Innate Differences in the Expression of Brain-Derived

Neurotrophic Factor in the Regions Within the Extended

Amygdala Between Alcohol Preferring and

Nonpreferring Rats

Anand Prakash, Huaibo Zhang, and Subhash C. Pandey

Background: Animal lines such as alcohol-preferring (P) and nonpreferring (NP) rats appear tobe suitable animal models to investigate the biological basis of alcohol-drinking behaviors. Theextended amygdala serves as a neuroanatomical substrate for alcohol-drinking behaviors. Brain-derived neurotrophic factor (BDNF) in the amygdala has been implicated in alcohol-drinkingbehaviors; however, its expression in the extended amygdala of P and NP rats is unknown. There-fore, we examined the basal expression of BDNF in the extended amygdala of alcohol naı̈ve Pand NP rats.

Methods: We determined the basal mRNA and protein levels of BDNF by in situ RT-PCRand immuno-histochemical procedure, respectively, in the amygdaloid [central nucleus of amyg-dala (CeA), medial nucleus of amygdala (MeA), and basolateral amygdala (BLA)], nucleusaccumbal (NAc shell and core), and bed nucleus of stria terminalis (BNST) [lateral BNST(lBNST), medial BNST (mBNST), and ventral BNST (vBNST)] brain structures of P and NPrats. In addition, we examined the localization of BDNF in neurons using double-immunofluores-cence labeling of BDNF with neuron-specific nuclear protein (NeuN) and also determined thenumber of NeuN-positive neurons in the amygdaloid structures of P and NP rats.

Results: The mRNA and protein levels of BDNF were found to be significantly lower in boththe CeA and MeA, but not in the BLA, of P compared with NP rats. We also found that BDNFwas expressed in neurons in the amygdaloid structures of P and NP rats. In addition, we foundthat the number of NeuN-positive neurons was similar in the amygdaloid structures of P and NPrats. Interestingly, the mRNA and protein levels of BDNF were also significantly lower in thelBNST, mBNST, and vBNST of P compared with NP rats. On the other hand, mRNA and pro-tein levels of BDNF were similar in the NAc shell and core structures of P and NP rats.

Conclusions: P and NP rats are selectively bred for higher and lower alcohol preference,respectively; therefore it is possible that lower BDNF levels in the amygdaloid and BNST struc-tures may be associated with the excessive alcohol-drinking behaviors of P rats.

Key Words: BDNF, Amygdala, BNST, Nucleus Accumbens, Alcohol Preference.

A LCOHOLISM IS A complex disease and several fac-tors, including genetics, play a role in the initiation and

maintenance of alcohol-drinking behaviors (Cloninger, 1987;Enoch, 2003; National Institute on Alcohol Abuse and Alco-holism, 1993; Radel and Goldman, 2001; Thome et al., 2000).More recently, it has been recognized that extended amygda-loid structures provide an important neuroanatomical sub-

strate, not only for drug and alcohol addiction (McBride,2002; Koob, 2003a,b; Pandey, 2004), but also for psychiatricconditions such as anxiety, fear, and emotion (Charney andDeutch, 1996; Davis, 1997, 2006; Davis and Whalen, 2001).The extended amygdaloid structures include the central(CeA) and medial nucleus of the amygdala (MeA), the bednucleus of the stria terminalis (BNST), and the shell of thenucleus accumbens (NAc) (Alheid and Heimer, 1988; Alheidet al., 1998; Koob, 2003a,b). Several animal models have beendeveloped to investigate the biological mechanisms in specificbrain circuitries that may be operative in contributing to agenetic predisposition to alcoholism (McBride and Li, 1998;Rodd et al., 2004). Among these animal models are alcohol-preferring (P) and nonpreferring (NP) rats that are selectivelybred for high and low alcohol preference, respectively (Liet al., 1987, 1993; McBride and Li, 1998; Murphy et al.,2002). Additionally, P rats have been shown to display anxi-ety-like behaviors compared with NP rats (Hwang et al.,2004; Mckinzie et al., 2000; Pandey et al., 2005; Stewart et al.,

From the Department of Psychiatry (AP, HZ, SCP); and theDepartment of Anatomy and Cell Biology (SCP); University ofIllinois at Chicago and Jesse Brown VA Medical Center (AP, HZ,SCP), Chicago, Illinois.

Received for publication January 11, 2007; accepted February 8, 2008.Reprint requests: Dr. Subhash C. Pandey, Department of Psychia-

try, University of Illinois at Chicago and Jesse Brown VA MedicalCenter, 820 South Damen Avenue (M ⁄C 151), Chicago, IL 60612;Fax: 312-569-8114; Email: scpandey@uic.edu

Copyright � 2008 by the Research Society on Alcoholism.No claim to original U.S. government works

DOI: 10.1111/j.1530-0277.2008.00650.x

Alcoholism: Clinical and Experimental Research Vol. 32, No. 6June 2008

Alcohol Clin Exp Res, Vol 32, No 6, 2008: pp 909–920 909

1993). Thus, P rats may be a suitable animal model forinvestigating the neuro-mechanisms involved in the comor-bidity of anxiety and alcoholism.We have previously shown that a decreased function in

cAMP-responsive-element binding (CREB) signaling in theCeA may be associated with anxiety-like and alcohol-drinking behaviors of P rats (Pandey et al., 2005).Brain-derived neurotrophic factor (BDNF) and its receptortyrosine kinase B (trkB) are CREB target genes (Duman,2004; Pandey et al., 2004; Shieh et al., 1998) that areinvolved in neuronal survival, differentiation, and consoli-dation of synaptic strength (Bibel and Barde, 2000; Carteret al., 2002; Poo, 2001; Thoenen, 1995, 2000). Binding ofBDNF to trkB receptors triggers the activation of mito-gen-activated protein kinase, phospholipase C-c, and phos-phoinositide 3-kinase signal transduction pathways thatregulate diverse neuronal function (Impey et al., 1999; Pan-dey, 2004; Thoenen, 1995; Ying et al., 2002). Recently, wehave shown that decreasing the expression of BDNF byinfusion of BDNF antisense oligodeoxynucleotides (ODNs)into the CeA and MeA, but not into the basolateral amyg-dala (BLA), provoked anxiety-like behaviors and promotedalcohol intake in Sprague Dawley (SD) rats, which wereattenuated by BDNF co-infusion (Pandey et al., 2006).These results suggest the possibility that decreased levels ofBDNF in the CeA and MeA may be responsible for agenetic predisposition to anxiety and alcohol-drinkingbehaviors. If so, P rats that innately display both anxiety-like behaviors and higher alcohol preference (Li et al.,1993; Pandey et al., 2005) may also express lower levels ofBDNF in the CeA and MeA compared with NP rats. Toexplore these possibilities, we determined the basal expres-sion of BDNF in the amygdaloid structures of alcoholnaı̈ve P and NP rats. We also examined the colocalizationof BDNF in neurons using double-immunofluorescencelabeling of BDNF and neuron-specific nuclear proteins,called neuronal nuclei (NeuN), in the amygdaloid struc-tures of P and NP rats. Furthermore, it is also possiblethat other structures of the extended amygdala such as thelateral BNST (lBNST), medial BNST (mBNST), ventralBNST (vBNST), and NAc (shell and core) of P rats mayalso abnormally express BDNF compared with NP rats.Therefore, we also determined the cellular expression ofBDNF in the BNST and NAc of P and NP rats.

METHODS

Alcohol-Preferring and Nonpreferring Rats

All experiments were conducted in accordance with the NationalInstitute of Health Guidelines for the Care and Use of LaboratoryAnimals and approved by the Institutional Animal Care and UseCommittee. Adult male alcohol-preferring (P) and nonpreferring(NP) rats (350 g) were received from the Alcohol Research Center(Indiana University, Indianapolis, IN). All rats were housed under a12-hour light ⁄dark cycle and had free access to water and food. Bothalcohol naı̈ve P and NP rats were perfused, as described below, andtheir brains were used in determining the protein and mRNA levelsof BDNF in the extended amygdaloid brain structures.

Antibodies

Two different kinds of BDNF antibodies were used to measureBDNF protein levels and were purchased from Santa Cruz Biotech-nology, Santa Cruz, CA. BDNF (H-117) is a rabbit polyclonal anti-body raised against a recombinant protein corresponding to aminoacids mapped at the carboxy-terminal of BDNF. On the other hand,BDNF (N-20) is a rabbit polyclonal antibody raised against a pep-tide mapped at the amino-terminal of BDNF. The blocking peptide(sc-546P) was also purchased from Santa Cruz Biotechnology. Themouse monoclonal antibody raised against a NeuN marker was pur-chased fromMillipore, Billerica, MA. The gold particle (1.4 nm) con-jugated anti-rabbit or anti-mouse secondary antibodies werepurchased from Nanoprobes, Yaphank, NY.

Gold-Immunolabeling of BDNF and NeuN in Rat Brain

The gold-immunolabeling of BDNF and NeuN were deter-mined by the histochemical procedure as previously described byus (Pandey et al., 2004, 2006; Zhou et al., 2005) and other inves-tigators (Izzo et al., 2001). P and NP rats were first anesthetizedusing pentobarbital (50 mg ⁄kg), then perfused intracardially withn-saline (100 ml) followed by 400 ml of 4% ice-cold paraformal-dehyde fixative. Brains were removed and placed in fixative for20 hours at 4�C. Brains were then soaked in 10% sucrose, fol-lowed by 20% sucrose, and finally 30% sucrose (prepared in0.1 M phosphate buffer, pH = 7.4). Brains were frozen and coro-nal sections (20 lm) were cut using a cryostat. Sections werewashed with 0.01 M phosphate-buffered saline (PBS; 2 · 10 min-utes), and then incubated with RPMI 1640 (with l-glutamine)medium (Invitrogen, Grand Island, NY) for 30 minutes, and 10%normal goat serum (NGS) [diluted in PBS containing 0.25% Tri-ton X-100 (PBST)] for 30 minutes at room temperature. Sectionswere then blocked with 1% bovine serum albumin (BSA) pre-pared in PBST for 30 minutes at room temperature. Sections werefurther incubated with anti-BDNF or anti-NeuN antibody (1:200dilution) in 1% BSA prepared in PBST for 18 hours at roomtemperature. Following 2 · 10-minute washes with PBS and2 · 10-minutes washes with 1% BSA in PBS, sections were incu-bated with gold particle (1.4 nm) conjugated anti-rabbit (forBDNF) or anti-mouse (for NeuN) secondary antibody (1:200dilution in 1% BSA in PBS) for 1 hour at room temperature.Following incubation with the secondary antibody, sections wererinsed several times in 1% BSA in PBS, followed by several rin-sings with double distilled water. The gold-immunolabeling wasthen silver-enhanced (Ted Pella Inc., Redding, CA) for approxi-mately 15 minutes and washed several times with tap water. Sec-tions were then mounted on slides and examined under a lightmicroscope. For negative brain sections, an identical protocol wasused, except that 1% BSA in PBST was substituted for the pri-mary antibody. In order to check the specificity of BDNF label-ing, brain sections were also incubated with a BDNF (N-20)antibody that was pre-absorbed with BDNF-blocking peptides(5 lg ⁄ml).The quantification of gold-immunolabeled BDNF proteins was

performed using the Image Analysis System (Loats Associates, West-minster, MD) connected to a light microscope at high magnification(100·). The threshold for each image was set up in such a way thatan area without staining gave zero counts. Under this condition,immuno-gold particles in the defined extended amygdaloid areas ofthree adjacent brain sections (9 object fields) for each P and NP ratwere counted, and values were then averaged for each rat. The num-ber of NeuN-positive neurons in the amygdaloid structures of threeadjacent brain sections in each P and NP rat was calculated at alower magnification (20·) using the Neurolucida program (Micro-BrightField, Inc., Williston, VT), and finally, the values were aver-aged for each rat.

910 PRAKASH ET AL.

Diaminobenzidine-Immunostaining for BDNF in Rat Brain

Diaminobenzidine (DAB)-immunostaining of BDNF was deter-mined by the histochemical procedure as previously described by us(Xu and Pandey, 2000). Coronal brain sections (20 lm) were washedwith 0.01 M PBS (2 · 10 minutes), treated with 0.3% hydrogen per-oxide diluted in PBST for 1 hour, followed by incubation with 10%NGS (diluted in PBST) for 30 minutes at room temperature. Sectionswere then incubated with an anti-BDNF (N-20) antibody (1:500 dilu-tion) in 3% NGS diluted in PBST (containing 0.01% sodium azide)for 18 hours at room temperature. Sections were washed with PBSand incubated with biotinylated anti-rabbit secondary antibody(1:300 dilution in PBST) for 2 hours at room temperature. After-wards, sections were washed with PBS and incubated with avidin-bio-tinylated-peroxidase complex (Vectastain Elite ABC kit; VectorLaboratories, Burlingame, CA). Following three 15-minute washeswith PBS, sections were incubated withDAB according to the instruc-tions provided with the DAB Peroxidase Substrate Kit (Vector Labo-ratories). After washing with PBS and then water, sections weremounted on slides and examined under a light microscope. For nega-tive brain sections, an identical protocol to the one mentioned abovewas used, except that 3% NGS in PBST (containing 0.01% sodiumazide) was substituted for the primary antibody. The optical density(OD) of DAB-immunostaining was calculated using an Image Ana-lyzer (Loats Associates) at 20· magnification. The mean OD from thedefined areas of amygdaloid structures (CeA, MeA, and BLA) ofthree adjacent brain sections (matched bregma) for each P or NP ratwas calculated, and then values for each rat were averaged. The ODfrom the amygdaloid areas of negative brain sections was subtractedfrom that of the positive brain sections. The results were representedas meanOD ⁄100 pixels of area for DAB-immunostaining of BDNF.

Double-Immunofluorescence Labeling of BDNF With NeuN

Double-immunofluorescence labeling was performed to examinethe colocalization of BDNF with NeuN in the amygdaloid structuresof P and NP rats according to the procedure described by us previ-ously (Xu and Pandey, 2000). Coronal brain sections (20 lm) werewashed with 0.01 M PBS, incubated with 10% normal horse serum(NHS) diluted in PBST, and then blocked with 1% BSA (diluted inPBST) for 30 minutes at room temperature. Sections were furtherincubated with anti-NeuN antibody [1:200 dilution in 3% NHS inPBST (PHT) containing 0.01% sodium azide] overnight at roomtemperature. Following 6 · 5-minute washes with 0.01 M PBS, sec-tions were incubated with biotinylated horse anti-mouse IgG (1:300dilution in PHT) for 2 hours at room temperature. Sections were fur-ther washed with 0.01 M PBS (3 · 5 minutes) and then incubatedwith avidin D-conjugated rhodamine (1:100 dilution in 0.01 M PBS)for 1 hour at room temperature in the dark. For double-immunoflu-orescence labeling, the above sections were washed with 0.01 M PBS(6 · 15 minutes) and incubated with 10% NGS followed by 1%BSA in PBST for 30 minutes each. The sections were then incubatedwith anti-BDNF (H-117) antibody [1:200 dilution in 3% NGS inPBST (PGT) containing 0.01% sodium azide] overnight at roomtemperature. The sections were washed with 0.01 M PBS (6 · 5 min-utes) and then incubated with biotinylated IgG (goat anti-rabbit)diluted (1:300) in PGT without 0.01% sodium azide for 2 hours atroom temperature. Brain sections were washed again with 0.01 MPBS (3 · 5 minutes) and finally incubated with avidin D-conjugatedFITC (1:500 dilution in 0.01 M PBS) for 1 hour at room temperaturein the dark. Sections were washed, mounted on slides, air-dried, andcover-slipped using Fluoromount-G (Southern Biotech, Birming-ham, AL). The patterns for colocalization of BDNF and NeuN wereexamined using confocal laser microscopy. For the negative brainsections, an identical protocol was used except that sections wereincubated with PHT or PGT containing 0.01% sodium azide withoutNeuN or BDNF primary antibody.

In Situ RT-PCR for BDNF mRNA Measurement in Rat Brain

Rat brain sections were used to determine the mRNA levels ofBDNF using in situ reverse transcriptase (RT)-PCR as reported ear-lier by us (Pandey et al., 2004, 2006; Zhou et al., 2005). Briefly, free-floating brain sections (40-lm thickness) were treated with proteinaseK (1 lg ⁄ml in 1· PBS containing 0.05% Triton X-100) for 15 min-utes at 37�C. After washing the sections with 1· PBS, sections weresubjected to DNase digestion and then incubated for 30 minutes at42�C with RT enzyme in the presence of oligo(dT)16 and dNTPs. RTenzyme was not added to negative sections. PCR was performed withTaq DNA polymerase enzyme and 100 pmol of each BDNF primer(BDNF forward 5¢TAACGGCGGCAGACAAAAAGACT 3¢ andBDNF reverse 5¢GTGTCTATCCTTATGAATCGCCAGCCA A3¢) and 1 mM of each dNTPs, except dTTP that was replaced bydigoxigenin (DIG)-11-dUTP (PCR conditions: 94�C for 2 minutes,94�C for 30 seconds, 57�C for 30 seconds, 72�C for 90 seconds, totalof 30 cycles, and 72�C for 10 minutes). These primer sequences werebased on a previous publication (Tokuyama et al., 2000). After termi-nation of PCR reaction, sections were mounted on slides, andBDNF-positive cell bodies were detected using an alkaline phospha-tase conjugated anti-DIG antibody and subsequent staining of thecomplex with the specific substrate, nitro blue tetrazolium chlo-ride ⁄5-bromo-4-chloro-3-indolylphosphate (Roche Diagnotics Cor-poration, Indianapolis, IN). The mean OD of BDNF-positive cellbodies was calculated using an Image Analyzer (Loats Associates).The OD from negative brain sections was subtracted from thatobtained from positive brain sections. The mean OD in the extendedamygdaloid structures of three adjacent brain sections from each ratwas calculated, and then values were averaged for each rat. Theresults were represented as mean OD ⁄100 pixels of area for BDNFmRNA levels.

Statistics

The differences between P and NP rats were evaluated usingStudent’s t-test. We considered p < 0.05 values to be statisticallysignificant.

RESULTS

mRNA and Protein Levels of BDNF in the AmygdaloidStructures of P and NP Rats

To examine the differences in the expression of BDNF inthe amygdaloid structures of P and NP rats, we determinedthe mRNA and protein levels of BDNF in the CeA, MeA,and BLA. Figure 1A shows gold-immunolabeling of BDNFprotein with both BDNF antibodies (N-20 and H-117) in theCeA, MeA, and BLA of P and NP rats. As can be seen, theBDNF antibody (N-20), raised against the amino-terminal,labeled BDNF proteins in both cell bodies and fibers, whereasthe BDNF antibody (H-117), raised against the carboxy-ter-minal, labeled BDNF proteins mainly in the cell bodies of theCeA, MeA, and BLA of P and NP rats. Also, gold-immu-nolabeling was shown to be specific to BDNF protein, asBDNF (N-20) antibody labeling was completely abolished byBDNF-blocking peptides (Fig. 1A; last panel). We also com-pared the pattern of gold-immunolabeling with the DAB-staining pattern observed in the amygdaloid structures of Pand NP rats using the BDNF (N-20) antibody. The patternof labeling was similar in both procedures, and BDNF

ALCOHOL PREFERENCE IN THE EXPRESSION OF BRAIN-DERIVED NEUROTROPHIC FACTOR 911

labeling was observed in both the somata and processes ofcells in the amygdaloid structures (Figs. 1A and 2A). As canbe seen from the high magnification photographs (last panelof Fig. 2A), DAB-staining using the BDNF (N-20) antibodyshowed cytosolic, nuclear, and fibrous labeling of cells in theCeA, MeA, and BLA structures. However, regardless of theBDNF antibodies used, we found that protein levels ofBDNF were significantly (p < 0.001) lower in the CeA andMeA, but not in the BLA, of P rats compared with NP rats(Figs. 1A, 1B and 2A, 2B) as measured by both gold- andDAB-immunolabeling. In Fig. 3A, the upper panel displaysthe expression of BDNF mRNA in the CeA, MeA, and BLAof P and NP rats. In Fig. 3A, the lower panel shows noBDNF mRNA signals in the negative sections (without RTenzyme) of CeA, MeA, or BLA of P and NP rats. ThemRNA levels of BDNF were also significantly lower(p < 0.01) in the CeA and MeA, but not in the BLA, of Prats compared with NP rats (Fig. 3A and 3B). These resultssuggest that both the protein and mRNA levels of BDNFwere lower in the CeA and MeA of P rats compared with NPrats.Next, we determined the number of neurons in the

amygdaloid structures of P and NP rats using NeuN

gold-immunolabeling. The NeuN-labeling was not onlypredominantly nuclear but also had weak cytosolic label-ing, which is similar to previous studies (Magavi et al.,2000; Wolf et al., 1996). In Fig. 4A and 4B, it can beseen that the number of NeuN-positive neurons was simi-lar in the CeA, MeA, and BLA structures of P and NPrats. These results suggest that lower expression of BDNFin the CeA and MeA of P rats was not due to the lowernumber of neurons in the amygdaloid structures of Prats.We identified the expression of BDNF in neuronal cells

using double-immunofluorescence staining of BDNF andNeuN in the amygdaloid structures of P and NP rats(Fig. 5). The negative brain sections, which were first incu-bated with PHT and then with PGT without the primaryantibody of NeuN or BDNF (H-117), did not show anypositive labeling (data not shown). We also found thatBDNF proteins, labeled by the BDNF antibody (H-117),were expressed on NeuN-positive neurons, as BDNF wascolocalized with NeuN proteins in the CeA, MeA, and BLAin both P and NP rats (Fig. 5; first column, NeuN; secondcolumn, BDNF; third column, NeuN+ BDNF). Thus, thepattern of BDNF- and NeuN-immunofluorescence labeling

Fig. 1. (A) Photomicrographs at low magnification showing BDNF (first, second, third, and fourth panel) gold-immunolabeling with BDNF (N-20 andH-117) antibodies in the amygdaloid brain structures of P and NP rats. The last panel shows the attenuation of BDNF gold-immunolabeling with BDNF(N-20) antibody, pre-absorbed with BDNF-blocking peptide, in the amygdaloid brain structures of NP rats (scale bar = 100 lm, amygdaloid structurecolumn; 30 lm, CeA, MeA, and BLA column). The inset in the CeA column shows immuno-gold particles in a cell body at high magnification (100·). (B)Quantitation of BDNF gold-immunolabeling (number of immuno-gold particles ⁄ 100 lm2 area) in the amygdaloid structures of P and NP rats. Values are themean ± SEM of five rats per group. *Significantly (p < 0.001) different from NP rats.

912 PRAKASH ET AL.

was similar to BDNF and NeuN gold-immunolabeling(Figs. 1A and 4A) in the amygdaloid structures of P andNP rats. Taken together, these results clearly suggest that

BDNF protein levels may be lower in neurons of the CeAand MeA, but not in the BLA, of P rats compared with NPrats.

Fig. 2. (A) Photomicrographs at low magnification showing BDNF (first, second, and third panel) DAB-immunostaining with BDNF (N-20) antibody in theamygdaloid brain structures of P and NP rats (scale bar = 100 lm, amygdaloid structure column, first and second panel; 30 lm, CeA, MeA, and BLA col-umn, first and second panel). Areas of the CeA, MeA, and BLA of NP rat are shown in the third panel at high magnification (100·; scale bar = 10 lm) indi-cating the cytosolic, nuclear, and fibrous labeling of BDNF. (B) Quantitation of DAB-immunostaining of BDNF (mean OD ⁄ 100 pixels area) in the amygdaloidstructures of P and NP rats. Values are the mean ± SEM of five rats per group. *Significantly (p < 0.001) different from NP rats.

Fig. 3. (A) Photomicrographs at low magnification showing mRNA levels of BDNF (first and second panel) and no mRNA signals in the negative sections(without RT enzyme; third and fourth panel) in the amygdaloid brain structures of P and NP rats (scale bar = 100 lm, amygdaloid structure column; 30 lm,CeA, MeA, and BLA column). (B) Quantitation of mRNA levels of BDNF in the amygdaloid structures of P and NP rats. Values are the mean ± SEM of fiverats per group. *Significantly (p < 0.01) different from NP rats.

ALCOHOL PREFERENCE IN THE EXPRESSION OF BRAIN-DERIVED NEUROTROPHIC FACTOR 913

mRNA and Protein Levels of BDNF in BNST Structuresof P and NP Rats

To examine the differences in the expression of BDNFin the BNST, we determined the mRNA and protein levelsof BDNF in the lBNST, mBNST, and vBNST of P andNP rats. Figure 6A shows the expression of BDNF protein(BDNF; H-117) and mRNA in the lBNST, mBNST, andvBNST of P and NP rats. Significant basal differenceswere found in the expression of BDNF in the lBNST,mBNST, and vBNST in P and NP rats (Fig. 6A and 6B).The levels of BDNF mRNA were significantly (p < 0.05–0.001) lower in the lBNST, mBNST, and vBNST brainstructures in P rats compared with NP rats. Similarly, sig-nificant differences (p < 0.01–0.001) were found in BDNFprotein levels in the BNST areas of P rats compared withNP rats. We observed that P rats had lower BDNF pro-tein levels in lBNST, mBNST, and vBNST compared withthe BDNF protein levels in the BNST areas of NP rats(Fig. 6A and 6B). These results suggest that mRNA andprotein levels of BDNF were lower in the BNST structuresof P rats compared with NP rats.

mRNA and Protein Levels of BDNF in NAc Structures ofP and NP Rats

To examine the differences in the expression of BDNF inthe NAc, we determined the mRNA and protein levels ofBDNF in NAc shell and core structures of P and NP rats.Figure 7A shows the expression of BDNF protein andmRNA in the NAc shell and core structures of P and NP rats.There were no significant differences in the BDNF mRNAlevels in NAc shell or core areas in P and NP rats (Fig. 7Aand 7B). Similarly, no significant differences were found inthe BDNF protein levels in the NAc shell or core of P or NPrats (Fig. 7A and 7B). These results suggest that mRNA and

Fig. 4. (A) Photomicrographs at low magnification showing NeuN gold-immunolabeling in the amygdaloid brain structures of P and NP rats (scalebar = 100 lm, amygdaloid structure column; 30 lm, CeA, MeA, and BLA column). (B) Quantitation of NeuN-positive neurons ⁄ 104 lm2 area in the amygda-loid structures of P and NP rats. Values are the mean ± SEM of five rats per group.

Fig. 5. Confocal images of fluorescent co-immunolabeled NeuN andBDNF (H-117) in the CeA, MeA, and BLA of P and NP rats. BDNF expres-sion can be seen in the NeuN-positive neurons of these brain structures(scale bar = 20 lm).

914 PRAKASH ET AL.

protein levels of BDNF were similar in the NAc shell andcore structures of P and NP rats.

DISCUSSION

The data presented here provide the first evidence thatsome structures of the extended amygdala of P rats displaylower expression of BDNF compared with NP rats. TheBDNF expression was found to be lower in the CeA, MeA,lBNST, mBNST, and vBNST, but not in the shell or corestructures of the NAc in alcohol naı̈ve P rats. Previously, ithas been shown that P rats displayed higher levels of anxiety-like behaviors compared with NP rats, as measured by the ele-vated plus-maze (EPM) test, and also that alcohol producedanxiolytic effects in P but not in NP rats (Pandey et al., 2005;Stewart et al., 1993). Furthermore, P rats compared with NPrats showed higher emotional reactivity, as measured by anacoustic startle response and ethanol exposure decreased theacoustic startle response, in P but not in NP rats (Jones et al.,2000). In addition, P rats have been shown to consume signifi-cantly higher amounts of ethanol compared with NP rats(McBride and Li, 1998; Li et al., 1993; Pandey et al., 2005).Our studies suggest that a deficiency in BDNF, within theregions of the extended amygdala, may be operative inemploying a genetic predisposition to anxiety-like and exces-sive alcohol-drinking behaviors of P rats. Several previousstudies support the above findings. The haplodeficiency of the

BDNF gene promoted alcohol intake in mice (Hensler et al.,2003; McGough et al., 2004), and BDNF conditional knock-out mice were more prone to anxiety-like behaviors (Rioset al., 2001). The BDNF gene polymorphism has also beenshown to be associated with the personality traits of anxietyand alcoholism (Jiang et al., 2005; Lang et al., 2005; Matsush-ita et al., 2004; Uhl et al., 2001). Recently, we found that infu-sion of BDNF antisense ODNs into the CeA and MeA, butnot BLA, provoked anxiety-like behaviors, as measured bythe EPM test, and promoted alcohol intake in SD rats. TheBDNF ODNs-induced behaviors were attenuated by BDNFcoinfusion into the CeA and MeA of SD rats. The mRNAand protein levels of BDNF, and protein levels of phosphory-lated CREB and extracellular-regulated kinase (Erk1 ⁄2), weredecreased by BDNF antisense but not by BDNF sense ODNsinfusion into the CeA, MeA, or BLA, and levels were restoredto normal after BDNF coinfusion into these amygdaloidstructures (Pandey et al., 2006). The studies conducted in SDrats, together with our current BDNF studies in P rats, indi-cate that decreased BDNF function in the CeA and MeAmay be involved in anxiety-like and alcohol-drinkingbehaviors.Other findings of the present investigation demonstrate that

BDNF was expressed in neurons and that the numbers ofneurons were similar in the amygdaloid structures of P andNP rats. These results suggest that lower expression of BDNFin both the CeA andMeA of P rats was not due to differences

Fig. 6. (A) Photomicrographs at low magnification showing BDNF (first and second panel) gold-immunolabeling and mRNA levels of BDNF (third andfourth panel) in the BNST brain structures of P and NP rats (scale bar = 100 lm, BNST structures column; 30 lm, lBNST, mBNST, and vBNST column).Inset in the lBNST column indicating immuno-gold particles in a cell body at high magnification (100·). (B) Quantitation of BDNF gold-immunolabeling (num-ber of immuno-gold particles ⁄ 100 lm2 area) and mRNA levels of BDNF in the BNST structures (lBNST, mBNST, and vBNST) of P and NP rats. Values arethe mean ± SEM of five rats per group. *Significantly (p < 0.05–0.001) different from NP rats.

ALCOHOL PREFERENCE IN THE EXPRESSION OF BRAIN-DERIVED NEUROTROPHIC FACTOR 915

in the number of neurons in the brain structures of P and NPrats. Previous studies have shown that BDNF localizationoccurs in both glial cells as well as in neurons in the brain(Riley et al., 2004; Yamasaki et al., 1998). However, somestudies were either not able to detect or detected very low lev-els of BDNF mRNA in astroglial cell cultures (Condorelliet al., 1994, 1995; Zafra et al., 1992). It is possible that BDNFmay be expressed in glial cells in the amygdala or in otherbrain structures of P and NP rats. Future studies are neededto explore this possibility. It is also important to mention thatBDNF protein levels, detected by the H-117 BDNF antibody,were predominantly expressed in neurons in the CeA andMeA. Thus, lower BDNF levels in amygdaloid and BNSTstructures may be related to lower BDNF expression in neu-rons of these brain structures of P rats compared with NPrats. In addition, lower expression of CREB has beenreported in the CeA and MeA, but not in BLA, of P ratscompared with NP rats (Pandey et al., 2005). BDNF is one ofthe CREB target genes (Duman, 2004; Shieh et al., 1998), andit may be possible that lower levels of BDNF in the CeA andMeA, but not in the BLA, of P rats compared with NP ratsmay be inherently due to lower levels of CREB in these brainstructures. We and other investigators have shown thatmRNA and protein levels of neuropeptide Y (NPY), another

CREB target gene (Pandey, 2003; Pandey et al., 2004), werelower in the CeA and MeA of P rats compared with NP rats(Hwang et al., 1999; Pandey et al., 2005). Taken together,these studies suggest that a deficiency in both CREB and itstarget genes, NPY and BDNF, in the CeA and MeA may beresponsible for a genetic predisposition to anxiety-like andexcessive alcohol-drinking behaviors of P rats.Previous studies in the field have provided evidence to sug-

gest that axonal BDNF expression could be due to both ret-rograde and anterograde transport (Conner et al., 1997;Kohara et al., 2001). Higher levels of fibers and axonalBDNF labeling have been observed in rat brain areas such asthe CeA and dorsolateral BNST, however, with no detectableBDNF mRNA in these brain structures (Agassandian et al.,2006; Conner et al., 1997). These studies suggest that fibrousBDNF labeling in these brain areas might be derived byanterograde transport. Here, we found BDNF labeling ofonly the cell bodies by the H-117 BDNF antibody and BDNFlabeling of both the cell bodies and fibers by the N-20 BDNFantibody in the CeA, MeA, and BLA of P and NP rats. Wealso found that BDNF mRNA was expressed in the CeA,MeA, and BLA of P and NP rats. These results were similarto our previous studies of BDNF in the amygdaloid struc-tures of rat (Pandey et al., 2006; Zhou et al., 2005) and mouse

Fig. 7. (A) Photomicrographs at low magnification showing BDNF (first and second panel) gold-immunolabeling and mRNA levels of BDNF (third andfourth panel) in the NAc brain structures of P and NP rats (scale bar = 100 lm, NAc structures column; 30 lm, NAc shell and NAc core). Inset in the NAcshell column shows the immuno-gold particles in a cell body at high magnification (100·). (B) Quantitation of BDNF gold-immunolabeling (number ofimmuno-gold particles ⁄ 100 lm2 area) and mRNA levels of BDNF in the NAc structures (shell and core) of P and NP rats. Values are the mean ± SEM offive rats per group.

916 PRAKASH ET AL.

(Pandey et al., 2004). The different patterns of BDNF labeling(cytosolic, nuclear, and fibrous) in various brain regions havebeen reported in the literature (Agassandian et al., 2006; Con-ner et al., 1997; Furukawa et al., 1998; Kawamoto et al.,1996; Wetmore et al., 1991; Yamasaki et al., 1998; Yanamotoet al., 2000). BDNF labeling was found to be dependent onthe location of the BDNF peptide, against which the antibod-ies were raised. The differences in fibrous versus cell bodyBDNF labeling and the detection of BDNF mRNA in theCeA between our studies and other studies (Agassandianet al., 2006; Conner et al., 1997) may be related to differencesin the characteristics of the BDNF antibody, in addition tothe sensitivity of the mRNA detection procedure (in situ RT-PCR vs. in situ hybridization). Therefore, it may be possiblethat the fibrous BDNF labeling observed in the CeA of P andNP rats may be derived from an afferent system, as demon-strated previously in the CeA of SD rats (Conner et al., 1997).It is important to mention that the techniques used here can-not differentiate between anterogradely versus retrogradelytransported BDNF, but can detect the total BDNF proteinlevels that have been endogenously synthesized or trans-ported. Here, we also observed that some cells expressedBDNF protein in both the cytosol and nucleus using theBDNF (N-20) antibody. One recent electron microscopystudy showed that precursor BDNF (pro-BDNF) was presentin the nucleus of the neurons in the amygdala (Agassandianet al., 2006). Zhou et al. (2004) showed that pro-BDNF wasdensely localized in the cell bodies and processes of cells in theamygdaloid structures of rats. Other studies also showedBDNF labeling in the nucleus of neurons in these brain struc-tures (Furukawa et al., 1998). The BDNF (N-20) antibodyrecognized both pro-BDNF and mature BDNF, indicatingthat the nuclear BDNF labeling observed in some cells couldhave been due to the presence of pro-BDNF. Future studiesare needed to investigate if the levels of pro-BDNF wouldalso be different in the amygdala or other brain structures ofP and NP rats.BNST is another key anatomical area of the extended

amygdala (Alheid and Heimer, 1988; Alheid et al., 1998) thatplays a crucial role in anxiety and drug-seeking behavior(Davis, 2006; Koob, 2003a,b; Shaham et al., 2000; Van Bock-staele et al., 1999). It has been shown that acute ethanol expo-sure reduced long-term potentiation in the dorsolateral BNSTstructures of mice in a GABAA receptor-dependent manner(Weitlauf et al., 2004). Also, withdrawal from chronic ethanolexposure increased corticotropin-releasing factor (CRF) levelsin the BNST, which was normalized by subsequent ethanolexposure in rats (Olive et al., 2002). Therefore, BNST neuronsmay be sensitive to ethanol exposure and its withdrawal. Cur-rently, there are no data available on BDNF in the BNST inrelation to alcohol-drinking behaviors. In the present study,we found that mRNA and protein levels of BDNF werelower in the lBNST, mBNST, and vBNST of P rats comparedwith NP rats. As BDNF expression has been shown to belower in the CeA, MeA, and BNST of P rats, and the nucleiof the amygdala are well connected to lBNST and mBNST

(Alheid and Heimer, 1988; Alheid et al., 1998), it can be spec-ulated that a deficiency of BDNF in the CeA, MeA, andBNST may be involved in the molecular mechanisms of anxi-ety and alcoholism.Dopaminergic (DA) innervation from the ventral tegmental

area to the NAc has been associated with the reward proper-ties of ethanol, as well as other drugs of abuse (Chao andNestler, 2004; Hyman and Malenka, 2001; Imperato and DiChiara, 1986; Robbins and Everitt, 1996; Weiss et al., 1993).The shell of the NAc, contained within the extended amyg-dala, has been implicated in both the reward and motivationalaspects of alcohol-drinking behaviors (Koob, 2003a,b). Weand others have previously reported that there were no signifi-cant differences in CREB or NPY levels in the NAc shell orcore structures of P and NP rats (Hwang et al., 1999; Pandeyet al., 2005). In the present study, we found that BDNFexpression was similar in the shell and core structures of theNAc in P and NP rats. One recent report found lower BDNFlevels in punched-out nucleus accumbal structures of P ratscompared with NP rats using an ELISA procedure (Yanet al., 2005). The reason for the discrepancy in our results withYan et al. (2005) is not clear, but may be related to differencesin the methodologies used. Nonetheless, our present resultsalong with previous studies (Pandey et al., 2005) indicate thatthe levels of CREB and its target genes, NPY and BDNF,were similar in the NAc structures of P and NP rats and maynot be involved in the excessive alcohol-drinking behaviors ofP rats.BDNF has been shown to interact with several neurotrans-

mitter systems, including the DA (Spenger et al., 1995), sero-tonin (5-HT) (Lyons et al., 1999; Rumajogee et al., 2002), andNPY systems (Barnea and Roberts, 2001; Nawa et al., 1993,1994). We and others have shown that these neurotransmittersystems were abnormal in the brain structures of P rats com-pared with NP rats (Hwang et al., 1999, 2004; McBride andLi, 1998; Murphy et al., 2002; Pandey et al., 1996, 2005).More specifically, we found that NPY levels were lower in theCeA and MeA, but not in the BLA or NAc, of P rats com-pared with NP rats, and that infusion of NPY into the CeAsignificantly attenuated both the anxiety levels and alcoholintake of P rats (Pandey et al., 2005). Previous studies havealso shown that lower levels of BDNF were associated withlower levels of NPY in both rat brain and cultured neurons(Barnea and Roberts, 2001; Nawa et al., 1993, 1994). There-fore, it may be possible that lower BDNF and NPY expres-sion in the amygdala of P rats occurs as a result of lowerCREB expression. Anxiety-like and high alcohol-drinkingbehaviors of P rats may also be regulated by the interactionsof BDNF, NPY, and other CREB target genes, CRF viaCREB (Pandey, 2003), in the extended amygdala. Further-more, mRNA levels and immunoreactivity of CRF werelower in the CeA of P rats compared with NP rats (Hwanget al., 2004). Levels of CRF have been shown to be lower inseveral brain regions, including the amygdala, of P rats com-pared with NP rats, and P rats exhibited an increased electro-encephalographic response to exogenous CRF, suggesting

ALCOHOL PREFERENCE IN THE EXPRESSION OF BRAIN-DERIVED NEUROTROPHIC FACTOR 917

that CRF receptors may be up-regulated in the brains of Prats (Ehlers et al., 1992). Thus, deficits in the BDNF, NPY,and CRF systems in the extended amygdaloid structures of Prats may be associated with anxiety and alcohol-drinkingbehaviors. Future studies are needed to explore the relation-ship between NPY, BDNF, and CRF in the amygdala andBNST, in relation to anxiety and alcohol-drinking behaviorsof P rats.In summary, the present investigation provides a neuro-

mechanism to possibly implicate innately lower BDNFexpression in the CeA, MeA, and various structures of BNSTin maintaining the excessive alcohol-drinking and anxiety-likebehaviors of P rats. We have previously shown that loweringBDNF expression in the CeA and MeA provoked anxiety-like behaviors and increased alcohol-drinking behaviors inSD rats (Pandey et al., 2006). Taken together, these resultsclearly suggest that a deficiency of BDNF in the amygdala(CeA and MeA), and possibly in the BNST, may be responsi-ble for a genetic predisposition to anxiety and alcoholism.

ACKNOWLEDGMENTS

This study was supported by grants from the NationalInstitute on Alcohol Abuse and Alcoholism (AA-010005;AA-013341; AA-016690; AA-015626) and the Department ofVeterans Affairs (Merit Review Grant; Research Career Sci-entist award) to SCP. The Alcohol Research Resource Award(R24AA015512) to Indiana University provided support forthe selective breeding of P and NP rats.

REFERENCES

Agassandian K, Gedney M, Cassell MD (2006) Neurotrophic factors in the

central nucleus of amygdala may be organized to provide substrates for

associative learning. Brain Res 1076:78–86.

Alheid GF, Beltramino CA, De Olmos JS, Forbes MS, Swanson DJ, Heimer

L (1998) The neuronal organization of the supracapsular part of the stria

terminalis in the rat: the dorsal component of the extended amygdala. Neu-

roscience 84:967–996.

Alheid GF, Heimer L (1988) New perspectives in basal forebrain organization

of special relevance for neuropsychiatric disorders: the striatopallidal, amyg-

daloid, and corticopetal components of substantia innominata. Neurosci-

ence 27:1–39.

Barnea A, Roberts J (2001) Induction of functional and morphological

expression of neuropeptide Y (NPY) in cortical cultures by brain-derived

neurotrophic factor (BDNF): evidence for a requirement for extracellular-

regulated kinase (ERK)-dependent and ERK-independent mechanisms.

Brain Res 919:57–69.

Bibel M, Barde YA (2000) Neurotrophins: key regulators of cell fate and cell

shape in the vertebrate nervous system. Genes Dev 14:2919–2937.

Carter AR, Chen C, Schwartz PM, Segal RA (2002) Brain-derived neuro-

trophic factor modulates cerebellar plasticity and synaptic ultrastructure.

J Neurosci 22:1316–1327.

Chao J, Nestler EJ (2004) Molecular neurobiology of drug addiction. Annu

RevMed 55:113–132.

Charney DS, Deutch A (1996) A functional neuroanatomy of anxiety and

fear: implications for the pathophysiology and treatment of anxiety disor-

ders. Crit Rev Neurobiol 10:419–446.

Cloninger CR (1987) Neurogenetic adaptive mechanisms in alcoholism. Sci-

ence 236:410–416.

Condorelli DF, Dell’Albani P, Mudo G, Timmusk T, Belluardo N (1994)

Expression of neurotrophins and their receptors in primary astroglial

cultures: induction by cyclic AMP-elevating agents. J Neurochem

63:509–516.

Condorelli DF, Salin T, Dell’Albani P, Mudo G, Corsaro M, Timmusk T,

Metsis M, Belluardo N (1995) Neurotrophins and their trk receptors in cul-

tured cells of the glial lineage and in white matter of the central nervous sys-

tem. J Mol Neurosci 6:237–248.

Conner JM, Lauterborn JC, Yan Q, Gall CM, Varon S (1997) Distribution of

brain-derived neurotrophic factor (BDNF) protein and mRNA in the nor-

mal adult rat CNS: evidence for anterograde axonal transport. J Neurosci

17:2295–2313.

Davis M (1997) Neurobiology of fear responses: the role of the amygdala.

J Neuropsychiatry Clin Neurosci 9:382–402.

Davis M (2006) Neural systems involved in fear and anxiety measured with

fear-potentiated startle. Am Psychol 61:741–756.

Davis M, Whalen PJ (2001) The amygdala: vigilance and emotion. Mol Psy-

chiatry 6:13–34.

Duman RS (2004) Role of neurotrophic factors in the etiology and treatment

of mood disorders. Neuromolecular Med 5:11–25.

Ehlers CL, Chaplin RI, Wall TL, Lumeng L, Li TK, Owens MJ, Nemeroff

CB (1992) Corticotropin releasing factor(CRF): studies in alcohol preferring

and non-preferring rats. Psychopharmacology (Berl.) 106:359–364.

Enoch MA (2003) Pharmacogenomics of alcohol response and addiction. Am

J Pharmacogenomics 3:217–232.

Furukawa S, Sugihara Y, Iwasaki F, Fukumitsu H, Nitta A, Nomoto H,

Furukawa Y (1998) Brain-derived neurotrophic factor-like immunoreactiv-

ity in the adult rat central nervous system predominantly distributed in neu-

rons with substantial amounts of brain-derived neurotrophic factor

messenger RNA or responsiveness to brain-derived neurotrophic factor.

Neuroscience 82:653–670.

Hensler JG, Ladenheim EE, Lyons WE (2003) Ethanol consumption and

serotonin-1A (5-HT1A) receptor function in heterozygous BDNF (+ ⁄ -)mice. J Neurochem 85:1139–1147.

Hwang BH, Stewart R, Zhang JK, Lumeng L, Li TK (2004) Corticotropin-

releasing factor gene expression is down-regulated in the central nucleus of

the amygdala of alcohol-preferring rats which exhibit high anxiety: a com-

parison between rat lines selectively bred for high and low alcohol prefer-

ence. Brain Res 1026:143–150.

Hwang BH, Zhang J-K, Elhers CL, Lumeng L, Li TK (1999) Innate differ-

ences of neuropeptide Y (NPY) in hypothalamic nuclei and central nucleus

of the amygdala between selectively bred rats with high and low alcohol

preference. Alcohol Clin Exp Res 23:1023–1030.

Hyman SE, Malenka RC (2001) Addiction and the brain: the neurobiology of

compulsion and its persistence. Nat Rev Neurosci 2:695–703.

Imperato A, Di Chiara G (1986) Preferential stimulation of dopamine release

in the nucleus accumbens of freely moving rats by ethanol. J Pharmacol

Exp Ther 239:219–228.

Impey S, Obrietan K, Storm DR (1999) Making new connections: role of

ERK ⁄MAP kinase signaling in neuronal plasticity. Neuron 23:11–14.

Izzo E, Auta J, Impagnatiello F, Pesold C, Guidotti A, Costa E (2001) Glu-

tamic acid decarboxylase and glutamate receptor changes during tolerance

and dependence to benzodiazepines. Proc Natl Acad Sci U S A 98:3483–

3488.

Jiang X, Xu K, Hoberman J, Tian F, Marko AJ, Waheed JF, Harris CR,

Marini AM, Enoch MA, Lipsky RH (2005) BDNF variation and mood

disorders: a novel functional promoter polymorphism and Val66Met are

associated with anxiety but have opposing effects. Neuropsychopharmaco-

logy 30:1353–1361.

Jones AE, McBride WJ, Murphy JM, Lumeng L, Li TK, Shekhar A,

McKinzie DL (2000) Effects of ethanol on startle responding in alcohol-

preferring and non-preferring rats. Pharmacol Biochem Behav 67:313–

318.

Kawamoto Y, Nakamura S, Nakano S, Oka N, Akiguchi I, Kimura J (1996)

Immunohistochemical localization of brain-derived neurotrophic factor in

adult rat brain. Neuroscience 74:1209–1226.

918 PRAKASH ET AL.

Kohara K, Kitamura A, MorishimaM, Tsumoto T (2001) Activity-dependent

transfer of brain-derived neurotrophic factor to postsynaptic neurons. Sci-

ence 291:2419–2423.

Koob GF (2003a) Alcoholism: allostasis and beyond. Alcohol Clin Exp Res

27:232–243.

Koob GF (2003b) Neuroadaptive mechanisms of addiction: studies on the

extended amygdala. Eur Neuropsychopharmacol 13:442–452.

Lang UE, Hellweg R, Kalus P, Bajbouj M, Lenzen KP, Sander T, Kunz D,

Gallinat J (2005) Association of a functional BDNF polymorphism and

anxiety-related personality traits. Psychopharmacology (Berl.) 180:95–99.

Li TK, Lumeng L, Doolittle DP (1993) Selective breeding for alcohol prefer-

ence and associated responses. Behav Genet 23:163–170.

Li TK, Lumeng L, McBride WJ, Murphy J (1987) Rodent lines selected for

factors affecting alcohol consumption. Alcohol Alcohol Suppl 1:91–96.

Lyons WE, Mamounas LA, Ricaurte GA, Coppola V, Reid SW, Bora SH,

Wihler C, Koliatsos VE, Tessarollo L (1999) Brain-derived neurotrophic

factor-deficient mice develop aggressiveness and hyperphagia in conjunction

with brain serotonergic abnormalities. Proc Natl Acad Sci U S A 96:15239–

15244.

Magavi SS, Leavitt BR, Macklis JD (2000) Induction of neurogenesis in the

neocortex of adult mice. Nature 405:951–955.

Matsushita S, Kimura M, Miyakawa T, Yoshino A, Murayama M, Masa-

ki T, Higuchi S (2004) Association study of brain-derived neurotrophic

factor gene polymorphism and alcoholism. Alcohol Clin Exp Res

28:1609–1612.

McBride WJ (2002) Central nucleus of the amygdala and the effects of alcohol

and alcohol-drinking behavior in rodents. Pharmacol Biochem Behav

71:509–515.

McBride WJ, Li TK (1998) Animal models of alcoholism: neurobiology of

high alcohol-drinking behavior in rodents. Crit Rev Neurobiol 12:339–369.

McGough NN, He DY, Logrip ML, Jeanblanc J, Phamluong K, Luong K,

Kharazia V, Janak PH, Ron D (2004) RACK1 and brain-derived neuro-

trophic factor: a homeostatic pathway that regulates alcohol addiction.

J Neurosci 24:10542–10552.

Mckinzie DL, Sajdyk TJ, Mcbride WJ, Murphy JM, Lumeng L, Li TK, She-

khar A (2000) Acoustic startle and fear-potentiated startle in alcohol-prefer-

ring (P) and -nonpreferring (NP) lines of rats. Pharmacol Biochem Behav

65:691–696.

Murphy JM, Stewart RB, Bell RL, Badia-Elder NE, Carr LG, McBride WJ,

Lumeng L, Li TK (2002) Phenotypic and genotypic characterization of the

Indiana University rat lines selectively bred for high and low alcohol prefer-

ence. Behav Genet 32:363–388.

National Institute on Alcohol Abuse and Alcoholism, (1993) Eighth Special

Report to the Congress on Alcohol and Health, DHHS Publication No.

ADM 281-91-003, Bethesda.

Nawa H, Bessho Y, Carnahan J, Nakanishi S, Mizuno K (1993) Regulation

of neuropeptide expression in cultured cerebral cortical neurons by brain-

derived neurotrophic factor. J Neurochem 60:772–775.

Nawa H, Pelleymounter MA, Carnahan J (1994) Intraventricular adminstra-

tion of BDNF increases neuropeptide expression in newborn rat brain.

J Neurosci 14:3751–3765.

Olive MF, Koenig HN, Nannini MA, Hodge CW (2002) Elevated extracellu-

lar CRF levels in the bed nucleus of the stria terminalis during ethanol with-

drawal and reduction by subsequent ethanol intake. Pharmacol Biochem

Behav 72:213–220.

Pandey SC (2003) Anxiety and alcohol abuse disorders: a common role for

CREB and its target, the neuropeptide Y gene. Trends Pharmacol Sci

24:456–460.

Pandey SC (2004) The gene transcription factor cyclic AMP-responsive ele-

ment binding protein: role in positive and negative affective states of alcohol

addiction. Pharmacol Ther 104:47–58.

Pandey SC, Lumeng L, Li TK (1996) Serotonin2C receptors and serotonin2Creceptor-mediated phosphoinositide hydrolysis in the brain of alcohol-pre-

ferring and alcohol-nonpreferring rats. Alcohol Clin Exp Res 20:1038–1042.

Pandey SC, Roy A, Zhang H, Xu T (2004) Partial deletion of the cAMP

response element-binding protein gene promotes alcohol-drinking behav-

iors. J Neurosci 24:5022–5030.

Pandey SC, Zhang H, Roy A, Misra K (2006) Central and medial amygdaloid

brain-derived neurotrophic factor signaling plays a critical role in alcohol-

drinking and anxiety-like behaviors. J Neurosci 26:8320–8331.

Pandey SC, Zhang H, Roy A, Xu T (2005) Deficits in amygdaloid cAMP-

responsive element-binding protein signaling play a role in genetic predispo-

sition to anxiety and alcoholism. J Clin Invest 115:2762–2773.

Poo MM (2001) Neurotrophins as synaptic modulators. Nat Rev Neurosci

2:24–32.

Radel M, Goldman D (2001) Pharmacogenetics of alcohol response and alco-

holism: The interplay of genes and environmental factors in thresholds for

alcoholism. DrugMetab Dispos 29:489–494.

Riley CP, Cope TC, Buck CR (2004) CNS neurotrophins are biologically

active and expressed by multiple cell types. J Mol Histol 35:771–783.

Rios M, Fan G, Fekete C, Kelly J, Bates B, Kuehn R, Lechan RM, Jaenisch

R (2001) Conditional deletion of brain-derived neurotrophic factor in the

postnatal brain leads to obesity and hyperactivity. Mol Endocrinol 15:1748–

1757.

Robbins TW, Everitt BJ (1996) Neurobehavioural mechanisms of reward and

motivation. Curr Opin Neurobiol 6:228–236.

Rodd ZA, Bell RL, Sable HJ, Murphy JM, McBride WJ (2004) Recent

advances in animal models of alcohol craving and relapse. Pharmacol Bio-

chem Behav 79:439–450.

Rumajogee P, Madeira A, Verge D, Hamon M, Miquel MC (2002) Up-regu-

lation of the neuronal serotoninergic phenotype in vitro: BDNF and cAMP

share Trk B-dependent mechanisms. J Neurochem 83:1525–1528.

Shaham Y, Erb S, Stewart J (2000) Stress-induced relapse to heroin and

cocaine seeking in rats: a review. Brain Res Brain Res Rev 33:13–33.

Shieh PB, Hu SC, Bobb K, Timmusk T, Ghosh A (1998) Identification of a

signaling pathway involved in calcium regulation of BDNF expression.

Neuron 20:727–740.

Spenger C, Hyman C, Studer L, Egli M, Evtouchenko L, Jackson C, Dahl-

Jorgensen A, Lindsay RM, Seiler RW (1995) Effects of BDNF on dopami-

nergic, serotonergic, and GABAergic neurons in cultures of human fetal

ventral mesencephalon. Exp Neurol 133:50–63.

Stewart RB, Gatto GJ, Lumeng L, Li TK, Murphy JM (1993) Comparison of

alcohol-preferring (P) and nonpreferring (NP) rats on tests of anxiety and

for the anxiolytic effects of ethanol. Alcohol 10:1–10.

Thoenen H (1995) Neurotrophins and neuronal plasticity. Science 270:593–

598.

Thoenen H (2000) Neurotrophins and activity-dependent plasticity. Prog

Brain Res 128:183–191.

Thome J, Gewirtz JC, Weijers HG, Wiesbeck GA, Henn FA (2000) Genome

polymorphism and alcoholism. Pharmacogenomics 1:63–71.

Tokuyama W, Okuno H, Hashimoto T, Li YX, Miyashita Y (2000) BDNF

upregulation during declaration memory formation in monkey inferior tem-

poral cortex. Nat Neurosci 3:1134–1142.

Uhl GR, Liu QR, Walther D, Hess J, Naiman D (2001) Polysubstance abuse-

vulnerability genes: genome scans for association, using 1,004 subjects and

1,494 single-nucleotide polymorphisms. Am J HumGenet 69:1290–1300.

Van Bockstaele EJ, Peoples J, Valentino RJ (1999) A.E. Bennett Research

Award: Anatomic basis for differential regulation of the rostrolateral

peri-locus coeruleus region by limbic afferents. Biol Psychiatry 46: 1352–

1363.

Weiss F, Lorang MT, Bloom FE, Koob GF (1993) Oral alcohol self-adminis-

tration stimulates dopamine release in the rat nucleus accumbens: genetic

and motivational determinants. J Pharmacol Exp Ther 267:250–258.

Weitlauf C, Egli RE, Grueter BA, Winder DG (2004) High frequency stimula-

tion induces ethanol-sensitive long-term potentiation at glutamatergic syn-

apses in the dorsolateral bed nucleus of the stria terminalis. J Neurosci

24:5741–5747.

Wetmore C, Cao YH, Pettersson RF, Olson L (1991) Brain-derived neuro-

trophic factor: subcellular compartmentalization and interneuronal transfer

as visualized with anti-peptide antibodies. Proc Natl Acad Sci USA 88:

9843–9847.

Wolf HK, Buslei R, Schmidt-Kastner R, Schmidt-Kastner PK, Pietsch T,

Wiestler OD, Blumcke I (1996) NeuN: a useful neuronal marker for diag-

nostic histopathology. J Histochem Cytochem 44:1167–1171.

ALCOHOL PREFERENCE IN THE EXPRESSION OF BRAIN-DERIVED NEUROTROPHIC FACTOR 919

Xu T, Pandey SC (2000) Cellular localization of serotonin2A (5-HT2A) recep-

tors in the rat brain. Brain Res Bull 51:499–505.

Yamasaki Y, Shigeno T, Furukawa Y, Furukawa S (1998) Reduction in

brain-derived neurotrophic factor protein levels in the hippocampal CA1

dendritic field precedes the delayed neuronal damage in the rat brain. J Neu-

rosci Res 53:318–329.

Yan QS, Feng MJ, Yan SE (2005) Different expression of brain-derived neu-

rotrophic factor in the nucleus accumbens of alcohol-preferring (P) and

-nonpreferring (NP) rats. Brain Res 1035:215–218.

Yanamoto H, Mizuta I, Nagata I, Xue J, Zhang Z, Kikuchi H (2000) Infarct

tolerance accompanied enhanced BDNF-like immunoreactivity in neuronal

nuclei. Brain Res 877:331–344.

Ying SW, Futter M, Rosenblum K, Webber MJ, Hunt SP, Bliss TV, Bram-

ham CR (2002) Brain-derived neurotrophic factor induces long-term poten-

tiation in intact adult hippocampus: requirement for ERK activation

coupled to CREB and upregulation of Arc synthesis. J Neurosci 22:1532–

1540.

Zafra F, Lindholm D, Castren E, Hartikka J, Thoenen H (1992) Regulation

of brain-derived neurotrophic factor and nerve growth factor mRNA in pri-

mary cultures of hippocampal neurons and astrocytes. J Neurosci 12:4793–

4799.

Zhou XF, Song XY, Zhong JH, Barati S, Zhou FH, Johnson SM (2004) Dis-

tribution and localization of pro-brain-derived neurotrophic factor-like

immunoreactivity in the peripheral and central nervous system of the adult

rat. J Neurochem 91:704–715.

Zhou J, Zhang H, Cohen RS, Pandey SC (2005) Effects of estrogen treat-

ment on expression of brain-derived neurotrophic factor and cAMP

response element-binding protein expression and phosphorylation in rat

amygdaloid and hippocampal structures. Neuroendocrinology 81:294–

310.

920 PRAKASH ET AL.