Interactions of Methicillin Resistant Staphylococcus ...

Interactions of Methicillin Resistant Staphylococcusaureus USA300 and Pseudomonas aeruginosa inPolymicrobial Wound InfectionIrena Pastar1, Aron G. Nusbaum1, Joel Gil1, Shailee B. Patel1, Juan Chen2¤, Jose Valdes1,

Olivera Stojadinovic1, Lisa R. Plano1,2,3, Marjana Tomic-Canic1, Stephen C. Davis1*

1Department of Dermatology and Cutaneous Surgery, Wound Healing and Regenerative Medicine Research Program, University of Miami Miller School of Medicine,

Miami, Florida, United States of America, 2Department of Pediatrics, University of Miami Miller School of Medicine, Miami, Florida, United States of America, 3Department

of Immunology and Microbiology, University of Miami Miller School of Medicine, Miami, Florida, United States of America

Abstract

Understanding the pathology resulting from Staphylococcus aureus and Pseudomonas aeruginosa polymicrobial woundinfections is of great importance due to their ubiquitous nature, increasing prevalence, growing resistance to antimicrobialagents, and ability to delay healing. Methicillin-resistant S. aureus USA300 is the leading cause of community-associatedbacterial infections resulting in increased morbidity and mortality. We utilized a well-established porcine partial thicknesswound healing model to study the synergistic effects of USA300 and P. aeruginosa on wound healing. Wound re-epithelialization was significantly delayed by mixed-species biofilms through suppression of keratinocyte growth factor 1.Pseudomonas showed an inhibitory effect on USA300 growth in vitro while both species co-existed in cutaneous woundsin vivo. Polymicrobial wound infection in the presence of P. aeruginosa resulted in induced expression of USA300 virulencefactors Panton-Valentine leukocidin and a-hemolysin. These results provide evidence for the interaction of bacterial specieswithin mixed-species biofilms in vivo and for the first time, the contribution of virulence factors to the severity ofpolymicrobial wound infections.

Citation: Pastar I, Nusbaum AG, Gil J, Patel SB, Chen J, et al. (2013) Interactions of Methicillin Resistant Staphylococcus aureus USA300 and Pseudomonasaeruginosa in Polymicrobial Wound Infection. PLoS ONE 8(2): e56846. doi:10.1371/journal.pone.0056846

Editor: Michael Otto, National Institutes of Health, United States of America

Received October 18, 2012; Accepted January 15, 2013; Published February 22, 2013

Copyright: � 2013 Pastar et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permitsunrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: The authors have no support or funding to report.

Competing Interests: The authors have declared that no competing interests exist.

* E-mail: [email protected]

¤ Current address: Division of Rheumatology, Xiamen University, Xiamen, China

Introduction

When the integument is compromised, bacterial microorgan-

isms from the environment and skin surface are able to gain access

to underlying tissues where the physical characteristics are optimal

for colonization and growth. Staphylococcus aureus and Pseudomonas

aeruginosa are among the most common organisms isolated from

both acute and chronic wounds of various etiologies. Their

prevalence has been demonstrated in surgical site infections as well

as in the military setting where they have been attributed to

causing infections of combat related injuries such as penetrating

trauma and burn wounds [1,2,3,4,5]. Multiple studies have also

emphasized the presence of bacteria and the polymicrobial nature

of chronic, non-healing wounds [6,7,8,9,10], and the frequency of

S. aureus and P. aeruginosa organisms has been shown to be

exceedingly high [10,11,12,13,14]. This polymicrobial bioburden

in wounds exists predominantly in the form of a biofilm resistant to

antimicrobial treatments [15,16,17,18,19].

S. aureus, in its methicillin sensitive and methicillin resistant form

(MRSA), is a common opportunistic pathogen, responsible for the

majority of all superficial skin infections, resulting in increased

morbidity, mortality, and tremendous health-care costs [20].

Increased incidence of MRSA-associated infections in both acute

and chronic wounds is well-documented [3,21,22], and toxins as

well as virulence factors produced by MRSA contribute in a major

way to the pathogenicity [23]. These virulence factors include

Panton-Valentine leukocidin (pvl), staphylococcal protein A (spa)

and a-hemolysin (hla) [24]. The leading cause of community-

associated bacterial infections in the United States is the MRSA

isolate USA300 [25], which appears to have enhanced virulence as

compared to the traditional hospital-associated MRSA strains

[26,27,28]. While there has been an intense effort to better

understand the mechanisms of MRSA virulence in various animal

models, including skin abscesses [29,30], the role of USA300 and

its virulence during cutaneous wound healing has not been

described.

The opportunistic pathogen P. aeruginosa expresses two types of

quorum sensing (QS) population density-dependent systems, LasI-

LasR and RhlI-RhlR. Both QS systems contribute to the

pathology of cutaneous wound infections [31,32], and LasI-LasR

and RhlI-RhlR have been shown to regulate the expression of

virulence factors such as exoenzyme S (ExoS) and exotoxin A

(ToxA) which can further induce apoptosis in macrophages and

neutrophils [33,34,35,36].

The widespread presence of both USA300 and P. aeruginosa in

acute and chronic wounds [3,4,5,11,12], the overwhelming

incidence of staphylococcal skin and soft tissue infections, as well

as the finding that wounds infected with Pseudomonas are slower to

PLOS ONE | www.plosone.org 1 February 2013 | Volume 8 | Issue 2 | e56846

heal [31,37,38], all lend support to the notion that these two

common pathogens are likely culprits in causing wound infection

and delayed healing. Furthermore, infection with either S. aureus or

P. aeruginosa has been shown to delay wound closure in mouse and

rabbit wound healing models [31,37,39,40,41].

Current knowledge regarding the interactions between S. aureus

and P. aeruginosa within polymicrobial wound infections is derived

from both in vitro [42] and in vivo studies [39]. While in vitro-

generated mixed species biofilms have been shown to delay

healing when placed in a murine wound model [42], and a recent

study demonstrated the ability of polymicrobial biofilms to impair

healing in a rabbit ear model [39], to our knowledge, the role of

bacterial virulence factors in polymicrobial wound infections has

not been evaluated until now. In this study, we utilized a well-

established porcine wound model [19,43,44] to investigate the

effects of polymicrobial USA300 and P. aeruginosa infections. The

P. aeruginosa strain used in the study was selected among different

wound isolates based on the presence of QS systems, virulence

factors and the ability to form a biofilm. Multi-species infected

cutaneous wounds were compared to those containing only a single

species or un-inoculated wounds, with respect to epithelialization,

expression of bacterial virulence factors, and host response.

Herein, we show that infection with both USA300 and P. aeruginosa

significantly impairs wound closure as compared to single-species

biofilms through down-regulation of keratinocyte growth factor 1

(KGF1) expression. In addition, we demonstrate induction of

USA300 virulence factors pvl and hla in the presence of P.

aeruginosa, providing in vivo evidence that interspecies interactions

are operative in promoting bacterial pathogenicity and delayed

healing in polymicrobial wound infections.

Materials and Methods

Bacterial Strains and Growth ConditionsMethicillin-resistant S. aureus USA300-0114 and 5 clinical

combat wound isolates of P. aeruginosa (obtained from the U.S.

Army Institute of Surgical Research, Fort Sam Houston, TX) were

used. Tryptic soy broth (TSB) served as the growth medium, while

Oxoid’s Oxacillin Resistance Screening Agar Base (ORSAB) and

Pseudomonas Agar with CN supplement (Oxoid) were used as

selective media for plate-counting.

In vitro Biofilm AssayIn order to quantify biofilm production by P. aeruginosa wound

isolates, 106 bacteria were inoculated in TSB media in 12-well

polystyrene plates and incubated at 37uC for 24 h. Biofilm

biomass by adherent bacteria was quantified upon removal of

medium, washing with phosphate-buffered saline (PBS), and

staining with 0.2% crystal violet [45]. Biofilm bound dye was

recovered with 100 ml of 1% sodium dodecyl sulfate (SDS), and

each biomass was quantified by measuring absorbance at 590 nm

(A590). Wells incubated without bacteria were used as blanks.

Alternatively, P. aeruginosa 09-010, USA300, or a combination of

both species was grown in TSB under same conditions. In order to

quantify the number of viable cells grown in the biofilm, bacteria

were recovered with sonication at 50W for 10 sec to separate

bacterial cells attached to the wells, and serial dilutions were plated

on selective medium, ORSAB or Pseudomonas Agar with CN

supplement, to determine colony forming units (CFU).

Experimental AnimalsTwo young, female, specific pathogen-free pigs (SPF: Ken-O-

Kaw Farms, Windsor, IL) weighing between 25 and 35 kg were

used in this study. These animals were fed a non-antibiotic chow

ad libitum before the study, fasted overnight before the

procedures, and housed individually in our animal facilities

(meeting USDA compliance) with controlled temperature (19–

21uC) and controlled light and dark cycles (12 hour light/12 hour

dark). The experimental animal protocols were approved by the

University of Miami Institutional Animal Care and Use Commit-

tee and all the procedures followed the federal guidelines for the

care and use of laboratory animals. In order to minimize possible

discomfort, analgesics (buprenorphine and fentanyl transdermal

patches) were used during the entire experiment. Forty eight (48)

partial thickness wounds were made on the paravertebral area of

each animal. The wounds were then divided into four groups,

each containing 12 wounds. First group was inoculated with

USA300, second group was inoculated with P. aeruginosa, third

group was inoculated with both USA300 and P. aeruginosa

simultaneously, and the fourth group remained un-infected as

a control. Three wounds from each group were used to determine

bacterial counts and bacterial RNA, and an additional three

wounds were used for histological evaluation and host RNA

isolation at days 2 and 4 post-wounding and inoculation from each

animal.

Wounding and InfectionMethods describing the animal preparation and wounding are

explained in detail in our previous studies [43,46]. Briefly, the

flank and the back of experimental animals were prepped on the

day of the experiment. Animals were anesthetized and partial

thickness wounds (10 mm67 mm) were made on the paraverteb-

ral area using a modified electrokeratome set at 0.5 mm deep [44].

The wounds were separated from one another by approximately

50 mm areas of unwounded skin.

Wounds were inoculated with 25 ml of 106 CFU/mL of either

USA300, P. aeruginosa, or both species immediately after wounding.

In order to promote establishment of biofilm infection, wounds

were covered with a polyurethane film dressing (Tegaderm; 3 M

Health Care, St. Paul, MN) to allow for biofilm formation as

previously described [43]. The film dressings were secured in place

by wrapping the animals with self-adherent bandages (Petflex;

Andover, Salisbury, MA).

Bacterial Recovery and Quantification from WoundsThree wounds from each treatment group at each assessment

time were cultured quantitatively using a modified scrub technique

[43]. Each wound was encompassed by a sterile surgical grade

steel cylinder (22 mm outside diameter) and bacteria were

collected by scrubbing the wound area with a sterile Teflon

spatula into 1 ml of sterile phosphate buffer saline. 500 ml of

collected suspension was centrifuged and the remaining pellet was

preserved in RNAlater (Ambion) for RNA extraction. The

remaining portion of the recovery suspension (500 ml) was used

for the quantification of viable organisms. Serial dilutions were

made and plated using a Spiral Plate System (Rockland, MA), and

selective media, ORSAB for USA300 and Pseudomonas Agar with

CN supplement was used to determine CFUs in the scrub solution

collected from each wound. Plated bacteria were incubated

aerobically for 24 hours at 37uC. CFUs were determined by the

standard colony counting method.

Biopsies and HistologyThree wounds per group were assessed on Days 2 or 4 post

inoculation and wounding. A 4 mm punch biopsy was collected

from the center of the wounds and stored in RNA later (Ambion)

for further RNA isolation. Three additional punches were

collected from unwounded skin and also preserved in RNA later.

Mixed-Species Biofilms in Wound Healing


To evaluate wound healing rates, incisional biopsies from three

wounds per condition from each animal were obtained; a trans-

verse section approximately 3-mm thick was cut through the

central part of the wound, including 5 mm of adjacent uninjured

skin at day 2 and 4 post-wounding. The tissues were fixed and

processed for paraffin embedding. 7 mm sections were cut and

stained with hematoxylin and eosin. Staining was analyzed using

a Nikon Eclipse E800 microscope, and the digital images were

collected using SPOT camera advanced program. The wounds

were quantified by planimetry as described previously [47,48,49].

ImmunohistochemistryParaffin sections were used for staining with anti-K14 antibody

(1:50, Abcam). 5 mm thick sections were de-waxed in xylene,

rehydrated, and washed with 16 phosphate-buffered saline (PBS)

(Fisher Scientific). For antigen retrieval, sections were heated in

95uC water bath in target retrieval solution (DAKO Corporation).

The tissue sections were blocked with 5% bovine serum albumin

(Sigma) and incubated with antibody against K14 overnight at

4uC. The slides were then rinsed in PBS, incubated with Alexa

Fluor 488-conjugated goat anti-mouse antibody (Invitrogen) for

1 hr at room temperature and mounted with Prolong DAPI Gold

antifade reagent (Invitrogen) to visualize cell nuclei. Specimens

were analyzed using a Nikon eclipse E800 microscope and digital

images were collected using the NIS Elements program.

RNA IsolationPorcine RNA was isolated using RNAspin Mini Kit (GE

healthcare) following manufacturer’s instruction. Briefly, skin was

digested with proteinase K treatment in TES buffer (30 mM Tris,

10 mM EDTA, 1% SDS, pH 8) and homogenized using

a handheld homogenizer and disposable sterile pestle upon

addition of RA1 lysis buffer. Bacterial RNA was isolated from

both in vitro grown bacteria and collected wound scrub samples

using RNeasy Mini Kit (Qiagen, Hilden, Germany). Bacterial

pellets were digested and lysed in the presence of proteinase K

containing either lysozyme (1 mg/ml; Sigma), or lysostaphin

(Sigma, 30 U/ml) for samples collected from P. aeruginosa and

USA300 wounds, respectively. Combination of lysozyme and

lysostaphin was used for scrubs samples collected from mixed

species inoculated wounds. RNA quality and concentration was

assessed on the Agilent Bioanalyzer using the RNA 6000 Pico

LabChipH Kit (Agilent Technologies, Waldbronn, Germany).

cDNA Synthesis and Real-time qPCRFor real-time qPCR, 20 ng of total RNA from unwounded

porcine skin and wound tissue was reverse transcribed and

amplified using iScript One-Step RT-PCR Kit (Biorad). Real-time

PCR was performed in triplicates using the IQ5 multi-color real-

time PCR system (Bio-Rad). Relative expression was normalized

for levels of GAPDH. The porcine primer sequences used were:

GAPDH, forward (59-ACATCATCCCTGCTTCTAC-39) and

reverse (59-T TGCTTCACCACCTTCTTG-39); IL-1a, forward(59-GCCAATGACACAGAAGAAG-39) and reverse (59-

TCCAGGTTATTTAGCACAGC -39); IL-1b forward (59-

GGCTAACTACGGTGACAAC-39) and reverse (59-

GATTCTTCATCGGCTTCTCC-39); IL-6 forward (59-

TTCACCTCTCCGGACAAAAC-39) and reverse (59-

TCTGCCAGTACCTCCTTGCT-39); IL-8, forward (59- GAC-

CAGAGCCAGGAAGAGAC -39) and reverse (59-

GGTGGAAAGGTGTGGAATGC-39); IL-10 forward (59-

TGGAGGACTTTAAGGGTTAC-39) and reverse (59-CAGGG-

CAGAAATTGATGAC-39); TNFa forward (59-

CACGCTCTTCTGCCTACTG-39) and reverse (59- ACGAT-

GATCTGAGTCCTTGG -39); KGF1 forward (59-CAGTGACC-

TAGGAGCAACGA-39) and reverse (59-AAAGTGCCCACCA-

GACAGAT-39).

For bacterial RNA, reverse transcription with DNase treatment

was performed using QuantiTect Reverse Transcription Kit

(Qiagen, Hilden, Germany) according to the manufacturers’

protocol and amplified using IQ Supermix (Bio-Rad). Gene

quantification was performed in triplicates using the IQ5 multi-

color real-time PCR system (Bio-Rad). For each sample, a mock

reaction without addition of reverse transcriptase was performed.

The sequences of the primers are shown in Table 1 and 2. Relative

expression was normalized for levels of gyrA for USA300 and rpoD

for P. aeruginosa. GyrA-FAM set of primers was used in combination

with hla-CY5 and spa-HEX. Primers and probe for pvl gene were

designed as previously described [50]. P. aeruginosa and USA300

specific primers and TaqMan probes were designed with the

Beacon DesignerTM software (Premier Biosoft International). The

specificity of all primers was confirmed by sequencing of PCR

products.

Statistical AnalysisStatistical comparisons of CFUs were performed using Student’s

t-test and presented as means6standard deviation (SDs). Statisti-

cally significant differences were defined as p,0.05. A comparison

of epithelialization rates and gene-expression data for each

treatment group was performed using GraphPad Prism 4. The

means were analyzed by an ANOVA, followed by the Bonferroni

post-hoc test. Significance was defined as a p,0.05.

Results

Differential Expression of Quorum Sensing Ligands andVirulence Factors in P. aerugionsa Wound IsolatesTo determine the presence and expression of virulence factors

and quorum sensing molecules in six P. aeruginosa combat wound

isolates we used PCR. Results revealed differences in expression of

genes encoding quorum sensing ligands and Pseudomonas virulence

factors in the wound isolates. Genes encoding autoinducer

synthesis protein RhlI (RhlI) and a key enzyme in alginate

production, GDP-mannose 6-dehydrogenase (AlgD), were present

in all strains tested. Only one of the strains tested, P. aeruginosa 09-

010, had a gene encoding ExoS, while the isolates 09-007 and 09-

008 did not contain ToxA nor autoinducer synthesis protein LasI

(Fig. 1A). Identical results were obtained when RNA was used as

a template (data not shown). Of five isolates tested, only one P.

aeruginosa 09-010, had all genes expressed. In addition in vitro

biofilm assay identified isolate 09-010 as the most potent biofilm

producer (Fig. 1B) and therefore this isolate was selected for

further mixed-species studies with USA300.

P. aeruginosa 09-010 Suppresses the Growth of USA300in vitro and Less Efficiently in vivoIn order to assess the growth of USA300 and P. aerugionsa 09-

010 in mixed-species biofilms, in vitro individual species and co-

cultures were grown on polystyrene plates to allow for bacterial

attachment and biofilm formation. USA300 and P. aerugionsa 09-

010 CFUs were determined after removal of planktonic bacteria.

In accordance to previous studies [51,52] Pseudomonas had an

inhibitory effect on S. aureus US300 growth, which was reduced by

4 logs in mixed-species biofilms in vitro (Fig. 2A).To further determine the effects of mixed-species infection on

the growth of individual species in vivo, bacteria were allowed 2

and 4 days post wounding to form a biofilm and CFUs were

determined by plating scrubbed wound solution on selective



media. Results show that USA300 and P. aeruginosa co-existed in

the wounds; and that the growth of USA300 was slightly reduced

by P. aeruginosa 09-010 in vivo, by 1.5 and 1.6 log on days 2 and 4

after wounding, respectively (Fig. 2B). The growth of Pseudomonas

remained unchanged in the presence of USA300. Although with

slightly reduced CFUs, both species remained present in wounds

at day 4 post inoculation. There was no cross-contamination

between the wounds as wounds inoculated with USA300 showed

no detectable Pseudomonas, and no USA300 was recovered in P.

aeruginosa 09-010 inoculated wounds. Neither Pseudomonas nor

USA300 were detected in un-inoculated control wounds using

selective growth media, and in addition, gram staining was used to

document that control wounds remained non-infected. In

summary, Pseudomonas has shown an inhibitory effect on

USA300 growth in the mixed-species biofilms in vitro, while this

effect was not as profound in vivo.

Mixed-species Infection Delays Epithelialization throughSuppression of KGF1Wound healing rates in single and mixed-species infected

wounds were assessed by histology. The rate of epithelialization

was measured using planimetry [47,49]. Wounds with polymicro-

bial infection showed a significant wound healing impairment over

the wounds infected with single-species biofilms (Fig. 3A). BothUSA300 and P. aeruginosa infected wounds showed delayed

epithelialization when compared to control, uninfected wounds,

however statistically significant differences were seen only in

USA300 infected wounds (Fig. 3B). The average rate of

epithelialization at day 2 for USA300, P. aeruginosa, and wounds

infected with both species was 42%, 57%, and 35%, respectively,

as compared to 74% wound closure in control uninfected wounds

(Fig. 3A).

Table 1. S. aureus specific primer’s and probes sequences used for qPCR.

Gene Primer sequences Probe

pvl [50] F: AATAACGTATGGCAGAAATATGGATGTR: CAAATGCGTTGTGTATTCTAGATCCT

ACTCATGCTACTAGAAGAACAACACACTATGG

spa F: GTAACGGCTTCATTCAAAGTCTR: TCATAGAAAGCATTTTGTTGTTCT

AAAGACGACCCAAGCCAAAGCACT

hla F: TCTGATTACTATCCAAGAAATTCGATATTTCAGTGTATGACCAATCG

TTTGCACCAATAAGGCCGCC

gyrA F: TGCTGAGTTAATGGAGGATATTGR:CACGTCTAATACCACTCTTACC

AGGTCCTGATTTCCCAACTGCT

doi:10.1371/journal.pone.0056846.t001

Table 2. Sequences of P. aeruginosa specific primers used forPCR.

Gene Forward primer Reverse primer

lasI ATCTGGGAACTCAGCCGTTTC CGGACCGAAGCGCGATAC

rhlI CCAGGGCATCTGCGGTTG CTGCACAGGTAGGCGAAGAC

algD GCCAACAAGGAATACATCGAGTC GCCCAGCACCAGCACATC

exoS CTGGATGCGGGACAAAAG GTTCAGGGAGGTGGAGAG

toxA CGACGTGGTGAGCCTGAC GCTCCACCGTCCAGTTCTG

rpoD AGAGAAGGACGACGAGGAAGAAG GGCCAGGCCGGTGAGTTC

doi:10.1371/journal.pone.0056846.t002

Figure 1. Differential expression of virulence factors, quorumsensing molecules and biofilm formation genes in five P.aeruginosa (PA) wound isolates. A. RT-PCR results showingexpression of ToxA, RhlI, ExoS, AlgD and LasI; RpoD was used asa housekeeping gene. P. aeruginosa 09-010 isolate expressed all genestested. B. In vitro biofilm assay by P. aeruginosa wound isolates. P.aeruginosa 09-010 has shown the most excessive biofilm production.The result is a summary of three independent experiments eachrepeated in triplicates.doi:10.1371/journal.pone.0056846.g001



We further analyzed host response in an established porcine

partial thickness wound healing model [19,43,46] using biopsies

collected from the wound center after inoculation with P.

aeruginosa, USA300 or a combination of both bacterial species.

Significant suppression of KGF1 was found in wounds infected by

mixed-species biofilms (Fig. 4A), while single species infection did

not result in suppression of KGF1 expression. KGF1 is produced

during acute wound healing process mainly by fibroblasts, and has

been shown to stimulate proliferation and migration of keratino-

cytes thus playing an important role in re-epithelialization [53,54].

Staining with epidermal marker, K14 specific antibody, confirmed

delayed epithelialization in infected wounds when compared to

non-infected control wounds (Fig. 4B), with more pronounced

inhibition of wound closure in mixed-species infected wounds. In

addition K14 staining revealed reduced epithelial thickness in

infected versus non-infected, control wounds (Fig. 4B).

Immune Response in Single and Mixed-species BiofilmWound InfectionsWealso analyzed immune response at days 2 and4post-wounding

to examine gene expression of pro- and anti-inflammatory cytokines

[63] responding tosingleormixed-species infectionusingqPCR.The

most significant changes in cytokine expression were detected in

wounds at day 2 post infection (Fig. 5). Significant induction was

found inTNFa, IL-1a and IL-1bmRNAlevels between infected and

uninfectedwounds, regardless of thebacterial species used forwound

inoculation, suggesting that the presence of both USA300 and P.

aeruginosa contributes to increased expression of these pro-inflamma-

torycytokines incutaneouswounds. IL-8expressionwasalso induced

in single and mixed-species infected wounds in comparison to

uninfected wounds. Expression of IL-6 was induced in wounds

infectedwitheithermixed-speciesorPseudomonas. IL-6alsoshowedan

increasing trend inUSA300 infected wounds; however these changes were not

significant in comparison to control, non-inoculated wounds. The

expression of IL-10, an anti-inflammatory cytokine,was significantly

up-regulated in wounds infected with Pseudomonas, while USA300 or

mixed-species infection did not cause significant induction of IL-10,

although an increasing trend of IL-10was observed in these wounds.

We did not observe synergistic nor additive effects of polymicrobial

infection on cytokine expression. In contrast, expression levels of IL-

1a, IL-1b, IL-6 and IL-10 showedadecreasing trend inmulti-species

versus single-species infected wounds. These data show distinct

differences in the host immune responses in porcine deep partial

thickness wounds when stimulated with USA300, P. aeruginosa, or

combination of both species. Although bacterial counts were still

significantly highatday4post-wounding (Fig.2) the expressionof alltested cytokines was similar to expression levels detected in normal

unwounded skin (data not shown). Even though infection inhibited

early epithelialization, both uninfected and infected wounds

epithelialized by day 4.

Wound Environment and P. aeruginosa PresenceDifferentially Regulate Expression of USA300 VirulenceFactorsTomeasure relative expression levels ofUSA300virulence factors,

spa, hla and pvl, RT-PCR analysis with bacterial RNA isolated from

mixed- and single-species infected wounds was performed. Expres-

sion levels of virulence factors in the wound environment were also

compared to mRNA levels of spa, hla and pvl in vitro (Fig. 6).Thewound environment led to a striking inductionof spa expression,with

mRNA levels of spa30 times higher inwounds as compared to in vitro.

Interestingly, the presence of P. aeruginosa led to suppression of this

virulencefactor inthemixed-speciescolonizedwoundsatdays2and4

post-inoculation. In contrast to observed suppression of spa, the

presence of P. aeruginosa induced expression of USA300 virulence

factor hla on day 4 post wounding and infection (Fig. 6). Theexpression of pvl, a major cause of skin necrosis [55,56,57], was

induced 8-fold in USA300 colonized wounds at day 2 versus pvl

expression levels in vitro, while reduced pvl levels were seen on day 4

post wounding. More importantly the presence of P. aeruginosa in

mixed species infectedwounds resulted ina striking inductionof pvlat

both assessment times (Fig. 6).

Figure 2. P. aeruginosa 09-010 supresses the growth of USA300 in vitro and in vivo. A. USA300 and P. aeruginosa 09-010 (PA) colonyforming units (CFUs) were quantified upon growth of single-species or mixed species biofilms in vitro (n = 9). PA reduced the growth of USA300 by 4logs (**p#0.001). B. USA300 and P. aeruginosa 09-010 (PA) CFUs determined from porcine wounds on day 2 and 4 post infection (n = 6 per timepoint). Pseudomonas reduced the growth of USA300 (black bars) in the wounds infected by both species (*p#0.05). The growth of Pseudomonas(grey bars) was not affected by the presence of USA300.doi:10.1371/journal.pone.0056846.g002



Figure 3. Mixed species biofilms inhibit epithelialization in porcine partial thickness woundmodel on day 2. A. Simultaneous infectionwith USA300 and P. aeruginosa 09-010 (PA) significantly inhibited epithelialization (*p#0.05) when compared to wounds infected with single speciesor control (Ctrl) uninfected wounds (**p#0.001). USA300 delayed epithelialization when compared to uninfected wounds (Ctrl) (**p#0.001). B.Representative wounds stained with H&E are shown. White arrows indicate wound edges after initial wounding while black arrowheads point at theepithelialized edges of the migrating fronts. CR = crust.doi:10.1371/journal.pone.0056846.g003



Figure 4. Mixed-species infection delays epithelialization through suppression of KGF1. A. Expression levels of KGF1 measured by qPCRin wounds infected with either USA300, P. aeruginosa (PA) or combination of both species (USA300+PA) and uninfected wounds (Ctrl). Mean values ofexpression levels were represented after normalization to GAPDH (n= 6). Error bars indicate mean SD. *statistically significant differences weredefined as p,0.05. B. Immunolocalization of epidermal marker K14 (green) at the wound edge on day 2 post-wounding. Single-species and mixed-species infections inhibited epithelialization and decreased epithelial tongue (ET) thickness. CR = crust. White arrowheads indicate wound edges afterinitial wounding. Scale bar = 100 mm.doi:10.1371/journal.pone.0056846.g004



Discussion

The polymicrobial nature of non-healing wounds, such as

venous, pressure, and diabetic foot ulcers is well documented and

established [6,7,8,9,58,59]. However, despite the exceedingly high

frequency of S. aureus and P. aeruginosa in chronic and acute

wounds, few in vivo studies have focused on the synergistic effects of

these prevalent bacteria within the wound environment [39,42]. In

order to investigate functional consequences of polymicrobial

infection with USA300 and P. aeruginosa on acute wound healing

we utilized a well-established porcine skin wound model

[19,43,46]. While murine [31,37,40,41] and rabbit [39] models

have previously been used to study the effects of bacterial infection

on wound healing, the porcine model offers certain advantages

such as its morphologic and physiologic similarity to human skin

[60] as well as its large surface area which allows the creation of

multiple wounds on a single animal that can be assessed at various

time points.

One of the most important mechanisms by which USA300 and

P. aeruginosa evade host immunity and establish persistent infections

is via biofilm formation, and we have previously documented

formation of bacterial biofilms in porcine cutaneous wounds [43].

In this study, we show that synergistic interactions between P.

aeruginosa and USA300 delayed re-epithelialization by down-

regulation of KGF1 compared to single species infected wounds

(Fig. 3 and 4). Despite the fact that P. aeruginosa inhibited the

growth of USA300 in vitro similarly to effects previously reported in

murine and rabbit wound polymicrobial infection [42], in the

porcine model, the wound environment allowed coexistence of

both species and the growth of USA300 was only slightly reduced

in comparison to the reduction observed in vitro (Fig. 2). Thisfinding supports the fact that Staphylococcus is commonly isolated

with P. aeruginosa from clinical samples, despite the multiple

described mechanisms by which Pseudomonas virulence factors and

exoproducts exert a negative influence on staphylococcal growth

Figure 5. Single and mixed species induce distinct immune responses. Expression levels of TNFa, IL-1a, IL-1b, IL-6, IL-8, and IL-10 in woundtissue measured by qPCR in uninfected wounds (Ctrl), and wounds infected with either USA300, P. aeruginosa (PA) or combination of both species,USA300+PA. Expression levels in unwounded skin are also presented. Mean values of expression levels were represented after normalization toGAPDH (n= 6). Error bars indicate mean SD. *statistically significant differences were defined as p,0.05.doi:10.1371/journal.pone.0056846.g005



in vitro [52,61,62]. Our results suggest that the wound environment

and increased virulence may protect USA300 from P. aeruginosa by

a yet unidentified mechanism. The improved survival of USA300

in porcine wounds could possibly be due to the formation of

staphylococcal small colony variants [52,61], however further

in vivo studies are needed to address this hypothesis.

Similarly to murine models of S. aureus wound infection [40,41],

inoculation of porcine wounds with USA300 alone was sufficient

to delay early phases of wound closure as documented by K14

staining, while Pseudomonas alone demonstrated a less pronounced

inhibition of epithelialization. Surprisingly, only polymicrobial

infection resulted in a decreased expression of KGF1, suggesting

the unique mechanism of wound healing inhibition by multi-

species biofilms. Produced by fibroblasts, KGF1 acts in a paracrine

fashion through the KGFR2IIIb receptor found exclusively on

keratinocytes, resulting in increased migration and proliferation

during wound healing [53]. Suppression of KGF1 together with

decreased trend of IL-1a, IL-1b, IL-6 and IL-8 expression in

mixed-species infected wounds when compared to wounds

infected with a single species, indicates that polymicrobial infection

delays wound closure through reduction of keratinocytes migration

and proliferation rather than through increased inflammation.

Our results contrast those of a recent study in a rabbit ear model

where increased expression of pro-inflammatory cytokines TNFaand IL-1b was seen with polymicrobial biofilm infection [39] and

these differences may be explained by the variability between

bacterial strains and animal models utilized.

Our study has also shown the lack of Pseudomonas virulence

factors and genes for QS molecules within wound isolates, which

goes in line with previous studies [64] confirming that spontaneous

QS- and virulence-deficient P. aeruginosa mutants are still capable

of causing wound infections. Pseudomonas has two QS systems,

LasI-LasR and RhlI-RhlR, shown to be important for wound

infection and biofilm formation in rodent models [32,36].

Although we analyzed a small number of isolates, the lack of LasI

in some and the presence of RhlI in all of the tested strains suggest

that RhlI might be more important than LasI for cutaneous

wound infections. Furthermore, the presence of AlgD, a key

enzyme in alginate production, in all strains indicates its

importance in establishing wound infection, while further studies

are needed in order to fully characterize the roles of exoS and ToxA

during cutaneous wound healing.

Lastly, our data revealed that synergy within mixed-species

wound biofilms significantly increased the virulence of USA300.

The presence of P. aeruginosa within the polymicrobial wound

environment resulted in a marked increase of pvl and hla expression

suggesting an overall induction of USA300 virulence and its

detrimental effects on wound healing in polymicrobial infections.

The importance of pvl in S. aureus infections is mostly controversial

mainly due to the limitations of the widely used murine models

[65,66,67,68,69], as neutrophils, the primary target cells for pvl,

are highly insensitive to this pore-forming toxin in mice [68,70,71].

In addition, S. aureus cannot fully utilize iron from murine

hemoglobin [68,70,71]. Recent studies showing the importance of

pvl in skin necrosis [55] confirmed that alternative animal models

Figure 6. Expression of USA300 virulence factors in inoculatedwounds. RT-PCR results for spa (A), hla (B) and pvl (C) expression inwounds colonized with single (USA300) and mixed species(USA300+PA) at days 2 and 4 post-infection (n = 6). The relativeexpression levels were normalized to gyrA. Inoculums= expressionlevels of spa, hla and pvl in USA300 culture used to infect the wounds.Error bars indicate mean SD. *statistically significant differences weredefined as p,0.05.doi:10.1371/journal.pone.0056846.g006



are more appropriate for studying S. aureus skin infection and

therefore the porcine wound model due to its many similarities to

wound healing in humans offers multiple advantages. Our results

demonstrating induction of hla in vivo versus in vitro, regardless of P.

aeruginosa presence support a recent in vitro study that showed the

importance of hla for invasion through human keratinocytes [72].

The same study indicated that pvl and spa were not important for

USA300 penetration through intact epidermis [72], however this

data cannot be fully extrapolated to the wound healing process

where the epidermal barrier is compromised, suggesting that the

role of pvl and spa in wound healing remains to be fully elucidated.

In contrast to the observed induction of pvl and hla, our study

showed that polymicrobial infection led to suppression of spa.

Nevertheless, this virulence factor was strikingly induced in

USA300 infected wounds when compared to in vitro expression

levels, suggesting its possible role during the initial phases of

wound infection. Taken together, future studies using mutant S.

aureus strains lacking individual virulence factors in the porcine

model are needed to address the questions regarding the role of

USA300 virulence factors in inhibition of wound healing.

Our data underline the importance of bacterial interactions in

multi-species wound infections as we demonstrate that bacterial

synergy can alter virulence, delay healing and perhaps even

change susceptibility of microbial communities to antimicrobial

therapy. Given the fact that chronic wounds are infected with

more than one species, understanding of interspecies interactions is

imperative for developing new successful therapeutic approaches

against polymicrobial wound infections.

Acknowledgments

We thank Col Lee C Cancio (USAISR), MD for the gift of P. aeruginosa

combat wound isolates. We also thank Shari V Jackson and Erica Good for

the technical support.

Author Contributions

Conceived and designed the experiments: IP LRP MTC SCD. Performed

the experiments: IP AGN SBP JG JV JC OS. Analyzed the data: IP AGN

JG LRP MTC SCD. Contributed reagents/materials/analysis tools: IP

AGN JG JC LRP MTC SCD. Wrote the paper: IP AGN SCD.

References

1. Fadeev SB, Nemtseva NV (2009) [Formation of biofilms by agents of surgical

soft tissue infections]. Zh Mikrobiol Epidemiol Immunobiol: 114–117.

2. Champion HR, Bellamy RF, Roberts CP, Leppaniemi A (2003) A profile of

combat injury. J Trauma 54: S13–19.

3. Co EM, Keen EF, 3rd, Aldous WK (2011) Prevalence of methicillin-resistant

staphylococcus aureus in a combat support hospital in Iraq. Mil Med 176: 89–

93.

4. Keen EF, 3rd, Robinson BJ, Hospenthal DR, Aldous WK, Wolf SE, et al. (2010)

Incidence and bacteriology of burn infections at a military burn center. Burns36: 461–468.

5. Gomez R, Murray CK, Hospenthal DR, Cancio LC, Renz EM, et al. (2009)Causes of mortality by autopsy findings of combat casualties and civilian patients

admitted to a burn unit. J Am Coll Surg 208: 348–354.

6. Frank DN, Wysocki A, Specht-Glick DD, Rooney A, Feldman RA, et al. (2009)

Microbial diversity in chronic open wounds. Wound Repair Regen 17: 163–172.

7. Pfaller MA, Wey S, Gerarden T, Houston A, Wenzel RP (1989) Susceptibility of

nosocomial isolates of Candida species to LY121019 and other antifungal agents.Diagn Microbiol Infect Dis 12: 1–4.

8. Gontcharova V, Youn E, Sun Y, Wolcott RD, Dowd SE (2010) A comparison ofbacterial composition in diabetic ulcers and contralateral intact skin. Open

Microbiol J 4: 8–19.

9. Bowler PG, Duerden BI, Armstrong DG (2001) Wound microbiology and

associated approaches to wound management. Clin Microbiol Rev 14: 244–269.

10. Fazli M, Bjarnsholt T, Kirketerp-Moller K, Jorgensen B, Andersen AS, et al.

(2009) Nonrandom distribution of Pseudomonas aeruginosa and Staphylococcus

aureus in chronic wounds. J Clin Microbiol 47: 4084–4089.

11. Martin JM, Zenilman JM, Lazarus GS (2010) Molecular microbiology: new

dimensions for cutaneous biology and wound healing. J Invest Dermatol 130:38–48.

12. Gjodsbol K, Christensen JJ, Karlsmark T, Jorgensen B, Klein BM, et al. (2006)Multiple bacterial species reside in chronic wounds: a longitudinal study. Int

Wound J 3: 225–231.

13. Dowd SE, Sun Y, Secor PR, Rhoads DD, Wolcott BM, et al. (2008) Survey of

bacterial diversity in chronic wounds using pyrosequencing, DGGE, and fullribosome shotgun sequencing. BMC Microbiol 8: 43.

14. Malic S, Hill KE, Hayes A, Percival SL, Thomas DW, et al. (2009) Detectionand identification of specific bacteria in wound biofilms using peptide nucleic

acid fluorescent in situ hybridization (PNA FISH). Microbiology 155: 2603–

2611.

15. Black CE, Costerton JW (2010) Current concepts regarding the effect of wound

microbial ecology and biofilms on wound healing. Surg Clin North Am 90:1147–1160.

16. Ebright JR (2005) Microbiology of chronic leg and pressure ulcers: clinicalsignificance and implications for treatment. Nurs Clin North Am 40: 207–216.

17. Wolcott RD, Ehrlich GD (2008) Biofilms and chronic infections. JAMA 299:2682–2684.

18. James GA, Swogger E, Wolcott R, Pulcini E, Secor P, et al. (2008) Biofilms inchronic wounds. Wound Repair Regen 16: 37–44.

19. Nusbaum AG, Gil J, Rippy MK, Warne B, Valdes J, et al. (2012) Effectivemethod to remove wound bacteria: comparison of various debridement

modalities in an in vivo porcine model. J Surg Res 176: 701–707.

20. Talan DA, Krishnadasan A, Gorwitz RJ, Fosheim GE, Limbago B, et al. (2011)

Comparison of Staphylococcus aureus from skin and soft-tissue infections in USemergency department patients, 2004 and 2008. Clin Infect Dis 53: 144–149.

21. Roghmann MC, Siddiqui A, Plaisance K, Standiford H (2001) MRSAcolonization and the risk of MRSA bacteraemia in hospitalized patients with

chronic ulcers. J Hosp Infect 47: 98–103.

22. O’Hara FP, Amrine-Madsen H, Mera RM, Brown ML, Close NM, et al. (2012)Molecular Characterization of Staphylococcus aureus in the United States

2004–2008 Reveals the Rapid Expansion of USA300 Among Inpatients andOutpatients. Microb Drug Resist.

23. Schiavo G, van der Goot FG (2001) The bacterial toxin toolkit. Nat Rev MolCell Biol 2: 530–537.

24. Otto M (2010) Basis of virulence in community-associated methicillin-resistantStaphylococcus aureus. Annu Rev Microbiol 64: 143–162.

25. King MD, Humphrey BJ, Wang YF, Kourbatova EV, Ray SM, et al. (2006)

Emergence of community-acquired methicillin-resistant Staphylococcus aureusUSA 300 clone as the predominant cause of skin and soft-tissue infections. Ann

Intern Med 144: 309–317.

26. Li M, Diep BA, Villaruz AE, Braughton KR, Jiang X, et al. (2009) Evolution of

virulence in epidemic community-associated methicillin-resistant Staphylococcusaureus. Proc Natl Acad Sci U S A 106: 5883–5888.

27. Li M, Cheung GY, Hu J, Wang D, Joo HS, et al. (2010) Comparative analysis ofvirulence and toxin expression of global community-associated methicillin-

resistant Staphylococcus aureus strains. J Infect Dis 202: 1866–1876.

28. Voyich JM, Braughton KR, Sturdevant DE, Whitney AR, Said-Salim B, et al.(2005) Insights into mechanisms used by Staphylococcus aureus to avoid

destruction by human neutrophils. J Immunol 175: 3907–3919.

29. Kennedy AD, Bubeck Wardenburg J, Gardner DJ, Long D, Whitney AR, et al.

(2010) Targeting of alpha-hemolysin by active or passive immunizationdecreases severity of USA300 skin infection in a mouse model. J Infect Dis

202: 1050–1058.

30. Kobayashi SD, Malachowa N, Whitney AR, Braughton KR, Gardner DJ, et al.

(2011) Comparative analysis of USA300 virulence determinants in a rabbit

model of skin and soft tissue infection. J Infect Dis 204: 937–941.

31. Zhao G, Hochwalt PC, Usui ML, Underwood RA, Singh PK, et al. (2010)

Delayed wound healing in diabetic (db/db) mice with Pseudomonas aeruginosabiofilm challenge: a model for the study of chronic wounds. Wound Repair

Regen 18: 467–477.

32. Nakagami G, Morohoshi T, Ikeda T, Ohta Y, Sagara H, et al. (2011)

Contribution of quorum sensing to the virulence of Pseudomonas aeruginosa in

pressure ulcer infection in rats. Wound Repair Regen 19: 214–222.

33. Heggers JP, Haydon S, Ko F, Hayward PG, Carp S, et al. (1992) Pseudomonas

aeruginosa exotoxin A: its role in retardation of wound healing: the 1992Lindberg Award. J Burn Care Rehabil 13: 512–518.

34. Fazli M, Bjarnsholt T, Kirketerp-Moller K, Jorgensen A, Andersen CB, et al.(2011) Quantitative analysis of the cellular inflammatory response against biofilm

bacteria in chronic wounds. Wound Repair Regen 19: 387–391.

35. Storey DG, Ujack EE, Rabin HR, Mitchell I (1998) Pseudomonas aeruginosa

lasR transcription correlates with the transcription of lasA, lasB, and toxA in

chronic lung infections associated with cystic fibrosis. Infect Immun 66: 2521–2528.

36. Rumbaugh KP, Griswold JA, Iglewski BH, Hamood AN (1999) Contribution ofquorum sensing to the virulence of Pseudomonas aeruginosa in burn wound

infections. Infect Immun 67: 5854–5862.

37. Zhao G, Usui ML, Underwood RA, Singh PK, James GA, et al. (2012) Time

course study of delayed wound healing in a biofilm-challenged diabetic mouse

model. Wound Repair Regen 20: 342–352.



38. Madsen SM, Westh H, Danielsen L, Rosdahl VT (1996) Bacterial colonization

and healing of venous leg ulcers. APMIS 104: 895–899.39. Seth AK, Geringer MR, Galiano RD, Leung KP, Mustoe TA, et al. (2012)

Quantitative Comparison and Analysis of Species-Specific Wound Biofilm

Virulence Using an In Vivo, Rabbit-Ear Model. J Am Coll Surg.40. Gurjala AN, Geringer MR, Seth AK, Hong SJ, Smeltzer MS, et al. (2011)

Development of a novel, highly quantitative in vivo model for the study ofbiofilm-impaired cutaneous wound healing. Wound Repair Regen 19: 400–410.

41. Schierle CF, De la Garza M, Mustoe TA, Galiano RD (2009) Staphylococcal

biofilms impair wound healing by delaying reepithelialization in a murinecutaneous wound model. Wound Repair Regen 17: 354–359.

42. Dalton T, Dowd SE, Wolcott RD, Sun Y, Watters C, et al. (2011) An in vivopolymicrobial biofilm wound infection model to study interspecies interactions.

PLoS One 6: e27317.43. Davis SC, Ricotti C, Cazzaniga A, Welsh E, Eaglstein WH, et al. (2008)

Microscopic and physiologic evidence for biofilm-associated wound colonization

in vivo. Wound Repair Regen 16: 23–29.44. Pechter PM, Gil J, Valdes J, Tomic-Canic M, Pastar I, et al. (2012) Keratin

dressings speed epithelialization of deep partial-thickness wounds. WoundRepair Regen 20: 236–242.

45. Christensen GD, Simpson WA, Younger JJ, Baddour LM, Barrett FF, et al.

(1985) Adherence of coagulase-negative staphylococci to plastic tissue cultureplates: a quantitative model for the adherence of staphylococci to medical

devices. J Clin Microbiol 22: 996–1006.46. Davis SC, Eaglstein WH, Cazzaniga AL, Mertz PM (2001) An octyl-2-

cyanoacrylate formulation speeds healing of partial-thickness wounds. DermatolSurg 27: 783–788.

47. Pastar I, Khan AA, Stojadinovic O, Lebrun EA, Medina MC, et al. (2012)

Induction of Specific MicroRNAs Inhibits Cutaneous Wound Healing. J BiolChem 287: 29324–29335.

48. Vukelic S, Stojadinovic O, Pastar I, Vouthounis C, Krzyzanowska A, et al.(2010) Farnesyl pyrophosphate inhibits epithelialization and wound healing

through the glucocorticoid receptor. J Biol Chem 285: 1980–1988.

49. Vukelic S, Stojadinovic O, Pastar I, Rabach M, Krzyzanowska A, et al. (2011)Cortisol synthesis in epidermis is induced by IL-1 and tissue injury. J Biol Chem

286: 10265–10275.50. Loughman JA, Fritz SA, Storch GA, Hunstad DA (2009) Virulence gene

expression in human community-acquired Staphylococcus aureus infection.J Infect Dis 199: 294–301.

51. Mitchell G, Seguin DL, Asselin AE, Deziel E, Cantin AM, et al. (2010)

Staphylococcus aureus sigma B-dependent emergence of small-colony variantsand biofilm production following exposure to Pseudomonas aeruginosa 4-

hydroxy-2-heptylquinoline-N-oxide. BMC Microbiol 10: 33.52. Biswas L, Biswas R, Schlag M, Bertram R, Gotz F (2009) Small-colony variant

selection as a survival strategy for Staphylococcus aureus in the presence of

Pseudomonas aeruginosa. Appl Environ Microbiol 75: 6910–6912.53. Werner S, Peters KG, Longaker MT, Fuller-Pace F, Banda MJ, et al. (1992)

Large induction of keratinocyte growth factor expression in the dermis duringwound healing. Proc Natl Acad Sci U S A 89: 6896–6900.

54. Pastar I, Stojadinovic O, Tomic-Canic M (2008) Role of keratinocytes in healingof chronic wounds. Surg Technol Int 17: 105–112.

55. Lipinska U, Hermans K, Meulemans L, Dumitrescu O, Badiou C, et al. (2011)

Panton-Valentine leukocidin does play a role in the early stage of Staphylococ-cus aureus skin infections: a rabbit model. PLoS One 6: e22864.

56. Lina G, Piemont Y, Godail-Gamot F, Bes M, Peter MO, et al. (1999)Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus

in primary skin infections and pneumonia. Clin Infect Dis 29: 1128–1132.

57. Diep BA, Sensabaugh GF, Somboonna N, Carleton HA, Perdreau-Remington F

(2004) Widespread skin and soft-tissue infections due to two methicillin-resistant

Staphylococcus aureus strains harboring the genes for Panton-Valentine

leucocidin. J Clin Microbiol 42: 2080–2084.

58. Smith DM, Snow DE, Rees E, Zischkau AM, Hanson JD, et al. (2010)

Evaluation of the bacterial diversity of pressure ulcers using bTEFAP

pyrosequencing. BMC Med Genomics 3: 41.

59. Dowd SE, Wolcott RD, Sun Y, McKeehan T, Smith E, et al. (2008)

Polymicrobial nature of chronic diabetic foot ulcer biofilm infections determined

using bacterial tag encoded FLX amplicon pyrosequencing (bTEFAP). PLoS

One 3: e3326.

60. Sullivan TP, Eaglstein WH, Davis SC, Mertz P (2001) The pig as a model for

human wound healing. Wound Repair Regen 9: 66–76.

61. Yang L, Liu Y, Markussen T, Hoiby N, Tolker-Nielsen T, et al. (2011) Pattern

differentiation in co-culture biofilms formed by Staphylococcus aureus and

Pseudomonas aeruginosa. FEMS Immunol Med Microbiol 62: 339–347.

62. Qin Z, Yang L, Qu D, Molin S, Tolker-Nielsen T (2009) Pseudomonas

aeruginosa extracellular products inhibit staphylococcal growth, and disrupt

established biofilms produced by Staphylococcus epidermidis. Microbiology 155:

2148–2156.

63. Eming SA, Krieg T, Davidson JM (2007) Inflammation in wound repair:

molecular and cellular mechanisms. J Invest Dermatol 127: 514–525.

64. Schaber JA, Carty NL, McDonald NA, Graham ED, Cheluvappa R, et al.

(2004) Analysis of quorum sensing-deficient clinical isolates of Pseudomonas

aeruginosa. J Med Microbiol 53: 841–853.

65. Labandeira-Rey M, Couzon F, Boisset S, Brown EL, Bes M, et al. (2007)

Staphylococcus aureus Panton-Valentine leukocidin causes necrotizing pneu-

monia. Science 315: 1130–1133.

66. Voyich JM, Otto M, Mathema B, Braughton KR, Whitney AR, et al. (2006) Is

Panton-Valentine leukocidin the major virulence determinant in community-

associated methicillin-resistant Staphylococcus aureus disease? J Infect Dis 194:

1761–1770.

67. Bae IG, Tonthat GT, Stryjewski ME, Rude TH, Reilly LF, et al. (2009) Presence

of genes encoding the panton-valentine leukocidin exotoxin is not the primary

determinant of outcome in patients with complicated skin and skin structure

infections due to methicillin-resistant Staphylococcus aureus: results of

a multinational trial. J Clin Microbiol 47: 3952–3957.

68. Pishchany G, McCoy AL, Torres VJ, Krause JC, Crowe JE, Jr., et al. (2010)

Specificity for human hemoglobin enhances Staphylococcus aureus infection.

Cell Host Microbe 8: 544–550.

69. Hruz P, Zinkernagel AS, Jenikova G, Botwin GJ, Hugot JP, et al. (2009) NOD2

contributes to cutaneous defense against Staphylococcus aureus through alpha-

toxin-dependent innate immune activation. Proc Natl Acad Sci U S A 106:

12873–12878.

70. Diep BA, Chan L, Tattevin P, Kajikawa O, Martin TR, et al. (2010)

Polymorphonuclear leukocytes mediate Staphylococcus aureus Panton-Valen-

tine leukocidin-induced lung inflammation and injury. Proc Natl Acad Sci U S A

107: 5587–5592.

71. Hongo I, Baba T, Oishi K, Morimoto Y, Ito T, et al. (2009) Phenol-soluble

modulin alpha 3 enhances the human neutrophil lysis mediated by Panton-

Valentine leukocidin. J Infect Dis 200: 715–723.

72. Soong G, Chun J, Parker D, Prince A (2012) Staphylococcus aureus activation of

caspase 1/calpain signaling mediates invasion through human keratinocytes.

J Infect Dis 205: 1571–1579.



Interactions of Methicillin Resistant Staphylococcus ...

Documents

Transcript of Interactions of Methicillin Resistant Staphylococcus ...