1

Interaction between Root-knot Nematode Meloidogyne

graminicola and Oomycete Pythium arrhenomanes on Rice Roots Md. Zahangir Alam1, 2

1 Department of Molecular Biotechnology, Faculty of Bioscience Engineering, Ghent University, Gent, Belgium 2 M.Sc. in Nematology, Department of Biology, Faculty of Science, Ghent University, Gent, Belgium

Summary - Both production and yield of rice are reduced to a great extent in response to single infection by

Meloidogyne graminicola and single infection by Pythium arrhenomanes. In contrast, increased grain yield of

rice has been reported in the double (P. arrhenomanes and M. graminicola) infected plants compared to single

(M. graminicola) infected plants. This research was designed to study the influence of P. arrenomanes on M.

graminicola and vice-versa in the SAP system adapted for double (P. arrhenomanes and M. graminicola)

infection experiments in our lab. An experiment was also conducted to evaluate the roles of phytohormones-

auxin, jasmonic acid (JA), salicylic acid (SA) and abscisic acid (ABA) on the M. graminicola infection and on

the interaction between P. arrhenomanes and M. graminicola. To study the interaction between P. arrhenomanes

and M. graminicola, rice cultivars Nipponbare and IR81413-BB-75-4 were used for double infection experiments.

To evaluate the role of auxin, a transgenic rice cultivar GH3.1OX which is auxin-deficient and external

applications with 100 µM NAA (auxin) were used. To evaluate the influence of M. graminicola on P.

arrhenomanes infection, GH3.1OX and Bomba were infected with only P. arrhenomanes as well as with both P.

arrhenomanes and M. graminicola, subsequently the DNA of P. arrhenomanes was quantified by qPCR both in

single (P. arrhenomanes) and double (P. arrhenomanes and M. graminicola) infected plants. To evaluate the roles

of JA, several transgenic/ mutant rice lines deficient in JA biosynthesis and signaling were used as well as JA

biosynthesis inhibitor-DIECA (100 µM) or Methyl Jasmonate (100 µM) were applied to rice cultivar Nipponbare.

To study the roles of SA and ABA, shoots of Nipponbare were treated with 100 µM PAL inhibitor-AOPP (results

in less SA biosynthesis) and 50 µM ABA biosynthesis inhibitor (abamine) respectively. To study the roles of

different treatments on the host finding ability of M. graminicola, a novel method as well as mathematical model

for data processing and subsequent analysis were developed in the lab for an in-vitro attraction assay of M.

graminicola. Our results of the double infection experiments suggest that P. arrhenomanes significantly reduces

the number of nematodes, gall formation and development of M. graminicola (only in Nipponbare) per root system

in both rice cultivars. Our results of qPCR suggest that, M. graminicola and internal auxin levels have no

significant impact on the in-planta growth of P. arrhenomanes. In this study, lower endogenous auxin level

significantly reduces the number of nematodes and gall formation both in single and double infected plants.

However, in presence of P. arrhenomanes, lower endogenous auxin level could not reduce gall formation

significantly indicating that P. arrhenomanes derived auxin might complement the endogenous auxin level in the

GH3.1OX line. In contrast, lower endogenous auxin level significantly promoted nematode development both in

single and double infected plants which was assumed to be regulated by the reduced competition of nutrients in the

double infected plants compared to single infected plants. On the other hand, foliar application of NAA slightly

reduces the number of nematodes and gall formation per root system both in absence and presence of P.

arrhenomanes. In this study, JA slightly promotes number of nematodes and gall formation. On the other hand,

in presence of P. arrhenomanes JA slightly reduces the number of nematodes and gall formation per root system,

indicating that the roles of JA on M. graminicola infection are modulated by P. arrhenomanes. In this study,

AOPP and abamine treatment slightly reduces the number of nematodes and gall formation per root system but in

presence of P. arrhenomanes the number of nematodes and gall formation are slightly increased indicating that

the roles of AOPP and abamine on M. gaminicola infection are modulated by P. arrhenomanes. Our results

suggest that the negative influence of P. arrhenomanes on M. graminicola infection is modulated by endogenous

auxin level (only in gall formation), JA level and signaling, SA-biosynthesis and ABA-biosynthesis. Our results

of attraction tests suggest that 100 µM NAA and metabolites of a 25-days old P. arrhenomanes culture

significantly attracts J2 of M. graminicola, while root tips together with root exudates of Oryza glabberrima and

MeJA treated plants and root exudates alone of ethephon treated plants and P. arrhenomanes infected plants

(although not significant) repel J2s of M. graminicola. In contrast to root tips together with root exudates, when

we used only root tips we could not observed any significant attraction or repulsion of J2s of M. graminicola,

indicating that the exudates are important for the host finding ability of the nematode.

Keywords – Antagonism, Phytohormones, qPCR, Root exudates, Metabolites of P. arrhenomanes, Attraction,

Novel method and Mathematical model.

2

1. Background Information

Rice (Oryza sativa L.) being the staple food for more than half of the world population, is one of the most

important food crops in the world (Matsumoto et al., 2005), mainly grown in Asia and provides mostly

carbohydrates among others nutrient elements in the diet (Kennedy & Burlingame, 2003; Yawadio et al., 2007;

Itani & Ogawa, 2004; Kennedy & Burlingame, 2003; Yawadio et al., 2007; Itani & Ogawa, 2004; Suzuki et al.,

2004; Chen et al., 2006). This important food crop is constantly challenged by a number of biotic (insects, fungi,

bacteria, nematodes, oomycetes, viruses among others) and abiotic (salinity, nutrient toxicity, natural disasters,

drought etc.) threats which can cause significant yield loss.

Rice is grown worldwide and adapted to various environmental and cultural conditions for example wetland,

dryland, upland and submerged conditions. Wetland rice is the main cultivation system accounting for 85% of

total production, however it requires a lot of fresh water (Bouman et al., 2007). Recently, aerobic rice, a water

saving rice production technology, is being popularized to reduce the pressure on fresh water. However, with the

introduction of aerobic rice cultivation, root-knot nematode Meloidogyne graminicola and oomycete Pythium

arrhenomanes have become more damaging than before (Kreye et al., 2009).

Pythium spp. range from hemi-biotrophic to necrotrophic pathogens causing significant growth reduction of root

and shoot, root necrosis, pre- and post-emergence death of seedling, has been ranked as one of the 10 most

important oomycetes in the world (Kamoun et al., 2015). Suitable chemical stimuli for example amino acids,

carbohydrates, volatile compounds (ethanol or aldehydes) derived from root and seed exudates, plant debris and

organic matter favor the germination of oospore to germ tube and facilitate the subsequent infection (Stangehellini

& Hancock, 1971; Lifshitz et al., 1986, Nelson 1991; Paulitz, 1991). Van Buyten (2013) reported that in aerobic

rice fields in Philippines; Pythium arrhenomanes, Pythium graminicola and Pythium inflatum were present,

among which P. arrhenomanes is the most virulent pathogen causing root necrosis, severe stunting and damping

off in rice seedlings. Recently it has been reported that the virulence of Pythium spp. is positively correlated with

their root colonization capacity and carbon utilization profile. The root exudates of rice contain several carbon

sources including carboxylic acid and amino acids on which P. arrhenomanes can grow (Van Buyten, 2013).

Meloidogyne spp. are biotrophic pathogens causing significant yield loss in a number of cereal and vegetable

crops, and have been ranked as the number one plant-parasitic nematodes based on scientific and economic

importance (Jones et al., 2013). After hatching the infective second stage juveniles (J2) of Meloidogyne

graminicola localize the elongation zone of the root surface by sensing stimuli present in the root exudates,

penetrate the root by thrusting their stylet, migrate intercellularly, make a U-turn around the vascular bundle, and

select suitable cells (2-12 in number) in the vascular bundle to induce giant cells (multinucleate, 100x larger than

normal cell) by reprogramming several morphological and physiological processes (Kyndt et al., 2013; Kyndt et

al., 2014; Ji et al., 2013). Then they produce characteristic knot/gall like structures, keep the cells/plants alive

and inhibit absorption as well as upward translocation of water and nutrients by the root system. As a result they

reduce plant height, root and shoot biomass, tiller number, leaf area index, cause seedling wilt in case of severe

infection, and finally reduce the yield of the plant (Bridge et al., 2005; Bimpong et al., 2010; Plowright & Bridge,

1990).

In order to establish successful infection, a pathogen must come in direct contact with the host plants. Upon

physical contact, an interaction between plant and pathogen occurs, which might be compatible or incompatible.

In a compatible interaction virulent pathogens overcome the constitutive and induced physical and biochemical

barriers of the plants and cause successful infection. On the other hand, in an incompatible interaction avirulent

pathogens cannot overcome these barriers and in some cases their spread within the plants will be restricted by

localized cell death or hypersensitive response. In the case of this kind of response, a biotrophic pathogen is

restricted since it can only grow on living tissue. In a natural ecosystem, plants are usually infected by more than

one pathogen simultaneously, causing pathogens to interact with each other in a same ecological niche. This

3

interaction among pathogens might be antagonistic (one pathogen suppresses the another pathogen) or synergistic

(one pathogen favors another pathogen) and this will determine the yield losses in the double infected plants

compared to single infected plants.

For both P. arrhenomanes and M. graminicola, yield reduction has been observed. The yield reduction in the

single infected rice plant by M. graminicola can range between 20 to 70% (Pokharel et al., 2007; Soriano et al.,

2000; Padgham et al., 2004). On the other hand, P. arrhenomanes can cause growth reduction of the rice root by

70% and shoot by 48% (Cother & Gilbert, 1993; Eberle et al., 2007). Severe infection by P. arrhenomanes can

cause pre and post emergence seedling death, hence total yield loss can occur. On the other hand, rice seedlings

can survive and recover from Pythium infection if the pathogen are not virulent and if there was a low density of

Pythium spp. in the soil. Double infections between root-knot nematodes and fungi/oomycetes have been reported

before. Meloidogyne spp. and Fusarium spp. on tobacco (Porter & Powel, 1967), on alfalfa (Griffin and Thyr,

1988), M. incognita and Belonolaimus longicaudatus with P. aphanidermatum on Iceberg chrysanthemum

(Johnson & Litrell, 1970) made the plants more vulnerable than single infection. However, an antagonistic

interaction between P. arrhenomanes and M. graminicola in rice has been reported (Verbeek et al., 2016). The

underlying mechanisms governing the interaction between P. arrhenomanes and M. graminicola are still not

clear.

The growth, yield and resistance of plants to biotic and abiotic stress are regulated by a number of phytohormones.

Phytohormones mediated resistance in plants can be plant, organ, as well as tissue specific. Many studies show

differences in regulation of phytohormones between monocots and dicots, as a result the outcome of hormonal

signaling in model organism Arabidopsis thaliana, cannot be extrapolated to rice. Even the outcome of hormonal

signaling in rice shoots cannot be extrapolated to rice roots. It is generally understood that auxin, cytokinin,

brassinosteroid, and abscisic acid play important roles in growth and development of plants, whereas salicylic

acid, ethylene and jasmonic acid play crucial roles in plant defence. However, more and more evidence is found

that all hormones play a role in defense (De Vleesschauwer et al., 2013). Soil-borne microorganisms modify the

root system by exploiting a number of growth hormones (Brassinosteroids, auxin, cytokinin, gibberellin and

abscisic acid) for their own benefits to facilitate root colonization and to suppress root immunity (Van Buyten,

2013; Yang et al., 2012; Albrecht et al., 2012; De Vleesschauwer et al., 2012). In contrast it has been reported

that jasmonate interferes with gibberellin signaling pathway to prioritize plant defense over growth (Yang et al.,

2012). Recently, tradeoff between growth and immunity of plant has been reported which is mediated by cross-

talk between growth hormone and defense hormone (Pieterse et al., 2009 and Huot et al., 2014).

Rice root immunity to Pythium spp. is mediated by salicylic acid and gibberellic acid signaling, whereas rice root

susceptibility to Pythium spp. is mediated by auxin, brassinosteroids and SLR1 signaling. Pythium inoculation

suppress the rice root immunity by promoting brassinosteroids and auxin signaling in rice and by suppressing

salicylic acid and gibberellic acid signaling (Van Buyten, 2013).

On the other hand, rice root immunity to M. graminicola is regulated by the phythormones salicylic acid (SA),

jasmonic acid (JA) and ethylene (ET) signaling, while rice root susceptibility to M. graminicola is regulated by

ABA and BR signaling. Exogenous application of salicylic acid and jasmonic acid suppresses M. graminicola

infection by suppressing ABA and BR signaling. Similarly, exogenous application of ET suppresses M.

graminicola infection by suppressing ABA and promoting JA signaling in rice (Kyndt et al., 2014). Upon

infection, the nematode stimulates ABA synthesis to suppress SA and JA mediated root defense and thereby

facilitating infection. However, the role of auxin, jasmonic acid, salicylic acid and abscisic acid are not yet clear

when the rice root is infected by both P. arrhenomanes and M. graminicola.

The outcome of hormonal defense depends on the biosynthesis, transportation, signaling pathways of each

hormone and finally cross-talk with other hormones. In healthy plants, the biosynthesis and signaling pathways

of the defense hormone remain inactivated, but in response to exogenous application of that particular hormone

or in response to pathogen attack, the biosynthesis and signaling pathways of the defense hormones become

4

active, facilitate the expression of hormone responsive defense gene and subsequently confer resistance to the

pathogens. On the other hand, in response to the exogenous application of inhibitor of a particular hormone the

biosynthesis and downstream signaling of that particular hormone is blocked.

Recently it has been reported that auxin is produced by Pythium spp. in vitro and contribute to elevated auxin

level in rice, thereby inducing auxin signaling and make the rice seedlings susceptible to Pythium infection (Van

Buyten, 2013). Recently, it has been reported that auxin is required for the gall formation and expansion (Kyndt

et al., 2016). The role of P. arrhenomanes and its secreted auxin in nematode-induced gall formation and

subsequent development of nematode still remain elusive.

In order to infect the host plants, plant-parasitic nematodes have to localize the suitable host surface. Root

exudates present in the rhizosphere help nematodes to localize the root surface. It has been reported that IAA

binds to the amphids, phasmids and surface cuticle of Meloidogyne incognita and thereby helps the nematodes to

orientate and localize the root surface of the host (Curtis, 2009). Recently, it has been reported that auxin facilitate

the host finding of the nematodes Aphelenchoides besseyi (Feng et al., 2014). Kammerhofer et al., (2015) and

Wubben et al., (2001) reported that activation of ethylene biosynthesis and signaling pathways favors the

attraction of cyst nematode- Heterodera schachtii, in contrast Fudali et al., (2013) reported that roots of ethylene

overproducing mutant repel Meloidogyne hapla. However, the role of auxin, jasmonic acid and ethylene are not

yet clear in host finding of J2 of M. graminicola.

In order to explore the aforementioned existing lack of information, it might be interesting to further investigate

the types of interaction and the underlying mechanism governing the interaction between P. arrhenomanes and

M. graminicola on rice roots; to find out the role of auxin, jasmonic acid, salicylic acid, and abscisic acid in the

interaction between oomycete P. arrhenomanes and root-knot nematode M. graminicola; to further investigate

the role of P. arrhenomanes on root penetration, gall formation and subsequent development of M. graminicola

inside rice roots and to find out the host finding agent of J2 of M. graminicola in the rhizosphere of rice. So, the

objectives of this research project are as follows:

To investigate the role of P. arrhenomanes on the root penetration, gall formation, and development of

M. graminicola

To investigate the role of auxin, jasmonic acid, salicylic acid, and abscissic acid in the Pythium

arrhenomanes - Oryza sativa - Meloidogyne graminicola interaction

To investigate the role of M. graminicola on the root colonization and multiplication of P. arrhenomanes

inside the rice roots

To investigate the role of P. arrhenomanes, auxin, jasmonic acid and ethylene on the host finding of M.

graminicola

5

2. Materials and Methods

2. 1 Maintenance of Pythium arrhenomanes and Meloidogyne graminicola culture: P. arrhenomanes was

isolated from the soil of aerobic rice fields in the Philippines (Van Buyten, 2013). P. arrhenomanes was cultured

and maintained following the method of Verbeek et al., (2016). For the preparation of inoculum, one P.

arrhenomanes containing agar plug was transferred to the center of a new PDA plate and kept in the incubator at

30ºC for 3 days. M. graminicola was maintained on susceptible rice cultivar-Nipponbare at 25ºC light dark regime

16/8h.

2. 2 Methodology for extraction of second stage juveniles (J2) of Meloidogyne graminicola: Around 3 month

old M. graminicola infected rice plants cv. Nipponbare were collected. The J2 of M. graminicola were extracted

with modified Baermann funnel method (Hooper et al., 2005; Luc et al., 2005). After 72 hours, the juveniles were

collected. Juvenile suspension was concentrated by centrifugation (1500 rpm) to 166 J2/ml.

2. 3 Methodology for double infection experiment: Seeds of IR81413-BB-75-4 and Nipponbare (to study the

type of interaction), Bomba and GH3.1OX (to study the role of auxin), COI1-18 – transgenic RNAi lines impaired

in JA signaling (Yang et al., 2012) and NC2728- JA biosynthesis mutant (Riemann et al., 2008) (to study the role

of jasmonic acid) were used in our experimentS. Seeds of these cultivars were soaked in 4% sodium hypochloride

solution and kept in a shaker for 15 minutes. Then the seeds were washed off with sterile water for three times.

Seeds were germinated on paper towel for 2 days 16/8h light regime at 31ºC.The germinated seeds were

transplanted into a plastic tube filled with sand + absorbent polymer (SAP). Before transplanting each SAP tube

was provided with 10 mL distilled water. The plants were grown at 28°C. The light (150 μmol m−2 s−1) /dark ratio

was 12-h/12-h and relative humidity was 70% to 75% (Nahar et al., 2011). At five days after germination, two P.

arrhenomanes plugs (4 mm) were used to inoculate each seedling, by placing them in two holes around the

seedling opposite to one another. The P. arrhenomanes plugs were inoculated to the holes in such a way so that

the inoculum containing side of the plug gets in contact with the root system. The control plants were also

inoculated with sterile agar plugs in the same way of P. arrhenomanes inoculation. After inoculation each plant

was provided with 10 mL distilled water. This was done very carefully and slowly so that the inoculum does not

float. After 4 days of P. arrhenomanes inoculation, each rice seedling was inoculated with 250 J2 of M.

graminicola. Each plant was provided with 10 mL Hoagland solution every two days until harvesting.

2. 4 Chemical treatments in the double infection experiment: 100 µM Naphthalene Acetic Acid-NAA

(Auxin); 100 µM Methyl Jasmonate-MeJA (a JA conjugate); 100 µM Diethyldithiocarbamic Acid-DIECA-JA

biosynthesis inhibitor (Doares et al., 1995); 100 µM alpha-aminooxy-beta- phenylpropionic acid-AOPP-PAL

inhibitor result in less SA biosynthesis (Massala et al., 1987); 50 µM abamine - ABA biosynthesis inhibitor

(Kitahata et al., 2006) solution were used for spraying to investigate the role of auxin and JA as well as to study

the role of SA and ABA in the antagonistic interaction. Twenty µL Tween 20 was added to 50 mL working

solution and mixed thoroughly by shaking. The hormones and inhibitors solution were sprayed on the shoot of

rice seedlings (after 6 days of transplanting and 24 hrs before nematode inoculation) under a fume hood. Time

schedule of a double infection experiment is shown in figure 1.

Figure 1. Layout of interaction experiments between P. arrhenomanes and M. graminicola on rice roots over

time.

6

After 12 days of nematode inoculation, the rice seedlings were harvested. Data were recorded on root length,

shoot length, root fresh weight, and root necrosis. The root system of P. arrhenomanes single infected plants and

double (P. arrhenomanes infected and M. graminicola) infected plants of Bomba and GH3.1OX were preserved

in -80̊ C for extraction of DNA and subsequent detection and quantification of P. arrhenomanes in single infected

and double infected plants of both cultivars.

2. 5 Fuchsin staining for gall/nematode visualization: The gall containing root system was stained with 0.013%

acid fuchsin and 0.8% acetic acid for 3 minutes to visualize gall and nematodes (Verbeek et al., 2016), then few

mL acid glycerol was added to each well of 6 well plate for destaining the root system. The stained root placed

on 6-well plate was kept in a shaker for some days. The number of gall per root system of single (M. graminicola)

infected and double (M. graminicola and P. arrhenomanes) infected plants were counted under microscope. The

numbers of galls and different life stages (J2, J3/J4, Female, and Female with eggmass) of M. graminicola were

also counted.

2. 6 Methodology for detection and quantification of Pythium arrhenomanes in rice roots: The DNA was

extracted from the preserved root sample of P. arrhenomanes infected as well as P. arrhenomanes and M.

graminicola infected plants of Bomba and GH3.1OX using the protocol of DNeasy Minikit (Qiagen). After

extraction the concentration and purity of DNA was measured with the help of Nano-drop (Isogen life science-

thermo scientific). Polymerase Chain Reaction (PCR) was done for the amplification of a specific length of DNA.

The mastermix for 10 samples was prepared as follows: milliQ water (119 µL); buffer-10X (20 µL); DNTPs - 25

mM (10 µL); forward primer -10 µM (10 µL); reverse primer -10 µM (10 µL); and Taq polymerase (2 µL). The

mastermix was mixed well. Then 20 µL of mastermix and 5 µL of template DNA were added in to PCR tube and

mixed properly. The PCR tubes were inserted in the Bio-Rad PCR machine and run as follows: 95̊ C for 10

minutes (Denaturation), 95ºC for 30 seconds, 58ºC for 40 seconds (Annealing), 72ºC for 25 seconds (Elongation),

then GO TO STEP 2 for 34X, then 72ºC for 5 minutes and 12º C for infinite. After PCR, the amplified DNA was

run in agarose gel, then stained with EtBr and documented under UV light. Based on the presence of band, the P.

arrhenomanes was detected in the root sample. To quantify the infection pressure of P. arrhenomanes, a

Quantitative Real Time PCR (qPCR) was done as follows:

Table 1. List of primer sets and their sequences used for the amplification of target sequence and subsequent

quantification of P. arrhenomanes DNA for qPCR.

Primer Sequences

Pythium arrhenomanes ATTCTGTACGCGTGGTCTTCCG (PT60 ITS Forward) and

ACCTCACATCTGCCATCTCTCTCC (PT60 ITS Reverse)

Plant TTCTCCTCCCAATCGTCTCG (Plant Exp Forward) and

TTAGGTGGAGGGAGCGAATC (Plant Exp Reverse)

For the preparation of sample mixture; 56 µL milliQ water was added to 56 µL sample DNA. After mixing it

thoroughly, the sample mixture was kept on ice. For No Template Control ( NTC), no sample was added to the

water and for Interrun-Calibrator (IRC), 16 µL plant sample was added to 48 µL water. For the preparation of

mastermix; 40µL of forward primer and 40µL of reverse primer were added in a brown tube. Then 400 µL

supermix was added to the brown tube and mixed thoroughly by pipetting several times. Special care was taken

to avoid any bubble formation in the mastermix. Then with the help of robotics machine; sample mix was mixed

with mastermix in the 96-well plate. After mixing, the 96-well plate was wrapped with plastic paper and rotated

for 30 seconds with the help of a manual rotator. Then the 96 well plate was put on the Bio-Rad Q PCR machine.

After completion of qPCR the data on Cq values were saved in excel file and the P. arrhenomanes DNA in rice

roots was quantified using a standard equation for P. arrhenomanes DNA.

7

2. 7 Methodology for attraction test of Meloidogyne graminicola: The second stage juveniles of M.

graminicola were used for attraction tests. Square plates (12 x 12 cm) were used for design of the attraction test

system. Plates were filled with 2% water agar. The square petridish was subdivided into four small sections. Then

24 longitudinal lines (within 6 cm length) were drawn at the center of each small section for movement scoring

purposes. In the middle a channel was created of 8 cm length with agar filled plastic straw. The one channel was

supplied with test treatment and another channel was supplied with control treatment. The treatments used in this

experiment were 2M NaCl solution; 100 µM NAA solution; 100 µM JA solution; root tip of P. arrhenomanes

infected plants; root tip of 100 µM NAA and 100 µM DIECA treated plants; root tips of GH3.1OX (less

endogenous free auxin compared to it’s wild type Bomba); root tips of Hebiba-JA biosynthesis mutant (Reinmann

et al., 2003); root tips and root exudates of 100 µM MeJA treated plants; root tip and root exudates of Oryza

glabberrima- resistant to plant-parasitic nematodes (Finkers-Tomczak et al.); root exudates of 400 µM ethephon

treated plants-precursor of ethylene, releases ethylene after decomposition in the plant (Weis et al., 1988); root

exudates of P. arrhenomanes infected plants and 25 days old P. arrhenomanes metabolites. Five µL nematode

suspensions containing 30 J2s of M. graminicola (on average) were carefully pipetted at the very center point of

each channel. Then the movement of nematodes was continuously monitored for 75 minutes. Data on number of

nematodes per small division were recorded at 0 minute and 70 minutes after nematodes inoculation.

Figure 2. Layout of a novel method developed and optimized in the lab for in-vitro attraction assay of root-knot

nematode M. graminicola.

2. 8 Statistical Analysis: The data were analyzed by SPSS Statistics 23 program. For the data having normal

distribution and homogeneous variances, were analyzed by Independent Sample T-Test (for less than 5

treatments) and one-way ANOVA with Duncan’s Post Hoc Test (for ≥ 5 treatments). For the data not having

normal distribution and homogeneous variances, were analyzed with Mann-Whitney U non-parametric test. Data

of attraction tests were analyzed by Paired-Sample T-Test. For all experiments, p value less than 0.05 was

considered as significant differences between the treatments.

8

3. Results

3. 1 Interaction between Pythium arrhenomanes and Meloidogyne graminicola

It is known that M. graminicola and P. arrhenomanes antagonize each other under raised bed and greenhouse

conditions with cultivar IR81413-BB-75-4 (Verbeek et al., 2016). To confirm if the interaction is also apparent

under our lab conditions, we do need to further investigate the interactions. The rice cultivars Nipponbare and

IR81413-BB-75-4 were used to study the interaction between P. arrhenomanes and M. graminicola. Number of

nematodes and galls per root system (Figure 3. A, B, C, D) were significantly reduced in the double (P.

arrhenomanes and M. graminicola) infected plants of both cultivars compared to single (M. graminicola) infected

plants. This showed that P. arrhenomanes reduced root penetration and gall formation in both cultivars under our

experimental settings.

The development of M. graminicola was significantly delayed in the double infected plants compared to single

infected plants in Nipponbare (Figure 3. E). In contrast, there was no significant difference in terms of

development of nematodes between single infected plants and double infected plants of IR81413-BB-75-4 (3. F).

3. 1. A Role of auxin in the interaction between Pythium arrhenomanes and Meloidogyne graminicola in

rice roots

It is known that auxin plays an important role in gall formation and expansion (Kyndt et al., 2016). It was therefore

studied if less free auxin in GH3.1OX (Domingo et al., 2009) compared to its wild-type Bomba could have an

effect on the interaction. Our results showed that, lower endogenous auxin level in GH3.1OX significantly

reduced nematode penetration and gall formation both in single (M. graminicola) infected and double infected

plants compared to Bomba (Figure 4. A, B) although the reduction of gall formation in the double infected plants

was not significant (Figure 4. B). On the other hand, lower endogenous auxin promoted nematode development

significantly both in single and double infected plants (Figure 4. C). If we observe the roles of P. arrhenomanes

on M. graminicola in this experiment, we can see that, P. arrhenomanes significantly reduced nematode

penetration and gall formation both in Bomba and GH3.1OX (Figure 4. A, B) although the reduction of gall

formation was not significant in GH3.1OX (Figure 4. B), in contrast P. arrhenomanes significantly promoted gall

formation in Bomba but P. arrhenomanes had no significant impact on development of M. graminicola in

GH3.1OX (Figure 4. C).

9

Figure 3. Meloidogyne graminicola infection data at 16 days post inoculation (dpi) of Pythium arrhenomanes

and 12 dpi of M. graminicola in the interaction experiment between these two root pathogens . Number of

M. graminicola per root system in Nipponbare (A) and IR81413-BB-75-4 (B); number of gall per root system

in Nipponbare (C) and IR81413-BB-75-4 (D); percentage of developmental stages of M. graminicola in

Nipponbare (E) and IR81413-BB-75-4 (F). Bars represent mean ± standard error with 12 replications for

Nipponbare and 15 replications for IR81413-BB-75-4. Different letters indicate statistically significant

different between the treatments (P < 0.05). Data on number of nematodes and number of gall per root system

were analyzed by Independent Sample T-Test. Data on percentage of developmental stages of M. graminicola

were analyzed by Mann-Whitney U non-parametric test.

10

Figure 4. Role of auxin on the nematode infection in the M. graminicola infected plants and P. arrhenomanes

+ M. graminicola infected plants. M. graminicola infection data after 16 days post inoculation (dpi) of P.

arrhenomanes and 12 dpi of M. graminicola in the interaction experiment between these two root pathogens.

Number of M. graminicola per root system (A); number of gall per root system (B); percentage of

developmental stages of M. graminicola (C). Bars represent mean ± standard error with 8 replications.

Different letters indicate statistically significant difference between the treatments (P < 0.05). Data on number

of nematodes were analyzed by Mann-Whitney U non-parametric test. and number of gall per root system

were analyzed by Independent Sample T-Test. Data on percentage of developmental stages of M. graminicola

were analyzed by Mann-Whitney U non-parametric test.

0

20

40

60

80

100

120

140

160

180

200

M. graminicola P. arrhenomanes + M. graminicola

Bomba GH3.1OXNu

mbe

rof n

emat

odes

per

root

syst

emA

a

b

b

c

0

10

20

30

40

50

60

M. graminicola P. arrhenomanes + M. graminicola

Bomba GH3.1OX

Num

bero

f gal

ls pe

r roo

t sys

tem

B

a

b bb

11

3. 1. B Role of M. graminicola and auxin on the in planta growth of Pythium arrhenomanes

For the formulation and prescription of effective control measures, accurate diagnosis of plant pathogens and

quantification of infection pressure are essential. Several authors identified and quantified the infection pressure

of plant pathogens by qPCR (Brouwer et al., 2003; Gachon & Saindrenan, 2004; Zhang et al., 2005; Lievens et

al., 2006; Kernaghan et al., 2008). Here, for accurate detection and quantification of infection pressure of the

oomycete P. arrhenomanes in rice roots, we did qPCR on DNA of single (P. arrhenomanes ) infected and double

(P. arrhenomanes & M. graminicola) infected root samples of Bomba and GH3.1OX (which contains less free

auxin compared to Bomba. We detected and quantified P. arrhenomanes DNA both in single and double infected

plants of Bomba and GH3.1OX. Our results also showed that M. graminicola slightly retards (not significant) in

planta growth of P. arrhenomanes within the root system in Bomba but not in GH3.10X (less amount of free

auxin) (Figure 5 ). Our results also demonstrated that the level of auxin in the plant did not play any significant

roles on the in-planta growth of P. arrhenomanes both in the single (P. arrhenomanes) and double (P.

arrhenomanes and M. graminicola) infected plants (Figure 5).

Figure 5. In planta quantification of P. arrehenomanes DNA with qPCR in rice cultivars Bomba and GH3.1OX.

The DNA of P. arrhenomanes was quantified in single infected (P. arrhenomanes) and double infected (P.

arrhenomanes and M. graminicola) roots of both cultivars. Bars represent mean ± standard error with 3

replications. Similar letter on error bar indicate statistically non-significant differences among the treatments (p

> 0.05). Data were analyzed by Duncan Multiple Range Test.

To further elucidate the role of auxin in the interaction between P. arrhenomanes and M. graminicola , rice shoots

(cv. Nipponbare) were sprayed with 100 µM NAA (an active auxin form). In contrast to Bomba, where high

endogenous auxin compared to GH3.1OX promoted root penetration and gall formation; spraying with NAA,

slightly reduced root penetration and gall formation in the single (M. graminicola) and double (P. arrhenomanes

and M. graminicola) infected roots in comparison to control rice plants (no NAA treatment) although it was not

statistically significant (Figure 6. A, B ). NAA treatments did not show any significant roles on nematode

development (Figure 6. C). In this experiment, P. arrhenomanes slightly reduced (not significant) nematode

penetration and gall formation both in the control and NAA treated plants (Figure 6. A, B ). P. arrhenomanes

did not show significant impact on nematode development (Figure 6. C).

12

Figure 6. Role of 100 µM NAA spraying on the nematode infection in the M. graminicola infected plants and P.

arrhenomanes + M. graminicola infected plants. M. graminicola infection data after 16 days post inoculation (dpi) of

P. arrhenomanes and 12 dpi of M. graminicola in the interaction experiment between these two root pathogens. Number

of M. graminicola per root system (A); number of gall per root system (B); percentage of developmental stages of M.

graminicola (C). Bars represent mean ± standard error with 10 replications. Similar letters indicate statistically non-

significant difference between the treatments (p > 0.05). Data on and number of gall per root system were analyzed by

Duncan Multiple Range Test. Data on number of nematodes and percentage of developmental stages of M. graminicola

were analyzed by Mann-Whitney U non-parametric test.

13

3. 1. C Role of jasmonic acid (JA) in the interaction between Pythium arrhenomanes and Meloidogyne

graminicola in rice roots: It was reported that, exogenous application of MeJA reduced the seedling mortality

to P. arrhenomanes, and increased the root length and shoot length of Pythium infected rice, in contrast MeJA

application reduced root length and shoot length in healthy plants (Van Buyten, 2013). On the other hand, mutual

antagonistic interaction prevails between JA and root-knot nematode (Kyndt et al., 2014). However, to know the

role of JA in the interaction between these two pathogens on rice roots, we used a number of rice cultivars

deficient in JA biosynthesis as well as used JA biosynthesis inhibitor (DIECA) and jasmonate conjugate (MeJA).

Our results showed that number of nematodes (significantly) and gall formation were slightly reduced in response

to JA inhibitor (DIECA) and in COI1-18 – transgenic RNAi line impaired in JA signaling (Yang et al., 2012) and

in NC2728- JA biosynthesis mutant in the single (M. graminicola) infected plants (Figure 7. A, B). In contrast,

nematodes numbers and gall formation were slightly increased (although not significant) in response to MeJA

spraying in the single (M. graminicola) infected plants (Figure 7. A, B). However, the roles of JA inhibitor and

JA biosynthesis and signaling mutant/transgenic lines on nematode establishment were slightly lost in the double

infected plants (Figure 7. A, B). Our experimental results also demonstrated that, JA had no significant influences

on nematode development both in the single and double infected plants (Figure 7. C). If we observe the roles of

P. arrhenomanes in this experiment, we can see that P. arrhenomanes slightly antagonized nematode

establishment (penetration and gall formation) in the control plants but the antagonistic roles of P. arrhenomanes

on M. graminicola was slightly lost in JA biosynthesis and signaling mutant/transgenic lines and also in JA

inhibitor treated plants (Figure 7. A, B). On the other hand, P. arrhenomanes did not have any significant effects

on development of nematodes both in control and in JA biosynthesis and signaling mutant/transgenic lines and

also in JA inhibitor and MeJA treated plants (Figure 7. C).

3. 1. D Role of salicylic acid (SA) inhibitor in the interaction between Pythium arrhenomanes and

Meloidogyne graminicola in rice roots: It is known that salicylic acid activate rice root immunity to Pythium

spp., in contrast Pythium inoculation suppresses SA biosynthesis and signaling (Van Buyten, 2013), on the other

hand, mutual negative interaction prevails between SA and M. graminicola (Kyndt et al., 2014). However, to

study the role of SA in the interaction between these two root pathogens, we used PAL inhibitor (AOPP) as foliar

application. Our results showed that SA inhibitor slightly decreased (not significant statistically) the nematode

penetration and subsequent gall formation in the single infected plants, in contrast, SA inhibitor slightly increased

(not significant statistically) nematode penetration and subsequent gall formation in the double infected plants

(Figure 8. A, B). SA inhibitor did not show any significant roles on nematode development (Figure 8. C).In this

experiment, P. arrhenomanes antagonize nematode penetration and gall formation in the control plants but the

roles of P. arrhenomanes to antagonize nematode establishment in the AOPP treated plant are lost rather it

increases nematode establishment (Figure 8. A, B). P. arrhenomanes did not show any significant roles on

nematode development both in control and AOPP treated plants (Figure 8. C)

3. 1. E Role of abscisic acid (ABA) inhibitor in the interaction between Pythium arrhenomanes and

Meloidogyne graminicola in rice roots: Foliar application of ABA promotes the induction of proteinase inhibitor

II, thus interferes the development of root-knot nematodes (Karimi et al., 1995). It has also been reported that

exogenous application of ABA induces the upregulation of three thionin genes encoding for antimicrobial

peptides and over expression of these genes suppress Pythium graminicola and M. graminicola (Ji et al., 2015).

On the other hand, it has been reported that ABA promotes the infection of Hirschmanniella oryzae (Nahar et al.,

2012). To further elucidate the roles of ABA in the interaction between P. arrhenomanes and M. graminicola on

rice roots, we used ABA inhibitor (abamine). Our results showed that, foliar application of abamine slightly

decreased (not significant) nematode establishment (penetration and gall formation) in the single infected plants

(Figure 9. A, B). In contrast, ABA inhibitor slightly increased (not significant) establishment in the double

infected plants (Figure 9. A, B). However, ABA inhibitor did not show any significant roles on nematode

development (Figure 9. C). In this experiment, P. arrhenomanes slightly antagonized nematode establishment in

the control plants but the roles of P. arrhenomanes to antagonize nematode establishment in the abamine treated

plant were lost rather it slightly increased nematode establishment (Figure 9. A, B).

14

Figure 7. Role of jasmonic acid (JA) on the nematode infection in the M. graminicola infected plants and P.

arrhenomanes + M. graminicola infected plants. M. graminicola infection data at 16 days post inoculation (dpi) of P.

arrhenomanes and 12 dpi of M. graminicola in the interaction experiment between these two root pathogens. Number

of M. graminicola per root system (A); number of gall per root system (B); percentage of developmental stages of M.

graminicola (C). Bars represent mean ± standard error with 10 replications. Asterisks indicate statistically significant

difference between the treatment and control plant (P < 0.05). Data on and number of gall and nematodes per root system

and percentage of developmental stages of M. graminicola were analyzed by Mann-Whitney U non-parametric test.

0

10

20

30

40

50

60

70

80

90

100

M. graminicola P. arrhenomanes + M. graminicola

Nipponbare (Control) Nipponbare + 100 µM DIECA

COI1-18 (JA biosynthesis RNAi) Nipponbare + 100 µM MeJA (JA biosynthesis)

NC2728 (JA biosynthesis transgenic)

AN

umbe

r of n

emat

odes

per

root

sys

tem

* *

Non-significant with control

0

5

10

15

20

25

30

M. graminicola P. arrhenomanes + M. graminicola

Nipponbare (Control) Nipponbare + 100 µM DIECA

COI1-18 (JA biosynthesis RNAi) Nipponbare + 100 µM MeJA (JA biosynthesis)

NC2728 (JA biosynthesis transgenic)

Num

ber o

fgal

ls p

er ro

ot s

yste

m

BNon-significant with control Non-significant with control

0

10

20

30

40

50

60

70

80

90

100

Nipponbare(Control)

Nipponbare+ 100 µM

DIECA

COI1-18 (JAbiosynthesis

RNAi)

Nipponbare+ 100 µMMeJA (JA

biosynthesis)

NC2728 (JAbiosynthesistransgenic)

Nipponbare(Control)

Nipponbare+ 100 µM

DIECA

COI1-18 (JAbiosynthesis

RNAi)

Nipponbare+ 100 µMMeJA (JA

biosynthesis)

NC2728 (JAbiosynthesistransgenic)

J2 J3/J4 Female Female with eggmasses Male

M. graminicola P. arrhenomanes + M. graminicola

Perc

enta

ge o

f nem

atod

espe

r st

age

CNon-significant with control Non-significant with control

15

Figure 8. Role of salicylic acid (SA) inhibitor (100 µM AOPP) on the nematode infection in the M. graminicola

infected plants and P. arrhenomanes + M. graminicola infected plants. M. graminicola infection data at 16 days post

inoculation (dpi) of P. arrhenomanes and 12 dpi of M. graminicola in the interaction experiment between these two root

pathogens. Number of M. graminicola per root system (A); number of gall per root system (B); percentage of

developmental stages of M. graminicola (C). Bars represent mean ± standard error with 10 replications. Similar letters

indicate statistically non-significant difference between the treatments (P > 0.05). Data on number of gall and nematodes

per root system were analyzed by Independent Sample T- Test and percentage of developmental stages of M.

graminicola were analyzed by Mann Whitney U Non-Parametric Test.

0

10

20

30

40

50

60

70

80

M. graminicola P. arrhenomanes + M. graminicola

Nipponbare Nipponbare + 100 µM AOPP

Aa

a

a

a

Num

ber o

f nem

atod

es p

er ro

ot s

yste

m

0

5

10

15

20

25

M. graminicola P. arrhenomanes + M. graminicola

Nipponbare Nipponbare + 100 µM AOPP

Num

ber o

f gal

ls p

er ro

ot s

yste

m

Ba

a

a

a

0

10

20

30

40

50

60

70

80

90

100

Nipponbare Nipponbare + 100 µM AOPP Nipponbare Nipponbare + 100 µM AOPP

M. graminicola P. arrhenomanes + M. graminicola

J2 J3/J4 Female Female with eggmasses Male

Perc

enta

ge o

f nem

atod

es p

er st

age

Ca a a a

16

Figure 9. Role of abscissic acid (ABA) inhibitor (50 µM abamine) on the nematode infection in the M. graminicola

infected plants and P. arrhenomanes + M. graminicola infected plants. M. graminicola infection data after 16 days post

inoculation (dpi) of P. arrhenomanes and 12 dpi of M. graminicola in the interaction experiment between these two root

pathogens. Number of M. graminicola per root system (A); number of gall per root system (B); percentage of

developmental stages of M. graminicola (C). Bars represent mean ± standard error with 10 replications. Similar letters

on the error bars indicate statistically non-significant differences between the treatments (P > 0.05). Data on number of

gall and nematodes per root system were analyzed by Independent Sample T-Test. Data on percentage of developmental

stages of M. graminicola were analyzed by Mann Whitney U Non-Parametric Test.

0

10

20

30

40

50

60

70

80

M. graminicola P. arrhenomanes + M. graminicola

Nipponbare Nipponbare + 50 µM Abamine

Num

ber o

f nem

atod

es p

er ro

ot sy

stem

Aa

aa

a

0

5

10

15

20

25

M. graminicola P. arrhenomanes + M. graminicola

Nipponbare Nipponbare + 50 µM Abamine

Num

ber o

f gal

ls pe

r roo

t sys

tem Ba a

a

a

0

10

20

30

40

50

60

70

80

90

100

Nipponbare Nipponbare + 50 µMAbamine

Nipponbare Nipponbare + 50 µMAbamine

M. graminicola P. arrhenomanes + M. graminicola

J2 J3/J4 Female Female with eggmasses Male

Perc

enta

ge o

f nem

atod

es p

er st

age

Ca a a a

17

3. 2 Development of a novel method for the in-vitro host finding assay of second stage juveniles (J2s)

of Meloidogyne graminicola : A novel method for the in-vitro host finding assay of infective second

stage juveniles of M. graminicola was developed and optimized in the lab as follows:

A. Calibration of the Square Petridish: The square petridish is subdivided into four small sections by

drawing with marker pen (Figure 10. A). Then 24 longitudinal lines (within 6 cm length) are drawn at

the center of each small section which will facilitate the monitoring of nematodes over time. The central

longitudinal line is drawn with blue colored pen to facilitate the inoculation of J2s of M. graminicola at

the center point of square petridish. Then the square petridish is labelled with the name of treatments

randomly.

B. Preparation of plastic straw: A number of 1 cm diameter plastic straws are cut in 8 cm length. Then

the plastic straws are filled with 2% water agar to add some weights which in turn will facilitate to make

smooth channel on 2% water ager. After few minutes the agar is solidified within the plastic straws

(Figure 10. B).

C. Preparation of channel in the square petridish: Under laminar air flow cabinet 50 mL, 2% water agar

is poured on the plastic petridish (Figure 10. C). After few minutes the water agar is solidified. Then 4

agar filled plastic straws are placed in parallel with each other per square petridish (Figure 10. D), then 1

cm length plastic straws are place in vertical line with large straws (Figure 10 E). After that, again 50

mL, 2% water agar is poured. After solidification of the water agar, the agar filled plastic straws are

removed. As a result, smooth channel are made on the agar plate which is used for the inoculation of

treatments and nematodes for the attraction test (Figure 10. F).

D. Attraction test of infective juveniles of Meloidogyne graminicola: The prepared square petridish is

placed on the stage of microscope. The one channel is filled with test treatment (90 µL) and another

channel is filled with control treatment (90 µL). It is done very carefully so that the treatment solution

does not cross the central line. Immediately after that, five µL nematode suspensions (30 nematodes on

average) are pipetted at the very center point of each channel. Then the movement of nematodes is

continuously monitored for 75 minutes. Data on number of nematodes per small division are recorded at

0 minute and 70 minutes after nematodes inoculation.

E. Optimization of the method: For the optimization of the method, attraction test was done with reference

repellent NaCl solution (Dalzell et al., 2011). The results of the attraction test demonstrated that, 2M

NaCl solution significantly repel the J2 of M. graminicola (Figure 12. A) indicating that the method is

optimized.

Figure 10. Development of a novel method for the in-vitro host finding assay of root-knot nematode Meloidogyne

graminicola. Figures showing calibration of square petridish (A), preparation of plastic straws (B), filling of

calibrated square petridish with 50 mL, 2% water agar (C), 2% water agar filled plastic straws are placed on the

square petridish filled with 50 mL water agar (D), 1 cm length agar filled plastic straws are placed in vertical line

with large plastic straws and again 50 mL water agar is poured on the square petridish (E), after solidification of

water agar, all the plastic straws are removed, then the square petridish become ready for the in-vitro host finding

assay of root-knot nematode M. graminicola (F).

A B C

D E F

18

3. 2 . 1 Development of a mathematical model for data processing and subsequent analysis of data derived

from in-vitro attraction assay (developed and optimized in this thesis) of root-knot nematode Meloidogyne

graminicola:

For getting accurate and reliable results, the no. of nematodes between treatment side and control side of the

channel at 0 minute as well as the total no. of nematodes at 0 minute and after 75 minutes should be equal. But in

practical, there are differences between treatment side and control side at 0 minute (which is not resulted by the

influences of treatment but just initial differences because of difficulties to inoculate equal number of nematodes

to both side of the channel) and also there are differences of total no. of nematodes at 0 minute and after 75

minutes (because of loss of nematodes in 2% water agar and counting error). So to reduce and adjust the

differences of number of nematodes between treatment side and control side at 0 minute and between 0 minute

and 75 minutes, a mathematical model comprising series of mathematical formulae is developed in this thesis as

follows:

Figure 11. Layout of a novel method ( developed and optimized in this thesis) for the in-vitro attraction assay

of M. graminicola.

To prove and validate the mathematical model, primary data of attraction test with root tips and root exudates of

MeJA treated plants and control plants are used hereunder as example.

Table 2. Showing the primary data on the number of nematodes at 0 minutes and after 75 minutes in both

treatment side and control side for the first 4 replications of attraction test (with root tips together with root

exudates of MeJA treated plants versus control plants), for the validation of a mathematical model developed for

data processing and subsequent analysis for the in-vitro host finding assay of M. graminicola.

Replication No. of

nematodes

in

treatment

side at 0

minute (B)

No. of

nematodes

in control

side at 0

minute (C)

Total no. of

nematodes

at 0 minute

(D)

No. of

nematodes

in

treatment

side after

75 minutes

(H)

No. of

nematodes

in control

side after

75 minutes

(I)

Total no. of

nematodes

after 75

minutes (J)

1 17 41 58 14 44 58

2 36 24 60 39 25 64

3 32 41 73 26 51 77

4 75 37 112 59 42 101

Let us consider that,

B = No. of nematodes in treatment side at 0 minute,

C = No. of nematodes in control side at 0 minute and

D = Total no. of nematodes at 0 minute

19

At 0 minute, the no. of nematodes in both treatment side and control side should be equal to get reliable results,

but in practical it is quite impossible to inoculate equal no. of nematodes at both side of the channel. However, to

adjust this initial differences, imbalance factor (E) at 0 minute is calculated and adjusted as follows:

𝐸 = (D/2 )– B

Table 3. showing the imbalance factor for the first four replication at 0 minute.

Replication The imbalance factor at 0 minute

1 12

2 -6

3 4,5

4 -19

F = Adjusted no. of nematodes in treatment side at 0 minute, is calculated as follows:

𝐹 = 𝐵 + 𝐸

G = Adjusted no. of nematodes in control side at 0 minute, is calculated as follows:

𝐺 = 𝐶 − 𝐸

Table 4. showing the adjusted no. of nematodes in both treatment side and control side at 0 minute.

Replication Adjusted no. of nematodes in

treatment side

Adjusted no. of nematodes in control side

1 29 29

2 30 30

3 36.5 36.5

4 56 56

Let us consider that,

H = No. of nematodes in treatment side after 75 minutes

I = No. of nematodes in control side after 75 minutes and

J = Total no. of nematodes after 75 minutes

Total no. of nematodes at 0 minute and 75 minutes should be equal to get reliable results but in practical, there

are differences of total no. of nematodes between 0 minute and after 75 minutes (because of loss of nematodes in

the agar system and counting error).This difference is minimized and adjusted by the imbalance factor (K) as

follows:

𝐾 = 𝐷 − 𝐽

Table 5. showing the imbalance factor of total no. of nematodes between 0 minute and 75 minutes.

Replications Imbalance factor of total no. of nematodes between 0 minute and 75

minutes

1 0

2 -4

3 -4

4 11

20

L = Adjusted no. of nematodes in treatment side after 75 minutes , is calculated as follows:

𝐿 = 𝐻 + (𝐾

2)

M = Adjusted no. of nematodes in control side after 75 minutes, is calculated as follows:

𝑀 = 𝐼 + (𝐾

2)

Table 6. showing the adjusted no. of nematodes in both treatment side and control side after 75 minutes.

Replication Adjusted no. of nematodes in

treatment side

Adjusted no. of nematodes in control

side

1 14 44

2 37 23

3 24 49

4 64,5 47,5

Then total no. of adjusted nematodes after 75 minutes (N) is calculated as follows:

𝑁 = 𝐿 + 𝑀

Table 7. showing the total no. of nematodes at 0 minute and total no. of adjusted nematode after 75 minutes.

Replication Total no. of nematodes at 0 minute Total no. of adjusted nematode after 75 minutes

1 58 58

2 60 60

3 73 73

4 112 112

Now, we can see that, there are no differences of total no. of nematodes between 0 minute and 75 minutes, so

we can calculate the no. of justified nematodes at both treatment side (O) and control side (P) after 75 minutes by

employing initial no. of nematodes and adjusted no. of nematodes in both treatment side and control side at 0

minute.

O = Number of justified nematodes in treatment side after 75 minutes, is calculated as follows:

0 = (𝐿 × 𝐹)/𝐵

P = Number of justified nematodes in control side after 75 minutes, is calculated as follows:

P =M × G

C

Table 8. showing the number of justified nematodes in both treatment side and control side after 75 minutes.

Replication Number of justified nematodes in

treatment side

Number of justified nematodes in control

side

1 23,88 31,12

2 30,83 28,75

3 27,37 43,63

4 48,16 71,89

Then the total no. of justified nematodes are calculated after 75 minutes (Q), as follows:

𝑄 = 𝑂 + 𝑃

21

The total no. of justified nematodes should be equal to total no. of adjusted nematodes total after 75 minutes or

total no. of nematodes at 0 minute, but in practical (after calculation of justified no. of nematodes at 75 minutes)

there are differences between total no. of adjusted nematode and total no. of justified nematodes after 75 minutes.

This difference is calculated by the Imbalance factor (R).

R = Difference between total no. of adjusted nematodes and total no. of justified nematodes after 75 minutes, is

calculated as follows:

𝑅 = 𝑁 − 𝑄

Table 9. showing the total no. of adjusted nematodes and total no. of justified nematodes and imbalance factor

between this two groups after 75 minutes.

Replication Total no. of

adjusted nematodes

Total no. of justified

nematodes

Differences between total no. of

adjusted nematodes and total no.

of justified nematodes

1 58 55,00 2,99

2 60 59,58 0,41

3 73 70,99 2,00

4 112 120,05 -8,05

To get reliable and accurate results the total no. of justified nematodes and total no. of adjusted nematodes should

be equal. To do so, the imbalance factor (R) is minimized and finally adjusted with the total no. of justified

nematodes in treatment side after 75 minutes and with the total no. of justified nematodes in control side after 75

minutes as follows:

S = Final no. of justified nematodes in treatment side after 75 minutes, is calculated as follows:

S = O + (R

2)

T = Final no. of justified nematodes in control side after 75 minutes, is calculated as follows

𝑇 = 𝑃 + (𝑅

2)

Table 10. showing the final no. of justified nematodes in both treatment side and control side after 75 minutes.

Replication Final no. of justified nematodes in

treatment side

Final no. of adjusted nematodes in

control side

1 25,38 32,61

2 31,04 28,95

3 28,37 44,62

4 44,13 67,86

Then total no. of final adjusted nematodes (U) is calculated as follows:

𝑈 = 𝑆 + 𝑇

Now , we can see that the total no. of final adjusted nematodes after 75 minutes are equal to the total no. of

nematodes after at 0 minute (which should be the case).

22

Table 11. showing the total no. nematodes at 0 minute and total no. of final adjusted nematodes after 75 minutes.

Replication Total no. of nematodes at 0

minute

Total no. of final adjusted nematodes after

75 minutes

1 58 58

2 60 60

3 73 73

4 112 112

So the data are now finally adjusted and justified to calculate the percentage of final adjusted no. of nematodes

in treatment side after 75 minutes (V). This is calculated as follows:

𝑉 = (𝑆 × 100)/𝑈

Similarly, we can calculate the percentage of final adjusted no. of nematodes in control side after 75 minutes (W)

as follows:

𝑊 = (𝑇 × 100)/𝑈

To get accurate result, the total no. of nematodes at 0 minute and total no. of final adjusted nematodes should be

equal. If the difference (Error factor- X) between the total no. of nematodes at 0 minute and total no. of final

adjusted nematodes is zero (0), then the model is said to be validated. It is calculated as follows

𝑋 = 𝐷 − 𝑈

After checking the error factor, we can observe that, the mathematical model is indeed validated for all the

replications of different treatments used for the in-vitro attraction assay of root-knot nematodes M. graminicola.

Table 12. showing the percentage of final adjusted no. of nematodes in both treatment side and control side after

75 minutes as well as validation factor.

Replication Percentage of final adjusted no.

of nematodes in treatment side

Percentage of final adjusted no.

of nematodes in control side

Error

factor

1 43,76 56,24 0

2 51,74 48,26 0

3 38,87 61,13 0

4 39,41 60,59 0

To further study if the root penetration of M. graminicola is based on the attractiveness of root tip and root

exudates, we did in-vitro attraction tests to find out which agents attract/repel M. graminicola. Our experimental

results showed that, 100 µM NAA solution (Figure 12) and metabolites of P. arrhenomanes (Figure 12)

significantly attracted J2s of M. graminicola. However, 100 µM JA solution (Figure 12) did not show any

significant impact on nematode attraction. When comparing root tips of GH3.1OX (less endogenous free auxin

compare to it’s wild type Bomba) (Figure 12), Hebiba - JA biosynthesis mutant (less JA compared to it’s wild

type Nihonmansri) (Riemann et al., 2003) (Figure 12), 100 µM NAA (Figure 12) and 100 µM DIECA (Figure

12) treated rice plants with their control, we did not observe any significant differences in their attractiveness to

J2 of M. graminicola. Both healthy root tip and P. arrhenomanes infected root tip equally attracted the J2 of M.

graminicola (Figure 12). Interestingly, root exudates along with root tips of Oryza glabberrima and MeJA treated

plants significantly repelled J2 of M. graminicola (Figure 12). Moreover, root exudates alone of ethephon treated

plants significantly repelled the J2s of M. graminicola (Figure 12) and root exudates of P. arrhenomanes infected

plants slightly repelled the J2S of M. graminicola (Figure 12).

23

Figure 12. Attraction test of J2s of root-knot nematode M. graminicola with a novel in-vitro agar plate method

developed and optimized in the lab. Data on number of J2 on both side of the plate were recorded at 0 minute

and 75 minutes after nematode inoculation. In the graph data are shown on the final adjusted percentage of

nematodes after 75 minutes on both treatment side and control side. Bars represent mean final adjusted

percentage of nematodes after 75 minutes ± standard error with 10 replications on average. On average 30

nematode were inoculated per replication. Primary data were processed by a mathematical model developed and

validated in this thesis to obtain final percentage of nematodes to each side of the channel after 75 minutes. Data

on final percentage of nematodes after 75 minutes were analyzed by Paired-Sample T-Test. Asterisk indicates

significant difference (p < 0.05). Treatments used in this experiment are 2M NaCl solution, 100 µM NAA

solution, 25 days old metabolites of P. arrhenomanes, 100 µM JA solution, root tip of 100 µM NAA treated

plants, root tip of GH3.1OX, root tips of Hebiba, root tip of DIECA treated plants, root tip of P. arrhenomanes

infected plants, root tip and root exudates of Oryza glabberrima, root tip and root exudates of MeJA treated

plants, root exudates of P. arrhenomanes infected plants, and root exudates of ethephon treated plants. PT60 =

P. arrhenomanes, RT = Root tips, RE = Root exudates, RTE = Root tips together with root exudates.

100 80 60 40 20 0 20 40 60 80 100

Final percentage of M. graminicola in treatment side Final percentage of M. graminicola in control side

24

4. Discussion

This experiment was carried out to study the interaction between oomycete - Pythium arrhenomans and root-

knot nematode - Meloidogyne graminicola on rice roots and also to study the roles of auxin, jasmonic acid,

salicylic acid and abscisic acid on the interaction between these two root pathogens. To reach the objective rice

roots were infected with P. arrhenomanes and M. graminicola, transgenic/mutant lines of the particular hormone

biosynthesis and signaling pathways were used for double infection experiment, shoots were sprayed with

particular hormone and inhibitor, attraction tests were done with particular hormone solution, metabolites of P.

arrhenomanes, root tips and root exudates of P. arrhenomanes, infected plants, different hormone treated plants,

resistant plants (Oryza glabberrima) and finally the infection pressure of both pathogens were scored in the

interaction experiments.

Interaction experiments between P. arrhenomanes and M. graminicola on two rice cultivars, Nipponbare and

IR81413-BB-75-4 showed an antagonism of P. arrhenomanes on M. gramninicola. Total number of nematodes

and gall per root system were significantly reduced in the double infected plants compare to single infected plants

in both rice cultivars, indicating that P. arrhenomanes antagonizes M. graminicola in terms of nematode

establishment (attraction and penetration, and subsequent gall formation) on the roots (Figure 3. A, B, C, D). The

results of the experiment reported in this thesis are consistent with the findings of Verbeek et al. (2016), who did

similar experiments in the Philippines. Considering the reason(s) why P. arrhenomanes antagonizes M.

graminicola, several hypotheses can be formulated. For example, the metabolites of P. arrhenomanes might

induce the mortality of infective juveniles of M. graminicola, several studies reported that the secondary

metabolites of fungal and bacterial pathogens promote the mortality of plant-parasitic nematodes (Hallmann &

Sikora, 1996; Hashem & Abo-Elyousr, 2011; Hu et al., 2012), P. arrhenomanes might act as mycoparasite on

infective juveniles of M. graminicola thereby reducing the root penetration capacity of the nematode. This is

supported by reports where the authors showed that several fungi mycoparasitize on plant-parasitic nematodes

along with trapping and feeding on nematodes (Persson & Bååth, 1992; Persmark et al., 1996; Bordallo et al.,

2002; Jansson & Lopez-Llorca, 2004). Alternatively, P. arrhenomanes infected plants might secrete some

allelochemicals which in turn repel (disrupt the host finding ability of the infective juveniles of M. graminicola)

and induce mortality of the J2 of M. graminicola, a hypothesis which is supported by previous reports (Sikora,

1992; Halbrendt, 1996) where the authors showed that plants secreted allelochemicals that had detrimental effects

on plant-parasitic nematodes. In line with this, our results of attraction test also demonstrated that the root

exudates of P. arrhenomanes infected plants repel the J2s of M. graminicola. It was also assumed that P.

arrhenomanes induce the necrotic lesions in the root system and as a result the infective juveniles of M.

graminicola might not find the roots suitable for gall formation (since it is obligate biotrophic pathogen, it will

select living tissue to make its feeding site) which is supported by the previous reports (Jones et al., 2013).

Another hypothesis is that P. arrhenomanes might prevent root-knot nematode infection by inducing JA signaling

in the root. Van Buyten, (2013) reported that Pythium spp. activate JA biosynthesis and signaling pathways, and

in addition, Nahar et al., (2011) and Kyndt et al., (2014) reported that activation of JA signaling suppresses M.

graminicola infection. This root immunity might resulted in reduced root branching, root length and root biomass

which might prevent and lower the nematode penetration and gall formation. Pieterse et al., (2009) and Huot et

al., (2014) reported that tradeoff between immunity and plant growth exist which is mediated by crosstalk

between defense hormone and growth hormone. The antagonistic interactions observed in our experiment are

contradictory with the findings of Sikder, (2015) who found synergism in terms of gall formation per root system

in Nipponbare and no interaction in terms of gall formation and number of nematodes per root system in IR81413-

BB-75-4. However, Sikder (2015) was not able to detect P. arrhenomanes in rice roots, showing that P.

arrhenomanes probably did not effectively colonize the rice roots, and subsequently could not antagonize M.

graminicola. In contrast to the experiments of Sikder (2015), we advanced the inoculation time of P.

arrhenomanes from 9 to 5 days after germination, after which we were able to observe root necrosis, and could

detect P. arrhenomanes DNA in the roots. Hence we showed that if P. arrhenomanes can colonize rice roots, it

25

antagonizes M. graminicola. In this experiment, Nipponbare was heavily infected with P. arrhenomanes (distinct

root necrosis) and M. graminicola, hence this cultivar seems to be highly susceptible for both pathogens. In

contrast to Nipponbare, the infection pressure of M. graminicola (observed by number of gall) and P.

arrhenomanes (observed by root necrosis) was lower in IR81413-BB-75-4. Nipponbare had already been

reported to be a susceptible rice cultivar to M. graminicola (Nahar et al., 2011; Kyndt et al., 2012b; Nahar et al.,

2012; Kyndt et al., 2014; Sikder, 2015) and P. arrhenomanes (Van Buyten & Höfte, 2013). The result of the

present study showed that P. arrhenomanes significantly delayed the development of M. graminicola in rice

cultivar Nipponbare (Figure 3. E). This result is consistent with the recent findings of Verbeek et al., (2016). It

was hypothesized that P. arrhenomanes antagonized nematode development because of the insufficient nutrients

(disruption of vascular bundles caused by root necrosis) along with competition for existing nutrients between

these two pathogens. Nutrient deficiency in the root system, as observed by the significant reduction of root fresh

weight and seedling length, was indeed confirmed in our results (Appendix Figure 1). In contrast to Nipponbare,

P. arrhenomanes did not antagonize nematode development in IR81413-BB-75-4 (Figure 3. F). We observed

that nematode infection in the rice cultivar IR81413-BB-75-4 was lower compared to Nipponbare, and as a result

of a lower infection pressure sufficient nutrients probably exist in the root system, so P. arrhenomanes did not

compete for nutrients with M. graminicola, consequently the development of nematodes was not affected in the

root of IR81413-BB-75-4. It also might be that IR81413-BB-75-4 is less susceptible to P. arrhenomanes

compared to Nipponbare, which in turn might result in a lower effect on the development of M. graminicola. It

has been reported that nutrient contents of the plants as well as types of plants (resistant or susceptible) govern

the development of root-knot nematode inside the plants (Oteifa, 1953; Bird, 1974; Roberts, 1992).

Auxin regulates growth, development and defense responses of plants (roots), thereby influencing the plant-

pathogen interaction (Park et al., 2007; Kazan & Manners, 2009). To know the role of auxin in the interaction, a

transgenic rice line overexpressing GH3.1, which was described to contain less free auxin compared to wild type

Bomba (Domingo et al., 2009), were used in the experiment. It was showed that, lower auxin levels in GH3.1OX

significantly decreased the total no. of nematodes (hence assumed nematode attraction and penetration) and

subsequent gall formation per root system compared to Bomba both in the single and double infected plants,

suggesting that lower auxin level antagonize M. graminicola in terms of nematode establishment (attraction,

penetration and gall formation)(Figure 4. A, B). We also found that 100 µM NAA solution attracts the J2 of M.

graminicola significantly. Feng et al., (2014) reported that 100 µM IAA solution facilitated the attraction,

migration and aggregation of Aphelenchoides besseyi in the pluronic F-127 gel medium. We observed that a cell

free culture filtrate of P. arrhenomanes did attract the J2 of M. graminicola..Van Buyten, (2013) reported that

Pythium spp. produced auxin in vitro, so it is tempting to assume that P. arrhenomanes produced auxin might

cause attraction of the nematode. In contrast, root tips of P. arrhenomanes infected plants and root tips of

GH3.1OX and 100 µM NAA treated plants did not show any significant impact on nematode attraction. Together

these results of attraction test suggest that, the types of treatments (hormone solution, root tip of hormone treated

plants, metabolites of P. arrhenomanes and root tip of P. arrhenomanes infected plants) regulate the outcome of

attraction test in our system. Hutangura et al., (1999) described that auxin is required as a trigger for giant cell

initiation. In line with this, recently it was reported that auxin is required for the initiation and expansion of giant

cell induced by root-knot nematodes (Kyndt et al., 2016). It was also observed that lower endogenous auxin level

could not reduce gall formation significantly in presence of P. arrhenomanes (Figure 4. B) suggesting that the

antagonistic role of lower endogenous auxin level on gall formation is slightly modulated by P. arrhenomanes.

However, in GH3.1OX, the development of nematodes inside root was significantly promoted compared to

Bomba both in single and double infected plants (Figure 4. C). We hypothesize that this is due to the availability

of sufficient nutrients inside roots, because of the three times lower number of nematodes in GH3.1OX (53.87)

compared to Bomba (170.67). P. arrhenomanes infection in the line with lower auxin is still able to antagonize

M. graminicola infection. This was mainly seen in the number of nematodes (Figure 4. A), the effect was not

significant for gall number although the trend was still observed (Figure 4. B). It was assumed that the ability of

P. arrhenomanes to retards gall formation is high in presence of high amount of auxin (Bomba) and the ability

26

of P. arrhenomanes to retards gall formation is low in presence of low amount of auxin (GH3.10X). It was also

assumed that high amount of P. arrhenomanes DNA (although not significant) in the double infected plants of

GH3.1OX compared to double infected plants of Bomba (Figure 5) might add some additional auxin which in

turn might promote the gall formation in GH3.OX and consequently antagonism was less clear. We also observed

that P. arrhenomanes significantly promoted nematode development in Bomba but it had no significant impact

on nematode development in GH3.1OX (Figure 4. C). It is hypothesize that this is due to the availability of

sufficient nutrients inside roots, because of the lower number of nematodes in double infected plant (86,75)

compared to compare to single infected plants of Bomba (170.67). On the other hand the average no. of nematodes

in the double infected plants of GH3.1OX is 30,63 and average no. of nematodes in single infected plants of

GH3.1OX is 53.87, so the competition for nutrients does not seem to be high , consequently the development of

nematodes might not be affected by P. arrhenomanes in GH3.1OX.

However, foliar application of 100 µM NAA did not increase number of nematodes, gall formation rather it

slightly decreased (not significant) number of nematodes and gall formation both in the single and double infected

plants compared to control plants (no NAA treatment) (Figure 6. A, B). Foliar application of NAA did not show

any significant impact on nematode development (Figure 6. C). These results suggest that NAA treatment slightly

antagonized M. graminicola both in the single and double infected plants. It was reported before that exogenous

application of lower concentrations of auxin facilitates root elongation, in contrast, higher concentrations are

detrimental to growth suggesting that small changes in the concentration of hormone can completely change

growth and subsequently defense responses of plants (Hardtke et al., 2007). On the other hand, P. arrhenomanes

slightly reduced (not significant) nematode penetration, gall formation both in control plants and NAA treated

plants suggesting that the antagonistic roles of P. arrhenomanes on M. graminicola are not modulated by NAA

treatment (Figure 6. A, B). The results of this experiment also suggesting that P. arrhenomanes antagonized M.

graminicola in terms of nematode establishment. However, P. arrhenomanes did not show any significant impact

on nematode development both in the control and NAA treated experiments (Figure 6. C). It might be because of

the lack of differences in nutrient contents between single infected plants and double infected plants.

The finding of the present experiments also indicated that M. graminicola slightly (not significant) retarded in-

planta growth of P. arrhenomanes within the root system of Bomba (Figure 5). It was hypothesized that, M.

graminicola might do so by competing with P. arrhenomanes for nutrients. To our knowledge this is the first

report to show the role of M. graminicola and auxin on the in planta growth of P. arrhenomanes, the underlying

mechanism is still not clear, so several individual replications might be useful to draw concluding remarks.

In this experiment, exogenous application of MeJA slightly increased the number of nematodes and gall

formation compared to control plants. In addition, JA biosynthesis inhibitor and JA biosynthesis/signaling

mutant/transgenic lines significantly decreased number of nematodes and slightly decreased subsequent gall

formation per root system compared to control plants (Nipponbare) (Figure 7. A. B). Exogenous application of

MeJA, JA biosynthesis inhibitor and JA signaling RNAi line did not have significant impact on nematode

development compared to control plants (Figure 7. C). These results indicated that JA favors nematode

penetration and gall formation, which contradicts previous studies (Nahar et al., 2011; Kyndt et al., 2012a; Kyndt

et al., 2012b; Kyndt et al., 2014; Sikder, 2015) where the authors described that JA antagonizes root-knot

nematode infection. The result of this experiment is also contradictory with our attraction test where root exudates

+ root tips of MeJA treated plants repelled nematodes significantly suggesting that JA will reduce infection of

M. graminicola. In contrast, 100 µM JA solution and root tip alone of Hebiba and 100 µM DIECA (JA

biosynthesis inhibitor) treated plant did not show any significant role in attraction of nematodes. It is not clear

why JA increased nematode infection in our double infection experiment. It should be mentioned that, 16 days

old seedlings were inoculated with M. graminicola in case of Nahar et al., (2011) experiments, but we used 9

days old seedlings in our experiments. This change in timing of nematode inoculation and hormone application

might result in complete reverse effects. It was reported that concentration, timing and amount of solution might

have an impact on the JA homeostasis (Hause et al., 2007), and as a result might have an impact on nematode

27

infection. Our result also showed that the roles of JA biosynthesis and signaling on number of nematodes and

gall formation are slightly lost in presence of P. arrhenomanes (Figure 7. A, B) It was hypothesized that, P.

arrhenomanes might convert the active form of JA and subsequently induce root susceptibility to M. graminicola.

Patkar et al., (2015) reported that antibiotic biosynthesis monooxygenase (abm) enzyme of the fungus Pyricularia

oryzae mediated the conversion of JA to 12OH-JA which in turn reduced the innate immunity of rice. Together

these results suggest that the role of JA on M. graminicola is modulated by P. arrhenomanes. Our results show

that P. arrhenomanes slightly antagonized M. graminicola in control plants (Nipponbare) but the ability of P.

arrhenomanes to antagonize M. graminicola is lost in different JA-deficient lines and also in MeJA and DIECA

treated plants (Figure 7. A, B) suggesting that the antagonism of P. arrhenomanes versus M. graminicola is

modulated by JA.

The Phenylalanine Ammonia Lyase (PAL) mediated phenylpropanoid pathway (Bate et al., 1994) provides

benzoic acid, the immediate precursor of SA (Mur et al., 2000). In our experiment, foliar application of a specific

inhibitor of PAL activity, alpha-aminooxy-beta-phenylpropionic acid (AOPP) slightly reduced nematode

penetration, gall formation and slightly delayed development of nematodes in rice roots compared to control

plants (no AOPP) (Figure 8. A, B, C) suggesting that SA inhibitor slightly antagonized nematode infection which

is contradictory with previous reports from our research group (Nahar et al., 2011; Kyndt et al., 2014; Huang et

al., 2015; Ji et al., 2015b) where the authors reported that activation of salicylic acid (SA) biosynthesis and

signaling pathways reduced the infection of root-knot nematode and AOPP slightly enhanced nematode infection.

The reason why this contradiction was observed might be because of the low concentration (100 µM) of AOPP

we used and incapability of AOPP alone to block PAL activity. Massala et al., (1987) reported that 250 μM

AOPP served as the potential inhibitor of PAL, in addition Dorey et al., (1997) reported that AOPP alone could

not block PAL activity but AOPP along with glycoprotein clearly reduced SA accumulation in plants. On the

other hand, the reason why activation of SA biosynthesis and signaling pathway reduced pathogen infection

might be because of the induction of systemic acquired resistance, production of H2O2 and subsequent defense

response (Shirasu et al., 1997). On the other hand, in presence of P. arrhenomanes, AOPP slightly increased the

number of nematodes and gall formation per root system compared to control plants (no AOPP) ( Figure 8. A,

B) suggesting that the role of PAL inhibitor on root-knot nematode infection is modulated by P. arrhenomanes.

P. arrhenomanes slightly antagonized M. graminicola in the control plants (Nipponbare) but in response to

application of SA inhibitor, the ability of P. arrhenomanes to antagonize M. graminicola in terms of number of

nematodes and gall formation per root system was lost compared to double infected control plants (no AOPP)

(Figure 8. A, B) indicating that PAL inhibitor has an influence on the interaction between P. arrhenomanes and

M. graminicola. It was reported that Pythium inoculation suppresses the SA biosynthesis and signaling pathway

(Van Buyten, 2013) resulting in low SA concentrations in plants. In addition, the PAL inhibitor also blocks SA

mediated defense, even in the presence of low concentrations of SA (Dempsey et al., 1999), consequently

nematode infection is increased in the AOPP treated double infected plants and as a result the antagonism was

lost.

In this experiment, foliar application of 50 µM abamine, an abscisic acid (ABA) biosynthesis inhibitor, slightly

reduced nematode penetration and delayed nematode development compared to control plants (no abamine)

(Figure 9. A, C) suggesting that the ABA inhibitor slightly reduces the infection of M. graminicola. Nahar et al.,

(2012) reported that exogenous application of ABA favors the infection of Hirschmanniella oryzae. In contrast,

Karimi et al., (1995) reported that exogenous application of ABA promoted the induction of proteinase inhibitor

II and subsequently delayed the development of root-knot nematode. Ji et al., (2015a) reported that exogenous

application of ABA significantly upregulated three thionin genes encoding antimicrobial peptides and over

expression of these genes reduced M. graminicola infection. In contrast to single infection by M. graminicola, in

presence of P. arrhenomanes, abamine slightly increased nematode number, gall formation and nematode

development plants compared to control plants (Figure 9. A, B, C) suggesting that the role of ABA inhibitor on

M. graminicola infection is modulated by P. arrhenomanes. P. arrhenomanes slightly antagonized nematode

number and gall formation per root system in Nipponbare but the ability of P. arrhenomanes to antagonize M.

28

graminicola was lost rather it slightly promoted nematode infection in response to foliar application of ABA

inhibitor, so the antagonism between both pathogens was lost. (Figure 9. A, B, C) indicating that the role of P.

arrhenomanes on M. graminicola infection is modulated by ABA inhibitor. It was hypothesized that P.

arrhenomanes might produce abscisic acid themselves and induce ABA signaling and might utilize ABA-

SA/JA/ET antagonistic cross-talk and subsequently induce root susceptibility to M. graminicola in the double

infected plants. This hypothesis is supported by the previous reports where the authors showed that plant

pathogens produce abscisic acid, induce ABA signaling, subsequently utilize ABA- SA/JA/ET antagonistic

cross-talk and finally render root susceptibility (Dörffling et al., 1984).

The roles of NAA treatment, JA, SA inhibitor and ABA inhibitor in the interaction between P. arrhenomanes

and M. graminicola do not always confirm previous results. Several hypotheses were assumed: in this study we

only made use of hormone inhibitors of SA and ABA, however the role of hormonal pathway in the interaction

between P. arrhenomanes and M. graminicola cannot be confirmed without the use of mutant lines in knock-out

or overexpressing of particular genes involved in hormone biosynthesis and signaling pathways and exogenous

application of optimized concentration of that particular hormone as well as its inhibitor. It should also be

mentioned that, the role of phytohormones on plant-microbes interaction depends on the methods of application,

timing of application and concentration of the solution used (Hause et al., 2007). Cross-talks among major plant

hormones involved in plant growth and defense regulate the outcome of plant-pathogen interaction (Lee et al.,

2001; Swarup et al., 2002; Gazzarrini & MCCOURT, 2003; Li et al., 2004; Mei et al., 2006; Qiu et al., 2007;

Qiu et al., 2009; Depuydt & Hardtke, 2011; Tamaoki et al., 2013; Van Buyten, 2013; Kyndt et al., 2014; Thole

et al., 2014), these need to be kept in mind in elucidating the role of phytohormones in plant-pathogen interaction.

Careful examination of phytohormones derived from pathogen (Arshad & Frankenberger, 1997; Baca &

Elmerich, 2007; Spaepen et al., 2007), here from P. arrhenomanes and M. graminicola and the role of these

pathogen derived phytohormones in the plant-pathogen interaction (Patkar et al., 2015) here from P.

arrhenomanes and M. graminicola also need to be examined.

A novel method for attraction tests, along with the mathematical model for data processing and subsequent

analysis was developed in the lab. It was demonstrated that 2M NaCl solution repels the J2 of M. graminicola

significantly, which is consistent with the results of Dalzell et al., (2011) suggesting that our method is working.

Several attraction tests were done using excised root tip but the nematodes did not respond to root tips alone. In

contrast to only root tip, root exudates together with the root tip of Oryza glabberrima and MeJA treated plants

did repel J2 of M. graminicola significantly, suggesting that resistant plant and JA signaling has an impact in the

repulsion of nematodes. This result also indicates that root exudates should be used along with root tip in our

method of attraction test. Our results also showed that root exudates of ethephon treated plants significantly

repelled the J2 of M. graminicola which is consistent with the reports of Fudali et al., (2013) where the author

showed that ethylene played a role in the repulsion of Meloidogyne hapla. However, our results of attraction test

with root exudates of ethephon treated plants contradicts the reports of Kammerhofer et al., (2015) and Wubben

et al., (2001) where the authors showed that ethylene favour the attraction of cyst nematode - Heterodera

schachtii. The reason(s) why root exudates of ethephon treated plants repel nematodes might be because of the

presence of several secondary metabolites and toxins in the root exudates which in turn repel nematodes. It was

reported that ethephon and ethylene induce the production of secondary metabolites, specially alkaloid production

(Cho et al., 1988). Root exudates play an important role in the attraction of plant-parasitic nematodes thus in

rhizosphere interaction (Bird, 1959; Rovira, 1969; Grundler et al., 1991; Bais et al., 2006). The infective stage

of plant-parasitic nematodes can sense and distinguish surrounding physical, chemical and biological stimuli with

the help of sensory perception organs like amphids, phasmids, and cuticle (Jones, 2002; Robinson, 2002).

Similarly infective juveniles can distinguish attractants and repellents in the soil and in the rhizosphere and help

themselves to orientate towards hosts in case of attractants or away from the host in case of repellents (Zuckerman

& Jansson, 1984).

29

5. Future Works

To explore the underlying mechanisms of antagonism, in depth morphological, histological, biochemical

and molecular analyses are to be carried out in P. arrhenomanes-Oryza sativa-M. graminicola interaction

experiment.

To elucidate the role of P. arrhenomanes on M. graminicola infection, composition and concentration of

culture filtrates of P. arrhenomanes and root exudates of P. arrhenomanes infected plants should be

examined by means of HPLC and mass spectrometry.

To find out the agents responsible for nematode attraction and repulsion present in the root exudates,

composition and concentrations of root exudates of different rice cultivars used for double infection

experiments and attraction tests are to be examined.

To confirm the role of phytohormones in the interaction between P. arrhenomanes and M. graminicola

on rice roots, exogenous application of hormones and its biosynthesis and signaling inhibitors, use of

mutant and transgenic lines (RNAi, T-DNA insertion mutant, knock-out and over-expression) of a

particular gene involved in hormone biosynthesis and signaling are to be used.

To explore the roles of pathogen derived phytohormones, and their interaction with plant-derived

phytohormones in the interaction experiments between P. arrhenomanes and M. graminicola,

composition and concentration of major growth and defense hormones are to be examined in the culture

filtrates of P. arrhenomanes and M. graminicola and also in rice cultivars used for double infection

experiments (before and after application of hormones as well as inhibitors, before and after inoculation

of pathogens).

6. Conclusions Based on the findings of this thesis, we can conclude that, P. arrhenomanes antagonizes M. graminicola in the

rice cultivars Nipponbare and IR81413-BB-75-4, in the SAP system adapted for double infection experiments in

our laboratory. Our results of the double infection experiment also demonstrated that lower endogenous auxin

level significantly reduces the nematode number and gall formation per root system. In line of this, our result of

attraction tests with 100 µM NAA solution supported that auxin favors the attraction of nematodes significantly.

Our results also indicate that P. arrhenomanes might complement the endogenous auxin level in the roots and

thus might promote gall formation therein. The results of this study indicate that JA promotes nematode

penetration and gall formation in absence P. arrhenomanes, but JA slightly reduces nematode penetration and

gall formation in presence of P. arrhenomanes. Our double infection experiment with a PAL inhibitor (resulting

in lower SA biosynthesis and lignin production) indicated that application of this inhibitor slightly blocks M.

graminicola infection in absence of P. arrhenomanes, but slightly increases M. graminicola infection in presence

of P. arrhenomanes. Based on our double infection experiment the ABA inhibitor slightly reduces M.

graminicola infection in absence of P. arrhenomanes, but the ABA inhibitor slightly increases nematode

infection in presence of P. arrhenomanes. Our results of several double infection experiments demonstrated that

the role of lower endogenous auxin level (only in gall formation), jasmonic acid biosynthesis and signaling, SA

inhibitor and ABA inhibitor on M. graminicola infection are modulated slightly by P. arrhenomanes. In addition,

the negative influence of P. arrhenomanes on M. graminicola infection is also regulated slightly by lower

endogenous auxin level (only gall formation), jasmonic level and signaling, salicylic acid biosynthesis and

abscisic acid biosynthesis. Based on qPCR-based P. arrhenomanes quantification, it can be said that M.

graminicola, and auxin levels have no significant impact on in-planta growth of P. arrhenomanes. A novel

method for in-vitro host finding assay of M. graminicola, along with mathematical model for data processing and

subsequent analysis were developed in this thesis. Our result of the attraction test also demonstrated that root

exudates of ethephon treated plants, root exudates of P. arrhenomanes infected plants (not significant), root tips

and root exudates of Oryza glabberrima and MeJA treated plants significantly repel the J2s of M. graminicola

whereas NAA solution and metabolites of P. arrhenomanes attract J2s of M. graminicola.

30

7. Acknowledgements

Ruben Verbeek (PhD student at the Department of Molecular Biotechnology, Ghent University, Belgium), my

thesis supervisor and Dr. Tina Kyndt (Professor of Epigenetics and Defence, Department of Molecular

Biotechnology, Ghent University, Belgium), my thesis promoter; you two peoples continuously taught and

assisted me a lot on how to plan and execute thesis works as well as write a thesis paper over the last 12 months.

I learned many aspects of higher research from both of you, I thank you so much and express my heartfelt

gratitude to both of you. Constructive criticisms, comments and direction for further improvement for thesis

writings from my jury members Professor Dr. Godelieve Gheysen, Department of Molecular Biotechnology and

Professor Dr. Monica Höfte, Department of Crop Protection, Faculty of Bioscience Engineering, Ghent

University, Belgium helped me a lot to improve the quality of thesis writings, I express my sincere gratitude to

both of you. I express my gratitude to the laboratory technicians Lien De Smet and Isabel Verbeke for their nice

cooperation during my thesis works. The supports and suggestions of Zobaida Lahari, Henok Zemene, Diana

Naalden, Mohammad Reza Atighi, and Richard Singh (PhD students of the Department of Molecular

Biotechnology, Ghent University, Belgium) were really great, I thank you all. I also express my gratitude to the

lab members of Molecular Phytopathology, Department of Crop Protection, Ghent University, Belgium. I learned

a lot from all the teachers of the Postgraduate International Nematology Course (PINC), Ghent University

Belgium, you peoples worked a lot to make my dream true for higher education and research, I am grateful to

you all. I specially acknowledge the scholastic supports of Professor Dr. Wilfrida Decraemer, Department of

Biology, Ghent University, Belgium. The cooperation of Inge Dehennin (Co-ordinator of PINC) from the very

first day of application for scholarship to the last day here in Ghent University, Belgium was really great, I thank

you very much and express my gratitude. Co-operation of Emmanuelle De Bock (Acting Co-ordinator of Agro

and Environmental Nematology Course) is also appreciated. The last but not the least, VLIR-UOS, the funding

agency, my dream for higher education would not come to true without the financial supports, I thank the

authority very much and also express my heartfelt gratitude.

8. References

Albrecht, C., Boutrot, F., Segonzac, C., Schwessinger, B., Gimenez-Ibanez, S., Chinchilla, D., Rathjen, J. P., De

Vries, S. C. & Zipfel, C. (2012). Brassinosteroids inhibit pathogen-associated molecular pattern–

triggered immune signaling independent of the receptor kinase BAK1. Proceedings of the National

Academy of Sciences 109, 303-308.

Arshad, M. & Frankenberger, W. T. (1997). Plant growth-regulating substances in the rhizosphere: microbial

production and functions. Advances in agronomy 62, 45-151.

Baca, B. & Elmerich, C. (2007). Microbial production of plant hormones. Associative and endophytic nitrogen-

fixing bacteria and cyanobacterial associations. Springer, pp. 113-143.

Bais, H. P., Weir, T. L., Perry, L. G., Gilroy, S. & Vivanco, J. M. (2006). The role of root exudates in rhizosphere

interactions with plants and other organisms. Annu. Rev. Plant Biol. 57, 233-266.

Bate, N. J., Orr, J., Ni, W., Meromi, A., Nadler-Hassar, T., Doerner, P. W., Dixon, R. A., Lamb, C. J. & Elkind,

Y. (1994). Quantitative relationship between phenylalanine ammonia-lyase levels and phenylpropanoid

accumulation in transgenic tobacco identifies a rate-determining step in natural product synthesis.

Proceedings of the National Academy of Sciences 91, 7608-7612.

Bimpong, I. K., Carpena, A. L., Mendioro, M. S., Fernandez, L., Ramos, J., Reversat, G. & Brar, D. S. (2010).

Evaluation of Oryza sativa x O. glaberrima derived progenies for resistance to rootknot nematode and

identification of introgressed alien chromosome segments using SSR markers. African Journal of

Biotechnology 9, 3988-3997.

Bird, A. F. (1959). The attractiveness of roots to the plant parasitic nematodes Meloidogyne javanica and M.

hapla. Nematologica 4, 322-335.

Bird, A. F. (1974). Plant response to root-knot nematode. Annual review of phytopathology 12, 69-85.

31

Bordallo, J., Lopez‐Llorca, L., Jansson, H. B., Salinas, J., Persmark, L. & Asensio, L. (2002). Colonization of

plant roots by egg‐parasitic and nematode‐trapping fungi. New Phytologist 154, 491-499.

Bouman, B., Humphreys, E., Tuong, T. & Barker, R. (2007). Rice and water. Advances in agronomy 92, 187-

237.

Bridge, J., Plowright, R. A. & Peng, D. (2005). 4 Nematode Parasites of Rice. Plant parasitic nematodes in

subtropical and tropical agriculture, 87.

Brouwer, M., Lievens, B., Van Hemelrijck, W., Van Den Ackerveken, G., Cammue, B. P. & Thomma, B. P.

(2003). Quantification of disease progression of several microbial pathogens on Arabidopsis thaliana

using real-time fluorescence PCR. FEMS Microbiology Letters 228, 241-248.

Chen, P.-N., Kuo, W.-H., Chiang, C.-L., Chiou, H.-L., Hsieh, Y.-S. & Chu, S.-C. (2006). Black rice anthocyanins

inhibit cancer cells invasion via repressions of MMPs and u-PA expression. Chemico-biological

interactions 163, 218-229.

Cho, G., Kim, D., Pedersen, H. & Chin, C. K. (1988). Ethephon enhancement of secondary metabolite synthesis

in plant cell cultures. Biotechnology progress 4, 184-188.

Cother, E. & Gilbert, R. (1993). Comparative pathogenicity of Pythium species associated with poor seedling

establishment of rice in Southern Australia. Plant Pathology 42, 151-157.

Curtis, R. H., Robinson, A. F. & Perry, R. N. (2009). 6 Hatch and Host Location. Root-knot nematodes, 139.

Dalzell, J. J., Kerr, R., Corbett, M. D., Fleming, C. C. & Maule, A. G. (2011). Novel bioassays to examine the

host-finding ability of plant-parasitic nematodes. Nematology 13, 211-220.

De Vleesschauwer, D., Gheysen, G. & Höfte, M. (2013). Hormone defense networking in rice: tales from a

different world. Trends in plant science 18, 555-565.

De Vleesschauwer, D., Van Buyten, E., Satoh, K., Balidion, J., Mauleon, R., Choi, I.-R., Vera-Cruz, C., Kikuchi,

S. & Höfte, M. (2012). Brassinosteroids antagonize gibberellin-and salicylate-mediated root immunity

in rice. Plant physiology 158, 1833-1846.

Dempsey, D. M. A., Shah, J. & Klessig, D. F. (1999). Salicylic acid and disease resistance in plants. Critical

Reviews in Plant Sciences 18, 547-575.

Depuydt, S. & Hardtke, C. S. (2011). Hormone signalling crosstalk in plant growth regulation. Current Biology

21, R365-R373.

Doares, S. H., Syrovets, T., Weiler, E. W. & Ryan, C. A. (1995). Oligogalacturonides and chitosan activate plant

defensive genes through the octadecanoid pathway. Proceedings of the National Academy of Sciences

92, 4095-4098.

Domingo, C., Andrés, F., Tharreau, D., Iglesias, D. J. & Talón, M. (2009). Constitutive expression of OsGH3. 1

reduces auxin content and enhances defense response and resistance to a fungal pathogen in rice.

Molecular plant-microbe interactions 22, 201-210.

Dorey, S., Baillieul, F., Pierrel, M.-A., Saindrenan, P., Fritig, B. & Kauffmann, S. (1997). Spatial and temporal

induction of cell death, defense genes, and accumulation of salicylic acid in tobacco leaves reacting

hypersensitively to a fungal glycoprotein elicitor. Molecular plant-microbe interactions 10, 646-655.

Dörffling, K., Petersen, W., Sprecher, E., Urbasch, I. & Hanssen, H.-P. (1984). Abscisic acid in phytopathogenic

fungi of the genera Botrytis, Ceratocystis, Fusarium, and Rhizoctonia. Zeitschrift für Naturforschung C

39, 683-684.

Eberle, M., Rothrock, C. & Cartwright, R. (2007). Pythium species associated with rice stand establishment

problems in Arkansas. BR Wells Rice Research Studies, 57-63.

Feng, H., Shao, Y., Wei, L.-H., Gao, C.-Y. & Zhou, Y.-J. (2014). The white-tip nematode, Aphelenchoides

besseyi, exhibits an auxin-orientated behaviour affecting its migration and propagation. Nematology 16,

837-845.

Finkers-Tomczak, A., Koropacka, K., Goverse, A., Smant, G. & Bakker, E. Resistant plant responses to parasitic

nematodes. Co-evolution between Globodera rostochiensis and potato driving sequence diversity of NB-

LRR resistance loci and nematode suppressors of plant immunity, 17.

32

Fudali, S. L., Wang, C. & Williamson, V. M. (2013). Ethylene signaling pathway modulates attractiveness of

host roots to the root-knot nematode Meloidogyne hapla. Molecular plant-microbe interactions 26, 75-

86.

Gachon, C. & Saindrenan, P. (2004). Real-time PCR monitoring of fungal development in Arabidopsis thaliana

infected by Alternaria brassicicola and Botrytis cinerea. Plant Physiology and Biochemistry 42, 367-371.

Gazzarrini, S. & Mccourt, P. (2003). Cross‐talk in plant hormone signalling: what arabidopsis mutants are telling

us. Annals of botany 91, 605-612.

Griffin, G. & Thyr, B. (1988). Interaction of Meloidogyne hapla and Fusarium oxysporum f. sp. medicaginis on

alfalfa. Phytopathology 78, 421-425.

Grundler, F., Schnibbe, L. & Wyss, U. (1991). In vitro studies on the behaviour of second-stage juveniles of

Heterodera schachtii (Nematoda: Heteroderidae) in response to host plant root exudates. Parasitology

103, 149-155.

Halbrendt, J. (1996). Allelopathy in the management of plant-parasitic nematodes. Journal of Nematology 28, 8.

Hallmann, J. & Sikora, R. (1996). Toxicity of fungal endophyte secondary metabolites to plant parasitic

nematodes and soil-borne plant pathogenic fungi. European Journal of Plant Pathology 102, 155-162.

Hardtke, C. S., Dorcey, E., Osmont, K. S. & Sibout, R. (2007). Phytohormone collaboration: zooming in on

auxin–brassinosteroid interactions. Trends in cell biology 17, 485-492.

Hashem, M. & Abo-Elyousr, K. A. (2011). Management of the root-knot nematode Meloidogyne incognita on

tomato with combinations of different biocontrol organisms. Crop Protection 30, 285-292.

Hause, B., Mrosk, C., Isayenkov, S. & Strack, D. (2007). Jasmonates in arbuscular mycorrhizal interactions.

Phytochemistry 68, 101-110.

Hooper, D. J., Hallmann, J. & Subbotin, S. A. (2005). Methods for extraction, processing and detection of plant

and soil nematodes. Plant parasitic nematodes in subtropical and tropical agriculture 2, 53-86.

Hu, Y., Zhang, W., Zhang, P., Ruan, W. & Zhu, X. (2012). Nematicidal activity of chaetoglobosin A poduced by

Chaetomium globosum NK102 against Meloidogyne incognita. Journal of agricultural and food

chemistry 61, 41-46.

Huang, W. K., Ji, H. L., Gheysen, G. & Kyndt, T. (2015). Thiamine‐induced priming against root‐knot nematode

infection in rice involves lignification and hydrogen peroxide generation. Molecular plant pathology.

Huot, B., Yao, J., Montgomery, B. L. & He, S. Y. (2014). Growth–defense tradeoffs in plants: a balancing act to

optimize fitness. Molecular Plant 7, 1267-1287.

Hutangura, P., Mathesius, U., Jones, M. G. & Rolfe, B. G. (1999). Auxin induction is a trigger for root gall

formation caused by root-knot nematodes in white clover and is associated with the activation of the

flavonoid pathway. Functional Plant Biology 26, 221-231.

Itani, T. & Ogawa, M. (2004). History and recent trends of red rice in Japan. Japanese Journal of Crop Science

73, 137-147.

Jansson, H.-B. & Lopez-Llorca, L. V. (2004). Control of nematodes by fungi. Fungal biotechnology in

agricultural, food, and environmental applications, 205-215.

Jansson, H.-B. & Nordbring-Hertz, B. (1980). Interactions between nematophagous fungi and plant-parasitic

nematodes: attraction, induction of trap formation and capture. Nematologica 26, 383-389.

Ji, H., Gheysen, G., Denil, S., Lindsey, K., Topping, J. F., Nahar, K., Haegeman, A., De Vos, W. H., Trooskens,

G. & Van Criekinge, W. (2013). Transcriptional analysis through RNA sequencing of giant cells induced

by Meloidogyne graminicola in rice roots. Journal of Experimental Botany 64, 3885-3898.

Ji, H., Gheysen, G., Ullah, C., Verbeek, R., Shang, C., De Vleesschauwer, D., Höfte, M. & Kyndt, T. (2015a).

The role of thionins in rice defence against root pathogens. Molecular plant pathology 16, 870-881.

Ji, H., Kyndt, T., He, W., Vanholme, B. & Gheysen, G. (2015b). β-Aminobutyric Acid–Induced Resistance

Against Root-Knot Nematodes in Rice Is Based on Increased Basal Defense. Molecular plant-microbe

interactions 28, 519-533.

33

Johnson, A. W. & Littrell, R. H. (1970). Pathogenicity of Pythium aphanidermatum to chrysanthemum in

combined inoculations with Belonolaimus longicaudatus or Meloidogyne incognita. Journal of

Nematology 2, 255.

Jones, J. (2002). 14. Nematode Sense Organs. The Biology of Nematodes, 353.

Jones, J. T., Haegeman, A., Danchin, E. G., Gaur, H. S., Helder, J., Jones, M. G., Kikuchi, T., Manzanilla‐López,

R., Palomares‐Rius, J. E. & Wesemael, W. M. (2013). Top 10 plant‐parasitic nematodes in molecular

plant pathology. Molecular plant pathology 14, 946-961.

Kammerhofer, N., Radakovic, Z., Regis, J., Dobrev, P., Vankova, R., Grundler, F. M., Siddique, S., Hofmann, J.

& Wieczorek, K. (2015). Role of stress‐related hormones in plant defence during early infection of the

cyst nematode Heterodera schachtii in Arabidopsis. New Phytologist 207, 778-789.

Kamoun, S., Furzer, O., Jones, J. D., Judelson, H. S., Ali, G. S., Dalio, R. J., Roy, S. G., Schena, L., Zambounis,

A. & Panabières, F. (2015). The Top 10 oomycete pathogens in molecular plant pathology. Molecular

plant pathology 16, 413-434.

Karimi, M., Montagu, M. V. & Gheysen, G. (1995). Exogenous application of abscissic acid to potato plants

suppresses reproduction of Meloidogyne incognita. Mededelingen Faculteit Landbouwkundige en

Toegepaste Biologische Wetenschappen Universiteit Gent (Belgium).

Kazan, K. & Manners, J. M. (2009). Linking development to defense: auxin in plant–pathogen interactions.

Trends in plant science 14, 373-382.

Kennedy, G. & Burlingame, B. (2003). Analysis of food composition data on rice from a plant genetic resources

perspective. Food Chemistry 80, 589-596.

Kernaghan, G., Reeleder, R. & Hoke, S. (2008). Quantification of Pythium populations in ginseng soils by culture

dependent and real-time PCR methods. applied soil ecology 40, 447-455.

Kitahata, N., Han, S.-Y., Noji, N., Saito, T., Kobayashi, M., Nakano, T., Kuchitsu, K., Shinozaki, K., Yoshida,

S. & Matsumoto, S. (2006). A 9-cis-epoxycarotenoid dioxygenase inhibitor for use in the elucidation of

abscisic acid action mechanisms. Bioorganic & medicinal chemistry 14, 5555-5561.

Kreye, C., Bouman, B., Reversat, G., Fernandez, L., Cruz, C. V., Elazegui, F., Faronilo, J. & Llorca, L. (2009).

Biotic and abiotic causes of yield failure in tropical aerobic rice. Field crops research 112, 97-106.

Kyndt, T., Denil, S., Bauters, L., Van Criekinge, W. & De Meyer, T. (2014). Systemic Suppression of the Shoot

Metabolism upon Rice Root Nematode Infection. PloS one 9, e106858.

Kyndt, T., Denil, S., Haegeman, A., Trooskens, G., Bauters, L., Criekinge, W., Meyer, T. & Gheysen, G. (2012a).

Transcriptional reprogramming by root knot and migratory nematode infection in rice. New Phytologist

196, 887-900.

Kyndt, T., Goverse, A., Haegeman, A., Warmerdam, S., Wanjau, C., Jahani, M., Engler, G., De Almeida Engler,

J. & Gheysen, G. (2016). Redirection of auxin flow in Arabidopsis thaliana roots after infection by root-

knot nematodes. Journal of Experimental Botany 67, 4559-4570.

Kyndt, T., Nahar, K., Haegeman, A., De Vleesschauwer, D., Höfte, M. & Gheysen, G. (2012b). Comparing

systemic defence‐related gene expression changes upon migratory and sedentary nematode attack in rice.

Plant biology 14, 73-82.

Kyndt, T., Vieira, P., Gheysen, G. & De Almeida-Engler, J. (2013). Nematode feeding sites: unique organs in

plant roots. Planta 238, 807-818.

Lee, M.-W., Qi, M. & Yang, Y. (2001). A novel jasmonic acid-inducible rice myb gene associates with fungal

infection and host cell death. Molecular plant-microbe interactions 14, 527-535.

Li, J., Brader, G. & Palva, E. T. (2004). The WRKY70 transcription factor: a node of convergence for jasmonate-

mediated and salicylate-mediated signals in plant defense. The Plant Cell 16, 319-331.

Lievens, B., Brouwer, M., Vanachter, A. C., Cammue, B. P. & Thomma, B. P. (2006). Real-time PCR for

detection and quantification of fungal and oomycete tomato pathogens in plant and soil samples. Plant

Science 171, 155-165.

34

Lifshitz, R., Windham, M. & Baker, R. (1986). Mechanism of biological control of preemergence damping-off

of pea by seed treatment with Trichoderma spp. Phytopathology 76, 720-725.

Lozano-Durán, R. & Zipfel, C. (2015). Trade-off between growth and immunity: role of brassinosteroids. Trends

in plant science 20, 12-19.

Luc, M., Sikora, R. A. & Bridge, J. (2005). Plant parasitic nematodes in subtropical and tropical agriculture.

Cabi, pp.

Massala, R., Legrand, M. & Fritig, B. (1987). Comparative effects of two competitive inhibitors of phenylalanine

ammonialyase on the hypersensitive resistance of tobacco to tobacco mosaic virus. Plant Physiology and

Biochemistry 25, 217-225.

Mei, C., Qi, M., Sheng, G. & Yang, Y. (2006). Inducible overexpression of a rice allene oxide synthase gene

increases the endogenous jasmonic acid level, PR gene expression, and host resistance to fungal

infection. Molecular plant-microbe interactions 19, 1127-1137.

Mur, L. A., Brown, I. R., Darby, R. M., Bestwick, C. S., Bi, Y. M., Mansfield, J. W. & Draper, J. (2000). A loss

of resistance to avirulent bacterial pathogens in tobacco is associated with the attenuation of a salicylic

acid‐potentiated oxidative burst. The Plant Journal 23, 609-621.

Nahar, K., Kyndt, T., De Vleesschauwer, D., Höfte, M. & Gheysen, G. (2011). The jasmonate pathway is a key

player in systemically induced defense against root knot nematodes in rice. Plant physiology 157, 305-

316.

Nahar, K., Kyndt, T., Nzogela, Y. B. & Gheysen, G. (2012). Abscisic acid interacts antagonistically with classical

defense pathways in rice–migratory nematode interaction. New Phytologist 196, 901-913.

Nelson, E. B. (1991). Exudate molecules initiating fungal responses to seeds and roots. The rhizosphere and plant

growth. Springer, pp. 197-209.

Oteifa, B. A. (1953). Development of the root-knot nematode, Meloidogyne incognita, as affected by potassium

nutrition of the host. Phytopathology 43, 1-74.

Padgham, J., Duxbury, J., Mazid, A., Abawi, G. & Hossain, M. (2004). Yield loss caused by Meloidogyne

graminicola on lowland rainfed rice in Bangladesh. Journal of Nematology 36, 42.

Park, J.-E., Park, J.-Y., Kim, Y.-S., Staswick, P. E., Jeon, J., Yun, J., Kim, S.-Y., Kim, J., Lee, Y.-H. & Park, C.-

M. (2007). GH3-mediated auxin homeostasis links growth regulation with stress adaptation response in

Arabidopsis. Journal of Biological Chemistry 282, 10036-10046.

Patkar, R. N., Benke, P. I., Qu, Z., Chen, Y. Y. C., Yang, F., Swarup, S. & Naqvi, N. I. (2015). A fungal

monooxygenase-derived jasmonate attenuates host innate immunity. Nature chemical biology 11, 733-

740.

Paulitz, T. (1991). Effect ofPseudomonas putida on the stimulation of Pythium ultimum by seed volatiles of pea

and soybean. Phytopathology 81, 1282-1287.

Persmark, L., Banck, A. & Jansson, H.-B. (1996). Population dynamics of nematophagous fungi and nematodes

in an arable soil: vertical and seasonal fluctuations. Soil Biology and Biochemistry 28, 1005-1014.

Persson, Y. & Bååth, E. (1992). Quantification of mycoparasitism by the nematode-trapping fungus Arthrobotrys

oligospora on Rhizoctonia solani and the influence of nutrient levels. FEMS Microbiology Letters 101,

11-16.

Pieterse, C. M., Leon-Reyes, A., Van Der Ent, S. & Van Wees, S. C. (2009). Networking by small-molecule

hormones in plant immunity. Nature chemical biology 5, 308-316.

Plowright, R. & Bridge, J. (1990). Effect of Meloidogyne graminicola (Nematoda) on the establishment, growth

and yield of rice CV IR36. Nematologica 36, 81-89.

Pokharel, R. R., Abawi, G. S., Zhang, K., Duxbury, J. M. & Smart, C. D. (2007). Characterization of isolates of

meloidogyne from rice-wheat production fields in Nepal. Journal of Nematology 39, 221-230.

Porter, D. & Powell, N. (1967). Influence of certain Meloidogyne species on Fusarium wilt development in flue-

cured tobacco. Phytopathology 57, 282-285.

Project, I. R. G. S. (2005). The map-based sequence of the rice genome. Nature 436, 793-800.

35

Qiu, D., Xiao, J., Ding, X., Xiong, M., Cai, M., Cao, Y., Li, X., Xu, C. & Wang, S. (2007). OsWRKY13 mediates

rice disease resistance by regulating defense-related genes in salicylate-and jasmonate-dependent

signaling. Molecular plant-microbe interactions 20, 492-499.

Qiu, D., Xiao, J., Xie, W., Cheng, H., Li, X. & Wang, S. (2009). Exploring transcriptional signalling mediated

by OsWRKY13, a potential regulator of multiple physiological processes in rice. BMC plant biology 9,

1.

Riemann, M., Müller, A., Korte, A., Furuya, M., Weiler, E. W. & Nick, P. (2003). Impaired induction of the

jasmonate pathway in the rice mutant hebiba. Plant physiology 133, 1820-1830.

Riemann, M., Riemann, M. & Takano, M. (2008). Rice JASMONATE RESISTANT 1 is involved in

phytochrome and jasmonate signalling. Plant, cell & environment 31, 783-792.

Roberts, P. A. (1992). Current status of the availability, development, and use of host plant resistance to

nematodes. Journal of Nematology 24, 213.

Robinson, A. F. (2002). Impact on Plant-parasitic Nematode Host Finding and Recognition. The Behavioural

Ecology of Parasites, 89.

Rovira, A. D. (1969). Plant root exudates. The Botanical Review 35, 35-57.

Shirasu, K., Nakajima, H., Rajasekhar, V. K., Dixon, R. A. & Lamb, C. (1997). Salicylic acid potentiates an

agonist-dependent gain control that amplifies pathogen signals in the activation of defense mechanisms.

The Plant Cell 9, 261-270.

Sikder, M. M. (2015). The analysis of Pythium arrhenomanes-Meloidogyne graminicola infection on rice. Gent

University.

Sikora, R. A. (1992). Management of the antagonistic potential in agricultural ecosystems for the biological

control of plant parasitic nematodes. Annual review of phytopathology 30, 245-270.

Soriano, I. R., Prot, J.-C. & Matias, D. M. (2000). Expression of tolerance for Meloidogyne graminicola in rice

cultivars as affected by soil type and flooding. Journal of Nematology 32, 309.

Spaepen, S., Vanderleyden, J. & Remans, R. (2007). Indole-3-acetic acid in microbial and microorganism-plant

signaling. FEMS microbiology reviews 31, 425-448.

Stanghellini, M. & Hancock, J. (1971). The sporangium of Pythium ultimum as a survival structure in soil.

Phytopathology 61, 7-164.

Suzuki, M., Kimura, T., Yamagishi, K., Shinmoto, H. & Yamaki, K. (2004). Comparison of mineral contents in

8 cultivars of pigmented brown rice. Journal of the Japanese Society for Food Science and Technology

(Japan).

Swarup, R., Parry, G., Graham, N., Allen, T. & Bennett, M. (2002). Auxin cross-talk: integration of signalling

pathways to control plant development. Auxin Molecular Biology. Springer, pp. 411-426.

Tamaoki, D., Seo, S., Yamada, S., Kano, A., Miyamoto, A., Shishido, H., Miyoshi, S., Taniguchi, S., Akimitsu,

K. & Gomi, K. (2013). Jasmonic acid and salicylic acid activate a common defense system in rice. Plant

signaling & behavior 8, e24260.

Thole, J. M., Beisner, E. R., Liu, J., Venkova, S. V. & Strader, L. C. (2014). Abscisic acid regulates root

elongation through the activities of auxin and ethylene in Arabidopsis thaliana. G3: Genes| Genomes|

Genetics 4, 1259-1274.

Van Buyten, E. (2013). Pythium spp. affecting aerobic rice cultivation in the Philippines: characterization,

virulence strategies and plant defense. Ghent University.

Van Buyten, E. & Höfte, M. (2013). Pythium species from rice roots differ in virulence, host colonization and

nutritional profile. BMC plant biology 13, 1.

Verbeek, R., Banaay, C., Sikder, M., De Waele, D., Cruz, C. V., Gheysen, G., Höfte, M. & Kyndt, T. (2016).

Interactions between the oomycete Pythium arrhenomanes and the rice root-knot nematode Meloidogyne

graminicola in aerobic Asian rice varieties. Rice 9, 36.

Weis, K. G., Goren, R., Martin, G. C. & Webster, B. D. (1988). Leaf and inflorescence abscission in olive. I.

Regulation by ethylene and ethephon. Botanical Gazette, 391-397.

36

Wubben, M. J., Su, H., Rodermel, S. R. & Baum, T. J. (2001). Susceptibility to the sugar beet cyst nematode is

modulated by ethylene signal transduction in Arabidopsis thaliana. Molecular plant-microbe interactions

14, 1206-1212.

Yang, D.-L., Yao, J., Mei, C.-S., Tong, X.-H., Zeng, L.-J., Li, Q., Xiao, L.-T., Sun, T.-P., Li, J. & Deng, X.-W.

(2012). Plant hormone jasmonate prioritizes defense over growth by interfering with gibberellin signaling

cascade. Proceedings of the National Academy of Sciences 109, E1192-E1200.

Yawadio, R., Tanimori, S. & Morita, N. (2007). Identification of phenolic compounds isolated from pigmented

rices and their aldose reductase inhibitory activities. Food Chemistry 101, 1616-1625.

Zhang, Z., Zhang, J., Wang, Y. & Zheng, X. (2005). Molecular detection of Fusarium oxysporum f. sp. niveum

and Mycosphaerella melonis in infected plant tissues and soil. FEMS Microbiology Letters 249, 39-47.

Zuckerman, B. M. & Jansson, H. (1984). Nematode chemotaxis and possible mechanisms of host/prey

recognition. Annual review of phytopathology 22, 95-113.

37

9. Appendix

Figure 1. Role of P. arrhenomanes on root length (A) and shoot length (B) of

Nipponbare in the interaction experiment between P. arrhenomanes and M.

graminicola . Data were recorded 19 days after seedling transplanting in the SAP

system. Bars represent mean ± standard deviation with 12 replications. Different

letters indicate statistically significant difference between the treatments (P < 0.05).

Data on root length were analyzed by Independent Sample T – Test and data on shoot

length were analyzed by Mann Whitney U Non-Parametric Test.

0

5

10

15

20

25

30

M. graminicola P. arrhenomanes + M. graminicola

Ro

ot

len

gth

in

cm b

a

A

0

5

10

15

20

25

30

M. graminicola P. arrhenomanes + M. graminicola

Sh

oo

t le

ng

th i

n c

m

b a

B

38

Figure 2. Role of P. arrhenomanes on seedling length (C) and root fresh weight (D)

of Nipponbare in the interaction experiment between P. arrhenomanes and M.

graminicola. Data were recorded 19 days after seedling transplanting in the SAP

system. Bars represent mean ± standard deviation with 12 replications. Different

letters indicate statistically significant difference between the treatments (P < 0.05).

Data on sedling length were analyzed by Mann Whitney U Non-Parametric Test and

data on root fresh weight were analyzed by Independent Sample T – Test.

39

Figure 3. Role of P. arrhenomanes on root length (A) and shoot length (B) of

IR81413-BB-75-4 in the interaction experiment between P. arrhenomanes and M.

graminicola . Data were recorded 19 days after seedling transplanting in the SAP

system. Bars represent mean ± standard deviation with 17 replications. Different

letters indicate statistically significant difference between the treatments (P < 0.05).

Data on root length and shoot length were analyzed by Independent Sample T – Test.

0

5

10

15

20

25

M. graminicola P. arrhenomanes + M. graminicola

Ro

ot

len

gth

in

cm

a a

A

0

5

10

15

20

25

30

35

M. graminicola P. arrhenomanes + M. graminicola

Sh

oo

t le

ng

th i

n c

m

b

a

B

40

Figure 4. Role of P. arrhenomanes on seedling length (C) and root fresh weight (D)

of IR81413-BB-75-4 in the interaction experiment between P. arrhenomanes and

M. graminicola . Data were recorded 19 days after seedling transplanting in the SAP

system. Bars represent mean ± standard deviation with 17 replications. Different

letters indicate statistically significant difference between the treatments (P < 0.05).

Data on seeding length were analyzed by Independent Sample T – Test and data on

root fresh weight were analyzed by Mann Whitney U Non-Parametric Test.

0

10

20

30

40

50

M. graminicola P. arrhenomanes + M. graminicola

Seed

lin

g l

en

gth

in

cm

ba

C

0

50

100

150

200

250

M. graminicola P. arrhenomanes + M. graminicola

Roo

t fr

esh

weig

ht

in m

g

a

a

D

41

Figure 5. Role of auxin on the root length (A), shoot length (B), seedling length (C)

and root fresh weight (D) in the M. graminicola infected plants and P. arrhenomanes

+ M. graminicola infected plants. Data were recorded 19 days after seedling

transplanting in the SAP system. Bars represent mean ± standard deviation with 8

replications. Different letters indicate statistically significant difference between the

treatments (P < 0.05). Data on root length, shoot length and seedling length were

analyzed by Mann-Whitney U non-parametric test and data on root fresh weight were

Independent Sample T-Test.

42

Figure 6. Role of NAA treatment on the root length (A) and shoot length (B) in the

M. graminicola infected plants and P. arrhenomanes + M. graminicola infected

plants. Data were recorded 19 days after seedling transplanting in the SAP system.

Bars represent mean ± standard deviation with 10 replications. Different letters

indicate statistically significant difference between the treatments (P < 0.05). Data on

root length and shoot length were analyzed by Mann-Whitney U non-parametric test.

0

5

10

15

20

25

M. graminicola P. arrhenomanes + M. graminicola

Ro

ot

len

gth

in

cm

Nipponbare Nipponbare + 100 µM NAA

ab b ab a

A

0

10

20

30

40

50

M. graminicola P. arrhenomanes + M. graminicola

Sh

oo

t le

ngth

in

cm

Nipponbare Nipponbare + 100 µM NAA

ab abba

B

43

Figure 7. Role of NAA treatment on the seedling length (C) and root fresh weight

(D) in the M. graminicola infected plants and P. arrhenomanes + M. graminicola

infected plants. Data were recorded 19 days after seedling transplanting in the SAP

system. Bars represent mean ± standard deviation with 10 replications. Different

letters indicate statistically significant difference between the treatments (P < 0.05).

Data on seedling length and root fresh weight were analyzed by Mann-Whitney U

non-parametric test.

0

10

20

30

40

50

60

70

M. graminicola P. arrhenomanes + M. graminicola

See

dli

ng

len

gth

in

cm

Nipponbare Nipponbare + 100 µM NAA

ab aba

C

0

50

100

150

200

250

300

M. graminicola P. arrhenomanes + M. graminicola

Ro

ot

fres

h w

eigh

t in

mg

Nipponbare Nipponbare + 100 µM NAA

bb

a a

D

44

Figure 8. Role of jasmonic acid on the root length (A) and shoot length (B) in the M.

graminicola infected plants and P. arrhenomanes + M. graminicola infected plants.

Data were recorded 19 days after seedling transplanting in the SAP system. Bars

represent mean ± standard deviation with 10 replications. Different letters indicate

statistically significant difference between the treatments (P < 0.05). Data on root

length were analyzed by Mann-Whitney U non-parametric test and shoot length were

analyzed by one-way ANOVA (Duncan Multiple Range Test).

0

10

20

30

M. graminicola P. arrhenomanes + M. graminicola

Ro

ot

len

gth

in

cm

Nipponbare (control)

Nipponbare + DIECA (JA biosynthesis inhibitor)

Nipponbare + MeJA

COI1-18 (JA signaling transgenic RNAi)

NC2728 (JA biosynthesis mutant)

aba a

b b aab ab ab

A

0

20

40

60

M. graminicola P. arrhenomanes + M. graminicola

Sh

oo

t le

ng

th i

n c

m

Nipponbare (control)

Nipponbare + DIECA (JA biosynthesis inhibitor)

Nipponbare + MeJA

COI1-18 (JA signaling transgenic RNAi)

NC2728 (JA biosynthesis mutant)

a a abab abab ab

bb b

B

45

Figure 9. Role of jasmonic acid on the seedling length (C) and root fresh weight (D)

in the M. graminicola infected plants and P. arrhenomanes + M. graminicola infected

plants. Data were recorded 19 days after seedling transplanting in the SAP system.

Bars represent mean ± standard deviation with 10 replications. Different letters

indicate statistically significant difference between the treatments (P < 0.05). Data on

seedling length and root fresh weight were analyzed by Mann-Whitney U non-

parametric test.

0

20

40

60

80

M. graminicola P. arrhenomanes + M. graminicolaSee

dli

ng

len

gth

in

cm

Nipponbare (control)

Nipponbare + DIECA (JA biosynthesis inhibitor)

Nipponbare + MeJA

COI1-18 (JA signaling transgenic RNAi)

NC2728 (JA biosynthesis mutant)

abb

ab

aab

abC

0

50

100

150

200

250

300

M. graminicola P. arrhenomanes + M. graminicolaRo

ot

fres

h w

eigh

t in

mg

Nipponbare (control)

Nipponbare + DIECA (JA biosynthesis inhibitor)

Nipponbare + MeJA

COI1-18 (JA signaling transgenic RNAi)

NC2728 (JA biosynthesis mutant)

c

bcb b b

a ab b ab ab

D

46

Figure 10. Role of PAL inhibitor (AOPP) on the root length (A) and shoot length (B)

in the M. graminicola infected plants and P. arrhenomanes + M. graminicola infected

plants. Data were recorded 19 days after seedling transplanting in the SAP system.

Bars represent mean ± standard deviation with 10 replications. Different letters

indicate statistically significant difference between the treatments (P < 0.05). Data on

root length and shoot length were analyzed by Mann-Whitney U non-parametric test.

0

5

10

15

20

25

M. graminicola P. arrhenomanes + M. graminicola

Ro

ot

len

gth

in

cm

Nipponbare Nipponbare + 100 µM AOPP

a a a aA

0

10

20

30

40

50

M. graminicola P. arrhenomanes + M. graminicola

Sh

oo

t le

ng

th i

n c

m

Nipponbare Nipponbare + 100 µM AOPP

a a a a

B

47

Figure 11. Role of PAL inhibitor (AOPP) on the seedling length (C) and root fresh

weight (D) in the M. graminicola infected plants and P. arrhenomanes + M.

graminicola infected plants. Data were recorded 19 days after seedling transplanting

in the SAP system. Bars represent mean ± standard deviation with 10 replications.

Different letters indicate statistically significant difference between the treatments (P

< 0.05). Data on seedling length and root fresh weight were analyzed by Mann-

Whitney U non-parametric test.

0

10

20

30

40

50

60

70

M. graminicola P. arrhenomanes + M. graminicola

Seed

lin

g l

en

gth

in

cm

Nipponbare Nipponbare + 100 µM AOPP

a a a aC

0

50

100

150

200

250

300

M. graminicola P. arrhenomanes + M. graminicola

Ro

ot

fresh

weig

ht

in m

g

Nipponbare Nipponbare + 100 µM AOPP

b b

aa

D

48

Figure 12. Role of ABA inhibitor on the root length (A) and shoot length (B) in the

M. graminicola infected plants and P. arrhenomanes + M. graminicola infected

plants. Data were recorded 19 days after seedling transplanting in the SAP system.

Bars represent mean ± standard deviation with 10 replications. Different letters

indicate statistically significant difference between the treatments (P < 0.05). Data on

root length were analyzed by Mann-Whitney U non-parametric test and shoot length

were analyzed by Independent Sample T-Test.

0

5

10

15

20

25

M. graminicola P. arrhenomanes + M. graminicola

Ro

ot

len

gth

in

cm

Nipponbare Nipponbare + 50 µM Abamine

a a a aA

0

10

20

30

40

50

M. graminicola P. arrhenomanes + M. graminicola

Sh

oo

t le

ng

th i

n c

m

Nipponbare Nipponbare + 50 µM Abamine

aa

abb

B

49

Figure 13. Role of ABA inhibitor on the seedling length (C) and root fresh weight

(D) in the M. graminicola infected plants and P. arrhenomanes + M. graminicola

infected plants. Data were recorded 19 days after seedling transplanting in the SAP

system. Bars represent mean ± standard deviation with 10 replications. Different

letters indicate statistically significant difference between the treatments (P < 0.05).

Data on seedling length and root fresh weight were analyzed by Mann-Whitney U

non-parametric test.

0

10

20

30

40

50

60

70

M. graminicola P. arrhenomanes + M. graminicola

See

dli

ng

len

gth

in

cm

Nipponbare Nipponbare + 50 µM Abamine

abb

aa

C

0

50

100

150

200

250

300

M. graminicola P. arrhenomanes + M. graminicola

Ro

ot

fres

h w

eigh

t in

mg

Nipponbare Nipponbare + 50 µM Abamine

b

b

a a

D