial insemination was decreased in cows

Table 1. Effect of BuffSynch and estradiol treatment on reproductive responses of Nili-Ravi buffaloes.

Items Group A Group B Group C Group DCyclic 80.0 (8/10) 70.0 (7/10) 70.0 (7/10) 70.0 (7/10)

Detected estrusa 30.0 (3/10) 60.0 (6/10) 50.0 (5/10) 80.0 (8/10)Short-cycling 5.8 (14/240) 6.6 (16/243) 3.3 (8/245) 5.4 (13/239)

Pregnancy per AI(day 40) 40.0 (4/10) 50.0 (5/10) 50.0 (5/10) 40.0 (4/10)

Pregnancy per AI(day 68) 40.0 (4/10) 50.0 (5/10) 50.0 (5/10) 50.0 (5/10)

AI interval(days) 25.6±1.1 25.2±1.1 27.0±1.1 27.0±1.0

aBuffaloes were classifi ed as cyclic when progesterone concentration in plasma was ≥1 ng/ml in at least 1 of 2 sampling days at 57 and 64 days in milk.


188

inseminated about 32 h after GnRH administration while in the Ovsynch program, a high proportion of cows come to be pregnant and more calvings were attained once artifi cial insemination was completed 16 h after the fi nal injection of GnRH (Pursley et al., 1998). Modifi cations in the Ovsynch program were evaluated, and it was observed that number of calvings increased when cows received the fi nal GnRH injection and timed artifi cial insemination at 72 h as compared with GnRH and timed artifi cial insemination 48 h after the PGF2α (Portaluppi and Stevenson 2005). Portaluppi and Stevenson (2005) further found that pregnancy loss was reduced in cows which were given a GnRH injection and timed artifi cial insemination at 72 h in comparison with cows given GnRH and timed artifi cial insemination at 48 h. When dairy cows were exposed to a presynchronized estrus synchronization program and artifi cially inseminated at detected estrus, the estrus distribution after induced luteolysis gave rise to mean and median intervals of 3.2±1.0 and 3.0 days, respectively (Cerri et al., 2004). Out of 258 cows detected in estrus, the percentage of cows showing estrus on day 1, 2, 3, 4 and 5 after PGF2α injection were correspondingly 2.4, 12.2, 52.4, 22.8 and 7.1 % (Cerri et al., 2004). Cerri et al. (2004) further found that distribution of estrus at day 1, 2 and 3 after PGF2α injection was 7.1, 26.5 and 66.5 % in cows that were given estradiol cypionate injection 24 h after PGF2α. Thus, 3 days after the estrus synchronization program is the time when most of the animals are observed in estrus. Likewise, in our study, the majority of the buffaloes were observed in estrus at 72 h after PGF2α injection. Walker et al. (1996) reported that after a preliminary show of estrus, the time of ovulation is about 28 h, and this is comparable in those cows in which ovulation was induced by GnRH in a synchronization program (Pursley et

al., 1995; Stevenson et al., 2004). Our assumption was that prolonging the time

of induced ovulation and artifi cial insemination from 48 to 72 h in a timed artifi cial insemination program will increase pregnancy per artifi cial insemination because of prolonged proestrus subsequently prolonged exposure to increased concentrations of estradiol and display of estrus. The fi ndings of present study are inagreement with Portaluppi and Stevenson (2005). These authors reported similar pregnancy per artifi cial insemination in cows given GnRH injections and timed artifi cial insemination at either 48 or 72 h after luteolysis. As observed in the current study, many authors (Sterry et al., 2007; Brusveen et al., 2008) have reported non-existence of alteration in pregnancy per artifi cial insemination to fi rst and following inseminations while cows were programmed for a 48 or 72 h synchronization protocol.

An important logic for prolonging proestrus was to enhance synchronization of ovulation with the anticipated time when the maximum number of buffaloes show estrus after luteolysis. This may be signifi cant when buffaloes are induced to ovulate and inseminated at the same time. Peters and Pursley (2003) reported that in the Ovsynch program, restricting proestrus to below 36 h resulted in ovulation of smaller follicles and lower pregnancy per artifi cial insemination in dairy cows.

Earlier studies (Pancarci et al., 2002) indicated that in a timed artifi cial insemination program, no effect on pregnancy per artifi cial insemination was observed if the fi nal GnRH injection is replaced by 1 mg estradiol cypionate. In contrast, Cerri et al. (2004) reported that when ovulation was induced with 1 mg estradiol cypionate, pregnancy per artifi cial insemination was increased in comparison with cows which were inseminated


189

after a synchronized estrus. Enhancements in pregnancy per artifi cial insemination were proposed by increased contact to estradiol during proestrus, which might have upgraded oocyte fertilization or well prepared the uterus for the succeeding luteal phase, which is signifi cant for induction of endometrial progesterone receptors (Zelinsky and Stormshak, 1981). It was suggested that in high producing cows, there is a defi ciency of adequate concentrations of estradiol in the blood to induce estrus, ovulation and uterine priming on account of their characteristically wide-ranging steroid metabolism and clearance (Wiltbank et al., 2006). Sartori et al. (2002) reported that heifers had advanced peak estradiol levels as compared to lactating cows, nevertheless cows had larger ovulatory follicles. Hence, it is likely that supplementation with estradiol during proestrus might benefi t fertility of buffaloes, principally in synchronization programs which may restrict exposure to follicular estradiol.

Previously, Sellars et al. (2006) verifi ed the assumption that supplemental estradiol might advantage fertility of dairy cows at timed artifi cial insemination programs. Cows were given 0.25 mg estradiol cypionate at the time of fi nal GnRH injection in the Ovsynch program, and even though serum estradiol concentrations increased in cows treated with estradiol, pregnancy per artifi cial insemination persisted unchanged. In cows on the Ovsynch programgiven 0.5 mg estradiol cypionate 24 h before the fi nal GnRH injection, a decrease in the percentages of oocytes and embryos was observed with no effect on fertilization (Cerri et al., 2004). Similarly, in buffaloes with 48 h of proestrus, it becomes doubtful that supplemental estradiol improves fertility. The fi ndings of current study are in agreement with Sellars et al. (2006).

Actually, in the current study, it was

observed that synchronized buffaloes and those having higher concentrations of progesterone at 7 days after artifi cial insemination were more likely to be pregnant at 40 and 68 days after artifi cial insemination, representing the signifi cance of increased progesterone concentrations for pregnancy.

CONCLUSION

Lactating buffaloes exposed to presynchronized timed artifi cial insemination program with variable intervals of proestrus before GnRH, in which artifi cial insemination was done at the time of the fi nal GnRH injection, practiced analogous pregnancy per artifi cial insemination. It is important that prolonging the period of proestrus and treating buffaloes with estradiol show estrus mainly at 72 h after PGF2α but did not increase fertility. Buffaloes that showed estrus had higher concentrations of progesterone 7 days after the time artifi cial insemination. These interventions caused buffaloes which showed estrus are more likely to become pregnant than those not expressing estrus. The fi ndings of current study established that timed artifi cial insemination protocols should be taken into consideration to increase displayed estrus either on the day of timed artifi cial insemination or after as it is related to increased fertility.

REFERENCES

Brusveen, D.J., A.P. Cunha, C.D. Silva, P.M. Cunha, R.A. Sterry, E.P.B. Silva, J.N. Guenther and M.C. Wiltbank. 2008. Altering the Time of the Second Gonadotropin-Releasing Hormone Injection and Artifi cial


190

Insemination (AI) During Ovsynch Affects Pregnancies per AI in Lactating Dairy Cows. J. Dairy Sci., 91: 1044-1052.

Caraviello, D.Z., K.A. Weigel, P.M. Fricke, M.C. Wiltbank, M.J. Florent, N.B. Cook, K.V. Nordlund, N.R. Zwald and C.L. Rawson. 2006. Survey of management practices on reproductive performance of dairy cattle on large US commercial farms. J. Dairy Sci., 89: 4723-4735.

Cerri, R.L.A., J.E.P. Santos, S.O. Juchem, K.N. Galvao and R.C. Chebel. 2004. Timed Artifi cial Insemination with Estradiol Cypionate or Insemination at Estrus in High- Producing Dairy Cows. J. Dairy Sci., 87: 3704-3715.

Kanai, Y. and H. Shimizu. 1983. Characteristics of the estrous cycle of the Swamp buffalo under temperate conditions. Theriogenology, 19 (4): 593-602.

Pancarci, S.M., E.R. Jordan, C.A. Risco, M.J. Schouten, F.L. Lopes, F. Moreira and W.W. Thatcher. 2002. Use of estradiol cypionate in a presynchronized timed artifi cial insemination program for lactating dairy cattle. J. Dairy Sci., 85: 122-131.

Paul, V. and B.S. Prakash. 2005. Effi cacy of the Ovsynch protocol for synchronization of ovulation and fi xed-time artifi cial insemination in Murrah buffaloes (Bubalus bubalis). Theriogenology, 64: 1049-1060.

Peters, M.W. and J.R. Pursley. 2003. Timing of fi nal GnRH of the Ovsynch protocol affects ovulatory follicle size, subsequent luteal function, and fertility in dairy cows. Theriogenology, 60(6): 1197-1204.

Portaluppi, M.A. and J.S. Stevenson. 2005. Pregnancy Rates in Lactating Dairy Cows After Presynchronization of Estrous Cycles

and Variations of the Ovsynch Protocol. J. Dairy Sci., 88: 914-921.

Pursley, J.R., M.O. Mee and M.C. Wiltbank. 1995. Synchronization of ovulation in dairy cows using PGF2a and GnRH. Theriogenology, 44: 915-923.

Pursley, J.R., R.W. Silcox and M.C. Wiltbank. 1998. Effect of time of artifi cial insemination on pregnancy rates, calving rates, pregnancy loss, and gender ratio after synchronization of ovulation in lactating dairy cows. J. Dairy Sci., 81: 2139-2144.

Sartori, R., G.J.M. Rosa and M.C. Wiltbank. 2002. Ovarian structures and circulating steroids in heifers and lactating cows in summer and lactating and dry cows in winter. J. Dairy Sci., 85: 2813-2822.

Sellars, C.B., J.C. Dalton, R. Manzo, J. Day and A. Ahmadzadeh. 2006. Time and incidence of ovulation and conception rates after incorporating estradiol cypionate into a timed artifi cial insemination protocol. J. Dairy Sci., 89: 620-626.

Stevenson, J.S., S.M. Tiffany and M.C. Lucy. 2004. Use of estradiol cypionate as a substitute for GnRH in protocols for synchronizing ovulation in dairy cattle. J. Dairy Sci., 87: 3298-3305.

Sterry, R.A., P.W. Jardon and P.M. Fricke. 2007. Effect of timing of Cosynch on fertility of lactating Holstein cows after fi rst postpartum and Resynch timed-AI services. Theriogenology, 67: 1211-1216.

Steel, R.G.D. and J.H. Torrie. 1980. Principles and Procedures of Statistics. A Biometrical Approach, 2nd ed. McGraw Hill, New York.

Wiltbank, M.C., H. Lopez, R. Sartori, S. Sangsritavong and A. Gumen. 2006. Changes in reproductive physiology of


191

lactating dairy cows due to elevated steroid metabolism. Theriogenology, 65: 17-29.

Zelinsky, M.B. and F. Stormshak. 1981. Temporal relationships between endometrial RNA polymerase activities and steroid hormone receptors following estradiol administration during the midluteal phase and of the ovine estrous cycle. Biol. Reprod., 24: 119-124.


192

Original Article

ABSTRACT

A baseline survey for iodine status was conducted by measuring plasma inorganic iodine (PII) levels in 73 buffaloes from 67 dairy units located in the districts of Ludhiana, Jalandhar, Ferozepur and Hoshiarpur of Punjab. Concentrations of triiodothyronine (T3), thyroxine (T4), total cholesterol and free fatty acids (FFA) were compared between iodine defi cient and normal buffaloes. Circulating T4 and T3 levels were determined before and after injection of ethiodised oil in animals with low PII levels. The prevalence rate of low iodine status was recorded to be 38.4 percent and varied between 26.3 to 50.0 percent among three age groups and 29.0 to 60.0 percent in different districts. Basal thyroxine (T4) and

triiodothyronine (T3), T4: T3 ratio, total cholesterol and free fatty acids were not signifi cantly affected by low iodine status. However, the activity of circulating T4, T4: T3 ratio increased and that of T3

decreased following iodine supplementation, thus suggesting that subclinical defi ciency is prevalent. It may also be concluded from this study that elevation in T4 and T4: T3 ratio in response to iodine supplementation is a more sensitive diagnostic test of iodine defi ciency than a single basal T4 and T3

assay.

Keywords: iodine defi ciency, buffaloes, plasma inorganic iodine, thyroxine, triiodothyronine, iodized oil, iodine injection

INTRODUCTION

Iodine exerts its physiological role as a component of thyroid hormones which exert global effects on body metabolism by virtue of control of cellular energy exchange, basal metabolic rate, tissue growth, reproduction and lactation. Recent fi gures from the surveys by the Government of India and state governments show that 82 percent of the districts surveyed (197/239) are endemic for iodine defi ciency in the human population and no single state in the country is free from iodine defi ciency disorders in people (Pandav and Anand, 1997). However, iodine defi ciency disorders in animals have yet to receive the same attention as that of human beings. It is believed that due to ecology of iodine, the geographic pattern of dietary iodine availability to farm animals is similar to that of the human population. Based on this assumption, about 100 million animals (cattle, buffaloes, sheep and goats) have been estimated in iodine defi cient zones of India (Bedi, 1997). This has also been refl ected to some extent by few observations (Rajkumar,

STUDIES ON THE PREVALENCE AND DIAGNOSIS OF SUBCLINICAL IODINE DEFICIENCY IN BUFFALOES (Bubalus bubalis)

C.S. Randhawa1, S.S. Randhawa2, Swaran S. Randhawa2,* and K. Dua1

1Department of Veterinary Medicine, Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana-141 004, Punjab, India2Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana-141 004, Punjab, India, *E-mail: [email protected]


193

1970; Raina and Pachauri, 1984) in small ruminants of these areas. In spite of this, no survey on iodine status has been done to determine iodine status of livestock, probably because clear signs are not commonly seen and marginal defi ciency may be prevalent. However, reports are there that productivity is inevitably reduced in all animals even with marginal defi ciency that does not cause clinical signs (Knights et al., 1979; Salakhutdinov, 1985; Sedina, 1987). Thus, it seemed necessary to determine iodine status and its effect on livestock health. Therefore, the objective of the present study was to assess iodine status of dairy buffaloes in Punjab state and to investigate the role of iodine injection in the control and prevention of iodine defi ciency.


AnimalsSeventy-three buffaloes were selected

randomly from 371 buffaloes in 67 dairy units located in four districts (Ludhiana, Jalandhar, Ferozepur, Hoshiarpur) of Punjab. They were classed by age (Table 1) as heifers (1 to 3 years), young buffaloes (3 to 6 years) and old buffaloes (>6 years). No iodophors or iodine-containing compounds for teat dipping or udder sanitation were used at any of these dairy units. Plasma collection

Blood was collected by venipuncture in to acid washed heparinised vials during the months of July to September 1997. Plasma was separated by centrifugation and stored at -10oC for analysis within a month. Biochemical assay Plasma inorganic iodine (PII): Since PII is very sensitive to iodine intake in ruminants (Rogers,

1992), it was employed to assess iodine status. The concentration was measured by a chromatographic and colorimetric technique (Aumont and Tressol, 1987). On the basis of their PII values, the animals were classifi ed as normal (>105 μg/L), marginal (51 to 104 μg/L) and low (<51 μg/L) (Rogers, 1992). Cholesterol: Total plasma cholesterol was measured colorimetrically (Zak, 1957). Free Fatty acids (FFA): The concentration of FFA was determined by the method of Lowry and Tinsley (1976). Thyroxine (T4): Activity was measured by radio-immunoassay using kits from Bhaba Atomic Centre (Radio-pharmaceuticals Operation Board of Radiation and Isotope Technology, BARC’s Vashi Complex, Navi Mumbai, India). Duplicate tubes of T4 assay for blank, zero standard and four standard concentrations (3.22, 6.44, 12.80 and 25.70 nmol/L) and single tubes for two controls were prepared according to instructions provided with the kit. Single tubes were prepared for the samples by adding 100 μL each of diluted plasma (1:10 with assay buffer), radio-labelled T4, T4 antiserum and assay buffer. Polyethylene glycol solution (1 ml) was added after incubation (at 37oC for 30 minutes) to all tubes except the blank and were centrifuged at 2000 g for 20 minutes. Radioactivity of the precipitate was measured as counts per minute using a gamma counter ( model LB2105; Berthold, Germany). Triiodothyronine (T3): Activity was measured by a radio-immunoassay (kit from Bhaba Atomic Research Centre). Duplicate tubes of T3 assay for blank, zero standard, fi ve standard concentrations (0.23, 0.46, 0.92, 1.84, 3.68 nmol/L) and two controls were prepared according to instructions. Single tubes were prepared for samples by adding 50 μL of plasma sample and


194

100 μL each of radio-labelled T3, T3 antiserum and 300 μL of assay buffer and incubated at 37oC for 45 minutes after mixing. The rest of the procedure was similar to the T4 assay. All the samples were run in a single assay. The intra- assay variation was 5.90% for T3 and 5.01% for T4. Experimental Design

A baseline survey was conducted to determine the PII concentration of all the animals. Concentration of plasma thyroxine (T4), triiodothyronine (T3), cholesterol and FFA were measured to assess their usefulness in the diagnosis of iodine defi ciency. Plasma samples from 15 buffaloes with PII levels below 105 μg/L were compared with 15 animals with PII levels above 105 μg/L.

Since the herdsmen had not observed perinatal weakness, stillbirths or neonatal goitre in any of the herds, the low PII values in some animals suggested that a non-clinical defi ciency might be prevalent (Rogers, 1992). Therefore, the effect of parenteral iodine supplementation on thyroid activity was examined in fi ve iodine defi cient cows. A single subcutaneous injection of 1 mL of 78% ethiodised oil was given to each of the cows. Levels of T4 and T3 were assayed before and 70 days after injection.


Measurement of PII in this study showed that iodine intake was low in buffaloes of Ludhiana, Jalandhar, Ferozepur and Hoshiarpur districts of Punjab. The mean (±SEM) PII value of the sampled buffaloes from four districts of Punjab was 222.6 ± 24.4 μg/L (range 10.5 - 780 μg/L). Marginally low (83.9 ± 3.61 μg/L) and low (34.1 ± 3.19 μg/L) PII levels were recorded equally in 19.2 percent of the

buffaloes (Table 1). In relation to age, prevalence rate was 27.8, 50.0 and 36.3 percent in heifers, young buffaloes (3- 6 years) and mature buffaloes (> 6 years), respectively (Table 1). Low PII levels were observed in 29, 47, 33.3 and 60 percent buffaloes of Ludhiana, Jalandhar, Ferozepur and Hoshiarpur districts. The district wise distribution of 24 dairy herds that had low PII levels was 8 of 36 in Ludhiana, 7 of 14 in Jalandhar, 4 of 11 in Ferozepur and 5 of 6 in Hoshiarpur. However, Chhabra (2006) recorded lower mean PII levels of 43.4 and 49.1 mg/ml during summer and winter seasons, respectively, in buffaloes from Amritsar, Ludhiana, and Patiala districts. The prevalence rate was also higher (84.5%) compared to the present study. The difference might be due to soil type and area of study. Similar baseline surveys in sub-mountainous regions (Singh et al., 2006) and districts of Ludhiana, Hoisharpur, Jalandhar and Ferozepur (Randhawa and Randhawa, 2001) in cows demonstrated low iodine intake in 48.8% and 38.4% of crossbred cattle.

Ramakrishna and Prasad (1991) found that 41.5 percent of goat thyroids from Barielly abattoirs had goitrous lesions. Occurrence of visible goitre varied between 0.5-5.5 percent at a goat farm at Laxmipur (Rajkumar, 1970) and 0.16-5.66 percent in Terai region at Uttar Pradesh. Indirect evidence supporting our results is also provided by the low soil iodine content of the region and the occurrence of endemic goitre (assessed by thyroid palpation) in 11.6 and 46.7 percent school children from two different areas of Ludhiana district (Jain, 1990).

Perinatal weakness and stillbirths were observed only in only one of the sampled dairy herds. However, non-specifi c clinical signs viz. anoestrus, suboestrus and prolonged postpartum anestrus were observed in one of eight iodine defi cient herds in Ludhiana, two of seven in Jalandhar, two


195

of four in Ferozepur and two of fi ve in Hoshiarpur. Our fi ndings on few characteristic clinical signs in iodine defi cient buffaloes are supported by those of McCoy et al. (1997) who also demonstrated that dietary iodine defi ciency (4-5 months) suffi cient to produce clinical and pathological changes in thyroids of pregnant cattle may still allow normal births.

Plasma thyroid hormones, cholesterol and free fatty acids in iodine defi cient buffaloes The mean PII level of iodine defi cient cows was 59.3±5.40 μg/L, which was well below the value considered normal (105 μg/L) by Rogers (1992) and was also lower to 297.0 μg/L in normal group. Concentrations of mean T3, T4, total cholesterol. A fall in plasma FFA levels showed that fat mobilisation was lower in buffaloes with low PII levels (Table 2). Non-observance of low T3 and T4 activities in cows having low PII values in this study concurred with the suggestion of Underwood (1981) that serum T3 and T4 are poorly related to thyroidal activity in domestic animals as had also been confi rmed by Rogers (1992) in cows. In contrast, Baysu and Dundar (1984) measured lower iodothyronines concentrations in cattle having low milk production and fertility problems in areas where goitre was endemic in humans than those from non-goitrous areas. Pichaicharnarong et al. (1982), however, did not monitor clinical sign or iodine status of Swamp buffaloes, but recorded low T3 ( 2.4 ± 0.07 vs. 2.20 ± 0.08 nmol/L) and T4

activities (98.71 ± 3.94 vs. 57. 40 ± 3.47 nmol/L) in human goitre endemic areas in comparison to non-goitrous areas in Thailand. Diagnosis of severe iodine defi ciency may be easily done from the clinical signs of goitre, perinatal weakness, hairlessness and stillbirths in neonates. However, less severe iodine defi ciency

is more diffi cult to diagnose (McDowell, 1992). Various indicators that have been used to assess iodine defi ciency in cattle including thyroid function tests (T3 and T4), PBI, MI and total serum iodine (Allcroft et al., 1954; Puls, 1981), all have limitations. Andrewartha et al. (1980) also concluded from their studies on iodine defi cient sheep that single thyroxine assay provided little information on iodine status. Rogers (1992) examined several tests on cattle blood. He found that total iodine; protein bound iodine and thyroid hormones were diffi cult or impossible to interpret, and advocated the use of MI or PII. Aumont and Tressol (1987) had also shown that direct determination of PII was useful in diagnosis of dietary iodine imbalance.

Effect of iodine supplementation on thyroid activity of iodine defi cient buffaloes Since specifi c clinical signs of iodine defi ciency were not apparent and the activities of thyroid hormone were not lower in the buffaloes in spite of low PII values, it appeared that defi ciency might be non-clinical. However, after subcutaneous injection of ethiodised oil, there was a large increase (P<0.01) in mean PII concentration and elevation of T4 (P<0.005) for more than 70 days post injection (Table 3). Simultaneously, plasma T3 concentration declined (P<0.05) and T4: T3 ratio increased (P<0.005). These alterations suggested that thyroid hormonogenesis improved following iodine supplementation.

Walton and Humphrey (1979) have also recorded similar increase in plasma thyroxine level in clinically iodine defi cient sheep (premature births, stillbirths and neonatal mortality) treated with iodised oil. Low T4 levels, T4:T3 ratio and a remarkable production of T3 had also been observed by Morinaga et al. (1990) in iodine-defi cient


196

Table 1. Prevalence of iodine defi ciency in buffaloes in Punjab.

PII class ( μg/L) Heifers (n=18)

Young buffaloes

(n=22)

Old buffaloes

(n=33)Total (n=73) Percent of

total buffaloes

Normal (105) 13 11 21 45 61.6Marginal (51-105) 3 4 7 14 19.2

Low (>51) 2 7 5 14 19.2

% defi cient (<105) 27.8 50.0 36.3 38.4

Table 2. Effect of plasma iodine concentration on biochemical constituents involved in thyroid dysfunction in buffaloes.

Class of buffaloes PII (μg/L) T3 (nmol/L) T4(nmol/L) Cholesterol

(nmol/L) FFA (mg/L)

Normal 297.0a 1.73a 37.9a 1.88a 52.9a

Defi cient 59.3b 1.55a 39.6a 1.85a 42.7b

Means with different superscripts in a column differ signifi cantly at P < 0.05.

Table 3. Effect of iodised oil administration on PII and thyroidal activity of iodine defi cient buffaloes (n=5).

VariableDay after injection

0 70 PII(μg/L) 66.6 ± 18.0 285.2 ± 20.5**T4(nmol/L) 39.1 ± 1.28 63.3 ± 6.45***T3(nmol/L) 1.18 ± 0.15 0.72 ± 0.11*T4: T3 35.2 ± 4.82 92.1 ± 7.94***

*P<0.05 **P<0.01 ***P<0.005


197

goitre-affected calves. Therefore, improved thyroid hormonogenesis in response to treatment in our buffaloes showing low PII values suggest that sub-clinical defi ciency may be prevalent, which, however, needs to be further confi rmed by monitoring the effect on production. The data in Table 3 further suggested that increase in PII and plasma T4 concentration, T4:T3

ratio persisted for more than 70 days after iodine injection. It may, therefore, be inferred that 780 mg of I as ethiodised oil is a useful long-term iodine supplement for treatment and prevention of subclinical iodine defi ciency in buffaloes. High milk iodine concentrations after iodised oil (400 mg of I) have been observed in ewes of goitre-affected fl ocks for more than two consecutive pregnancies (Statham and Koen, 1982; Azuolas and Caple, 1984). The results also revealed that thyroid provocation by iodine supplementation was more sensitive diagnostic test of low iodine intake than single basal T4 and T3 assay.

REFERENCES

Allcroft, R., J. Scarnell and S.L. Hignett. 1954. A preliminary report on hypothyroidism in cattle and its possible relationship with reproductive disorders. Vet. Rec., 66: 367- 377.

Andrewartha, K.A., I.W. Caple, W.D. Davies and J.W. McDonald 1980. Observations on serum thyroxine concentrations in lambs and ewes to assess iodine nutrition. Aust. Vet. J., 56(1): 18-21.

Aumont, G. and J.C. Tressol. 1987. Rapid method for direct determination of inorganic iodine in plasma using ion- exchange chromatography and the Sandell and

Kolthoff reaction. Anal., 12(6): 875-878. Azuolas, J.K. and I.W. Caple. 1984. The iodine

status as monitored by concentrations of iodine in milk. Aust. Vet. J., 61: 223-227.

Baysu, N. and Y. Dundar. 1984. Preliminary survey of serum T3 and T4 levels and their effects on the productivity of cattle in the Inegol. Vet. Fak. Ankara Univ., 31(2): 281-292.

Bedi, S.P.S. 1997. Iodine Status of Feeds and Fodders, p. 161-177. In Pandav, C.S. and A.R. Rao (eds.) Iodine Defi ciency Disorders in Livestock Ecology and Economics. Oxford University Press, Delhi, India.

Chhabra, S. 2006. Studies on mineral imbalances in dairy animals with reference to copper, manganese and iodine status in Punjab. Ph.D. Dissertation, Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, India.

Jain, R. 1990. Dietary intake of iodine in selected goitre endemic and non- endemic areas of Punjab. Ph.D. Dissertation, Punjab Agricultural University, Ludhiana, India.

Knights, G.I., P.K. O’Rourke and P.S. Hopkins 1979. Effects of iodine supplementation of pregnant and lactating sows on the growth and maturation of their offsprings. Aust. J. Agric. Anim. Husb., 19(96): 19-22.

Lowry, R.R. and I.J. Tinsley 1976. Rapid colorimetric determination of free fatty acids. J. Am. Oil Chem. Soc., 53: 470-472.

McCoy, M.A., J.A. Smyth, W.A. Ellis, J.R. Arthur, and D.G. Kennedy 1997. Experimental reproduction of iodine defi ciency in cattle. Vet. Rec., 141(121): 544-547.

McDowell, L.R. 1992. Minerals in Animal and Human Nutrition. Academic Press, New York, USA. 224p.

Morinaga, Y., I.S. Osame, T. Sarashina and S. Ichigo.


198

1990. Clinico-pathological observations on calves with enzootic goitre. Jpn. J. Vet. Sci., 52(6): 1309-1311.

Pandav, C.S. and K. Anand. 1997. Towards the elimination of iodine Defi ciency Disorders in India. p 45-64. In Pandav, C.S. and A.R. Rao (eds.) Iodine Defi ciency Disorders in Livestock Ecology and Economics. Oxford University Press, Delhi, India.

Pichaicharnarong, A., V. Chairuktum, T. Vongsomboon, P. Loypetjra, N. Chaiyabutr, T. Bhanaseri, and D. Durdevic. 1982. The thyroid activity of swamp buffaloes inhabiting non- goitrous and goitrous areas in Thailand. Acta Vet. Yugosl., 32(5/6): 253- 259.

Puls, R. 1981. Veterinary trace mineral defi ciency and toxicity information. Publication No. 5139, Information Service Agriculture, Ottowa.

Raina, A.K. and S.P. Pachauri. 1984. Studies on prevalence of goitre in goats in Tarai.Indian Vet. J., 61(8): 684-688.

Rajkumar, S.S. 1970. Incidence of goitre in goats. Indian Vet. J., 47: 185- 187.

Ramakrishna, C. and M.C. Prasad 1991. Spontaneous lesions in goat thyroid. Indian J. Anim. Sci., 61(2): 161-164.

Randhawa, C.S. and S.S. Randhawa. 2001. Epidemiology and diagnosis of subclinical iodine defi ciency in crossbred cattle of Punjab. Aust. Vet. J., 79: 349-351.

Rogers, P.A.M. 1992. Iodine defi ciency in cattle. Irish Vet. News, 14-17, September Issue.

Salakhutdinov, K.G. 1985. Iodine defi ciency in farm Animals. Kazanskii Veterinarnyt institute: Kazan . VSSR pp 96-99 (Original not seen. Cited from V. Kapoor and A.R. Rao. Global occurrence of iodine defi ciency disorders in

livestock. Eds. C.S. Pandav and A.R. Rao. In: Iodine Defi ciency Disorders in Livestock Ecology and Economics. Oxford University Press, Delhi, 99-131p.

S’edina, G.V. 1987. Effect of iodine nutrition of cows on their milk yield and biochemical values of blood: Bulletin Vseosoyuznogo. Nauchnoissledovatel’s Kogo Insatituta Ravadeniyai – Genetiki Sel’ skokhozy aistvennykh. Zhivotnykh 100: 17-19 (Original not seen. Cited from V. Kappoor and A.R. Rao. Global occurrence of iodine defi ciency disorders in livestock. Eds. C.S. Pandav and A.R. Rao. In: Iodine Defi ciency Disorders in Livestock Ecology and Economics. Oxford University Press, Delhi, 99-131p.

Singh, R., S.S. Randhawa and C.S. Randhawa 2006. Iodine status of crossbred cattle from sub- mountainous areas of Punjab. Indian Vet. J., 283: 181-184.

Statham, M. and T.B. Koen 1982. Control of goitre in lambs by injection of ewes with iodised poppy seed oil. Aust. J. Agric. Anim. Hus., 22(114): 29-34.

Underwood, E. 1981. The Mineral Nutrition in Livestock, 2nd ed. Commonwealth Agricultural Bureaux, Farnham Royal, Slough. 77p.

Walton, E.A. and J.D. Humphrey. 1979. Endemic goitre of sheep in the highlands of Papua Guinea. Aust. Vet. J., 55(1): 43-44.

Zak, B. 1957. Simple and rapid microtechnic forserum total cholesterol. Am. J. Clin. Path., 27(5): 583-588.


199

ABSTRACT

In the Malwa region of Madhya Pradesh reproductive failure (anoestrus) is a major problem in buffaloes under fi eld conditions due to under feeding and nonavailability of balanced ration. To fi nd out the nutritional causes behind anoestrus, thirty anoestrus buffaloes {10 heifers (average body wt. 262.80 ± 22.51 kg) + 20 buffaloes (average body wt. 461 ± 10.83 kg, milk yield 7.62 ± 0.48 litre/h/d)} that had normal genitalia were selected randomly from ten villages of Indore district. Average daily feed intake of each animal was recorded and proximate principles, major (Ca and P) and trace elements (Fe, Zn, Mn, Cu and Co) in available feedstuffs were determined to fi nd out nutrient availability. Defi ciency of various nutrients was calculated by comparing with the standard requirements of the animals. A strategic nutrient supplement containing defi cient nutrients was formulated on the basis of nutrient defi ciency observed in rations of buffaloes of Indore district and a supplementation study was carried out in the same thirty affected anoestrus buffaloes by dividing them into two groups of 15 (fi ve heifers + 10 buffaloes) in each. One of them served as control (un-supplemented), while the other was supplemented with the strategic nutrient supplement (treatment). This supplementation study was continued for a period of two months, during which each individual

animal was regularly examined for onset of estrus and artifi cially inseminated. After two months of the last artifi cial insemination, pregnancy diagnosis of each animal was carried out per rectally to fi nd out the conception status. Onset of estrous (12 vs. 4) and conception rate (10 vs. 3) were higher in the animals of supplemented group and an additional advantage in the form of improvement (P<0.05) in the body weight of heifers of the treated group was also observed. On the basis of above fi ndings it may be concluded that strategic nutrient supplementation not only improved the reproductive performance of the anestrous buffalo heifers and lactating buffaloes, but it also improved the growth performance of the heifers. Keywords: nutrient, supplement, anoestrus, buffaloes, Malwa

INTRODUCTION

Reproductive failure of dairy animals is a major area of concern nowadays all over India, for it causes a huge economic loss to dairy owners. Among the various factors affecting it, nutrition is one of the most important though it receives less attention than it deserves. For normal development and activity of reproductive organs, feeding of a balanced ration is of utmost importance because

EFFECT OF STRATEGIC NUTRIENT SUPPLEMENTATION ON THE REPRODUCTIVE PERFORMANCE OF ANOESTRUS BUFFALOES IN

THE MALWA REGION OF MADHYA PRADESH

Nagendra Patil, R.K. Jain* and Vishal Mudgal

Department of Animal Nutrition, College of Veterinary Science and Animal Husbandry, Mhow (Madhya Pradesh) 453 446 M.P.P.C.V.V., Jabalpur, India, E-mail: [email protected]

Original Article


200

most fi eld cases of reduced fertility or sterility are of nutritional origin. The interaction between nutrition and reproduction needs particular attention in India to overcome nutritional inadequacies either in terms of quantitative or qualitative nutrient defi ciencies/ imbalances.

In the Malwa region of Madhya Pradesh, buffaloes make a signifi cant contribution as dairy animals. Nutritional defi ciencies cause several infertility conditions in buffaloes and the highest (50.26%) prevalence was observed for anoestrus, while cases of repeat breeder, metritis, pyometra and prolapse were only about (25.69%) among the common fi eld cases of Malwa region of Madhya Pradesh (Shukla et al., 2007). Thus anoestrus remains a major condition which constitutes about half of reproductive problems occurring in buffaloes. Farmers follow traditional feeding practices. Usually cotton seed cake is the only concentrate source fed to lactating animals along with straw (wheat/ masoor/ gram/ soybean), and mineral supplementation is rarely practiced by farmers (Mudgal et al., 2003). On the basis of these fi ndings, a study was planned fi rst to fi nd out the nutritional status of the dairy buffaloes of Indore district affected with anestrous and after getting its defi ciency picture, implementing strategic nutrient supplementation to overcome the problem.


Thirty buffaloes {10 heifers (average body wt. 262.80 ± 22.51 g) + 20 buffaloes (average body wt. 461 ± 10.83 kg , milk yield 7.62 ± 0.48 litre/h/d)}with normal genitalia (by per rectal examination) and without any clinical infection, showing anoestrus were selected randomly from 10 villages (Borkhedi, Harsola, Kevti, Piplihamalhar,

Umaria, Panda, Rau, Rangwasa, Sonvay and Bhaslai) around Veterinary College, Mhow of Indore District. Body weights (kg) of the animals were determined by recording the length (inch) and girth (inch) of each animal and then putting them in Shaeffer’s formula (Sastry et al., 1982). Feed offered and residue left of each animal was weighed with the help of spring balance at both feeding times (morning and evening) for three consecutive days. Then average feed intake of each animal was calculated. The representative samples of each feed were subjected to proximate analysis (AOAC, 1995), Ca and P (Talpatra et al., 1940) and trace mineral estimations by atomic absorption spectrophotometer. Milk yield (litre) of each lactating animal was measured during milking (morning and evening) for three consecutive days. After that average milk yield was calculated. Availability of DM, DCP, TDN, major elements (Ca and P), trace elements (Fe, Cu, Mn, Zn and Co) for each animal was calculated on the basis of chemical composition of feedstuffs and their intake. Selenium, carotene and vitamin E intake were worked out using values given in the literature. Finally, the nutrient availability of individual animal was compared with the standard nutrient requirements calculated for the specifi c body weight and productivity of each individual animal with the help of feeding standards (Kearl, 1982) and thus the defi ciencies/ excess of each specifi c nutrient was worked out. As per the defi ciency status of the nutrients, a strategic nutrient supplement was prepared using SoyaDe Oiled Cake (for protein and energy), sodium dihydrogen orthophosphate dihydrate (for P), zinc oxide (for Zn), copper sulphate (for Cu) and vitamin supplement (for vitamin A and E) were used. The amounts of specifi c supplement added in the normal routine diet of heifers or buffaloes are


201

presented in Table 3. Measured amounts of trace minerals were supplemented by placing them in gelatin capsules.

The supplementation study was carried out in same thirty anoestrus heifers and buffaloes by dividing them into two groups having fi ve heifers and 10 buffaloes in each, the control animals were offered the same diet which was being routinely followed by the farmer, while each animal of the treatment group was supplemented with a specifi c amount of supplement (Table 3) in addition to the normal control diet. Deworming of each animal was done before starting the supplementation and other management practices remained same for both the groups like proper hygienic and ventilated housing with clean drinking water available ad-libitum. This supplementation study was continued for a period of two months, during which individual animal of both the groups were regularly examined for onset of oestrus and artifi cially inseminated. After two months of the last artifi cial insemination, pregnancy diagnosis of each animal was done per-rectally to fi nd out the conception rate. The data were analyzed as per the standard statistical methods described by Snedecor and Cochran (1994) for mean, standard error and paired ‘t’ test.


The chemical composition of specifi c feed ingredients being consumed by the animals has been presented in Table 1. The feeds being offered to the animals were mainly the agricultural by-products including wheat straw, gram straw, masoor straw, soybean straw and wheat bran, while the cake was only cotton seed cake, while at some places concentrate mixtures was also being used.

In Table 2, the availability of different

nutrients to the animals was worked out and compared with the standard requirement and hence the excess or defi ciency of each specifi c nutrient has been presented. As compared to the standard requirements (Kearl, 1982), availability of DM was about 4-6% less, which may be associated with the defi ciency of TDN too. Similar fi ndings was also been reported by Mudgal et al. (2003) and Tiwary et al. (2007). Between the groups defi ciency of major nutrients was observed in heifers for digestible crude protein, which was only about 48% to that of the requirements, while buffaloes were observed with only limited defi ciency (11%), which may be associated with the supply of concentrate to the lactating buffaloes. Similar observations were also recorded by earlier workers (Sinha, 1982; Sohal et al., 1982; Mudgal et al., 2003 and Tiwary et al., 2007). The lower levels of energy and /or protein may be associated with the ovarian inactivity and anoestrus (Wiltbank et al., 1965) as negative energy balance depresses the ovarian activity by inhibiting pulsatile LH release (Butler and Smith, 1989).

When the major minerals were compared, calcium was shown to be the element supplied in excess (33 to 283%) to the requirement, which may be due to supply of higher amounts of leguminous straws in their ration. Leguminous straw reduces the availability of phosphorus on one hand and over supplies calcium on other hand, as leguminous straws have a wider Ca: P ratio and a fair defi ciency of element phosphorus. Phosphorus is necessary for normal energy and phospholipid metabolism as well as normal skeletal development and its severe defi ciency may delay the onset of puberty, cause postpartum anoestrus. and increase incidence of cystic follicles because of inactive ovaries, and moderate and low conception rates (Pugh et al., 1985). Many other workers also have found lower levels of inorganic phosphorus in serum of anoestrus


202

Tabl

e 1.

Mac

ro a

nd m

icro

nut

rient

con

tent

s of f

eeds

tuffs

(DM

bas

is).

Feed

stuf

fsW

heat

stra

wG

ram

stra

wM

asoo

r st

raw

Soyb

ean

stra

wW

heat

bra

nC

otto

nSe

ed c

ake

Con

cent

rate

m

ixtu

re

CP

(%)

3.95

±0.2

26.

24±0

.24

6.52

±0.3

26.

14±0

.34

13.9

9±0.

5222

.60±

0.42

16.1

6±2.

70EE

(%)

0.99

±0.0

60.

63±0

.50

1.50

±0.1

10.

80±0

.06

3.45

±0.1

110

.22±

0.64

3.50

±0.1

8C

F (%

)33

.08±

0.69

39.1

6±0.

7436

.91±

0.82

41.7

7±1.

489.

99±0

.92

27.1

5±1.

7215

.19±

1.36

NFE

(%)

50.3

1±0.

6645

.95±

1.20

46.2

1±0.

8745

.52±

1.74

68.7

1±1.

6335

.75±

1.15

49.2

9±2.

51TA

(%)

11.6

4±0.

647.

98±0

.34

8.84

±0.3

06.

59±0

.38

4.51

±0.7

44.

25±0

.22

13.9

8±1.

79A

IA (%

)5.

84±0

.16

2.44

±0.1

54.

17±0

.23

0.69

±0.0

60.

48±0

.10

0.18

±0.0

26.

08±1

.48

Ca

(%)

0.23

±0.0

21.

54±0

.08

1.46

±0.0

70.

94±0

.04

0.21

±0.0

10.

22±0

.01

0.32

±0.0

5P

(%)

0.06

±0.0

10.

04±0

.00

0.05

±0.0

00.

24±0

.015

0.61

±0.0

50.

51±0

.02

0.17

±0.0

2Fe

(ppm

)41

4.76

±6.4

736

4.14

±12.

860

5.28

±8.0

546

1.99

±62.

7029

8.51

±15.

2327

5.24

±16.

9625

8.45

±5.9

4Zn

(ppm

)13

.48±

1.12

8.41

±0.2

823

.24±

1.92

26.4

3±1.

3763

.40±

8.19

41.6

4±3.

0328

.83±

2.49

Mn

(ppm

)39

.81±

1.18

15.6

8±0.

8587

.07±

7.35

67.6

3±2.

3871

.37±

3.22

15.8

0±0.

5618

.82±

1.37

Cu

(ppm

)7.

91±0

.36

4.36

±0.2

94.

86±0

.41

10.0

1±0.

7011

.68±

1.16

10.1

2±0.

802.

66±0

.32

Co

(ppm

)0.

16±0

.03

0.72

±0.0

60.

71±0

.06

0.18

±0.0

20.

69±0

.17

0.55

±0.0

50.

86±0

.05


203

Tabl

e 2.

Dai

ly re

quire

men

ts a

nd a

vaila

bilit

y of

nut

rient

s in

anoe

stru

s buf

falo

es.

Para

met

ers

Req

uire

men

ts

for

300k

g B

ody

wt.

Avai

labi

lity

for

262.

80±

22.5

1 B

ody

wt.

Defi

cie

ncy

/ E

xces

s (%

)

Req

uire

men

ts

for

500

kg B

ody

Wt a

nd 8

lits

/da

y pr

oduc

tion

(7%

fat)

Avai

labi

lity

For

461±

10.8

3 kg

B

ody

wei

ght

Defi

cie

ncy

/E

xces

s (%

)

Hei

fers

Buf

falo

esD

MI (

Kg)

5.99

5.75

±0.4

34

(-)

1211

.33±

0.47

6 (-

)D

CP

(g)

374

179.

32±2

1.80

52 (-

)77

268

4.69

±39.

9711

(-)

TD

N K

g)3.

552.

83±0

.21

20(-

)7.

286.

06±0

.26

17 (-

)C

a (g

)15

57.3

8±8.

9228

3 (+

)46

.461

.93±

6.39

33 (+

)P

(g)

128.

16±1

.28

32 (-

)35

.824

.41±

2.15

31 (-

)Fe

(mg)

299.

527

79.5

6±25

2.64

828

(+)

600

3801

.73±

239.

8753

4 (+

)Z

n (m

g)17

911

8.24

±13.

7434

(-)

480

294.

24±2

1.01

39 (-

)M

n (m

g)23

9.6

353.

96±3

8.74

48 (+

)48

039

6.24

±24.

8317

(-)

Cu

(mg)

59.9

44.6

1±3.

2226

(-)

120

91.4

0±4.

0924

(-)

Co

(mg)

0.59

2.45

±0.5

131

5 (+

)1.

204.

68±0

.38

290

(+)

Se (m

g)0.

6-1.

80.

78±0

.06

Ade

quat

e1.

2-3.

62.

4A

dequ

ate

Vit

A (I

U)

1200

057

17.8

1±45

52 (-

)21

000

1141

8.95

±0.2

046

(-)

Vit

E (I

U)

159.

49±1

.54

38 (-

)15

57.9

6±4.

9828

6 (+

)


204

heifers /buffaloes than cyclic animals (Naidu and Rao, 1982; Kumar et al., 1992 and Dutta et al., 2001).

Among trace elements, the supply of iron and cobalt remained on the plus side, while zinc and copper remained defi cient, and Mn was defi cient only in buffaloes but not in heifers. The presence of zinc is highly essential for certain enzymatic activities related to reproduction and indirectly it may act through the pituitary to infl uence the release of gonadotropic hormones or directly through complexing with specifi c ligands in gonads (Miller, 1979). Defi ciency of copper may also be refl ected on reproductive behavior as well as performance of animals. Inactive ovaries, delayed oestrus and early embryonic death have been reported to occur due to defi ciency of copper

(Hidiroglou, 1979 and Singh and Vadnere, 1987). Due to practice of supply supplying little

green feed by farmers, vitamin A remained the most defi cient among the animals, and vitamin A is very important for maintaining the health status of epithelial tissue of the reproductive tract. The defi ciency of vitamin E was only observed in heifers but not in lactating buffaloes and may be due to lack of concentrate in the ration of heifers. . The negative impact of insuffi cient vitamin E has been observed on ovulation rates (Harrison et al., 1984) and postpartum activities (Arechiga et al., 1994) of animals. On the basis of multiple defi ciencies observed in buffalo heifers and lactating buffaloes, two separate strategic nutrient supplements were prepared (Table 3)

Table 3. Ingredient composition of the supplements used for anestrous buffaloes (Quantity / day).

Ingredients Heifers BuffaloesSoya De Oiled Cake 550 g 250 gSodium di hydrogen ortho phosphate di hydrate - 50 g

Zinc oxide 60 mg 224 mgCopper sulfate 10 mg 90 mgVitamin supplement* 1 ml 1 ml

* Each ml contains Vitamin A 12000 IU and vitamin E 48mg.

Table 4. Effect of strategic nutrient supplementation on reproductive performance of anoestrus buffaloes.

Groups of animals Total animals

No of animals exhibited

estrusSuccess (%) No of animals

conceived Success (%)

HeifersControl 5 1 20 1 20Treatment 5 4 80 3 60

BuffaloesControl 10 3 30 2 20Treatment 10 8 80 7 70


205

and supplemented in the diet of affected animals. The effect of their supplementation has been presented in Table 4. After supplementation of strategic nutrients, 80% of the heifers and lactating buffaloes showed the signs of estrus, while 60% of the heifers and 70% of the lactating buffaloes conceived. The rate of onset of estrous for the control group remained 20% for heifers and 30% for buffaloes, while only 20% of the animals conceived. A signifi cant improvement (P<0.05) in body weight of treated heifers was also observed as compared to the controls. Similar results have also been observed by several scientists (Baruah et al., 2000; Lall et al., 2000; Nayyar et al., 2003; Koley and Biswas 2004 and Sharma et al., 2007). On the basis of above fi ndings it may be concluded that strategic nutrient supplementation not only improved the reproductive performance of the anestrous buffalo heifers and lactating buffaloes, but it also improved the growth performance of the heifers.

REFERENCES

AOAC. 1995. Offi cial Methods of Analysis, 15th ed. Association of Offi cial Analytical Chemists, Washington, DC.

Arechiga, C., F.O. Ortiz and P.J. Hansen. 1994. Theriogeneology, 41:1251 (Cited from Sharma, K. 2007. Nutritional approaches to prevent reproductive disorders in dairy animals. Lead paper in XXIII Annual convention of ISSAR and National Symposium on Challenges in Improving Reproductive Effi ciency of Farm and Pet Animals.7th - 9th Dec., 2007; Orissa University of Agriculture and Technology -Bhubaneswar).

Baruah, K.K., A. Hansen and D. Bhuyan. 2000.

Status of macro and micro mineral levels in postpartum anoestrus swamp buffaloes in relation to soil and plants. Indian J. Dairy Sci., 53(6): 424-427.

Butler, W.B. and R.D. Smith. 1989. Interrelationship between energy balance and poetpartum reproductive function in dairy cattle. J. Dairy Sci., 72: 767.

Dutta, A., B.C. Sarmah and K.K. Baruah. 2001. Concentration of serum yrace elements in cyclic and anoestrus heifers in lower Brahmaputra valley of Assam. Indian Vet. J., 78: 300-302.

Harrison, J.H., D.D. Hancock and H.R. Conard H.R. 1984. J. Dairy Sci., 67: 123 (Cited from Sharma, K. 2007. Nutritional approaches to prevent reproductive disorders in dairy animals. Lead paper in XXIII Annual convention of ISSAR and National Symposium on Challenges in Improving Reproductive Effi ciency of Farm and Pet Animals.7th-9th Dec., 2007; Orissa University of Agriculture and Technology- Bhubaneswar).

Hidiroglou, M. 1979. Trace element defi ciency and fertility in ruminants: A review. J. Dairy Sci., 62: 1195-1206.

Kearl, L.C. 1982. Nutrient Requirements of Ruminants in Developing Countries. International Feedstuffs Institute. Utah State University, Logan, Utah, USA

Koley, S. and P. Biswas. 2004. Effect of mineral supplementation on the performance of anoestrus cows. Indian J. Anim. Nutr., 21(4): 268-270.

Kumar, H., G.D. Singh and H.C. Pant 1992. Indian J. Dairy Sci., 45(5): 278-280 (Cited from Kumar, H. 2004. Reproductive disorders due to defi ciency of minerals and vitamins


206

in livestock. Short course on role of minerals and vitamins in livestock health and production. IVRI, Izatnagar ,U.P.)

Lall, D., V.B. Dixit, U. Arora, B. Kumar and T. Chauhan. 2000. Effect of mineral supplementation on reproductive performance of anestrous buffaloes under fi eld conditions. Indian J. Anim. Nutr., 17(1): 34-39.

Miller, W.J. 1979. Dairy Cattle Feeding and Nutrition. Academic Press, New York.

Mudgal, V., M.K. Mehta, A.S. Rane and S. Nananavati. 2003. A survey on feeding practices and nutritional status of dairy animals in Madhya Pradesh. Indian J. Anim. Nutr., 20(2): 217-220.

Naidu, K.V. and A.R. Rao. 1982. Indian Vet. J., 59: 781(Cited from Kumar, H. 2004. Reproductive disorders due to defi ciency of minerals and vitamins in livestock. Short course on role of minerals and vitamins in livestock health and production. IVRI, Izatnagar ,U.P.)

Nayyar, S., V.K. Gill, V.S. Malik, K.S. Roy and R. Singh. 2003. Vitamin E and Selenium improve the blood biochemical composition of anoestrus buffalo heifers. Indian J. Anim. Sci., 71(6); 654-656.

Pugh, D.G., R.G. Almore and T.R. Hembri. 1985. Recent Advances in Animal Reproduction and Gynecology. Nanda, A.S. (ed.) USG Publishers. p. 103-121.

Sastry, N.S.R., C.K. Thomas and R.A. Singh. 1982. Farm Animal Management and Poultry Production, 2nd ed. Vikas Publishing House Pvt. Ltd. New Delhi, India.

Sharma, K.B., R. Kumar, M. Verma and R. Sharma. 2007. Comparative studies on strategic mineral mixture supplementation in animals

under different managemental conditions. (Abst.) XXIII Annual convention of ISSAR and National Symposium On Challenges in Improving Reproductive Effi ciency of Farm and Pet Animals.7th - 9th Dec., 2007; Orissa University of Agriculture and Technology - Bhubaneswar.

Shukla, S.P., S.P. Nema, A.K. Pandey and D.P. Dwivedi. 2007. Surveillance of reproductive disorders in cows and buffaloes in Malwa region of Madhya Pradesh. XXI Annual convention of ISSAR and National Symposium On Challenges in Improving Reproductive Effi ciency of Farm and Pet Animals. 7th - 9th Dec., 2007; Orissa University of Agriculture and Technology - Bhubaneswar.

Singh, S. and S.V. Vadnere. 1987. Indian J. Anim. Reprod., 8: 46-49 (Cited from Kumar, H. 2004. Reproductive disorders due to defi ciency of minerals and vitamins in livestock. Short course on role of minerals and vitamins in livestock health and production. IVRI, Izatnagar ,U.P.)

Sinha, M.N. 1982. Gap analysis in relation to feeding recommendation. Annual Report. National Dairy Research Institute, Karnal, India. pp. 168-169.

Snedecor, G.W. and W.G. Cochran. 1994. Statistical Methods. Iowa State University Press Ames, Iowa, USA.

Sohal, T.S., J.N. Singh and J.P. Singh. 1982. Impact of Intrusive Extension Education, the adoption of scientifi c diary farming by landless rural families around Karnal. Indian J. Diary Sci., 35: 447-453.

Talpatra, S.K., S.C. Ray and K.C. Sen 1940. Indian J. Vet. Sci. A. H., 10: 243 (Cited from Bhaid, M.V. 1960. Studies on dual purpose fodder


207

crop” M.V.Sc. Thesis, Mathura Veterinary College (U.P.), India.

Tiwary, M.K., D.P. Tiwari, A. Kumar and B.C. Mondal. 2007. Existing feeding practices, nutrient availability and reproductive status of dairy cattle and buffaloes in Haridwar district of Uttarakhand. Indian J. Anim. Nutr., 7: 177-185.

Wiltbank, J.N., J. Bond, E.J. Warwick, R.E. Devis, A.C. Cook, W.L. Reynolds and W.H. Hazen. 1965. Infl uence of total feed and protein intake on reproductive performance in the beaf female through 2nd calving. Tech. Bull., 1314, Agr. Res. Service, U.S.D.A., Washington, D.C.


208

ABSTRACT

A two-year retrospective study was performed to determine the bacteriological aspects of coagulase positive Staphylococcal mastitis by bacterial culture and by polymerase chain reaction using specifi c primers in cattle and buffalo farms from three distinct geoclimatic zones of India. A total of 3934 quarters from 1022 cattle and buffaloes were screened from the Bareilly, Kumaoun and Rajnanadgoan regions of India. Mastitis cases were detected from 754 quarter milk samples on the basis of CMT positive, SCC > 7 x 105 cells /ml and milk positive on bacterial culture. The overall prevalence of Staphylococcal mastitis (BSM) was 22.02% on cow basis and 8.64% on quarter basis in 1022 lactating cows with 3934 functional quarters. The intra-mammary infection (IMI) was higher to the extent of 45.54% in the Bareilly and 56.31% in the Rajnandgoan regions as compared to the Mukteshwar region. The coagulase gene of S. aureus was amplifi ed with a pair of primers using the polymerase chain reaction (PCR). PCR revealed the cao gene from 14.73%, 10.53% and 13.24% more mastitic milk samples as compared

to the bacterial culture method. Amplifi cation of the coa gene by PCR is an important technique for quick diagnosis of prevalent bacterial pathogens of a particular region. With the help of PCR, a large number of lactating dairy animals can be screened with accuracy in less time in the study area for implementing therapeutic and preventive measures.

Keywords: bovine mastitis, coagulase gene, geoclimatic zones, Staphylococcus aureus, polymerase chain reaction

INTRODUCTION

Mastitis is generally associated with intensive dairy farming systems. It causes great economic losses due to lower and poor quality of milk production and treatment cost (Ruegg, 2011). Staphylococcus aureus is the major contagious pathogen It spreads rapidly in dairy herds during milking and generally leads to subclinical (SCM), chronic and sometimes clinical mastitis (Ott, 1999). The implementation of proper therapeutic and

PREVALENCE OF COAGULASE GENE POSITIVE Staphylococcus aureus BOVINE MASTITIS IN THREE DISTINCT GEOCLIMATIC REGIONS OF INDIA

B.D. Sahu1, R. Mukherjee1,*, Ajay Kumar2, Amit Kumar3 and Jyoti Sahu4

1Division of Medicine, Indian Veterinary Research Institute, Izatnagar, UP, 243 122, India, *E-mail: [email protected] of Veterinary Biotechnology, Indian Veterinary Research Institute, Izatnagar, UP, 243 122, India3Division of Animal Breeding and Genetics, Indian Veterinary Research Institute, Izatnagar, UP, 243 122, India4Department of Veterinary Pharmacology and Toxicology, College of Veterinary Science and Animal Husbandry, Anjora, Durg, Chhattisgarh, 491 001, India

Original Article


209

preventive measures depends on the appropriate knowledge of clinical, epidemiological and bacteriological aspects of mastitis (Shpigel, 1998). Raw milk is a potential source of S. aureus. The gene encoding coagulase (coa) is an important virulence factor responsible for invasion of S. aureus into the mammary epithelium. Coa gene polymorphism is found suitable for epidemiological investigation of bovine S. aureus mastitis (Zecconi et al., 2006). The bacterial culturing of the milk samples is the standard procedure for mastitis testing, but the method is time consuming. About 25% of the mastitic milk samples do not yield bacterial growth with the conventional culturing method, and therefore a proper control program cannot be implemented on a particular farm (Makovec and Ruegg, 2003). The polymerase chain reaction (PCR) can identify the pathogen in the milk if present in traces (Bradley et al., 2007). The technique is simple and fast. In the present study, we collected milk samples from three distinct geoclimatic zone of India for detection of coagulase positive S. aureus by bacterial culture and PCR directly from the raw milk to note the sensitivity of these two techniques.


A total of 1022 cattle and buffaloes were

screened for udder health status in the Bareilly, Kumaoun and Rajnandgoan regions. Udder health status was screened on the basis of CMT reaction, somatic cell count (SCC) and bacterial isolation. Milk samples positive for CMT and SCC > 0.6 to 3.2 million cells / ml of milk and positive for bacterial isolate were diagnosed as subclinical and clinical mastitis. Ten ml milk was collected from each teat, after cleaning the teat end with cotton soaked in 70% alcohol and after discarding 3-4 milk squirts. SCC of the milk samples were done as per the standard method (Schalm et al., 1971). Milk samples were collected for bacterial isolation and identifi cation from 387, 95 and 272 quarters, found positive on CMT. The identifi cation and biochemical characterization of causative organism in collected milk samples were carried as per (Balows et al., 1991).

Amplifi cation of the coagulase (coa) gene from raw milk samples

DNA extraction was carried out as per the method described by Ahmadi et al. (2010). The DNA pellet was quantifi ed in NanoDrop ND-1000 Spectrophotometer (Thermo Scientifi c). The coagulase gene of Staphylococcus aureus from milk samples was amplifi ed using the primer pair (Eurofi ns Genomics India Pvt Ltd, Bangalore, India) listed as below:

Table 1. Primer pair used for amplifi cation of in the study coa gene.

Gene Primer Oligonucleotide sequence Gene bank accession no.

Amplicon size (bp)

Coagulase (coa)

Forward TGGTTTATGCCGGCTTTGATCAB436983.1 807

Reverse GCAGCAGCTTTCAATGACGGA


210

For PCR, each reaction mixture contained 2 μl of target DNA (approximately 260 ng/μl), 1 μl each of primers (20 pmol), 0.5 μl of a mix of deoxynucleotide triphosphate (200 μM each), 0.3 μl of Taq polymerase (5U) and 3 μl of PCR 10X buffer (Tris-HCl 100 mM; KCl 500 mM; Triton X-100 1% MgCl2; pH 8.4). The volume was adjusted to 30 μl with nuclease free water. All the reactants were thoroughly mixed and fl ash spun in microcentrifuge (St.Louis, MO, USA). Amplifi cation was carried out in a thermal cycler (MJ Mini Cycler Bio-Rad Laboratories, Hercules, California, USA) as follows: initial denaturation at 94ºC for 4 minutes, 30 cycles of amplifi cation (denaturation at 94ºC for 1 minute, annealing at 56 ºC for 1 minute and extension at 72ºC for 1 minute) and fi nal extension at 72ºC for 5 minutes. One positive control containing S. aureus reference strain MTCC No.96 (Microbial Type Culture Collection, Chandigarh, India) was included in each reaction. The PCR product was visualized by electrophoresis in 1.2% agarose gel containing 0.5 μg/ml ethidium bromide (Fermentas, Germany). The size of PCR product was determined by comparing with a standard molecular weight marker, and was photographed by gel documentation system (Alpha Imager™ 1220, Documentation and Analysis, Alpha Innotech Corporation, USA). The chi-square Test was used to assess association between the probability of developing Staphylococcal mastitis and region, CMT, SCC and bacterial examination.


The prevalence of bovine Staphylococcal (coa gene positive) mastitis (BSM) was studied in three distinct geo-climatic regions of India i.e., the sub-tropical humid climate zone of the

Bareilly region (Uttar Pradesh), the temperate and mountainous climatic zone of the Uttarakhand (Kumaoun) region and the tropical wet and dry climatic zone of the Rajnandgaon region (Chattisgarh). The prevalence of mastitis varied in these three distinct regions. The climatic conditions of Bareilly (U.P), Uttarakhand (Kumaon) and Rajnandgaon (Chattisgarh) are detailed in Table 2. One thousand twenty two (3934 functional quarters) cattle and buffaloes were screened for udder health status. In the present study, the prevalence of Staphylococcal mastitis (BSM) was 22.02% on animal basis and 8.64% on quarter basis in 1022 lactating dairy animals with 3934 functional quarters in three geo-climatic regions of India. The animal wise prevalence of BSM in Bareilly, Kumaoun and Rajnandgoan was 23.05%, 15.84% and 24.76% respectively. The prevalence of Staphylococcal intra-mammary infection (IMI) was higher to an extent of 45.54% in Bareilly and 56.31% in Rajnandgoan compared to the Kumaoun region.

Bacterial isolation and biochemical characterization in milk samples collected from Bareilly, Kumaoun and Rajnandgoan region of India

Out of 387 milk samples collected from mastitic quarters from Bareilly, 36 (9.30%) isolates were found coagulase positive Staphylococcus sp. (CPS) (Figure 1) and 110 (28.42%) isolates were coagulase negative Staphylococci (CNS). Whereas 6 (6.32%) and 22 (8.09%) milk samples from the Kumaoun and Rajnandgoa regions identifi ed as CPS, while 38 (40.0%) and 89 (32.72%) were identifi ed as CNS. The prevalence of CPS was 47.15% and 28.01% higher in the Bareilly and Rajnandgoan regions as compared to the Kumaoun region. The lowest prevalence (6.32%) of CPS was


211

recorded from the Kumaoun region.

Prevalence of Coagulase Positive Staphylococci in quarter milk samples from bovine mastitis in three geo-climatic regions of India Amplifi cation of the coagulase gene yielded a single PCR product of 807 bp in raw milk samples (Figure 2). The prevalence of CPS was higher to an extent of 39.89% and 25.74% in the Bareilly and the Rajnandgoan regions as compared to the Kumaoun region. The prevalence rate of CPS in quarter milk samples from mastitic cows and buffaloes varied signifi cantly with the two different methods used for identifi cation of the causitive organism i.e. by bacterial culture and PCR amplifi cation of the cao gene. Mastitic milk samples revealed growth in 9.3%, 6.32% and 8.09%, positive CPS by conventional culturing method from the Bareilly, Kumaoun and Rajnandgoan regions, respectively. Whereas S. aureus by PCR technique yielded the cao gene in 14.73%, 10.53% and 13.24% positive milk samples from the Bareilly, Kumaoun and Rajnandgoan regions, respectively (Table 3). The prevalence of coagulase positive S. aureus by the PCR technique was found to be higher to an extent of 58.39%, 66.61% and 63.66% as compared to bacteriological examination in the Bareilly, Kumaoun and Rajnandgoan regions, respectively. S. aureus is the most common cause of contagious and sub-clinical mastitis in dairy herds (Mukherjee and Dash, 2003). For implementation of preventive and control measures for bovine mastitis on a dairy farm, somatic cell count and bacteriological aspects must be assessed at frequent time intervals. The coagulase gene is one of the virulence factors of S. aureus; it determines the ability to coagulate mammalian plasma. Coa gene polymorphism is frequently applied for epidemiological investigations of bovine S. aureus

mastitis (Zecconi et al., 2006). Mukherjee et al., (2004, 2010) recorded 14.28% and 36% positive S. aureus mastitis in organized and unorganized dairy farms by bacterial and biochemical characterization. Moreover, the prevalence of CPS positive mastitic cases by isolating marker gene was reported from many countries (Su et al., 1999). Sindhu et al. (2010) reported 56% of quarter milk samples from buffaloes were positive for S. aureus based on detection of the coa gene in Haryana. Similarly, Ahmadi et al. (2010) reported 21% of the milk samples from cow were positive for S. aureus using amplifi cation of the coa gene in industrial dairy herds in Iran. In conclusion, case occurrence of Staphylococcal mastitis varied with the geo-climatic conditions of the area, with the greatest number of Staphylococcal intramammary infections in the tropical, dry climate of Rajnandgaon followed by subtropical humid climatic zone of Bareilly and the fewest number of cases in the temperate Kumaoun zone. Amplifi cation of the coa gene by PCR is an important technique for quick diagnosis of prevalent bacterial pathogens of a particular region. With the help of PCR, large numbers of lactating dairy animals can be screened with accuracy in less time in the study area.

ACKNOWLEDGEMENT

The fi rst author thanks IVRI Deemed University for the grant as Senior Fellowship for the Ph.D. research work.

REFERENCES

Ahmadi, M., S.M.R. Rohani and N. Ayremlou. 2010. Detection of Staphylococcus aureus


212

Table 2. Geographical and meteorological parameters of three geo-climatic regions of India.

Region Specifi cations Latitude LongitudeAir temp (degree celcius)

Average annual rainfall (mm)

Bareilly (Tropical & humid climate)

Hot & humid summer and cold winters, average three winter month

28o10Ń 78o23É 4.5-45.8 1032.0

Kumaoun (Temperate climate)

moderate summer and very cold winters, average six winter months

29o29Ń 79o39É Summer-17-26Winter-0 -14 1494.1

Rajnandgaon (Tropical climate and dry)

Hot and dry summer and moderate winters, average one winter months

20o70´ & 22o29´ N

81o29´ & 88o29´ E 8.4-46.6 1275.0

Table 3. Prevalence of coagulase positive staphylococci (CPS) (based on bacteriological and PCR method of identifi cation) in quarter milk samples from bovine mastitis in three geo-climatic regions of India.

Geo-climatic regions

Quarters screened

Positive for mastitis

Coagulase positive

mastitis on the basis of

bacterial culture

Coagulase positive

mastitis on the basis of PCR

Bareilly 1872 387 36 (9.3 %) 57 (14.73 %)Kumaoun 856 95 6 (6.32 %) 10 (10.53%)Rajnandgoan 1206 272 22 (8.09%) 36 (13.24 %)

Wald Chi-square (P value) = <0.0001, Intercept (P value) = <0.0001. Paired T Test Results: DF = 2, t value = 13.36; Pr>ItI = 0.006.


213

Figure 1. Coagulation of rabbit plasma by pathogenic Staphylococcus aureus isolated from mastitic milk samples.

Figure 2. Amplifi cation of Coagulase gene from mastitic milk samples.

Coagulase negative sample

Lane M – 1kbp molecular weight markerLane 1 - S. aureus reference strain MTCC 96Lane 2 and 3 - S. aureus positive samples

Coagulase positive sample Coagulation of plasma


214

in milk by PCR. Comp. Clin. Pathol., 19: 91-94.

Balows, A., W. HousherJr, K.L. Herrman, H.D. Isenberg and H.J. Shadoms. 1991. Manual of Clinical Microbiology, 5th ed. American Society of Microbiology, Washington DC, USA.

Bradley, A.J., K.A. Leach, J.E. Breen, L.E. Green and M.J. Green. 2007. Survey on the incidence and aetilogy of mastitis on dairy farms in England and Wales. Vet. Record., 160: 253-258.

Makovec, J.A. and P.L. Ruegg. 2003. Results of milk samples submitted for microbiological examination in Wisconsin from 1994 to 2001. J. Dairy Sci., 86: 3466-3472.

Mukherjee, R. and P.K. Dash. 2003. Immunomodulatory and therapeutic potential of enrofl oxacin in bovine. Sub clinical mastitis. Asian Austral. J. Anim., 16: 889- 893.

Mukherjee, R., P.K. Dash, G.C. Ram and T. Goswami. 2004. The activity of milk leukocytes in response to a water-soluble fraction of Mycobacterum phlie in bovine sub clinical mastitis. Vet. Res. Commun., 28: 47-54.

Mukherjee, R., U.K. De and G.C. Ram. 2010. Evaluation of mammary gland immunity and therapeutic potential of Tinospora cordifolia against bovine sub clinical mastitis. Trop. Anim. Health Prod., 42: 645-649.

Ott, S. 1999. Costs of herd-level production losses associated with subclinical mastitis in US Dairy Cows, p. 152-156. In Proceedings of the 38th Annual Meeting of the National Mastitis Council, Arlington VA.

Natl Mast Coun. Madison ,W.I., Ruegg, Pamela. 2011. Emerging Mastitis Threats on the

Dairy. http://milkquality.wisc.edu/wp-content/uploads/2011/09/

Schalm, O.W., E.J. Carrol and N.C. Jain. 1971. Bovine Mastitis. Lea and Febiger, Philadelphia.128-129.

Shpigel, N.Y., M. Winkler, G. Ziv and A. Saran. 1998. Clinical, bacteriological and epidemiological aspects of clinical mastitis in Israeli dairy herds. Prev. Vet. Med., 35: 1-9.

Sindhu, N., A. Sharma and V.K. Jain. 2010. Coagulase gene based molecular detection of Staphylococcus aureus directly from mastitis milk samples of Murrah buffalo. Buff. Bull., 29: 62-69.

Su, C., C. Herbelin, N. Frieze, O. Skardova and L.M. Sordillo. 1999. Coagulase gene polymorphism of Staphylococcus aureus isolates from dairy cattle in different geographical areas. Epidemiol. Infect., 122: 329-336.

Zecconi, A., L. Cesaris, E. Liandris, V. Dapra and R. Piccinini. 2006. Role of several Staphylococcus aureus virulence factors on the infl ammatory response in bovine mammary gland. Microb. Pathog., 40(4): 177-183.


215

ABSTRACT

Somatic cell count (SCC), total bacterial count (TBC), L selectin and CD 18 on milk leukocytes was studied in buffaloes infl icted with intramammary infection in response to Curcuma longa (C. longa, CL) and vitamin E plus selenium (group II), Enrofl oxacin (group III) and sterile PBS (group IV). Signifi cant reduction (P<0.05) in SCC, TBC was observed in post-treated buffalo cows. The mean fl uorescent intensity (MFI) of L selectin increased signifi cantly (P<0.05) in Group 2 post-treated cows; however, there was no reduction in CD 18 counts in this group. The results suggest that Curcuma longa (CL) possesses antibacterial, anti-infl ammatory and immunomodulatory properties. In the present study the biological activity of the CL and vitamin E plus selenium at standardized dose against mastitis in buffalo cows is reported for the fi rst time. Development of alternative therapy is an option for livestock farmers who are not allowed to use allopathic drugs under certain farming system.

Keywords: CD 18, Curcuma longa, L selectin, mastitis, vitamin E

INTRODUCTION

Considerable progress has been made through extensive research on bovine mastitis, still it continues to be the most frequent and costly disease of dairy animals (Ruegg, 2010). Leukocyte migration from the central pool into the infected udder depends on the activation of leukocyte adhesion molecules (LAM), however the expression of LAM like L selectin is generally lower during periparturient period and mastitis (Paape et al., 2002). Antibiotics are used for the treatment of mastitis, but it has got few limitations, like development of antimicrobial resistance and antibiotic residue in milk. Few antibiotics also reduce the functional activities of the immune cells. Curcuma longa (CL) or turmeric belongs to Zingiberaceae family, the rhizomes possess antimicrobial, anti-infl ammatory, antioxidant and immunomodulatory properties (Menon and Sudhir, 2007). Antimicrobial activity of Curcuma longa against S. aureus, S. epidermis, E. coli, Pseudomonas aeruginosa and Salmonella typhimurium was observed by many researchers (Singh et al., 2002, Han yang, 2005). Micronutrients and vitamins like

MILK LEUKOCYTE ADHESION MOLECULES IN RESPONSE TO Curcuma longa PLUS α -TOCOPHEROL AND SELENIUM IN MASTITIC RIVERINE BUFFALOES

Reena Mukherjee1, R.K. Jadhav2 , Nitika Sharma3, B.D. Sahu2 and U.K. De4

1Preventive Medicine Laboratory, Division of Medicine, Indian Veterinary Research Institute, Izatnagar, Uttar Pradesh, India, E-mail: [email protected] of Medicine, Indian Veterinary Research Institute, Izatnagar, Uttar Pradesh, India3Central Institute of Research on Goats, Farah, Uttar Pradesh, India4Indian Veterinary Research Institute, Izatnagar, Uttar Pradesh, India

Original Article


216

Selenium and Vitamin E helps in reducing severity and duration of clinical mastitis by alleviating infl ammatory metabolites from the site of infection and by improving leukocyte activities (Politis et al., 2004; Smith et al., 1997, Mukherjee, 2008). There are no reports regarding the immunotherapeutic potential of CL against bovine mastitis. The present study, therefore, is an effort to evaluate the potential of CL along with selenium and vitamin E on the somatic cell count (SCC), total bacterial count (TBC) and milk LAM from the lactating buffalo cows infl icted with intramammary infection.


Hydro-methanolic extract of C. longa (CL) was prepared as per (Peach and Tracy, 1956). The antibiogram and MIC of the extract was done as per standard method (NCCLS, 1997) against Staphylococcus aureus, CNS, Streptococcus agalactiae, Streptococcus uberis and Coliform bacilli. The dose was determined on the basis of mean MIC of the extract against the pathogens Twenty-four crossbred lactating buffaloes were divided in four equal groups. Buffalo cows of Group 1, selected where milk SCC < 0.5 million cells /ml of milk, served as control. Eighteen mastitic animals selected formed Groups 2, 3 and 4 positive for intramammary infection were taken for the drug trial, selection criteria being the SCC >0.7 million cells /ml of milk and milk secretions positive for pathogenic isolate. Buffalo cows of Group 2 received 150 mg of sterile CL extract per teat after reconstituting in 5 ml warm PBS by i/ mam route with a sterile antibiotic dispensing canula for 5 days. Vitamin E plus selenium was also given at the rate of 10 ml per buffalo by intramuscular route on day 0 only. Group 3 buffaloes were treated

with enrofl oxacin at the dose rate of 3 mg per kg body weight by i/m route for 5 days or till clinical recovery. Group 4 animals received 5 ml of sterile PBS for 5 days by i/mam route. SCC and TBC of the milk samples were done as per the standard method (Schalm et al., 1971) (Balows et al., 1991). The identifi cation and biochemical characterization of causative organism in collected milk samples was carried as per (Balows et al., 1991). SCC and TBC were done on day ‘0’ and thereafter on 2, 10 days PT. Milk leukocytes were isolated as per the method describe by Daley et al. (1991) for enumeration of CD 18 and L- Selectin in milk PMNs. About 100 μl of milk cell suspension was incubated in the dark with 1 μl of primary antibodies against CD 18 and L- Selectin for 30 minutes at room temperature. CD 18 and L-Selectin was done by using commercial kit (CD 18 ,Clone- BAQ30A, Isotype- IgG1, VMRD, Inc. Pullman, WA, USA and L-Selectin, Clone- DU1-29, Isotype- IgG1, VMRD, Inc. Pullman, WA, USA) as per method described by Soltys and Quinn (1999). The data were analyzed applying one-way analysis of variance (ANOVA) to determine the level of signifi cance between the groups, and Duncan’s multiple range test (DMRT) was applied to determine the level of signifi cance within the group at different time intervals by using an SPSS 10.1 software package.


There were no differences in SCC and TBC in the milk samples isolated from healthy cows at different time intervals of the study period. The SCC and TBC in Group 2 and Group 3 signifi cantly decreased (P<0.05) on day 7 and day 15 (Table 1). Out of 14 milk samples collected


217

from diseased buffalo cows, the organisms isolated were Staphylococcus aureus (7%), CNS (56%), Streptococcus agalactiae. (3%), Streptococcus uberis (9%), Coliform bacilli (14%), no growth (11%). Mean fl uorescent intensity of L selectin was lower in mastitic cows (P<0.05) before treatment. However, the expression increased (37.42%) in Group 2 cows on day 7, whereas non-signifi cant increased expression of L selectin was recorded in Group 3 posttreated animals (Table 2). Contrary to values of L selectin, the expression of CD18 was higher in the PMNs isolated from mastitic cows both before and after treatment (P<0.05). However, it reduced signifi cantly (P<0.05) in Group 3 (42.26%) on day 7 as compared to pretreatment values and Group 2 (Table 2). Mastitis is one of the major causes of economic loss in dairy cattle. Once established in the udder, it impairs alveolar function, reduces milk yield and has a deleterious effect on milk composition, including increased milk SCC and bacterial load. In the present study the SCC and TBC were higher in mastitic buffalo cows before treatment (P<0.05). Regulation of PMNs migration from the central pool to the infected site is of great importance for host defense against mastitis (Paape et al., 2002). For appropriate elimination of pathogen the effectiveness of the drug and optimum functioning of the hosts’ immune system is required. In and around the calving period there is down-regulation of selectins, which affects migration of leukocytes into the udder parenchyma and its functional activities (Lee and Kehrli, 1998; Paape et al., 2002). Leukocyte activities can be modulated by number of specifi c and non-specifi c mediators (Smith, 1994). Antibiotics are used to treat mastitis, but they are not effective in removing the infl ammatory metabolites from the tissue milieu and also contaminate the milk (Erskine, 2000).

In the present drug trial signifi cant reduction of SCC and TBC was observed in Group 2 treated with CL along with i.m. administration of vitamin E and selenium; however, the therapy enhanced the expression of L selectin and did not reduced the MFI of CD 18 in post- treated buffalo cows. On the contrary, the expression of CD 18 reduced signifi cantly in Group 3 cows treated with enrofl oxacin.

C. longa, commonly known as ‘turmeric’, is widely used as a spice in Indian cuisine. The rhizome possess several medicinal properties. Curcumin is the main phytochemical principal of CL attributing a wide array of biological activities such as antioxidant, anti-infl ammatory, wound-healing, antifungal and antibacterial activity (Singh et al., 2002). Singh et al. (2002) observed inhibition of growth of pathogenic S aureus with CL extract. Menon and Sudhir (2002) suggested that the therapeutic effect of CL could be due to its anti-infl ammatory and antioxidant properties. Udder health in lactating animals is also infl uenced by the dietary status, supplementation of selenium and vitamin E in feed of lactating dairy cows was found to improve leukocyte migration, phagocytosis and intracellular killing respectively (Smith et al., 1997). It has been observed that supplementation of micronutrients and vitamin E in feed helps in reducing severity and duration of clinical mastitis and helps in alleviating the acute phase response from the site of infection (Politis et al., 2004).There are several reports on the therapeutic effect of vitamin E and selenium against mastitis; however, its synergistic effect with CL against mastitis, particularly the leukocyte activities, are undefi ned. In conclusion, this study represents an initial investigation into the synergistic effect of vitamin E plus selenium and CL on the activity of L selectin, CD 18, SCC and TBC in mastitic buffalo cows.


218

Table 1. Somatic cell count (SCC) 1x 10 5 cells / ml and total bacterial count (TBC) 1x 10 3 cells / ml of milk in response to the treatment with C. longa plus Vitamin E and selenium (Group 2) and Enrofl oxacin (Group 3) and sterile PBS (Group 4) mastitic cows and in normal healthy cows (group I) (mean ± SE).

Groups Days post treatmentSCC Day 0 Day 7 Day 15Gr I 2.79 ± 1.22x 3.02 ± 1.26 x 3.09 ± 1.14 x

Gr II 8.87 ± 1.09 a, y 5.26 ±1.04 b, y 5.09 ±1.16 c, y

Gr III 9.07 ±1.01 a, y 5.03 ±1.17 b, z 5.07 ± 1.05 b, y

Gr IV 8.53 ± 1.33 a, y 8.12 ± 1.72 a, y 7.46 ± 1.96 a, y

TBCGr I 0.27±1.11a,w 0.26±1.23a,w 0.27±1.21a,w

Gr II 2.86±1.21a,x 1.09±1.07b,x 0.82±1.12c,x

Gr III 3.06±1.73a,x 0.98±1.05b,y 0.58±1.79c,y

Gr IV 2.75±1.66a,x 2.53±1.95a,x 2.21±1.59a,x

*Values with different superscripts in each rows (a, b) and each column (w, x, y) differ signifi cantly (P<0.05).

Table 2. Expression of L selectin and CD 18 in response to treatment with C. longa plus vitamin E and selenium (Group 2) and enrofl oxacin (Group 3) and sterile PBS (Group 4) mastitic cows and in normal healthy cows (group I) (mean ± SE).

Group of cows

L selectin on milk PMNs CD 18 in milk PMNsDay 0 Day 8 Day 0 Day 8

Group 1 4.66±1.37 x 4.59±1.29 x 5.93±1.49 x 5.84±1.41 x

Group 2 1.99±1.52 y, a 3.18±1.16y ,b 8.63±1.68 a, y 7.81± 1.17 b, x

Group 3 2.01±1.17y 2.22±1.09z 8.28.±2.03 a, y 5.82±1.20 b,y

Group 4 2.26±1.32y 2.15±1.44y 8.35±2.03 a, y 7.25±1.87a, y

*Values with different superscripts in each rows (a, b) and each column (x, y, z) differ signifi cantly (P<0.05).


219

The results indicate the enhanced cellular defense of the diseased mammary gland and subsequently reduction in infection and infl ammation.

ACKNOWLEDGEMENTS

The authors thank Dr. B. Sharma, National Professor for his expertise in FACS analysis. The junior authors also thank the Indian Council Agricultural Research, New Delhi for providing Junior Research Fellowship.

REFERENCES

Balows, A., W. HousherJr, K.L. Herrman, H.D. Isenberg and H.J. Shadoms. 1991. Manual of Clinical Microbiology, 5th ed. American Society of Microbiology, Washington DC, USA.

Erskine, R.J. 2000. Antimicrobial drug use in bovine mastitis. In Antimicrobial Therapy in Veterinary Medicine. Eds Prescott, J.F., J.D. Baggot and R.D. Walker. Iowa State University Press. 712-734.

Han, S. and Y. Yang. 2005. Antimicrobial activity of wool fabric treated with curcumin. Dyes and Pigments, 64: 157-161

Lee, E.K. and M.E. Kehrli. 1998. Expression of adhesion molecules on neutrophils of periparturient cows and neonatal calves. Am. J. Vet. Res., 59: 37-43.

Menon, V.P. and A.R. Sudheer. 2007. Antioxidant and anti-infl ammatory properties of curcumin. Adv. Exp. Med. Biol., 595: 105-125.

Daley, M.J., E.R. Oldham, T.J. Williams and P.A. Coyle. 1991. Quantitative and qualitative

properties of host PMN cells during experimentally induced Staphylococcus aureus mastitis in cows. Am. J. Vet. Res., 52: 474-479.

Mukherjee, R. 2008. Selenium and vitamin E increases polymorphonuclear cell phagocytosis and anti-oxidant levels during acute mastitis in riverine buffaloes. Vet. Res. Commun., 32: 305-313.

NCCLS (National Committee for clinical laboratory standards). 1997. Performance Standards for Antimicrobial Disc Susceptibility Test, 6th ed. Approved Standard, Wayne, PA. M2-A6.

Paape, M., J. Mehrzad, X. Zhaom, J. Detilleuxm and C. Burvenich. 2002. Defense of the bovine mammary gland by polymorphonuclear neutrophil leukocytes. J. Mammary Gland Biol. Neoplasia., 7: 109-121.

Peach, K. and M.V. Tracy. 1956. Modern Method of Plant Analysis, Vol. 1, Berlin, Springer Verlog. 26-54.

Politis, I., I. Bizelis, A. Tsiaras and A. Baldi. 2004. Effect of vitamin E supplementation on neutrophil function, milk composition and plasmin activity in dairy cows in a commercial herd. J. Dairy Res., 2004, 71: 273-278.

Schalm, O.W., E.J. Carroll and N.C. Jain. 1971. Number and types of somatic cells in normal and mastitic milk, p. 94-127. In Schalm, O.W., E.J. Carroll and N.C. Jain (eds.) Bovine Mastitis, 1st ed. Lea and Febiger, Philadelphia, PA.

Singh, R., C. Ramesh, M. Bose and P.M. Luthra. 2002. Antibacterial activity of Curcuma longa rhizome extract on pathogenic bacteria. Curr. Sci., 83: 737-740.

Ruegg, P.L. 2010. The application of evidence based


220

veterinary medicine to mastitis therapy, World Buiatrics Congress, Santiago Chile.

Smith, K.L., J.S. Hogan and W.P. Weiss. 1997. Dietary vitamin E and selenium affect mastitis and milk quality. J. Anim. Sci., 75: 1659-1665.

Soltys, J. and M. Quinn. 1999. Selective Recruitment of T-cell subsets to the udder during Staphylococcal and Streptococcal mastitis: Analysis of lymphocyte subsets and adhesion molecule expression. Infect. Immun., 67: 6293-6302.


221

ABSTRACT

In the present study, superovulatory response was determined in eight healthy matured Berari (Nagpuri) buffaloes which were divided in two groups (A and B). The superovulatory treatment was started in donor buffaloes from the 10th day after induced estrus. Animals in Group A and Group B were administered, respectively, with 500 mg and 560 mg FSH-P in descending doses (100, 75, 50, 25 mg and 100, 80, 60, 40 mg twice daily) for four consecutive days. PGF2α (Lutalyse) 25 mg was injected to all the animals in both groups after 72 h of initiation of superovulatory treatment. Oestrus was recorded in all the buffaloes under study. Onset and length of superovulatoryoestrus in Groups A and B were recorded to be 20.00±0.00 h, 36.50±5.50 h and 19.00±0.00 h, 38.75±3.32 h, respectively. Per rectal assessment of superovulatory response on the 6th day after the last FSH-P injection revealed the average number of corpora lutea and unovulatory follicles per donor buffalo in Group A and Group B to the tune of 3.00±0.71, 1.00±0.00 and 2.75±0.48, 1.50±0.29, respectively. No signifi cant difference was recorded in terms of superovulatory response in either group at 5 percent level (P < 3.185).

Keywords: buffalo, Berari (Nagpuri), superovulation

INTRODUCTION

Indian buffaloes constitute more than 50 percent of the world buffalo population. Region specifi c breeds of buffaloes are still reared in rural India with Murrah as an exception. The Berari (Nagpuri) buffalo is a native breed of the Vidarbha region of Maharashtra. This breed is common in Akola, Buldhana, Yeotmal, Washim, Amravati and Nagpur districts. Infertility is the most common cause of reproductive failure especially in buffaloes. Silent estrus coupled with low conception rate, seasonality of breeding, higher optimal age at fi rst calving, anoestrus and repeat breeding are some of the major constraints associated with buffalo reproduction. Although, artifi cial insemination (AI) technique has signifi cantly enhanced timely conception in milch animals, roblems of infertility and silent oestrus in buffaloes are still persistent. Oestrus synchronization and superovulation coupled with embryo transfer technology are proved to be promising tools in animal reproduction and has been found to be advantageous in national breeding

EFFECT OF TWO DIFFERENT DOSES OF FSH-P (FOLLTROPIN-V) ON SUPEROVULATION IN BERARI (NAGPURI) BUFFALOES (Bubalus bubalis)

A.R. Ratnaparkhi1, C.H. Pawshe2, S.K. Sahatpure2, S.A. Chede2, A.P. Gawande2, M.S. Patil2 and R.P. Kolhe2

1Department of Veterinary Public Health KNP, College of Veterinary Science, Shirwal, Tal-Khandala, Dist-Satara, Maharashtra-412 801, India, E-mail: [email protected] of Animal Reproduction, Post Graduate Institute of Veterinary and Animal Sciences, Krishinagar Akola-444104, Maharashtra, India

Original Article


222

programme. The process of superovulation means the increased capacity of the dam to produce a greater number of ova by injecting gonadotrophines. This technique is highly useful for the improvment and conservation of native germplasm and increasing number of offsprings from donor females at faster rate (Misra et al., 1990, Patel et al., 2010).

The superovulation of donor females has been traditionally done by the single intramuscular injection of pregnant mare serum gonadotropine (PMSG) but, nowadays injections of pituitary extract containing follicle stimulating hormone (FSH-P) are used. FSH is usually given within a period of 4 to 5 days at the mid luteal stage of the oestrus cycle through a series of injections so that follicles are recruited immediately prior to the lysis of the existing corpus luteum. The results of superovulation in buffalo are disappointing when compared with those in cattle (Lindsell et al., 1986). FSH-P preparations proved to be effective in superovulating cattle and produce no evidence of reduced embryo quality at high dosage (Wang et al., 1988; Mapletoft et al., 1988). Information about superovulation in Berari (Nagpuri) buffaloes is lacking in the available literature. Therefore, the present study was proposed with the objective of investigating the effect of two different doses of FSH-P (Folltropin -V) on superovulation in Berari buffaloes.


Selection of animals: Eight (n=8) normal, healthy, cyclic Berari (Nagpuri) buffaloes free from any pathological and reproductive disorder were selected from the experimental animals of the ICAR - Embryo Transfer Technology project being implemented at the Department of Gynaecology,

Dr. Panjabro Deshmukh Krishi Vidyapeeth, campus Akola. All the animals were maintained under uniform stall fed condition throughout the study.

Synchronization and Superovulation: All buffaloes showing regular cyclic activity for two consecutive cycles and those with an active corpus luteum were selected and oestrus was synchronized by administering 25 mg Lutalyse (prostaglandin F2

alpha analogue) intramuscularly on day 0 and day 11. Synchronization of oestrus was determined on the basis of 1) effi cacy of PGF2α for induction of synchronized oestrus, 2) time required for the onset of oestrus and 3) length of synchronized oestrus. Eight buffaloes, synchronized by injection PGF2α were divided into two groups (A and B). Folltropin-V (FSH-P) was used for superovulation. Superovulatory treatment commenced from the 10th day during the mid luteal stage of the oestrus cycle. The protocol for superovulation is shown in Table 1. Experimental buffaloes were closely observed after treatment for induction of oestrus. The superovulatory response was estimated by per rectal palpation on day 6 after the last FSH-P injection.

Data analysis: The data collected were analyzed statistically and the difference in superovulatory response was tested using the student’s t-test.

RESULTS

a) Oestrus response and the time required for onset of oestrus: The intramuscular injection of 25 mg Lutalyse was given to eight normal cyclic Berari (Nagpuri) buffaloes. Of the eight buffaloes, seven


223

(87.50 percent) exhibited oestrus, and on the 11th day the second intramuscular injection at same dose was again given. All buffaloes (100.00 percent) exhibited oestrus to the 2nd dose. The results of synchronization of oestrus are shown in Table2.

b) Length of oestrus: The length of synchronized oestrus after the fi rst PGF2α injection ranged from 22 to 28 h with an average of 20.80 ± 3.07 h. However, after the second injection of PGF2α, the length of oestrus was slightly higher (22-36 h) with an average of 26.50 ± 1.59 h. The mean time required for induction of oestrus after the fi rst and the second injection of PGF2α (Lutalyse) were 36.75 ± 6.10 h and 34.75 ± 2.74 h, respectively.

c) Onset and duration of superovulatory oestrus: The time required for onset of oestrus after superovulatory treatment in Group A buffaloes was 20.00 ± 0.00 h and that in Group B was 19.00 ± 0.00 h. The aggregate average of onset of superovulatory oestrus in both the groups was 19.50 ± 0.18 h. The calculated ‘t’ value (2.00) for both groups elicited non-signifi cant differences at 5 percent level of signifi cance (3.182). The length of oestrus during superovulatory treatment in Group A buffaloes was 36.50 ± 5.50 h and that in Group B buffaloes was 38.75 ± 3.32 h ; however, the length of superovulatory oestrus in Group A was 26-46 h and while that in Group B was 29-44 h.

d) Superovulatory response: On the basis of number of palpable corpora lutea and unovulatory follicles on both the ovaries, the superovulatory response was graded manually. In the present studies, the number of corpora lutea in Group A

buffaloes treated with 500 mg FSH-P ranged from two to fi ve with an average of 3.00 ± 0.71, whereas in Group B buffaloes treated with 560 mg FSH-P, the number ranged from two to four with an average of 2.75 ± 0.48. Calculated ‘t’ value (0.245) elicited non-signifi cant differences between the two groups (3.182) at 5% level. The number of unovulatory follicles in Group A buffaloes ranged from zero to one with an average of 1.0 ± 0.00, whereas the number in Group B buffaloes ranged from one to two with an average of 1.5 ± 0.26. No signifi cance difference was recorded between the two groups. Numbers of corpora lutea were nonsignifi cantly higher with 500 mg FSH-P dose as compared to 560 mg FSH-P.

DISCUSSION

In the present study, the time required for onset of oestrus was shorter; however, longer onset times have been recorded earlier by Pant and Singh (1980), Kamonpatana et al. (1979), Rajeshwaran et al. (1992) who recorded the time required for onset of oestrus to be 50.33 ± 9.46 h, 69.3 ± 5.6 h, 71.33 ± 6.38 h, respectively. The length of oestrus was longer with the second PGF2α injection than with the fi rst injection of PGF2α. The student’s’ test (1.81) elicited non-signifi cant differences (2.365). The present fi ndings are also in agreement with Rao et al. (1982), Kaikini and Pargaonkar (1969) and Patil (2000) who recorded the average duration of oestrus to be 24.18 ± 0.69 h, 28.61 ± 0.51 h and 26.14 ± 1.39 h, respectively in Berari buffaloes. Patil (1997) also recorded the average duration of oestrus to be 25.50 ± 1.79 h. In the studies of Chede (1990) and Chouhan et al. (1992) it was respaectively 28.61 ± 2.62 h and 28.40 ± 10.07 h, which are higher as compared to present fi ndings.


224

Table 1. Treatment schedule of superovulation in Berari (Nagpuri) buffaloes.

Days of oestrus cycle

Time Donor buffalo treatment

Folltropin - V 500 mg (Group - A)

Folltropin - V 560 mg (Group - B)

10th dayMorning 100 mg 100 mgEvening 100 mg 100 mg

11th day Morning 75 mg 80 mgEvening 75 mg 80 mg

12th day Morning 50 mg 60 mgEvening 50 mg + PGF2α 25 mg 60 mg + PGF2α 25 mg

13th day Morning 25 mg 40 mgEvening 25 mg 40 mg

19th dayPer rectal estimation of superovulatory response

Table 2. Synchronization response and average time required for induction of oestrus in Berari (Nagpuri) buffaloes.

PGF2α analogue used for

synchronizationTreatment

Response to the synchronization treatment

Average time required

for onset of oestrus (h)

Range for time required

(h)No. of

buffaloes treated

No. of buffaloes

responded

Dinoprost (Lutalyse)

25 mg

First injection

Second injection

8

8

7 (87.50 %)

8 (100.00%)

36.75 ± 6.10

34.75 ± 2.74

29-53

25-43


225

The aggregate average of onset of superovulatory oestrus in both the groups was 19.50±0.18 h. The onset of superovulatory oestrus in both groups was shorter; however, some of researchers recorded average times required for onset of superovulatory oestrus in buffaloes ranging from 28 to 33 h (Taneja et al., 1995; Mathroo and Meharsingh, 1997; Sartape, 1999). Non-signifi cant differences between the two groups at 5 percent level of signifi cance (3.182) were also recorded (‘t’ value -0.508) in terms of length of oestrus during superovulatory treatment. These fi ndings are corroborative with the fi ndings of Sartape (1999) and Yadav et al. (1985) who recorded the average duration of oestrus to be 39.8±1.64 h and 41.3±1.25 h, respectively. No signifi cant difference was recorded with superovulatory response and presence of unovulatory follicles when ovaries were palpated manually. Numbers of unovulatory follicles were non-signifi cantly lower with the 500 mg dose schedule. These fi ndings are in close agreement with the studies of Mathroo and Meharsingh (1997), Taneja et al. (1995), Singla and Madan (1990). These results are also in accordance with those of Drost et al. (1986) and Singh and Narayana (1997) who recorded the average number of unovulatory follicle to be 1.50 and 1.4 ± 0.21, respectively.

Motwani (1986), Misra et al. (1991) and Beg et al. (1997) recorded slightly higher average numbers of unovulatory follicles viz. 2.2 ± 0.82; 2.67±0.71 and 3.00±1.05, respectively. A comparatively better superovulatory response was obtained in buffaloes injected with 400 mg of FSH than those injected with 600 mg in the studies by Patel et al. (2010). A non-signifi cant increase in number of unovulatory follicles in 600 mg (1.90±0.67) compared to 400 mg (0.88±0.44) of FSH dose was observed. Such variation in results could be attributed to differences in location, breed, hormonal treatments and individual response to the treatment.

CONCLUSION

The response of synchronization of oestrus, time required for onset of oestrus and length of oestrus needs to be studied in a larger number of buffaloes in breeding and non-breeding seasons. Because of variable response to the two FSH-P treatment recorded in the individual buffaloes in the present studies, it is suggested that the trials on similar lines should be conducted in a larger number of donor buffaloes and in different seasons

Table 3. Onset and duration of oestrus in superovulated Berari (Nagpuri) buffaloes.

Sr. No. Groups Number of

animalsAverage onset of

oestrus (h)

Average length of oestrus (h) (with

range in h)

1 Group-I FSH-P (500 mg treatment) 4 20.00 ± 0.00 36.50 ± 5.50

(26-46)

2 Group-II FSH-P (560 mg treatment) 4 19.00 ± 0.00 38.75 ± 3.32

(29 - 44)

Aggregate average (h) 8 19.50 ± 0.18 37.62 ± 3.01 (26-46)


226

of the year.

REFERENCES

Beg, M.A., P.C. Sanwal and M.C. Yadav. 1997. Ovarian response and endocrine changes in buffalo superovulated at mid luteal and late luteal stage of the oestrus cycle. Theriogenology, 47: 423-432.

Chede, S.A. 1990. Patterns of oestrus, oestrus behaviour and synchronization in buffaloes. Ph.D. Thesis submitted to Dr. Panjabrao Deshmukh Krishi Vidyapeeth, Akola.

Chouhan, K.R., R.A. Chaudhary, N.U. Khan, N.A. Chaudhary and M. Ahmed. 1992. Oestrus behaviour and fertility in normal cycling and oestrus synchronized buffaloes. Indian J. Dairy Sci., 45: 588-590.

Drost, M., M. Wright and R.P. Elsden .1986. Intergeneric embryo transfer between water buffalo and domestic cattle. Theriogenology, 25: 13-23.

Kaikini, A.S and D.R. Pargaonkar.1969. Nagpuri buffalo. Indian Dairyman, 21: 47-48.

Kamonpatana, M.A., P. Kunawongkrit, Bodhipaksha and Y. Luvita. 1979. Effect of PGF2α on serum prostaglandin levels in swamp buffalo (Bubalus bubalis) J. Reprod. Ferti, 56: 445-448.

Lindsell, G.E., B.D. Murphy and R.J. Mapletoft. 1986. Superovulatory and endocrine response in heifers treated with FSH-P at different stages of the estrus cycle. Theriogenology, 33: 1131-1147.

Mapletoft, R.J., A. Gonzalez and A.G. Lussier. 1988. Superovulation of buffalo heifers with Folltropin or FSH-P. Theriogenology, 29: 274.

Mathroo, J.S. and Meharsingh. 1997. Seasonal variation in superovulatory response and embryo recovery in buffalo (Bubalus bubalis). Indian J. Anim. Reprod., 18: 125.

Misra, A.K., B.V. Joshi, P.L. Agrawala, R. Kasiraj, S. Sivaiah, N.S. Rangareddi and M.U. Siddiqui. 1990. Multiple ovulation and embryo transfer in Indian buffaloes (Bubalus bubalis). Theriogenology, 33: 1131-1142.

Misra, A.K., B.V. Joshi., P.L. Agrawala., R. Kasiraj., S. Sivaiah and N. S. Rangareddi. 1991. Improved super ovulatory regimen for buffalo (Bubalus bubalis). Theriogenology, 35: 245.

Motwani, K.T. 1986. Superovulation, non surgical recovery and embryo transfer in the water buffalo (Bubalus bubalis). Indian J. Anim. Reprod., 7: 100-101.

Pant, H.C and G.D. Singh.1980. Control of oestrus cycle in buffalo with a synthetic analogue of prostaglandin F2 alpha (ICI 80,996). Indian Vet. J., 57: 870- 871.

Patel, D.V., S.P. Singh, H.R. Shukla, C.P. Devanand and R. Kasiraj. 2010. Superovulatory response to FSH and embryo recovery rate in pandharpuri buffaloes (Bubalus bubalis). Buffalo Bull., 29(4): 244-249.

Patil, G.R. 1997. Oestrus response in post partum anestrus buffaloes treated. with progesterone and prostaglandin during low breeding season. M.V.Sc. Thesis submitted to Dr. Panjabrao Deshmukh Krishi Vidyapeeth, Akola.

Patil, M.S. 2000. Comparative effi cacy of two different prostaglandin F2 alpha analogues : Dinoprost (Lutalyse) and Luprostiol (Prosolvin) for inducing synchronized oestrus in Nagpuri buffaloes. M.V.Sc. Thesis submitted to Dr. Panjabrao Deshmukh


227

Krishi Vidyapeeth, Akola.Rajeshwaran, S., A.K. Misra and B.V. Joshi.1992.

Synchronization of oestrus in Surti buffaloes. Indian J. Anim. Reprod., 13: 20-22.

Rao, V.P., D.B. Reddy and T. Gopalkrishnan. 1982. Note on oestrus, oestrus cycle and time of ovulation in murrah buffaloes. Indian J. Anim. Sci., 52: 354-355.

Sartape, B.P. 1999. Superovulatory response with FSH-P in Nagpuri buffaloes synchronized by Norgestomet ear implant with supplementary Norgestomet oestradiol injection. M.V.Sc. Thesis submitted to Dr. Panjabrao Deshmukh Krishi Vidyapeeth, Akola.

Singh, A.K and K. Narayana.1997. Superovulation in Murrah buffaloes. Indian J. Anim. Reprod., 18: 77.

Singla, S.K and M.L. Madan. 1990. Response of superovulation in buffaloes (Bubalus bubalis) with Super-ov and FSH-P. Theriogenology, 33: 327.

Taneja, M., S.M. Totey and A. Ali. 1995. Seasonal variation in follicular dynamics of superovulated Indian water buffalo. Theriogenology, 43: 451-564.

Wang, H., W.U.M., B.D. Murphy and R.J. Mapletoft. 1988. Superovulation of buffalo heifers with Folltropin: a dose trial. Theriogenology, 29: 332.

Yadav, M.C., K.E. Leslie and J.S. Walton. 1985. The onset and duration of ovulation in superovulated beef heifers. Theriogonology, 23: 237.


228

ABSTRACT

The present research was carried out to study the effect of GnRH and PGF2α administration on uterine involution and post-partum fertility in buffaloes. A total of 36 normally calved Murrah buffaloes were divided into three groups. The buffaloes of Group1 were treated with GnRH (buserelin acetate) 0.020 mg while buffaloes of Group 2 with PGF2α (cloprostenol sodium) 1.30 mg on day 14 post-calving intramuscularly while the buffaloes of Group 3 were kept as control. The average days required for involution of the uterus were 25.08±1.04, 22.75±0.91 and 30.33±1.31 while the average days required for exhibition of fi rst post-partum oestrus were 37.5±5.16, 26.91±1.36 and 45.08±3.77 days in Groups 1, 2 and 3, respectively. The fi rst service conception rate was highest 41.66% in Group 2 while the rates were 33.33 and 16% in Groups 1 and III, respectively.

Keywords: buffaloes, Bubalus bubalis, post-partum, fertility, GnRH, PGF2α

INTRODUCTION

The buffalo occupies an important place in the livestock economy of Asia and India. Buffaloes are valued for milk, meat and draught power. Low

reproductive effi ciency in livestock in general and in buffaloes in particular remains a major economic problem globally, and its incidence is higher in India. The post-partum period is regarded as an important period in the reproductive life of bovines (Fonesca et al., 1983). Uterine involution begins and ovarian follicular waves resume soon after parturition due rising in FSH concentration (Schallenberger, 1985). However, the dominant follicle of these waves fails to ovulate due to failure to undergo fi nal terminal maturation. Failure of post-partum dominant follicles to undergo fi nal maturation is due to inadequate LH pulse frequency, which results in low androgen production in the follicle (Fortune, 1986) and inadequate oestrodiol positive feedback to induce an LH surge (Peters et al., 1985), which is perquisite for follicular terminal maturation prior to ovulation. Absence of LH pulses between days 15 to 30 post-partum is due to continued sensitivity of the hypothalamic GnRH pulse generator to the negative feedback effect of estradiol-17β, which results in an absence of GnRH pulses. The administration of GnRH will overcome the inadequate secretion of pituitary LH in the early post-partum period (Shah et al., 1990) and restore ovarian function earlier within the post-partum period and assists in cleansing the uterus, brining faster uterine involution and terminal maturation and ovulation of the dominant follicle (Takkar et al., 1999).

EFFECT OF GnRH AND PGF2α ADMINISTRATION IN EARLY POST PARTUM PERIOD ON FERTILITY POTENTIAL OF BUFFALOES

M.V. Ingawale*, S.A. Bakshi, H.S. Birade, S.R. Chinchkar and S.U. Gulavane

Department of Animal Reproduction, Post Graduate Institute of Veterinary and Animal Sciences, Akola- 444 104, Maharashtra, India, *E-mail: [email protected]

Original Article


229

The reproductive cyclicity and its rhythm in terms of its reawakening during the early post-partum period has been linked to temporal changes of hormones, mainly prostaglandin (Perera et al., 1981). Leindell et al. (1980) reported that PG metabolites increased at the time of parturition and remained high for 8 to 16 days post-partum. So delay in involution of uterus was due to the short period of high prostaglandin F2α metabolite release. It has also positive effect on the uterine musculature tone (Lindell and Kindahl, 1983). PGF2α injection in the early post-partum period enhances the uterine involution and reproductive effi ciency in normal calved buffaloes (Nazir et al., 1994). Considering these facts, the present research was carried out to evaluate the effect of GnRH and PGF2α administration on day 14 post-calving on uterine involution and post-partum fertility in buffaloes.


A total of 36 Murrah buffaloes in their second to seventh lactation which had normally calved were selected. The buffaloes were housed in a loose housing barn and fed chopped roughages like sugercane, alfalfa, napier grass, green maize and jowar straw three times a day. A pre-calculated

quantity of concentrate mixture was fed through an automatic concentrate feeding station (AFS) to each buffalo based on milk yield, body weight and pregnancy status. The selected buffaloes were divided into three groups and buffaloes of Group 1 were treated with GnRH (buserelin acetate) 0.020 mg intramuscularly while those of Group 2 with PGF2α (cloprostenol sodium) 1.30 mg on day 14 post calving intramuscularly while the buffaoes of Group 3 were kept as control. The uterine involutions were monitored at weekly intervals on day 14, 21 and 28 post-partum. The fi nger width of left palm was pre-measured with a measuring tape and this was used as a scale for measuring internal biometry. The data pertaining to uterine involution, post-partum exhibition of oestrus, fi rst service conception rate were analyzed by randomized block design described by Snedecor and Cochran (1989).


Uterine involution The average days required for involution of the uterus in these buffaloes were 25.08±1.04, 22.75 ±0.91 and 30.33±1.31 for Groups 1, 2 and 3, respectively. In Group 2, the least time was required for whereas Group 3 required more time

Table 1. Average days required for involution of uterus in experimental buffaloes.

Sr. No. Particulars Mean1 Group 1 25.08±1.04a

2 Group 2 22.75±0.91b

3 Group 3 30.33±1.31c

Column wise superscript (a, b and c) denoted the signifi cant difference at P<0.05 and P<0.01 levels.


230

for involution of the uterus. The results were statistically signifi cant at the P<0.05 and P<0.01 levels (Table 1).

The present fi ndings regarding the effect of GnRH administration on the uterine involution is in close accordance with Barkawi et al. (1995) who reported 27.90±0.9 days while Takkar et al. (1999) recorded 31 days for uterine involution in GnRH treated buffaloes, which was slightly more than present fi ndings. The results of the present study for the number of days required to complete uterine involution after PGF2α treatment were slightly less than those reported by Nazir et al. (1994) who observed 24.88±0.97 days required for uterine involution in Nili-Ravi buffaloes. Nasr et al. (1994) observed 29.9 days and Iqbal et al. (2003) observed 28.90±1.79 days for uterine involution in after PGF2α treatment. In the present study, the effect of PGF2α treatment on uterine involution was in close agreement with those of Malvi et al. (2004) who observed 22.7±1.75 days and Tiwari et al. (2004) who observed 18.20±1.47 days required for uterine involution in buffaloes.

The fi nding of days required for uterine involution in the control group was in accordance Nazir et al. (1994) who observed 29.75±0.75 days in Nili Ravi buffaloes, Khasatiya et al. (2005) observed 30.00±1.36 and 33.75±1.65 days in post-partum fertile and infertile Surti buffaloes.

The variation between values obtaned by the above mentioned researcher and the present

fi ndings may be due to factors like difference in age, parity, nutrition of dams during late gestation, season of calving, sex and birth weight of the calf and the post-partum husbandry practices and hygiene of buffaloes.

Days required for exhibition of fi rst post-par-tum oestrus

The average days required for exhibition of fi rst post-partum oestrus were 37.5±5.16, 26.91±1.36 and 45.08±3.77 days in Groups 1, 2 and 3, respectively. The results are signifi cant at P<0.05 and P<0.01 (Table 2). The average days required for fi rst post-partum estrus exhibition after GnRH treatment in Group 1 were 37.5±5.16 days. The results are in concurrence with Barkawi et al. (1995) who reported 33.6±3.1 days in GnRH treated buffaloes. Fewer days required for PPE after GnRH treatment than present fi ndings are reported by Takkar et al. (1999) who reported 24.0±2 and 27.3±4 days when GnRH was administered at doses of 8 μg and 12 μg, respectively in buffaloes.

The average days required for exhibition of fi rst post-partum oestrus in Group 2 were 26.91±1.36. However, the days required for fi rst post-partum exhibition after PGF2α treatment in the present study were less than those reported Nasr et al. (1994) 43.00 days and Tiwari et al. (2004) 54.00±3.19 days in buffaloes. In Group 3 (control group), the average days required for fi rst

Table 2. Average days required for exhibiting fi rst PPE in experimental buffaloes.

Sr. No. Particulars Mean1 Group 1 37.5±5.16a

2 Group 2 26.91±1.36b

3 Group 3 45.08±3.77c

Column wise superscript (a, b and c) denote a signifi cant difference at the P<0.05 and P<0.01 levels.


231

post-partum exhibition of estrus were 45.08±3.77. However, the days required for fi rst post-partum exhibition of estrus in untreated buffaloes are less than reported by Suthar and Kavani (1992) 56.72±3.58 days in Meshana buffaloes and Tiwari and Pathak (1995) 57.7±5.61 days in suckled buffaloes. The variation between values obtained by the above mentioned research scientists and the present fi ndings may be due to factors like difference in nutrition of dam during late gestation and the post-partum husbandry practices and hygiene, and estrus detection aids.

First service conception rate The fi rst service conception rate was high-

est 41.66% in Group 2 which is indicative of the fact that PGF2α treatment was most benefi cial. That the fi rst service conception rate was 33.33% in Group 1 buffaloes indicates that GnRH treatment also yielded good results. Group 3 yielded the lowest results i.e. a 16.16% fi rst service concep-tion rate. The present results are low in compari-son with Takkar et al. (1999) who reported a 50% conception rate in GnRH treated and a 38% rate in control buffaloes.

CONCLUSION

The buffaloes treated with PGF2α showed the least time i.e. 22.75±0.91 days required for uterine involution and their fi rst service conception rate was highest: 41.66%, which is indicative of the fact that PGF2α treatment is benefi cial for improv-ing postpartum fertility in buffaloes.

REFERENCES

Barkawi, A. H., N.M. Farghely and A.M. El-Borady. 1995. Effect of treatment with GnRH analogue on post-partum reproductive performance of suckling Egyptian buffalo cows. Buffalo Journal, 1: 117-123.

Fonesca, F.A., J.H. Britt, B.T. Mcdainel, A.H. Rakes and J.C. Wilk. 1983. Reproduction traits in Holland and Jersey. Effect of age, milk yield and clinical abnormalities on involution of cervix and uterus, ovulation, estrus cycle, detection of estrus, CR and days open. J. Dairy Sci., 66: 1128-1147.

Fortune, J. E. 1986. Bovine theca and granulose cells interact to promote androgen production. Biol. Reprod., 35: 292-299.

Iqbal, S., M. Aleem and M.A. Sayeed. 2003. Role of single injection of prostaglandin F2α on breeding effi ciency of post-partum buffaloes. Pak. Vet. J., 23(4): 197-201.

Khasatiya, C.T., A.J. Dhami and F.S. Kavani. 2005. Productive traits and metabolic profi le in post-partum fertile and infertile Surti buffaloes. Indian Vet. J., 82: 637-641.

Leindell, W., P. Hegner and P. Rockel. 1980. Investigations on the prostaglandin F2α concentrations in maternal and fetal cotyledons of cows with and without retained fetal membranes. Zebl. Vet. Med. A., 27: 691-696.

Lindell, J.O. and H. Kindahl. 1983. Exogenous prostaglandin F2α promotes uterine involution in the cows. Acta Vet. Scand., 24(3): 269-274.

Malvi, G.R., R.K. Pangaonkar, R.K. Sharma and V.K. Gandotra. 2004. Effect of certain hormones on reproductive performance of post-partureint buffaloes. Buffalo Journal,


232

2: 193-201.Nasr, M.T., M.A. Agag and G.A. Sosa. 1994.

The effect of PGF2α and/or L-tyrosine on the puerperium of buffaloes. Annals of Agricultural Science Moshtohor, 32(4): 2213-2225.

Nazir, F., R.A. Chaudhry, T. Rahil and K.R. Chohan. 1994. Effect of prostaglandin F2α at early postpartum on uterine involution and subsequent reproductive performance in suckled Nili-Ravi buffaloes. Buffalo Journal, 10(3): 269-271.

Perera, B.M.A.O., H. Abeygumawardona, A. Thamotharm, H. Kindahl and L.E. Edquist. 1981. Peripheral changes of oestrogen, progesterone and prostaglandin in water buffaloes. Theriogenology, 15: 463-467.

Peters, A.R., M.G. Pimental and G.E. Lamming. 1985. Hormone response to exogenous GnRH pulses in post-partum dairy cows. J. Reprod. Fertil., 75: 557-565.

Schallenberger, E. 1985. Gonadotropin and ovarian steroids in cattle. III Pulsatile changes of gonadotropin concentration in jugular vein post-partum. Acta Endocrinol-Cop., 109: 37-43.

Shah, S.N.H., A.H. Willemase and D.F.M. Van-de-wiel. 1990. Reproductive performance of Nili-Ravi buffaloes after single injection of GnRH early post-partum. Trop. Anim. Health Pro., 22(4): 239-246.

Snedecor, G.W. and W.G. Cohran. 1989. Statistical Methods, 8th ed. Iowa State University Press, Ames, Iowa, USA.

Suthar, B.N. and F.S. Kavani. 1992. Occurrence and nature of fi rst post-partum estrus in Meshani buffaloes. Indian Journal of Animal Reproduction, 13(2): 161-164.

Takkar, O.P., N. Singh, J. Kaur and K.C. Chaudhary.

1999. Augmentation of post partum reproductive effi ciency by use of GnRH in buffaloes. Indian Journal of Animal Reproduction, 20(1): 9-11.

Tiwari, R.P., S. Jogi and S.K. Sahu. 2004. Effect of prostaglandin administration after calving in buffaloes on post-partum reproductive performances. Buffalo Bull., 23(3): 53-57.

Tiwari, S.R. and N.M. Pathak. 1995. Infl uence of suckling on postpartum reproduction performance of Surti buffaloes. Buffalo Journal, 11(2): 213-217.


233

ABSTRACT

The present study was undertaken in buffalo neonates born to vitamin E supplemented (treatment group) and non-supplemented (control group) Murrah buffaloes. Blood samples were collected into sterile vacutainer tubes from calves at day 0 (before colostrum feeding), 7, 28, and 126-post birth. The lymphocytes were separated and cultured in RPMI 1640 medium with mitogen phytohemagglutinin-P (PHA-P) for 36h at 37oC in a humidifi ed CO2 incubator (95% air and 5% CO2). The lymphocyte responsiveness in vitro evaluated in response to different nitric oxide compounds viz. S-Nitroso-N-acetylpenicillamine (SNAP), Nω-Nitro-L-arginine methyl ester (L-NAME) and L-NG-Monomethyl-arginine (NMMA). The blastogenic response between days in both groups varied signifi cantly (P<0.01) but it was not found to be signifi cant between different groups. The precolostrum stimulation index was signifi cantly low (P<0.05) in all the calves. The mitogen induced lymphocyte blastogenesis was not affected by low levels (1.0 mM) of SNAP but signifi cantly inhibited (P<0.001) at 10 mM in both the groups. At 10 mM of L-NAME the blastogenic response between days in both groups varied signifi cantly (P<0.01) but it was not found to be signifi cant at 10 mM of L-NMMA. Nitric oxide (NO) production by lymphocytes

from all calves increased (P<0.01) progressively with age. The lymphocytes supplemented with SNAP (1.0 and 10 mM) signifi cantly (P<0.001) produce higher amounts of NO in comparison to non-supplemented lymphocytes. At a low level (0.2 mM) of L-NAME and L-NMMA, the change in the NO production between days was signifi cant in both the groups. However, at a higher level (10 mM) of L-NAME and L-NMMA, the differences were not found to be signifi cant between days and between the two groups. The study demonstrates that buffalo calves lymphocytes have an active nitric oxide synthase (NOS) system. The present study also indicates that the immune competence of buffalo calf lymphocytes is not affected by prepartum supplementation of vitamin E to buffaloes.

Keyword: Murrah buffaloes, buffalo calf, cell mediated immunity, lymphocytes, nitric oxide

INTRODUCTION

The neonatal period represents a critical stage in the development of physiological and immunological functions. Metabolic instability during this period makes the neonate particularly sensitive to perinatal diseases that result in high mortality (Dwyer, 2008). The neonate has an

EFFECT OF PRE-PARTUM SUPPLEMENTATION OF VITAMIN E TO MURRAH BUFFALOES ON LYMPHOCYTE FUNCTION OF CALVES

A.K. Singh*, S. Pandita, R.C. Upadhyay and G. Chandra

Dairy Cattle Physiology Division, National Dairy Research Institute, Karnal-132001 (Haryana), India, *E-mail: [email protected]

Original Article


234

immature immune system compared with that of an adult. The calf immune system is more susceptible to oxidative stress during the neonatal period due to a weak defense system against superoxide radicals (Inemani et al., 1999). The calves are lymphopenic at birth (Outteridge and Duffy, 1981; Manak, 1986). The lymphocyte concentration gradually increases with age (Osburn et al., 1974; Clover and Zarkowen, 1980). Nagahata et al. (1991) found that antibody-producing activity of lymphocytes was lower in calves up to 3 weeks after birth. In addition, Tizard (2004) reported that antibody-producing activity in suckling calves is low at least up to 1 month after birth. Osburn et al. (1974) depicted a suppressed PHA-induced lymphocyte blastogenesis in the newborn as compared to bovine fetal lymphoid cells at 90 and 121 days of gestation (Osburn et al., 1974; Rensbaw et al., 1977). Clover and Zarkower (1980) reported that both PHA and poke weed mitogen (PWM)-induced blastogenic responses of peripheral blood lymphocytes from 6-hr old, colostrum fed calves were suppressed relative to those from 4-day old calves. Rajaraman et al. (1997) reported that peripheral blood mononuclear cells (PBMC) from 1-wk-old calves fed colostrum and milk were functionally hypo-responsive when compared to PBMC from adult cattle. Person et al. (1983) suggested that although the lymphocytes of neonate calves had the ability to respond to mitogens, individual variations are there in the lymphocyte reactivity. Compared with adult cattle, calves have a low percentage of E rosette-forming cells (Outteridge and Duffy, 1981) and their lymphocytes show less mitogen-induced proliferation (Manak, 1986). Yang and Shultz (1986) reported that lymphocytes from young piglets showed greater sensitivity to prednisolone than lymphocytes from 6-month old pigs. Other functional differences include the capacity of

PBMC from young calves to produce inducible NOS, a component of bactericidal mechanisms of phagocytic leukocytes and interferon-γ (IFN), a pivotal cytokine in cell-mediated immunity, reduced secretion of other cytokines (Nonnecke et al., 2003), and reduced neutrophil function (Dore et al., 1991; Higuchi et al., 1997) have also been reported after birth.

Vitamin E has been reported to be an immunopotentiator, which not only provides additional immunity to dairy animals when fed peripartum but also has been reported to enhance calf viability (Amer and Hashem, 2008). Therefore, in order to improve the immune status of neonates, it is imperative to supplement pregnant animals with vitamin E to increase its level in the colostrum and thus transfer it to calves. Induction of the lymphocyte proliferative response induced by antigen/mitogen in vitro has been shown to be representative of cellular immunocompetence. This measure can potentially be used as an indicator of an individual’s ability to mount an immune response to a specifi c pathogen or immunomodulators. To date, no study describing the age-related changes in lymphocyte function in buffalo calves as infl uenced by ante-partum supplementation of vitamin E to buffaloes is available. Furthermore, study on the in vitro effect of nitric oxide on lymphocyte function in the developing buffalo calf is unavailable. Therefore, the purpose of this study was to investigate the age-related changes in mitogen-induced lymphocyte proliferation and the effects of nitric oxide (NO) on in vitro immune competence in terms of the lymphocyte proliferative response in buffalo calves.


235


The experiment was approved by the Institutional Animal Ethics Committee constituted as per the article number 13 of the CPCSEA rules, laid down by the Government of India.Selection of animals

The experiment was conducted on twenty apparently healthy Murrah buffaloes in an advance state of pregnancy selected from the National Dairy Research Institute (NDRI), Karnal herd, from October 2009 until May 2010. These were randomly divided into two groups (10 in each group). The control group was fed the diet as practiced for pregnant buffaloes on the NDRI dairy farm. The treatment group was supplemented with 2000 IU vitamin E (dl-alpha-tocopherol acetate) mixed with moistened concentrate and fed individually in the morning each day with the normal diet. Vitamin E supplementation was initiated 30 days prior to the expected date of parturition and was continued until parturition. Calves born from these buffaloes (both the groups) were removed from their dams before colostrum ingestion and housed in a calf’s pen separately in two groups after weighing and ear tagging. The colostrum of the same dam was fed to the newborn within 2 h of birth, which was designated as 0 h, and subsequent feedings at an interval of 12 h for fi ve days was followed.

Collection of blood and separation of lymphocytes

Approximately 15 ml of blood was drawn in sterile, heparinized vacutainer tubes (BD Franklin, USA) from each calf by jugular venipuncture on day 0 (before colostrums feeding), and on days 7, 28, and 126 post-birth at 6.00 AM in the morning.

Blood was centrifuged at 3000 rpm for 40 min at 4°C; the buffy coat was harvested and re-

suspended in 1:1 v/v Dulbecco’s Phosphate Buffer Saline (DPBS). The total contents were carefully layered on lymphocyte separation medium (Histopaque 1077) in a ratio of 4:1 v/v in a sterile 15 ml polypropylene centrifuge tube and centrifuged at 1500 rpm for 40 minutes at room temperature. The lymphocyte rich layer was removed and washed (1200-1500 rpm; 10 minutes) twice with DPBS. The washed lymphocyte were resuspended in RPMI 1640 medium (3-4 ml) containing 25 mM HEPES buffer (Gibco Laboratories, Grand Island, NY) that was supplemented with 10% FCS (Hyclone), 2 mM L-glutamine, antibiotics (100 IU/ml of penicillin G and 100 μg/ml of streptomycin), antimycotics (5 μg/ml of amphotericin B) (all from Sigma Chemical Co., St. Louis, MO, USA). Cells were counted on a hemocytometer and cell suspensions were diluted with RPMI to 1 x 106 cells/ml. Viability of cells (>95%) was determined by trypan blue dye exclusion.

Lymphocyte proliferation in response to PHA-P and Nitric oxide

The lymphocytes (1x106 live lymphocyte/well) were cultured in 96 well fl at-bottomed tissue culture plates. The cells were allowed to proliferate with and without mitogen (PHA-P) to determine the difference between cell proliferations. To the PHA-P positive wells, 20 μl PHA-P (5 μg/ml) was added. The effect of nitric oxide on the lymphocyte proliferation response was studied by using nitric oxide compounds viz. S-Nitroso-N-acetylpenicillamine (S-NAP) - a nitric oxide donor (0.1, 1.0, 10.0 mM/well) and nitric oxide synthase inhibitors i.e. Nω-Nitro-L-arginine methyl ester (L-NAME) and L-NG-monomethyl-arginine (L-NMMA) (0, 0.2, 1.0, 5.0 and 10.0 mM/well). In all the cases, fi nal culture volume was 200μl/well. The blank wells consisted of 200 μl of culture


236

media only. The culture plates were maintained at 37°C in a humidifi ed atmosphere of 5% CO2 for 36 h.

MTT AssayThe proliferative response of lymphocytes

was estimated using the colorimetric MTT [3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide] assay according to the procedure given by Mosmann (1983). MTT assay is based on the ability of a mitochondrial dehydrogenase enzyme from viable cells to cleave the tetrazolium rings of the pale yellow MTT and form dark blue formazan crystals, which are largely impermeable to cell membranes, thus resulting in their accumulation within healthy cells. Solubilisation of the cells by the addition of a detergent dimethyl sulfoxide (DMSO) results in the liberation of the crystals. The number of surviving cells is directly proportional to the level of the formazan product created. The plate was read at 450 nm with Microscan MS-5608A plate reader.

Statistical AnalysisAll analysis was done using a Systat 12

software package. Data from different experiments are presented as mean ± SE. Analysis of variance of the data was done using RBD factorial design. The responses have been compared with respect to unstimulated cells for different experiments involving the mitogen and different immunomodulators (S-NAP, L-NAME and L-NMMA). Signifi cance was considered at P<0.05 or is mentioned otherwise.


In the present study, cell-mediated

immunity was assessed by measuring the proliferation of mitogen-stimulated lymphocytes and nitric oxide (NO) produced by lymphocytes in buffalo calves under different experiments. The lymphocyte proliferation response was expressed as a stimulation index for mitogen stimulated and mitogen plus immunomodulator stimulated as a relative stimulation index. The blastogenic response between days in both groups varied signifi cantly (P<0.01) but it was not found to be signifi cant between different groups. The precolostrum stimulation index was signifi cantly low (P<0.05) in all the calves. The values registered a signifi cant rise on day 7 post birth followed by a decline subsequently. The ANOVA revealed that antepartum supplementation of vitamin E had a signifi cant effect on the stimulation index (P<0.05)

of mitogen-induced lymphocyte blastogenesis (Figure 1).

Effect of nitric oxide donor (SNAP) on blastogenic response of lymphocytes

Effect of different concentrations of SNAP on the blastogenic response of lymphocytes in vitro following the culture of lymphocytes in the presence of 1.0 and 10 mM of SNAP, the mitogen induced lymphocyte blastogenesis was not affected by low levels (1.0 mM) of SNAP. It was signifi cantly inhibited (P<0.001) at 10 mM in both the groups. At the both SNAP concentrations (1.0 and 10 mM) the lymphocyte stimulation index was not signifi cant between the different groups (Table 1).

Effect of nitric oxide synthase (NOS) inhibitors (L-NAME and L-NMMA) on the blastogenic response of lymphocytes

The blastogenic response of cultured lymphocytes was signifi cantly reduced in the


237

with specifi c antigens (Daguiliard, 1972). In the present study, functional capacity of lymphocytes was further evaluated by nitric oxide (NO) production by lymphocytes and their responsiveness to immunomodulators. Secretion of nitric oxide (NO), which is essential for effective cell-mediated immunity, was also infl uenced by treatment with values lowering signifi cantly in response to antepartum supplementation of vitamin E. The functional capacity of lymphocytes was further evaluated by adding different immunomodulators in culture. NO production by lymphocytes from all calves increased (P<0.01) progressively with age. However, mitogen stimulated cells produced less NO in culture until day 126 as compared to unstimulated cells of all the calves (Figure 2).

Nitric oxide is a small inorganic paramagnetic free radical gas, which acts as a biological messenger molecule transmitting signals within and between cells, exerting a number of biological actions including vasodilation, neurotransmission, cytotoxicity and modulator of infl ammation and immunity. Nitric oxide is produced by lymphocytes, macrophage, endothelial cells and neutrophils. Although production of NO by leukocytes that are stimulated by pathogens is an important component of the innate immune system, excess production of this molecule can be damaging to the tissues of the host. Nitric oxide (NO) production is a component of the innate immune system that has not been well studied in neonates. Nitric oxide acts as an intracellular signaling molecule or as a neurotransmitter when produced in low quantities. When produced in higher quantities for extended periods, NO is involved in the killing of microorganisms and tumor cells (Nathan, 1995) and in hematopoiesis (Ouaaz, 1995). Chronic production of NO in

presence of 0.2 and 10 mM of L-NAME and L-NMMA in all the animals of both groups. At 10 mM of L-NAME the blastogenic response between days in both groups varied signifi cantly (P<0.01) but it was not found to be signifi cant at 10 mM of L-NMMA. When the two groups were compared with respect to blastogenic response, the differences were not found to be signifi cant between the two groups (Table 1).

The lymphocyte proliferation assay is a measure of immune activation/stimulation. This assay helps evaluate the immunostimulatory/immunosuppressive activity of a mitogen. Cell-mediated immunity requires a full repertoire of functional T cells. T cells, which derive from the bone marrow and fetal liver, mature in the thymus. In the blood circulation, they account 40 % to 80 % of the lymphocytes.

The results of the present study are in general agreement with Rajaraman et al. (1997) who reported that PBMC from 1-wk-old calves fed colostrum and milk were functionally hypo-responsive when compared to PBMC from adult cattle. These variations were also infl uenced by season and the age of the bovine (Soper et al., 1978). In piglet Hoskinson et al. (1990) found highest spontaneous proliferation in the newborn piglet at wk 0.5 but it decreased (P<0.008) over 75% by wk 1. Proliferation tended to decrease, but more gradually, through wk 6. The present study indicated that the animals in different groups exhibited different blastogenic responses to different levels of NOS inhibitors. Lymphocyte stimulation is widely used to measure (i) immune competence by stimulation of lymphocytes with phytomitogens (Douglas, 1972; Weigel et al., 1992); (ii) histocompatability by mixed leukocyte culture (Thorsby, 1974) and (iii) exposure to infectious agents by stimulation of lymphocytes


238

Figure 2. Age related changes in NO production of buffalo calves in response to mitogen (PHA-P) stimulation.

Figure 1. Age related in vitro changes in stimulation indices of buffalo calves in response to mitogen (PHA-P) stimulation.


239

Table 1. Age related changes in relative stimulation Indices of buffalo calves in response to different immunomodulators.

Group DaysSNAP L-NAME L-NMMA

1 mM/well 10 mM/well 0.2 mM/well

10 mM/well

0.2 mM/well

10 mM/well

Con

trol

0 1.52±0.26 0.91±0.16 0.92±0.09 0.79±0.07 0.92±0.09 0.94±0.087 1.32±0.26 0.30±0.16 0.67±0.09 0.53±0.07 0.93±0.09 0.82±0.0828 1.30±0.34 0.53±0.21 0.93±0.12 0.87±0.10 0.95±0.11 0.99±0.11126 0.90±0.42 0.15±0.26 0.64±0.14 1.01±0.12 0.91±0.14 1.07±0.13

Trea

tmen

t 0 0.98±0.26 0.57±0.16 0.81±0.09 0.85±0.07 0.87±0.09 0.91±0.087 1.34±0.28 0.47±0.17 0.96±0.10 0.76±0.08 1.15±0.09 1.11±0.0928 0.95±0.28 0.45±0.17 0.75±0.10 0.92±0.08 0.78±0.09 0.71±0.09126 0.89±0.28 0.16±0.17 0.78±0.10 0.98±0.08 0.95±0.09 1.01±0.09

association with superoxide anion generates toxic radicals, which can damage cell membranes, cause infl ammation, and induce apoptosis (Dugas et al., 1995).

Leukocytes from calves produced unusually high concentrations of NO when compared with those produced by cows, a possible indicator of the immaturity of the immune system of the neonatal calf. This refl ected immature cell mediated immune functions in neonate buffaloes and could be explained on the basis of higher secretion of cytokines (interferon γ) by immune cells in the case of new born calves in response to any stress producing external stimuli (Nonnecke et al.,1993), thus exerting an inhibitory effect on NO production. Shoker et al. (1997) have also reported a relationship between IL-2 and NO in lymphocyte culture studies in humans. The higher the IL-2 production was, the lower the nitric oxide production. Rajaraman et al. (1998) showed that mitogen-stimulated PBMC from milk replacer fed calves produced more NO than parallel cultures of adult PBMC. They suggested that the age-related differences in NO secretion might be attributable to

the immaturity of the neonatal immune system.

Effect of nitric oxide doner (SNAP) on nitric oxide (NO) production by lymphocytes

Effect of different concentrations of SNAP on in vitro nitric oxide (NO) secretion by lymphocytes following culture of lymphocytes in the presence of 1.0 and 10 mM of SNAP were evaluated. The lymphocytes supplemented with SNAP (1.0 and 10 mM) signifi cantly (P<0.001) produced higher amounts of nitric oxide (NO) in comparison to non-supplemented lymphocytes. In both the groups, nitric oxide (NO) secretion in culture supernatants was signifi cantly (P<0.001) increased at both the concentrations (1.0 and 10 mM). However, the increase in the nitric oxide production at higher levels (10 mM) was much higher than at low levels (1.0 mM) of SNAP (Table 2).

Animal experiments suggest that the synthesis of nitric oxide by L-arginine-NO biosynthetic pathway affects immunoregulation (Moncada et al., 1991). Hence, it was important to test in the fi rst instance the maximum non-cytotoxic


240

Tabl

e 2.

Age

rela

ted

chan

ges i

n N

O p

rodu

ctio

n of

buf

falo

cal

ves i

n re

spon

se to

mito

gen

and

imm

unom

odul

ator

s stim

ulat

ion.

Gro

upD

ays

PHA

-PPH

A-P

+ S

NA

PPH

A-P

+ L

-NA

ME

PHA

-P +

L-N

MM

A

5 μg

/ml

1 m

M/w

ell

10 m

M/w

ell

0.2

mM

/wel

l10

mM

/wel

l0.

2 m

M/w

ell

10 m

M/w

ell

Control0

16.3

3±3.

73

49.7

8±6.

1937

7.46

±25.

1715

.77±

2.85

13.8

6±2.

9315

.71±

3.09

14.6

4±1.

697

16.0

0±3.

73

49.6

0±6.

1933

8.30

±25.

1715

.37±

2.85

9.68

±2.9

313

.92±

3.09

12.1

4±1.

6928

17.9

5±4.

81

55.1

5±7.

9947

0.09

±32.

4917

.32±

3.67

10.1

2±3.

7812

.89±

3.99

9.72

±2.1

812

645

.40±

5.89

11

4.16

±9.7

940

5.50

±39.

8043

.31±

4.50

14.7

2±4.

6333

.63±

4.89

10.2

1±2.

67

Treatment

09.

98±3

.73

50

.60±

6.19

351.

29±2

5.17

9.82

±2.8

58.

49±2

.93

7.17

±3.0

98.

64±1

.69

712

.73±

3.93

50

.84±

6.52

401.

98±2

6.53

13.6

2±3.

006.

92±3

.09

9.02

±3.2

69.

93±1

.78

2823

.19±

3.93

47

.26±

6.52

367.

40±2

6.53

22.1

9±3.

009.

26±3

.09

13.8

6±3.

269.

86±1

.78

126

34.6

3±3.

93

112.

02±6

.52

447.

35±2

6.53

34.5

8±3.

0011

.31±

3.09

24.7

5±3.

269.

54±1

.78


241

concentration of nitric oxide compounds. The maximum non-cytotoxic concentration of the nitric oxide donor (SNAP) using the trypan blue exclusion test was found to be 10 mM. At this concentration percent killing after exposing the lymphocytes for 24 h with SNAP was less than 5%. Shoker et al. (1997) using sodium nitroprusside (SNP) as a nitric oxide donor reported maximum inhibition at 2 mM concentration in human lymphocytes. SNAP decomposes at room temperature to produce nitric oxide. Nitric oxide in turn tends to affect the lymphocyte functions. Shoker et al. (1997) reported that human lymphocytes do not produce appreciable amounts of nitric oxide to affect lymphocyte mitogenesis. They further indicated that some of the nitric oxide generating compounds viz. sodium nitruprusside (SNP) and nitroglycerine (NG) had a potent but non-specifi c immuno inhibitory effect on human lymphocyte function by a mechanism other than nitric oxide production.

Effect of nitric oxide synthase (NOS) inhibitors (L-NAME and L-NMMA) on nitric oxide (NO) production by lymphocytes

The nitric oxide production in culture supernatants of lymphocyte was signifi cantly inhibited in the presence of 0.2 and 10 mM of L-NAME and L-NMMA in all the animals of both groups. At 1.0 mM of L-NAME the nitric oxide production was not signifi cant between different groups but at same concentration of L-NMMA, nitric oxide production was signifi cantly (P<0.05) reduced in the treated group. At a low level (0.2 mM) of L-NAME and L-NMMA, the change in the nitric oxide production between days was signifi cant in both the groups. However, at a higher level (10 mM) of L-NAME and L-NMMA, the differences were not found to be signifi cant between days and between the two groups (Table 2).

L-NAME and L-NMMA are competitive inhibitors of the enzyme nitric oxide synthase (NOS). These work by preventing the availability of the substrate for NOS i.e. L-arginine to the enzyme resulting in reduced nitric oxide output. In the present experiment, the inhibitory effects of nitric oxide inhibitors (L-NAME, L-NMMA) at the lowest levels (0.2 mM) on lymphocyte proliferation further supported the contention that nitric oxide exerts a direct effect on lymphocyte mitogenesis.

CONCLUSIONS

In conclusion, these results indicate that the lymphocytes are responsive to nitric oxide compounds and produce signifi cant amounts of nitric oxide to modify lymphocyte mitogenesis. Although production of NO by leukocytes that are stimulated by pathogens is an important component of the innate immune system, excess production of this molecule can be damaging to the tissues of the host. Production of high concentrations of nitric oxide is a possible indicator of the immaturity of the immune system of the buffalo calf. The immune competence of buffalo calf lymphocytes is not affected by vitamin E. Further studies are required to investigate the mechanisms and the pathways that affect mitogenesis in buffalo calves.

REFERENCES

Amer, H.A. and M.A. Hashem. 2008. Reproductive performance and viability of newborns in buffaloes treated antepartum with viteselen and / or ultra-corn. Slov. Vet. Res., 45: 53-60.

Dore, M., D.O. Slauson and N.R. Nielson. 1991.


242

Decreased respiratory burst activity in neonatal bovine neutrophils stimulated by protein kinase C. Am. J. Vet. Res., 52: 375-380.

Clover, C.K. and A. Zarkower. 1980. Immunologic responses in colostrum-fed and colostrum-deprived calves. Am. J. Vet. Res., 41: 1002.

Daguiliard, F. 1972. Immunologic signifi cance of in vitro lymphocyte responses. Med. Clin. North Am., 56: 293-303.

Douglas, S.D. 1972. Electron microscopic and functional aspects of human lymphocyte response to mitogens. Transplant. Rev., 11: 39-59.

Dugas, B., P. Debre and S. Moncada. 1995. Nitric oxide, a vital poison inside the immune and infl ammatory network. Res. Immunol., 146: 664-670.

Higuchi, H., H. Nagahata, M. Hiroki and H. Noda. 1997. Relationship between age-dependent changes in bovine neutrophil functions and their intracellular Ca2+ concentrations. J. Vet. Med. Sci., 59: 271-276.

Hoskinson, C.D., B.P. Chew and T.S. Wong. 1990. Age-related changes in mitogen-induced lymphocyte proliferation and polymorphonuclear neutrophil function in the piglet. J. Anim. Sci., 68: 2471-2478.

Inemani, O., A. Shiga, K. Okada, R. Sato, Y.I. Miyake and M. Kuwabara. 1999. Lipid peroxides and antioxidants in serum of neonatal calves. J. Vet. Res., 60: 452-457.

Manak, R.C. 1986. Neonatal calf serum immunoregulation of lymphocyte blastogenic responses. J. Anim. Sci., 62: 759.

Moncada, S., R.M.J. Palmar and E.A. Higgs. 1991. Nitric oxide: physiology, pathophysiology, and pharmacology. Brit. J. Pharmaco., 147:

S193-S201.Nagahata, H., N. Kajima, I. Higashitani, H. Ogawa

and H. Noda. 1991. Postnatal changes in lymphocyte function of dairy calves. J. Vet. Med., 38: 49-54.

Nathan, C. 1995. Natural resistance and nitric oxide. Cell, 82: 873-876.

Nonnecke, B.J., S.T. Franklin, T.A. Reinhardt and R.L. Horst 1993. In vitro modulation of proliferation and phenotype of resting and mitogen-stimulated bovine mononuclear leukocytes by 1, 25-dihydroxyvitamin D3. Vet. Immunol. Immunopathol., 38: 75-89.

Osburn, B.I., G.H. Stabenfeldt, A.A. Ardans, C. Trees and M. Sawyer. 1974. Perinatal immunity in calves. J. Amer. Vet. Med. Assoc., 164: 295.

Ouaaz, F. 1995. Nitric oxide in human hematopoiesis. Res. Immunol., 146: 678-681.

Outteridge, P.M. and J.H. Duffy. 1981. Surface markers for characterization of bovine blood lymphocyte populations and changes in these from birth to maturity. Res. Vet. Sci., 31: 315.

Person, J.M., F. Quintin-Colonna, F. Barrett, Y. Le Garrec and Ch. et Pilet. 1983. Immunocompetance du veau nouveau-ne: Evaluation de la response lymphocytaire proliferative in vitro a trois mitogens non specifi gues (Concanavaline A, Phytohemo-agglutinine, Pokeweed mitogen) au cours des trois premiers de vie. Com. Immun. Microbiol. Infect. Dis., 6: 345-356.

Rajaraman, V., B.J. Nonneck and R.L. Horst. 1997. Effect of replacement of native fat in colostrum and milk with coconut oil on fat soluble vitamins in serum and immune function in calves. J. Dairy Sci., 80: 2380-2390.


243

Rajaraman, V., B.J. Nonnecke, S.T. Franklin, D.C. Hammell and R.L. Horst. 1998. Effect of vitamins A and E on mitric oxide production by nlood mononuclear leukocytes from neonatal valves fed milk teplacer. J. Dairy Sci., 81: 3278-3285.

Rensbaw, H.W., W.P. Eckblad, D.O. Everson, P.D. Tassinari and D. Amos. 1977. Ontogeny of immnnocompetence in cattle: evaluation of phytomitogen induced in vitro bovine fetal lymphocyte blastogenesis, using a whole blood culture technique. Am. J. Vet. Res., 38: 1141-1150.

Shoker, A.S., H. Yang, M.A. Murabit, H. Jamil, A. Al-Ghoul and K. Okasha 1997. Analysis of the in vitro effect of exogenous nitric oxide on human lymphocytes. Mol. Cell. Biochem., 171: 75-83.

Soper, F., C.C. Muscoplat and D.W. Johnson. 1978. In vitro stimulation of bovine peripheral blood lymphocytes: Analysis of variation of lymphocyte blastogenic response in normal dairy cattle. Am. J. Vet. Res., 39: 1039-1042.

Thorsby, E. 1974. The human major histocompatibility system. Transplant. Rev., 18: 51-129.

Tizard, I.R. 2004. Immunity in the Fetus and Newborn. In Veterinary Immunology: An Introduction, 7th ed. Philadelphia. WB Saunders.

Weigel, K.A., A.E. Pneman, M.E. Kehrli, Jr., J.R. Thurston, M.J. Stear and D.H. Kelley. 1992. Association of class I bovine lymphocyte antigen complex alleles with health and production traits in dairy cattle. J. Dairy Sci., 73: 2538.

Yang, W.C. and R.D. Schultz. 1986. Effect of corticosteroid on porcine leukocytes: Age

related effects of corticosteroid inhibition on porcine lymphocyte rsponses to mitogens. Vet. Immunol. Immmop., 13: 19

Instructions for Authors

Buffalo Bulletin is published by International BuffaloInformation Center under the authorization of Office of UniversityLibrary, Kasetsart University, Thailand. Contributions on any aspectof research or development, progress report of projects and news onbuffalo will be considered for publication in the bulletin.

General editorial policies

Authorship criteriaAuthorship is restricted to those who (1) have contributed

substantially to one or more of the following aspects of the work and (2)are willing to assume public responsibility for the validity of thework.Copyright

Copyright to published manuscripts becomes the soleproperty of International Buffalo Information Center.

Criteria for manuscript acceptanceManuscript acceptability is based on clarity of objectives;

originality; appropriateness of the experimental design, methods andstatistical analysis; substance of the results; thoroughness with which theresults are discussed; and appropriateness of the conclusions.

Following acceptance of a paper and prior to publication, theauthor will be received the acceptance letter.

Manuscript requirements

Manuscripts preparationManuscripts on original research in English language should

include at least the following elements.Title

• Full title (be concise)• Name(s) of author(s) and the first author

affiliation with complete address.Abstract

• An abstract not exceeding 250 words; allacronyms and abbreviations defined; noreferences cited. State what, where and how itwas done, major results.

• Five key words.Introduction. Review pertinent work, cite key references,explain importance of the research, and state objectives ofyour work.

Materials and Methods. Provide sufficient detail so workcan be repeated. Describe new methods in detail; acceptedmethods briefly with references.

Use of trade names. Trade names are to beavoided in defining products whenever possible.

Use of abbreviations and acronyms. At first textuse, define in parentheses. Do not use abbreviations andacronyms in titles.Results and discussion. Present results concisely usingfigures and tables as needed. Do not present the sameinformation in figures and tables. Discuss principles andrelationship, point out exception. Show agreement withpublished research work. The significances of work orconductions should be presented in the end of discussion.Tables. Number each table with Arabic numerals. Place adescriptive caption at the top of each table.

Figures. (graphs, charts, line drawings, photographs)Number each figure with Arabic numerals under theillustration. Lettering, data lines and symbols must besufficiently large so as to be clearly visible when the figureis reduced to a size commonly used in the journal.References. List only those references cited in the text.Required format of described below.

Reference cited format

Manuscripts should follow the name-year reference format.Cite only necessary publications. Primary rather than secondaryreferences should be cited, when possible. It is acceptable to cite workthat is “in press” (i.e., accepted but not yet published) with the pertinentyear and volume number of the reference.

In text. Cite publications in text with author name andyear. Three or more authors use “et al.”. In parenthetical citations,separate author and year with a comma. Use suffixes a, b and c toseparate publications in same year by the same author. Semi-colonseparate citations of different authors. Cite two or more publicationsof different authors in chronological sequence, from earliest to latest.For example:….used liquid nitrogen vapour freezing technique from Verma et al.(1975)….liquid nitrogen vapour freezing technique (Verma et al., 1975)…and buffaloes (Singh et al., 1983; Shah et al., 1987; Misra, 1996;Pant et al., 2002)In reference cited. List only those literature cited in the text.References should be listed alphabetically by the first author’s lastname. Single author precedes same author with co-authors. Typereferences flush left as separate paragraphs. Do not indent manually.Write the name of book or journal in italic letters. Use the followingformat.• Journal articles: Author(s). Year. Article title. Journal title,

volume number: inclusive pages.Example: Citation in text: Chaudhary et al. (1981)

Choudhary, P.C., B. Prasad and S.K. Misra. 1981. Note on the use of rumen liquor in the treatment of chronic alkaline indigestion in cows. Indian J. Anim. Sci., 51: 356-360.

• Books: Author(s) or editor(s). Year. Title. Publishername,Placeof publication. Number of pages.Example: Citation in text: Snedecor and Cochram. (1980)Snedecor, G.W. and W.G. Cochram. 1980. Statistical Methods, 7th ed.

The Iowa State University Press, Ames, Iowa, USA. 593p.Sattar, A. 1995. Studies on the effect of immunopotentiation of vaccinated pregnant buffaloes and cows on neonatal antibody titre and hematological profile. Ph. D. thesis, University of Agriculture, Faisalabad, Pakistan. 208p.• Chapter: Author(s) of the chapter. Year. Title of the chapter,pages of the chapter. In author(s) or editor(s). Title of the book.Publisher name, Place of publication.Example: Citation in text: Sloss and Dufty. (1980)Sloss, V. and J.H. Dufty. 1980. Disorders during pregnancy, p. 88-97. In Sloss, V. and J.H. Dufty (eds.) Handbook of Bovine Obstetrics. Williams and Wilkins, Baltimore, U.S.A.Sabrani, M., K. Diwyanto and M. Winugroho 1994. A critical review of buffalo research and development activities in

Indonesia. Past performanceand future strategies, p. 78-89. InProceedings of 1st Asian Buffalo Association Congress,Thailand.

Submission manuscriptSubmit the following items.Cover letter. Identify the corresponding author and provide his/herfull name, address, numbers for telephone and fax, and e-mail address.Manuscript. In 12 point Times or Times New Roman. Type on oneside of A4 paper. Use one inch margins. Number all pages. Send anoriginal manuscript and 1 photocopy.Disk. Include an IBM-formatted, 3-1/2" disk or 4-3/4" CD-ROM,containing the manuscript in Microsoft Word.Mail manuscript to:By post: International Buffalo Information Center

Office of University LibraryKasetsart University,50 Pahonyothin Road, Chatuchak,Bangkok 10900, ThailandTel. 66-2-942-8616

By e-mail: [email protected]

BUFFALO BULLETIN

IBIC, KASETSART UNIVERSITY, P.O. BOX 1084

BANGKOK 10903, THAILAND

URL : http://ibic.lib.ku.ac.th

E-mail : [email protected]

Tel : 66-2-9428616 ext. 344

Fax : 66-2-9406688

mailto:[email protected]

International Buffalo Information Center (IBIC)ibic.lib.ku.ac.th/e-Bulletin/33-2.pdfInternational...

Documents

Transcript of International Buffalo Information Center (IBIC)ibic.lib.ku.ac.th/e-Bulletin/33-2.pdfInternational...