Proc. NatL Acad. Sci. USAVol. 78, No. 11, pp. 6657-6661, November 1981Biochemistry

Internal control regions for transcription of eukaryotic tRNA genes(deletion mutants/RNA polymerase III promoter)

STEPHEN SHARP, DONALD DEFRANCO, THEODOR DINGERMANN, PAUL FARRELL*, AND DIETER SOLLDepartment of Molecular Biophysics and Biochemistry, Yale University, New Haven, Connecticut 06511

Communicated by H. Gobind Khorana, July 1, 1981

ABSTRACT We have identified the region within a eukaryotictRNA gene required for initiation of transcription. These resultswere obtained by systematically constructing deletions extendingfrom the 5' or the 3' flanking regions into a cloned DrosophilatRNAum gene by using nuclease BAL 31. The ability of the newlygenerated deletion clones to direct the in vitro synthesis of tRNAprecursors was measured in transcription systems from Xenopualavis oocytes, Drosophila Kc cells, and HeLa cells. Two controlregions within the coding sequence were identified. The first wasessential for transcription and was contained between nucleotides8 and 25 ofthe mature tRNA sequence. Genes devoid ofthe secondcontrol region, which was contained between nucleotides 50 and58 of the mature tRNA sequence, could be transcribed but withreduced efficiency. Thus, the promoter regions within a tRNAgene encode the tRNA sequences of the D stem and D loop, theinvariant uridine at position 8, and the semi-invariant G-T-0fCsequence.

Types ofRNA formed by RNA polymerase III include 5S RNA,adenovirus virus-associated RNA, and tRNA. Internal "pro-moter" regions for 5S and adenovirus virus-associated RNAgenes have been characterized by transcription analysis of invitro deletion mutations (1-3). An internal control region,within the mature tRNA coding sequence (and possibly its 3'flanking sequences), was shown to be sufficient for accuratetRNA gene transcription by RNA polymerase III (4).

In this paper we identify more precisely the internal controlregion. It is composed of two regions within the mature tRNAcoding sequence which appear to be highly conserved in alltRNAs.

MATERIALS AND METHODSThe plasmid pArg (pYH48) consists of a 508-base-pair HindIIIDrosophila DNA fragment (carrying the gene for the majortRNA' 5 species) inserted into the HindIII site of pBR322 (5).The construction of 5'- and 3'-deletion plasmid DNA was per-formed as outlined in Fig. 1 by standard methods and will bedescribed in detail elsewhere. Covalently closed circular plas-mid DNA was transcribed in S-100 extracts prepared from Xen-opus laevis (6), HeLa cells (7), or Drosophila Kc cells (8). TheRNA transcripts were extracted as described (9) and identifiedby gel electrophoresis on thin gels (10).

RESULTSConstruction and Analysis of Deletion Clones. Two series

of deletion mutations were constructed in the tRNAArg geneaccording to the scheme outlined in Fig. 1. The final result wasthe replacement of Drosophila DNA by plasmid DNA. Fig. 2diagrams the locations ofthe deletions in the various clones. The

B

1. B

2.-BAL-31

3. Klenow

4. oam linker + ligase

5. B+E

6. pBR322 / B / E + Ilgase

S5'- Deletion Clones

i. E

2. BAL-31

3. Klenow

4. EcoRI linker+ ligase

5. B + E

6. pBR322 / B / E + ligas.

3'- Deletion Clones

B

FIG. 1. Construction of 5'- and 3'-deletions within the tRNAA'ggene. The Drosophila DNA insert contained within pBR322 (narrowline) is indicated by crosshatching. The position of the tRNA gene isindicated by the thick band, and its orientation is shown by the tri-angular end. For deletion clone construction, the indicated manipu-lations were performed. The dashed line represents the area in whichdeletions were made. B, BamHI; E, EcoRI; H, Hindm; pBR322/B/E,the isolated large fragment of pBR322 double digested with BamHIand EcoRI.

nucleotide sequences of all clones were established by DNAsequence analysis (11), and these are shown in Fig. 3.

Systems Used for Transcription. In view of the possibilitythat different RNA polymerase III transcription systems mayhave different requirements, the altered tRNA genes weretested for their ability to be transcribed in cell-free extracts fromX. laevis oocytes, Drosophila Kc cells, or HeLa cells. The over-all results were the same, but some variation was observed.Transcription results obtained with the Drosophila and Xeno-pus systems were similar (Fig. 4 A and B). The 5'-deletion

* Present address: Medical Research Council Laboratory of MolecularBiology, University Medical School, Hills Road, Cambridge CB22QHEngland.

6657

The publication costs ofthis article were defrayed in part by page chargepayment. Thisarticle must therefore be hereby marked "advertise-ment" in accordance with 18 U. S. C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Oct

ober

17,

202

0

Proc. Natd Acad. Sci. USA 78 (1981)

70 80 90

Clone

85-_ Arg.3.85(2 Arg 3.72

a Arg 3.60I' Arg3.581 Arg 3.50Arg 3.41

: Arg 3.404 Arg3.36Arg 3.28

: Arg 3.26Arg 3.24

| Arg 3.6

FIG. 2. Schematic representa-tion of deletions within the tRNAAmgene. Nucleotides are numberedrelativeto the 5' end of the maturetRNA- coding sequence. The pri-mary transcript is represented bythe heavy line. The series desig-nated Arg5 represent 5'-deletionclones; and Arg3 represent 3'-dele-tion clones. The second number inthe designation indicates the ex-tent of deletion, the number beingthe first (5'-deletion) or the last (3'-deletion) nucleotide that remainsfrom the wild-type Drosophila pArgsequence.

clones pArg5.-8 and pArg5.7 were transcribed less efficientlyin the Drosophila transcription system (Fig. 4B, lanes 2 and 3)than they were in either the Xenopus or HeLa system (Fig. 4A and C, lanes 2 and 3). In the HeLa cell extracts, however,there was a more pronounced decrease in transcription activityafter deletion ofnucleotides 50-58: clone pArg3.50 (and furtherdeletions upstream of that position) (Fig. 4C, lane 13) tran-scribed poorly (<10%) compared to pArg3.58 (Fig. 4C, lane 12).

Transcription of 5'-Deletion Clones. The clone pArg con-tains 288 base pairs of Drosophila DNA upstream of thetRNA~rg gene. Deletions in this 5' flanking region up to nu-cleotide -20 did not affect the efficiency of transcription or theRNA initiation site (data not shown). Deletion of sequencesbetween positions -8 (pArg5.-8) and +7 (pArg5.7) loweredtranscription efficiency (Fig. 4 A, B, and C, lanes 2 and 3) toabout 50% compared to the pArg control (lane 1). Deletion oftwo additional nucleotides from the mature tRNA encoding se-quence (pArg5.9) resulted in a template unable to support RNAsynthesis in vitro (lane 4). Further removal of nucleotides upto position 55 did not restore template activity (lanes 4-9). Inthe construction of clone pArg5.9 the guanosine present in the

wild-type gene at position 7 was re-formed. The difference be-tween pArg5.7, which could be transcribed, and pArg5.9,which could not be transcribed, is the replacement ofthymidineat position 8 with guanosine. Therefore, the 5' boundary of thesignal for transcription of the tRNAArg gene is nucleotide T atposition 8.

Transcription of3'-Deletion Clones. Deletion ofnucleotidesapproaching the gene from the 3' flanking region resulted inremoval of the normal transcription termination sequence fromthe parent tRNAg gene. Ligation ofthe EcoRI-linked 3'-dele-tion fragments into the EcoRI site of pBR322 (see Fig. 1) re-sulted in proper alignment ofa T-T-T-T-T sequence in pBR322(positions 4319-4323) with the noncoding strand of the tRNAgene. This sequence serves as an efficient termination signalfor RNA polymerase III (e.g., see refs. 5 and 12) in the 3'-dele-tion clones. Transcription of these clones therefore resulted insynthesis of RNAs differing in length from the primary tran-script of the parent pArg. In the Drosophila transcription sys-tem approximately 10% of the transcription products of the 3T-deletion clones were observed as termination read-throughproducts ofthe first termination sequence. From size estimates

-10 +1 10 20 30 40 50 60 70 80 90Arg 5'-CACR CAAGCGGTCCTGTGGCGCAATGGATAACGCGTCTGACTACGGATCAGAAGATTCCAGGTTCGACTCCTGGCAGGATCGAATTTTTGGCGTTAT-3'

51-G GCCAAGCGGTCCTGTGGCGCAATGGATAACGCGTCTGACTACGGATCAGAAGATTCCAGGTTCGACTCCTGGCAGGATCGAATITTT...GGCGTTAT-3'5'-GGCOTAGAGGATCCG GTGGCGCAATGGATAACGCGTCTGACTACGGATCAGAAGATTCCAGGTTCGACTCCTGGCAGGATCGAATTTTTTTGGCGTTAT-3'5 '-CCGGCGTAGAGGATCC GCAATGGATAACGCGTCTGACTACGGATCAGAAGATTCCAGGTTCGACTCCTGGCAGGATCGAATTTTTrTGGCGTTAT-3'5'-CGTCCGGCGTAGAGGATC TAACGCGTCTGACTACGGATCAGAAGATTCCAGGTTCGACTCCTGGCAGGATCGAATTTTTTTGGCGTTAT-3'5 '-GCCACGATGCGTCCGGCGTAGAGGATCCGG CGCGTCTGACTACGGATCAGAAGATTCCAGGTTCGACTCCTGGCAGGATCGAATTTTTTTGGCGTTAT-3'5 '-GGTGATGCCGGCCACGATGCGTCCGGCGTAGAGGAICCGG CTACGGATCAGAAGATTCCAGGTTCGACTCCTGGCAGGATCGAATTTTTTTGGCGTTAT-3'5 '-GCGCCGGTGATGCCGGCCACGATGCGTCCGGCGTAGAGGATCC AGATTCCAGGTTCGACTCCTGGCAGGATCGAATTTTTTTGGCGTTAT-3'5'-GCCAGCAACCGCACCTGTGGCGCCGGTGATGCCGGCCACGATGCGTCCGGCGTAGAGGATCC CGACTCCTGGCAGGATCGAATTTTTTTGGCGTTAT-3'

5 '-CACJrCAAGCGGTCCTGTGGCGCAATGGATAACGCGTCTGACTACGGATCAGAAGATTCCAGGTTCGACTCCTGGCAGGATCGAA GCG.AAGCC -3'5'-CAC TCAAGCGGTCCTGTGGCGCAATGGATAACGCGTCTGACTACGGATCAGAAGATTCCAGGTTCGACTCCTGGCAGGAT GAATTCTTGAAGACGAA-3'5 '-CACJTCAAGCGGTCCTGTGGCGCAATGGATAACGCGTCTGACTACGGATCAGAAGATTCCAGGTTCGAC GAATTCTTGAAGACGAAAGGGCCTCGTGA-3'5 '-CACTCAAGCGGTCCTGTGGCGCAATGGATAACGCGTCTGACTACGGATCAGAAGATTCCAGGTTCG GAATTCTTGAAGACGAAAGGGCCTCGTGATA-3'5 '-CAcrCAAGCGGTCCTGTGGCGCAATGGATAACGCGTCTGACTACGGATCAGAAGATTC GGAATTCTTGAAGACGAAAGGGCC TCGTGAIACGCCTATT-315 '-CAC¢TCAAGCGGTCCTGTGGCGCAATGGATAACGCGTCTGACTACGGATC GAATTCTTGAAGACGAAAGGCCTCGTGAIACGCCrAITTTTATAGGT -3'5 '-CACjTCAAGCGGTCCTGTGGCGCAATGGATAACGCGTCTGACTACGGAT GAATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTT -3'5 '-CA CAAGCGCTCCTGTCGCGCAATGCATAACGCGTCTCACTAC* GAATTCTTGAAGACGAAAGGGCCICGIGATACGCCTAITTW[ATAGGTTAAIG-3'5 '-CAiCTCAAGCGGTCCTGTGGCGCAATGGATAACGCGTCTGAATTCTTGAAGACGAAAGGGCCTCGTGATAC&CCTAIITATAGGTTATATAGTCAGATA-3'5'-CACDrCAAGCGGTCCTGTGGCGCAATGGATAACCCG GAATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTTATAGGTTAATGTCATGATAAT-3'5'-CACGTCAAGCGGTCCTGTGGCGCAATGGATAACGCGAATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAA-3'5'-CACGTCAAGCGGTCCTGGAATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAG-3'

FIG. 3. DNA sequences of the anti-coding strand of the deletion clones shown in Fig. 2. Arg-is the sequence of the wild-type (parent) gene. Theextent of the deletions is outlined and pBR322 sequences are in serif type. bor the genes that are transcribed, the RNA initiation site nucleotide(-7) is boxed and the termination sequence is underlined.

-7 10 20 30 40 50 60

Clone

Arg5.-8Arg5.7Arg5.9Arg 5.12Arg 5.21Arg 5.31Arg 5.36Arg 5.55S

:_-879.

2

_31

Arg5.-8Arg5.7Arg5.9Arg5 .12Arg5.21Arg5.31Arg5 .36Arg5.55

Arg3.85Arg3 .72Arg3.60Arg3.58Arg3 .50Arg3.41Arg3.40Arg3.36Arg3 .28Arg3 .26Arg3 .24Arg3.6

'pppG un"

6658 Biochemistry: Sharp et aL

Dow

nloa

ded

by g

uest

on

Oct

ober

17,

202

0

Proc. Natd Acad. Sc. USA 78 (1981) 6659

2 3 4 5 6 7.8 9 10 11 12 13 14 15 16 17 18 19 20 21(D a2:I ..,

lprecursor Sn = 120

a'.-.precursor

n-84

tRNA

2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18

precursorn.120

precursor sn-84tRNA -a tRNA M-

0D 2 3 4 5 6 7 8 9 10 11 1-2 13 14 15 16 17 1 19 20 21

a

precursor

tRNA_

FIG. 4. Autoradiograph of a gel electrophoretic separation of 32P-labeledRNA transcribed from the 5'- and 3'-deletion clones. (A)X. kaevis oocyteS-100. [a-32P]LTP was used in all reactions. Lanes: 1, pArg; 2, pArg5.-8; 3, pArg5.7; 4, pArg5.9; 5, pArg5.12; 6, pArg5.21; 7, pArg5.31; 8, pArg5.36;9, pArg5.55; 10, pArg3.85; 11, pArg3.72; 12, pArg3.60; 13, pArg3.58; 14, pArg3.50; 15, pArg3.41; 16, pArg3.40; 17, pArg3.36; 18, pArg3.28; 19,pArg3.26; 20, pArg3.24; 21, pArg3.6. (B) Drosophila Kc cell S-100. Lanes 1-9 were as in A and used [a-32P]GTP. The radioactive species with amobility slightly faster than that of mature tRNA is not a transcription product but results from a GMP-transferase activity in the extract whichuses endogenous RNA as substrate. Lanes 10-18: 10, pArg3.72; 11, pArg3.60; 12, pArg3.58; 13, pArg3.50; 14, pAri3.40; 15, pArg3.36; 16, pArg3.28;17, pArg3.26; 18, pArg3.24. Reactions 10-18 used [a-3'P]UTP. (C) HeLa cell S-100. Lanes 1-21 were as inA and [a- 2PUTPwas used in all reactions.

of these transcripts, termination occurred with transcription oftwo to five uridine-residues, within the T-T-T-T-T sequence inpBR322 at positions 4233-4237.

Transcription ofdeletion clone pArg3.85, which still containsthe wild-type pArg terminator, gave the same transcriptionproducts as synthesized from the parent pArg clone (Fig. 4A,lane 10). This demonstrates that removal of 3' flanking se-quences does not affect the synthesis of tRNAA"9. Removal of3' sequences downstream from nucleotide 72 deleted the nor-mal pArg termination site (pArg3.72). This clone produced theexpected primary transcript of approximately 120 nucleotides(Fig. 4A, lane 11; Fig. 4 B and C, lane 10). Transcription of thesuccessive 3'-deletion clones up to nucleotide 26 resulted inprimary transcription products that were sequentially shorter(Fig. 4A, lanes 11-19; Fig. 4 B and C, lanes 10-12). Removalof nucleotides 26 and 25 resulted in a tRNA gene template

(pArg3.24) unable to support RNA synthesis. Because guano-sine at position 26 was reconstructed in clone pArg3.24, weconclude that the 3' boundary of the signal for transcription ofthe tRNAAT9 gene is at nucleotide 25.

Repeated quantitative analysis of the amount of transcriptformed from the 3'-deletion clones showed that the removal ofnucleotides 50-58 resulted in a 50% lower activity comparedto the native control. Therefore, the tRNA gene region boundedby nucleotides 50 and 58 also has some function as a controlsequence for tRNA gene transcription.

DISCUSSIONWe have constructed deletion mutations within a DrosophilatRNAP gene by using the processive nuclease BAL 31 (13). Inthe resulting mutants, successively larger sequences of Dro-sophila DNA from either the 5' or 3' side ofthe tRNA gene have

Biochemistry: Sharp et aL

Dow

nloa

ded

by g

uest

on

Oct

ober

17,

202

0

6660 Biochemistry: Sharp etaP

AOHCCG

pG . CG * UU *0 AC * GC * GU * A/iG G U

1F AG A

UA

U * AC *1 GU * AG * CA GU

C A

U GA G

C

FIG. 5. Internal transcription control regions (boxed) drawn intothe cloverleaf structure of Drosophila tRNA2`. Crosshatched nucleo-tides represent invariant or semi-invariant positions in tRNA (14).

been replaced by pBR322 DNA. By analyzing the ability of the5'- and 3'-deletion templates to direct the synthesis ofRNA invitro, we have defined the outside borders of the internal tran-scriptional control regions required for tRNA gene transcrip-tion. These results show that there are two transcriptional con-

trol regions within the tRNA coding sequence (Fig. 5). Onecontrol region, bounded by nucleotides 8 and 25, encodes theD stem and D loop and the invariant uridine at position 8 foundin all tRNAs (14). The second control region is bounded by nu-

cleotides 50 and 58 and encodes the semi-invariant sequence

G-T-qi-C in loop IV of tRNA (14). The D-stem/D-loop controlregion of the gene displayed "classical" gene promoter qualitiesin that removal of the single nucleotide, thymidine-8, and sim-ilarly nucleotide 25, a cytidine, resulted in complete loss oftran-scriptional activity. Although the loop IV control region en-

hanced transcriptional activity, its presence was not an absoluterequirement for tRNA gene transcription. Templates devoid ofthe loop IV region were transcribed, whereas templates con-

taining this region but lacking the D-stem/D-loop regionshowed no transcriptional activity.The transcriptional properties ofthe deletion templates were

defined by the presence or absence of stable transcripts as ana-

lyzed by gel electrophoresis. Although unlikely, there is thepossibility that some mutants may support the synthesis ofRNAthat is hypersensitive to nuclease degradation. A study of pro-moter efficiencies by competition experiments (3, 15) will verifythe defined boundaries for the tRNA2rg gene internal controlregion. Such studies will also determine whether any effects ontranscription can be attributed to the pBR322 sequences usedto replace Drosophila DNA in the deletion constructions.

The presence of two, possibly internal, control regions was

implicated in an earlier study (16). In this work, neither half ofa Xenopus tRNA1Met gene, which included some flanking se-

quences cloned into a plasmid, would support in vitro or in vivo

transcription. At present, this result is at variance with our find-ings because the 5'-half of the tRNA'9 gene alone (clonespArg3.41, pArg3.40, pArg3.36, and pArg3.28) could efficientlydirect RNA synthesis in various cell-free extracts (includingXenopus germinal vesicles). Further studies should clarifywhether a different mechanism operates for the transcriptionof initiator tRNA genes.

Recently, Koski et aL (17) demonstrated that a single mutationwithin the yeast SUP4-o tRNATYr gene at cytidine-56 locatedin the semi-invariant G-T-f-C sequence significantly reducedthe in vitro transcriptional activity of this gene. Two other mu-tations, which affect in vitro transcription properties of thisgene, lie within the D loop (17). This is in agreement with ourfinding that these regions are important for transcriptioncontrol.

Comparison of all known tRNA sequences (14) shows that theD stem, D loop, uridine-8, and G-T-q-C sequence are highlyconserved in prokaryotic and eukaryotic cytoplasmic tRNAs.These invariant nucleotides are indicated (crosshatched) in thecloverleaf structure of Drosophila tRNAP (Fig. 5). They liewithin the sequences that comprise the transcriptional controlregions (boxed areas). It is interesting that the gene regionscontaining the regulatory signals for RNA polymerase III ortranscription factors include these invariant positions. In vitromutagenesis studies will show whether these bases are crucialfor promoter function. At the RNA level, some of the same nu-cleotides are involved in tRNA functions such as aminoacyl-tRNA synthetase interaction (18) or ribosome binding (19). Thisis efficient use ofnucleotide sequence information for differentfunctions, first at the level of the gene and then at the level ofthe gene product. It also indicates that some of the invariantnucleotides found in tRNA may not be related to any ofthe func-tions of the tRNA molecule itself.The identification of the D stem, D loop, and loop IV region

as transcriptional control signals for tRNA genes is significantwhen one considers that tRNA genes vary greatly in length.Some of them contain long extraloop (loop III) sequences andothers may have intervening sequences (e.g., see ref. 20). Thestudies by Johnson et aL (20) and Wallace et al. (21) demon-strated that addition or deletion ofintervening sequence regionswithin a tRNA gene does not affect the transcription of thisgene. This may suggest that tRNA genes assume a tRNA-likesecondary structure during transcription initiation.

Recently, the outside boundaries ofthe internal transcriptioncontrol region for the adenovirus VAI and VAIIRNA genes weredetermined (3). It was observed that there are significant hom-ologies in this region with certain parts oftRNA sequences (3).Our results show that the tRNA transcription control regionsare indeed within these sequences. Fig. 6 compares sequencesofVA RNA, 5S RNA genes, and some tRNA genes, which couldbe transcribed efficiently in Drosophila and Xenopus extracts.Analysis of the sequences of all known eukaryotic tRNAs (14)leads to the predicted general promoter structure. The VAIRNA gene has more homology with that sequence than does theVAII RNA gene (24). This may be why VAI RNA is found inmuch larger amounts than VAII RNA (3). An interesting aspectof this comparison is the good homology between prokaryoteand eukaryote tRNAs within the eukaryotic tRNA gene pro-moter regions. Because the promoter for prokaryote tRNAgenes is in the region 5' flanking the coding sequence (25), thishomology may reflect functional similarities of prokaryote andeukaryote tRNAs. From this homology, however, the questionis raised whether prokaryote tRNA genes could be transcribedby eukaryote RNA polymerase III.

Homologous regions between the generalized promoter se-quence of tRNA genes and the 5S RNA gene are found in the

Proc. Nad Acad. Sci. USA 78 (1981)

Dow

nloa

ded

by g

uest

on

Oct

ober

17,

202

0

Proc. Natd Acad. Sci. USA 78 (1981) 6661

tRNA2Axg Drosophila 6TGTGGCGCAAT.GGAT.AA::cGCGT27..21BP..49CCAGGTTCGACTCC62

tRNA2LYS Drosophila 6GcTAGCTcAGTcGGT..AG::AGCAT27 ..21BP . 49GTGGGTTCGAGCCC62tRNALeU Drosophila 6GATGGCCGAGc.GGTCTAA::GGCGC27. ..B.... 79GTGGGTTCGAATCC62tRNA MetXenopus 6AGTGGCGCAGC.GGA..AG::CGTGC27 . 20BP..49GATGGATCGAAACC62tRNAA"aBomby 6CGTAGCTCAGATGGT..AG::AGCGC27..21BP..49CCGGGATCGATACC62tRNAT3" sup-4 yeast 6GGTAGCcAAGTTGGTTTAA::GGCGC27..35BP..49GGGCGTTCGACTCG62tRNATrP yeast 6GGTGGCTCAAT.GGT..AG::AGCTT27..54BP..49GCAGGTTCMTTCC62

VAI RNA adenovirus 15CGTGGTCTGGT.GGATAAATTCGCAA39..19BP .. 59CGGGGTTCGAACCC72VAil RNA adenovirus 12TGTAGCCGGAG.GGTTATTTTCCAAG36..17BP..53CCCGGTTCGAGTCT6655 RNA Xenopus 71GTTAGTACCT .. GGATGGGAGAGCGC94 56ACAGGGTCGGGCCT69tRNA eukaryote 6NNTPNQNNAPN. GGN ..AN::NPNNN2 . 49NNNNGRTCPANNCN62

tRNA prokaryote

General promoter

6NNTNNNNNAPN.GGN..NN::NPNNN27........49NNNPGRTCPANQCP62

6NNTPNQNNPPN.GGN..AN::NPNNN27 .....49NNNNGRTCPANNCN62

FIG. 6. Comparison of tRNA, 5S RNA, and VA RNA gene sequences. Larger letters show matches in the sequences. N, any nucleotide; P, purinenucleotide; Q, pyrimidine nucleotide; R, adenosine or thymidine. The sequences are taken from refs. 1, 14, 16, and 21-24.

internal promoter region for 5S RNA (1, 2). However, as pointedout earlier (3), there is less homology between 5S and tRNAgenes than between VA RNA and tRNA genes. In addition, theorientations of the homologous regions in the 5S gene are op-posite to those found in the tRNA gene (Fig. 6). Furthermore,the 5S transcription factor (26, 27) is not involved in the tran-scription oftRNA genes (26-28). This suggests that a differentfactor may be involved in the initiation of transcription of bothVA and tRNA genes, and that such factors would determinegene selection (29).

Note Added in Proof. Recently, the presence ofa split promoter wasalso shown in a Xenopus tRNA gene (29).

We thank S. Mount and G. S. Reed for providing the Drosophila Kcand HeLa cells and B. Appel for helping with transcription reactionsin the germinal vesicle system. This work was supported by grants fromthe National Institutes ofHealth and the National Science Foundation.T.D. was a Postdoctoral Fellow ofthe Deutsche Forschungsgemeinschaft.

1. Bogenhagen, D. F., Sakonju, S. & Brown, D. D. (1980) Cell 19,27-35.

2. Sakonju, S., Bogenhagen, D. F. & Brown, D. D. (1980) Cell 19,13-25.

3. Fowlkes, D. M. & Shenk, T. (1980) Cell 22, 405-413.4. DeFranco, D., Schmidt, O., Soil, D. & Hovemann, B. (1980)

Proc. Natl Acad. Sci. USA 77, 3365-3368.5. Silverman, S., Schmidt, O., Soil, D. & Hovemann, B. (1979)J.

Biol Chem. 254, 10290-10294.6. Ng, S. Y., Parker, C. S. & Roeder, R. A. (1979) Proc. NatL Acad.

Sci. USA 76, 136-140.7. Weil, P. A., Segall, J., Harms, B., Ng, S. Y. & Roeder, R. A.

(1979) J. Biol Chem. 254, 6163-6173.8. Dingermann, T., Sharp, S., Appel, B., DeFranco, D., Mount,

S., Heiermann, R., Pongs, 0. & S11, D. (1981) Nucleic AcidsRes. 9, 3907-3981.

9. Schmidt, O., Mao, J., Silverman, S., Hovemann, B. & S611, D.(1978) Proc. Natl Acad. Sci. USA 75, 4819-4823.

10. Sanger, F. & Coulson, A. R. (1978) FEBS Lett. 87, 107-110.11. Maxam, A. M. & Gilbert, W. (1980) Methods Enzymol 65,

499-560.12. Schmidt, 0. & Soil, D. (1981) Bioscience 31, 34-39.13. Lau, P. P. & Gray, H. B. (1979) Nucleic Acids Res. 6, 331-357.14. Gauss, D. H. & Sprinzl, M. (1981) Nucleic Acids Res. 9, rl-r23.15. Wormington, W. M., Bogenhagen, D. F., Jordan, E. & Brown,

D. D. (1981) Cell 24, 809-817.16. Kressmann, A., Hofstetter, H., DiCapua, E., Grosschedl, R. &

Birnstiel, M. L. (1979) Nucleic Acids Res. 7, 1749-1762.17. Koski, R. A., Clarkson, S. G., Kurjan, J., Hall, B. D. & Smith,

M. (1980) Cell 22, 415-425.18. Schimmel, P. R. (1979) in tRNA: Structure, Properties and Rec-

ognition, eds. Schimmel, P. R., S11, D. & Abelson, J. N. (ColdSpring Harbor Laboratory, Cold Spring Harbor, NY), pp.297-310.

19. Cantor, C. R. (1979) in tRNA: Structure, Properties and Recog-nition, eds. Schimmel, P. R., Soil, D. & Abelson, J. N. (ColdSpring Harbor Laboratory, Cold Spring Harbor, NY), pp.363-392.

20. Johnson, J. D., Ogden, R., Johnson, P., Abelson, J., Dembeck,P. & Itakura, K. (1980) Proc. Natl Acad. Sci. USA 77, 2564-2568.

21. Wallace, R. B., Johnson, P. F., Tanaka, S., Schold, M., Itakura,K. & Abelson, J. (1980) Science 209, 1396-1400.

22. Robinson, R. R. & Davidson, N. (1980) Cell 23, 251-259.23. Hovemann, B., Sharp, S., Yamada, H. & Soil, D. (1980) Cell 19,

889-895.24. AkusjIrvi, G., Matthews, M. B., Andersson, R., Vennstrom, B.

& Pettersson, U. (1980) Proc. NatL Acad. Sci. USA 77, 2424-2428.25. Sekiya, T., Gait, M. J., Norris, K., Ramamoorthy, B. & Khorana,

H. G. (1976) 1. Biol Chem. 251, 4481-4489.26. Engelke, D. R., Ng, S.-Y., Shastry, B. S. & Roeder, R. G. (1980)

Cell 19, 717-728.27. Pelham, H. R. B. & Brown, D. D. (1980) Proc. NatL Acad. Sci.

USA 77, 4170-4174.28. Sakonju, S., Brown, D. D., Engelke, D., Ng, S.-Y., Shastry, B.

S. & Roeder, R. G. (1981) Cell 23, 665-669.29. Hofstetter, H., Kressmann, A. & Birnstiel, M. L. (1981) Cell 24,

573-585.

Biochemistry: Sharp et d

Dow

nloa

ded

by g

uest

on

Oct

ober

17,

202

0