Initiation of Swarming Motility by Proteus mirabilis Occurs in … · (4). Once bacteria have...

Initiation of Swarming Motility by Proteus mirabilis Occurs inResponse to Specific Cues Present in Urine and Requires ExcessL-Glutamine

Chelsie E. Armbruster, Steven A. Hodges, Harry L. T. Mobley

Department of Microbiology and Immunology, University of Michigan Medical School, Ann Arbor, Michigan, USA

Proteus mirabilis, a leading cause of catheter-associated urinary tract infection (CaUTI), differentiates into swarm cells that mi-grate across catheter surfaces and medium solidified with 1.5% agar. While many genes and nutrient requirements involved inthe swarming process have been identified, few studies have addressed the signals that promote initiation of swarming followinginitial contact with a surface. In this study, we show that P. mirabilis CaUTI isolates initiate swarming in response to specificnutrients and environmental cues. Thirty-three compounds, including amino acids, polyamines, fatty acids, and tricarboxylicacid (TCA) cycle intermediates, were tested for the ability to promote swarming when added to normally nonpermissive media.L-Arginine, L-glutamine, DL-histidine, malate, and DL-ornithine promoted swarming on several types of media without enhanc-ing swimming motility or growth rate. Testing of isogenic mutants revealed that swarming in response to the cues required pu-trescine biosynthesis and pathways involved in amino acid metabolism. Furthermore, excess glutamine was found to be a strictrequirement for swarming on normal swarm agar in addition to being a swarming cue under normally nonpermissive condi-tions. We thus conclude that initiation of swarming occurs in response to specific cues and that manipulating concentrations ofkey nutrient cues can signal whether or not a particular environment is permissive for swarming.

Urinary tract infection (UTI) is one of the most common hos-pital-associated infections, with an estimated 424,000 cases

and 13,000 UTI-related deaths in U.S. hospitals in 2002 (1). Inaddition, placement of an indwelling catheter predisposes indi-viduals to the development of catheter-associated UTI (CaUTI),the most common type of nosocomial infection (2, 3). CaUTI isgenerally thought to be caused by self-inoculation of the catheter(4). Once bacteria have colonized the catheter, motile species canrapidly traverse the catheter surface to reach the bladder and po-tentially establish a UTI.

The dimorphic, motile, Gram-negative bacterium Proteus mi-rabilis is one of the leading causative agents of CaUTI, responsiblefor up to 44% of these infections (3, 5–7). P. mirabilis infectionsfrequently develop into cystitis and pyelonephritis and can be fur-ther complicated by catheter encrustation and formation of uri-nary stones (8, 9). P. mirabilis has fascinated scientists for over 125years for its ability to differentiate from short swimmer cells intoelongated swarm cells that express hundreds to thousands of fla-gella (10). These swarm cells interact intimately with one anotherto form multicellular rafts (11–13). In the context of CaUTI, P.mirabilis utilizes this process of swarming to migrate along thecatheter surface, gaining entry to the bladder and causing painfuland sometimes serious complications (3, 14).

Swarming is distinct from swimming motility in that it refers tomulticellular flagellum-mediated migration across a surfacerather than movement in liquid medium or through soft agar. P.mirabilis swarming also requires differentiation into a distinctswarm cell morphology. Regulation of the swarm cell differentia-tion process is not fully understood, but many components havebeen investigated and recently reviewed (15–17). For instance,surface contact and the resulting inhibition of flagellar rotationare critical for swarm cell differentiation in most strains (18), anda combination of surface contact and changes in cell wall andlipopolysaccharide composition ultimately promote activity of

the flagellar master regulator FlhD2C2 and expression of the fla-gellar genes (18–22). Factors that impact temporal regulation ofswarming, swarm speed, or overall swarm pattern have also beenidentified, such as putrescine and certain fatty acids (23, 24).There is also an intimate connection between swarming and en-ergy metabolism, as normal swarming requires pathways that gen-erate pyruvate and a complete oxidative tricarboxylic acid (TCA)cycle, even though P. mirabilis appears to use anaerobic respira-tion during swarming (25–27). P. mirabilis swarming is also influ-enced by aeration, growth rate, cell density, and the concentrationof NaCl or other electrolytes (28–31).

Despite these advances in the understanding of swarming, in-formation is limited regarding whether or not P. mirabilis usesnutrient conditions or environmental cues as specific signals toinitiate swarming following contact with a solid surface. An earlyinvestigation of nutritional requirements for swarming showedthat a mixture of 22 amino acids promoted swarming on a nor-mally nonpermissive minimal medium and that glutamic acid,aspartic acid, serine, proline, alanine, asparagine, and glutaminewere each sufficient to promote swarming when added individu-ally to the base medium (29). That study also found that thesesame amino acids decreased the generation time in liquid culture,suggesting a correlation between swarming and growth rate. Amore recent investigation into potential swarming cues for a P.

Received 19 November 2012 Accepted 6 January 2013

Published ahead of print 11 January 2013

Address correspondence to Harry L. T. Mobley, [email protected].

Supplemental material for this article may be found at http://dx.doi.org/10.1128/JB.02136-12.

Copyright © 2013, American Society for Microbiology. All Rights Reserved.

doi:10.1128/JB.02136-12

March 2013 Volume 195 Number 6 Journal of Bacteriology p. 1305–1319 jb.asm.org 1305

on April 23, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

http://dx.doi.org/10.1128/JB.02136-12

http://dx.doi.org/10.1128/JB.02136-12

http://dx.doi.org/10.1128/JB.02136-12

http://jb.asm.org

http://jb.asm.org/

mirabilis UTI isolate revealed that the addition of glutamine to adifferent formulation of nonpermissive minimal medium allowedfor initiation of swarming, yet 19 other proteinogenic amino acidswere not sufficient (32).

Putrescine also has the potential to be a signal for initiation ofswarming (23). P. mirabilis can produce putrescine either directlyfrom ornithine via ornithine decarboxylase (SpeF) or sequentiallyfrom arginine and agmatine via arginine decarboxylase (SpeA)and agmatinase (SpeB), and putrescine accumulation repressesSpeA activity (23, 33). Disruption of speA or speB results in asevere swarming defect which can be complemented by exoge-nous putrescine, as would be expected if putrescine acts as a sig-naling molecule. However, as putrescine is also a component ofthe outer membrane of P. mirabilis (34), the exact cell-cell com-munication capabilities of this molecule remain unclear.

In this study, we expand on these previous investigations byfurther testing the hypothesis that P. mirabilis CaUTI isolates re-spond to specific cues capable of initiating swarming. Normallynonpermissive low-salt LB agar was used as a complex medium toscreen for compounds that promote swarming, and a defined me-dium that does not permit swarming was used to precisely deter-mine whether the nutrients act as swarming cues (35). P. mirabilisstrain HI4320 was chosen for these investigations, as this strain isa CaUTI isolate for which the complete genome sequence is avail-able, facilitating the generation of isogenic mutants to identifygenes required for responses to the swarming cues. Using thisapproach, we identified five swarming cues (L-arginine, DL-histi-dine, L-glutamine, malate, and DL-ornithine), four of which hadnot previously been linked to swarming in P. mirabilis and all ofwhich were detected in normal human urine. The ability to pro-mote swarming required synthesis of both putrescine and glu-tamine and did not correlate with an alteration of the growth rate.Swarming in response to the cues was affected by disruption ofpathways involved in amino acid metabolism, such as the oxida-tive TCA cycle, and required synthesis of glutamine but not argi-nine or histidine. Furthermore, in addition to promoting swarm-ing under normally nonpermissive conditions, excess L-glutaminerepresented a strict requirement for swarming in general but notswimming motility. We conclude that P. mirabilis HI4320 initiatesswarming in response to specific cues that are present in normalhuman urine and may therefore have physiological relevance forthe establishment of CaUTI. Furthermore, while the response to

these cues requires specific metabolic pathways, all but malateappear to promote swarming independently of their known rolesin biosynthetic pathways.

MATERIALS AND METHODSBacterial strains and culture conditions. A complete list of bacterialstrains used in this study is provided in Table 1. All mutants were gener-ated with P. mirabilis strain HI4320. CaUTI isolates that were tested forthe ability to respond to swarming cues were isolated from female patientswho were catheterized for �100 consecutive days (7). Bacteria were rou-tinely cultured at 37°C with aeration in LB broth (10 g/liter tryptone, 5g/liter yeast extract, 0.5 g/liter NaCl) or on LB broth solidified with 1.5%agar. Normal swarming was assessed by using swarm agar (LB agar with 5g/liter NaCl), and swarming initiation studies utilized nonpermissive low-salt LB agar (0.5 g/liter NaCl), with test compounds added at a final con-centration of 20 mM. Swimming motility was assessed by using Mot me-dium (10 g/liter tryptone, 5 g/liter NaCl) solidified with 0.3% agar. Proteusmirabilis minimal salts medium (PMSM) (35) was utilized for studiesrequiring defined medium [10.5 g/liter K2HPO4, 4.5 g/liter KH2PO4, 0.47g/liter sodium citrate, 1 g/liter (NH4)2SO4, and 15 g/liter agar, supple-mented with 0.001% nicotinic acid, 1 mM MgSO4, and 0.2% glycerol].For studies using human urine, samples from 5 healthy female donorswere pooled, filter sterilized, and solidified with 1.5% agar, where indi-cated. Media were supplemented with chloramphenicol (20 �g/ml), am-picillin (100 �g/ml), kanamycin (25 �g/ml), or tetracycline (5 �g/ml), asrequired.

Construction of mutant strains. A kanamycin resistance gene wasinserted into speB, speF, hisG, or glnA by using the TargeTron method(Sigma) according to the manufacturer’s instructions, as previously de-scribed (36). Primer sequences for intron reprogramming are included inTable 2 for each gene. Mutants were verified by PCR with primers desig-nated “ver” in Table 2.

Screen for compounds that promote initiation of swarming. For ini-tial identification of swarming cues, test compounds purchased fromSigma (L-amino acids, TCA cycle intermediates, urea cycle intermediates,polyamines, and fatty acids) were dissolved in distilled H2O or methanolfor fatty acids and passed through a 0.22-�m Millex filter (Millipore). LBagar was prepared and autoclaved, cooled to �42°C, and supplementedwith a test compound to a final concentration of 20 mM prior to pouring.Exactly 8 ml of agar was dispensed into 60-mm petri dishes (Fisher Scien-tific). P. mirabilis HI4320, isogenic mutants, and other CaUTI isolateswere cultured for �8 h in LB broth at 37°C with aeration, and plates wereinoculated with 5 �l of these cultures and incubated at 37°C for 18 h.Swarm diameter was measured by using a caliper. This strategy was also

TABLE 1 P. mirabilis strains used in this study

Strain Description Reference

HI4320 Proteus mirabilis isolated from the urine of an elderly, long-term-catheterized woman 7ureC Ampr and disrupted urease subunit alpha 54speB Kanr insertion disrupting agmatinase (polyamine biosynthesis) This studyspeF Kanr insertion disrupting ornithine decarboxylase (polyamine biosynthesis) This studyspeBF Kanr insertion disrupting ornithine decarboxylase was excised, and an additional Kanr

gene was inserted into agmatinase (polyamine biosynthesis)This study

argG Kanr insertion disrupting arininosuccinate synthase (urea cycle) 27argH Tn5 insertion disrupting argininosuccinate lyase (urea cycle) 27hisG Kanr insertion disrupting ATP phosphoribosyltransferase (histidine biosynthesis) This studyglnA Kanr insertion disrupting glutamine synthetase (GS-GOGAT) This studygdhA Kanr insertion disrupting glutamate dehydrogenase 53sdhB Kanr insertion disrupting succinate dehydrogenase subunit B (TCA cycle) 27frdA Kanr insertion disrupting fumarate reductase subunit A (TCA cycle) 27fumC Kanr insertion disrupting fumarate hydratase (TCA cycle) 27

Armbruster et al.

1306 jb.asm.org Journal of Bacteriology


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

used to test the ability of the swarming cues to induce swarming on PMSMand urine agar.

Measurement of swimming motility. Mot agar was autoclaved,cooled to approximately �42°C, and supplemented with individualswarming cues to a final concentration of 20 mM, and 20 ml was dis-pensed into 100-mm petri dishes (Fisher Scientific). Mot plates were al-lowed to dry at room temperature for �5 h and stab inoculated with aculture of HI4320 grown for �8 h in LB medium at 37°C with aeration.Mot plates were incubated at 30°C for �16 h, and swimming diameter wasmeasured by using a caliper.

Analysis of urine composition. Urine samples collected from 5healthy female donors were pooled and filter sterilized, and 4 aliquots of0.5 ml were immediately frozen. The remaining pool was used to generateurine agar plates. Duplicate aliquots were sent to the Directed Metabolo-mics Laboratory of the Michigan Nutrition and Obesity Research Centerat the University of Michigan. Purification of amino acids and derivatiza-tion for gas chromatography (GC)-mass spectrometry (MS) analysis wereperformed by using the EZ:faast kit for free amino acids (Phenomenex)(37). TCA cycle metabolites and nucleotides were analyzed by liquid chro-matography (LC)-MS using mixed-mode hydrophilic interaction–anion-exchange liquid chromatography, as described previously by Lorenz et al.(38).

Testing the influence of pH and urea on swarming. The same generalstrategy described above for the screen was used to test the impact of pHand urea on swarming. For pH studies, PMSM is a well-buffered medium,but LB agar was buffered with 10 mM HEPES (Fisher Scientific). The pHof the medium was adjusted to exactly 5.0, 6.0, 7.0, 8.0, or 9.0 with HCl orKOH prior to autoclaving. Unsupplemented LB broth and PMSM werepH �7.0. For urea studies, urea was added to LB agar prior to pouring fora final concentration of 10 mM, 25 mM, 50 mM, 100 mM, or 500 mM. Forstudies on swarm agar, exactly 20 ml of medium was dispensed into100-mm petri dishes instead of 60-mm petri dishes.

Growth curves. Bacteria were cultured at 37°C overnight in 5 ml LBbroth with aeration. Cultures grown overnight were diluted 1:100 in LBbroth or PMSM supplemented with the swarming cues to a final concen-tration of 20 mM. A Bioscreen-C automated growth curve analysis system(Growth Curves USA) was utilized to generate growth curves. Cultureswere incubated at 37°C with continuous shaking, and optical density at600 nm (OD600) readings were taken every 15 min for 24 h.

Statistics. Significance was determined by unpaired Student’s t test,two-way analysis of variance (ANOVA), or Pearson’s correlation withlinear regression, where appropriate. All P values are two tailed at a 95%confidence interval. Analyses were performed by using GraphPad Prism,version 5 (GraphPad Software, San Diego, CA).

RESULTSIdentification of compounds that promote Proteus mirabilisswarming on a nonpermissive rich medium. LB agar containing100 mM NaCl allows for robust swarming and is referred tothroughout as swarm agar. Decreasing the salt concentration to 10mM generates a rich medium that does not permit swarmingwithin 24 h of growth at 37°C, which is referred to simply as LBagar or low-salt LB agar. Importantly, low-salt LB agar does notinhibit swarm cell differentiation, as P. mirabilis can swarm onthese plates if incubated at 30°C or room temperature. The lowestconcentration of NaCl that promotes detectable motility for P.mirabilis strain HI4320 after 24 h of growth at 37°C was experi-mentally determined to be �30 mM (Fig. 1A). Therefore, testcompounds were added to LB agar at a final concentration of 20mM to ensure a high-enough concentration to allow for identifi-cation of all factors that induce swarming while remaining belowthe concentration of NaCl that makes LB agar permissive forswarming.

Thirty-three compounds representing 20 proteinogenic aminoacids, 5 TCA cycle intermediates, 6 urea cycle intermediates, 3fatty acids, and 5 intermediates in polyamine biosynthesis weretested for their ability to promote swarming when added to LBagar (Fig. 1B). Of these compounds, seven significantly increasedswarm colony diameter when added in excess to LB agar. Argi-nine, glutamine, histidine, malate, and ornithine promoted thedevelopment of at least two distinct swarm rings (Fig. 1C) thatcontained elongated swarm cells (see Fig. S1 in the supplementalmaterial) and are referred to as swarming cues. While theseswarming cues consistently promoted swarming on low-salt LBagar, it is important to note that the swarms exhibited moderate

TABLE 2 Primers used in this study

Primer Sequence

speB-IBS AAAAAAGCTTATAATTATCCTTATTCACCTCCTGTGTGCGCCCAGATAGGGTGspeB-EBS1d CAGATTGTACAAATGTGGTGATAACAGATAAGTCTCCTGTTTTAACTTACCTTTCTTTGTspeB-EBS2 TGAACGCAAGTTTCTAATTTCGGTTGTGAATCGATAGAGGAAAGTGTCTspeF-IBS AAAAAAGCTTATAATTATCCTTATCCTTCATAACGGTGCGCCCAGATAGGGTGspeF-EBS1d CAGATTGTACAAATGTGGTGATAACAGATAAGTCATAACGTGTAACTTACCTTTCTTTGTspeF-EBS2 TGAACGCAAGTTTCTAATTTCGGTTAAGGATCGATAGAGGAAAGTGTCThisG-IBS AAAAAAGCTTATAATTATCCTTAGCTTGCCGTTTAGTGCGCCCAGATAGGGTGhisG-EBS1d CAGATTGTACAAATGTGGTGATAACAGATAAGTCCGTTTATCTAACTTACCTTTCTTTGThisG-EBS2 TGAACGCAAGTTTCTAATTTCGATTCAAGCTCGATAGAGGAAAGTGTCTglnA-IBS AAAAAAGCTTATAATTATCCTTACAAATCTATAAAGTGCGCCCAGATAGGGTGglnA-EBS1d CAGATTGTACAAATGTGGTGATAACAGATAAGTCTATAAATATAACTTACCTTTCTTTGTglnA-EBS2 TGAACGCAAGTTTCTAATTTCGGTTATTTGTCGATAGAGGAAAGTGTCTspeB-ver-F TCCGGCAAGGGCAGTAATATCTGAspeB-ver-R GTGCTCACGCTAAACACTTTGGCAspeF-ver-F TTTCCACGGCAACTAACTCCACCTspeF-ver-R AGCATCTGGTCGCACAAATTGCTChisG-ver-F TGGACGGAGTGGTTGATTTAGGCAhisG-ver-R TTGTTGCGTCCATTTCACCGTCACglnA-ver-F TGGCCCTGAACCTGAATTCTTCCTglnA-ver-R AGGATCTGGGAAACGCACTTCGATpACD4K-C5= CCGCGAAATTAATACGACTCACTApACD4K-C3= GGTATCCCCAGTTAGTGTTA

Proteus mirabilis Swarming Cues

March 2013 Volume 195 Number 6 jb.asm.org 1307


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

variability in pattern and diameter between independent experi-ments. Fumarate and agmatine allowed for a statistically signifi-cant increase in swarm colony diameter but did not consistentlypromote the development of more than one swarm ring and weretherefore not considered to be swarming cues.

Swarming in response to glutamine, histidine, malate, and or-nithine generally exhibited a normal dose response, while arginineexhibited a dose response only at concentrations of up to 20 mM,and higher concentrations prevented swarming (see Fig. S2 in thesupplemental material). Importantly, none of the five cues dra-matically altered normal swarming on permissive medium, al-though arginine resulted in a slight but statistically significant de-crease in the diameter of the second swarm ring (P � 0.001), andglutamine resulted in a slight but statistically significant increasein the diameter of all swarm rings (P � �0.05) (see Fig. S3 in thesupplemental material). All five swarming cues were also capableof promoting swarming when the salt concentration was de-creased to 5 mM or lower (data not shown). None of the cues

enhanced swimming motility through semisolid Mot agar, indi-cating that the identified cues are specific for swarming (Fig. 2).Furthermore, the cues were not observed to promote swarm celldifferentiation during culture in LB broth, indicating that surfacecontact is required for swarming in response to the cues and thatthey do not strictly force swarm cell differentiation (data notshown). Thus, P. mirabilis HI4320 initiates swarming on agarplates in response to swarming-specific cues that include one TCAcycle intermediate (malate), three proteinogenic amino acids (ar-ginine, glutamine, and histidine), and two amino acid intermedi-ates of both polyamine synthesis and the urea cycle (arginine andornithine).

Most P. mirabilis CaUTI isolates tested respond to the fiveswarming cues. To determine if the identified swarming cues areuniversal for P. mirabilis CaUTI isolates, 20 clinical isolates wereexamined for swarming on swarm agar and the response to theswarming cues for comparison to P. mirabilis HI4320 (Fig. 3).Two of the 20 isolates were nonmotile and were therefore ex-

FIG 1 Identification of factors that promote Proteus mirabilis swarming. (A) Representative images of swarming on LB agar containing increasing amounts ofsodium chloride. (B) Diameter of the P. mirabilis swarm colony following 18 h of incubation on low-salt LB agar containing the listed factors at a finalconcentration of 20 mM. The dashed line indicates the average swarm colony diameter for P. mirabilis HI4320 on LB agar containing 20 mM NaCl. Error barsrepresent means and standard deviations for three independent experiments with four replicates each. Statistical significance was determined by comparing theswarm colony diameter on test compounds to the diameter on LB medium containing 20 mM NaCl. �, P � 0.05; ��, P � 0.01; ��, P � 0.001. (C) Representativeimages of swarming induced by 20 mM arginine, glutamine, histidine, malate, or ornithine on low-salt LB agar.

Armbruster et al.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

cluded from the study. Of the remaining 18 isolates that weremotile, 5 were capable of swarming on low-salt LB agar, butswarm diameter was further enhanced by each of the swarmingcues (Fig. 3B). Ten of the isolates exhibited the same general re-sponse to all five swarming cues as P. mirabilis HI4320, althoughthe exact swarm pattern and diameter varied between isolates (Fig.3C). Two isolates swarmed in response to glutamine, histidine,malate, and ornithine but did not respond to arginine (Fig. 3D),and one isolate swarmed in response to ornithine but did notrespond to the other swarming cues (Fig. 3E). Thus, the identifiedswarming cues promoted swarming in the majority of P. mirabilis

CaUTI isolates tested, but considerable strain variability exists inthe extent of swarming that occurs in response to the cues.

Swarming cues promote swarming on other types of media.To determine if initiation of swarming is a specific response to thecues, a defined minimal salts medium (PMSM) that is not nor-mally permissive for swarming was utilized (35). Notably, PMSMlacks amino acids and contains only glycerol, citrate, and nicotinicacid. Unlike LB agar, the addition of sodium chloride to this me-dium does not make it permissive for swarming (data not shown).Only the four amino acid cues were capable of promoting swarm-ing on PMSM (Fig. 4A and B), indicating that arginine, glutamine,histidine, and ornithine alone are sufficient to induce swarming inminimal medium. In contrast, malate decreased the colony diam-eter on PMSM, indicating that this particular cue promotesswarming only in complex media.

As swarming along a urine-bathed catheter is a mechanism bywhich P. mirabilis gains entry to the urinary tract, it was impera-tive to determine if the cues influence swarming under physiolog-ically relevant conditions, such as when added to urine agar. Urinesamples collected from five healthy female donors were pooledand solidified with 1.5% agar. In agreement with the literature, allfive swarming cues were present in the pooled urine, with histi-dine being the second most concentrated free amino acid at 0.25mM (Table 3) (39–41). Interestingly, P. mirabilis HI4320 was un-able to swarm on urine agar, even when further supplementedwith the cues (Fig. 4C and D). However, P. mirabilis encodes aurease that cleaves urea to carbon dioxide and ammonia, resultingin a rapid increase in pH and precipitation of calcium and mag-nesium ions that form crystals (8). The rapid increase in pH andthe formation of crystals in the confined space of the plate caninterfere with growth and swarming, so a urease-negative (ureC)mutant was also tested for swarming on urine agar (Fig. 4C andD). Importantly, the ureC mutant exhibited modest swarming onunsupplemented urine agar that was significantly enhanced byeach of the cues (Fig. 4C) and resulted in production of elongatedswarm cells (data not shown). Interestingly, glutamine allowed forthe development of a bull’s-eye pattern, malate and ornithine pro-moted what appeared to be uncoordinated swarms, and swarmingin response to arginine or histidine did not always exhibit normalperiodicity. However, the results indicate that the four amino acidswarming cues are sufficient to promote swarming as long as

FIG 2 Swarming cues do not enhance swimming motility. (A) Representative images of swimming motility on plain Mot agar compared to Mot agar containingthe swarming cues at 20 mM. White horizontal lines indicate total swimming diameter at 16 h. (B) Graph of swimming motility diameter compiled from sixindependent experiments with three replicates each. The dashed line indicates the average swimming motility diameter in unsupplemented Mot agar. Error barsrepresent means and standard deviations. ��, P � 0.01.

FIG 3 Cues promote swarming in other Proteus mirabilis strains. Twenty P.mirabilis clinical isolates from patients with CaUTI were tested for their abilityto swarm in response to cues. Eighteen strains were capable of swarming onswarm agar and were further tested for responses to the swarming cues. (A)Representative images of the swarming pattern for HI4320 in response to thecues. (B) Representative images for five strains that swarmed on LB agar butincreased the swarm diameter in response to the cues. (C) Representativeimages for 10 strains that did not swarm on LB agar but responded to all fivecues. (D) Representative images for two strains that swarmed in response to allcues except arginine. (E) Representative images for one strain that respondedto ornithine only. All images are representative of two independent experi-ments with three replicates each.




http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

growth requirements are satisfied, while malate promotes swarm-ing only in more complex media, and all five compounds promoteswarming in human urine. Furthermore, swarming in response tothe cues on urine agar could be initiated with 0.1 mM each cue and

followed the same general trends as those observed with low-saltLB agar (see Fig. S4 in the supplemental material).

Response to swarming cues varies with pH and the additionof urea. One explanation for the difference between P. mirabilisHI4320 and the ureC mutant on urine agar is that swarming maybe suboptimal at basic pH, particularly as swarm cells appear to bemost abundant at low pH (42). To determine the impact of pH onswarming for P. mirabilis HI4320, swarm agar was buffered with10 mM HEPES and adjusted to pH 5.0, 6.0, 7.0, 8.0, or 9.0(Fig. 5A). Swarming was optimal at neutral pH, and the swarmring diameter varied across the pH range, but P. mirabilis wascapable of swarming at all pH values tested. To determine theimpact of urea and subsequent urease activity on swarming, ureawas added to swarm agar in concentrations ranging from 10 mMto 500 mM (Fig. 5B). Urea at 10 mM had no impact on swarmdiameter, but swarming was significantly impaired by 50 mM ureaand completely inhibited by 500 mM urea. Therefore, P. mirabilisHI4320 is capable of swarming at high pH and with a moderateconcentration of urea but is inhibited by high concentrations ofurea within the confines of a 100-mm petri dish.

As the urea concentration can reach 500 mM in urine, andurease activity results in a rapid increase in pH, the most relevantswarming cues for the study of CaUTI would need to be effectiveacross a wide pH range and promote swarming in the presence ofurea. When added to buffered LB agar, arginine and malate pro-moted the largest swarms at pH 6, glutamine and ornithine pro-moted the most swarming at pH 9, and modulating pH did notimpact swarming in response to histidine (Fig. 5C). Therefore,arginine and malate are optimal under slightly acidic conditions,while the other cues function well across a wide pH range butappear to be best at basic pH. Furthermore, all cues promotedswarming when urea was present at 5 mM, all but histidine pro-moted swarming with up to 25 mM urea, and ornithine still pro-moted swarming with over 100 mM urea (Fig. 5D).

Swarming in response to the swarming cues is not correlatedwith growth rate. A previous study of nutritional requirementsfor swarming found a correlation between induction of swarmingand decreased generation time (29). However, none of the swarm-

FIG 4 Cues promote swarming on other normally nonpermissive media. (A) Representative images of swarming in response to the five cues at 20 mM in PMSM.(B) Swarm colony diameter on PMSM for five independent experiments with 3 replicates each. The dashed line indicates the average swarm colony diameter onunsupplemented PMSM. (C) Comparison of swarming by P. mirabilis HI4320 and a ureC mutant on urine agar with swarming cues added to a final concen-tration of 20 mM. (D) Swarm colony diameter on urine agar for HI4320 and a ureC mutant. White lines indicate swarm diameter. Error bars represent meansand standard deviations for four independent experiments with four replicates each. Statistical significance was determined by comparing the swarm diameterunder each condition to the diameter on plain medium for each strain. �, P � 0.05; ��, P � 0.01; ��, P � 0.001.

TABLE 3 Composition of pooled urine from female donors

Component of pooled human urine Avg concn (�M)

Amino acids4-Hydroxyproline 0.62Alanine 130.61Alpha-aminoisobutyric acid 4.38Arginine �a

Asparagine 43.03Aspartic acid 5.81Cystine 6.76Glycine 775.09Glutamic acid 5.54Glutamine 66.92Histidine 250.04Isoleucine 4.81Leucine 12.51Lysine 23.43Methionine 3.41Ornithine 2.58Phenylalanine 17.15Proline 4.19Sarcosine 1.08Serine 122.02Threonine 69.36Tryptophan 8.38Tyrosine 19.83Valine 17.08

TCA cycle intermediatesAlpha-ketoglutarate 172.57Citrate 1,826.01Fumarate 2.59Malate 31.50Succinate 90.55

a �, arginine was detected, but the exact concentration could not be determined.

Armbruster et al.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

ing cues in the present study increased the growth rate in LB me-dium, and malate slightly decreased the optical density at whichstationary phase was achieved (P � 0.05) (Fig. 6), indicating thatthe cues do not promote swarming on LB agar by enhancing thegrowth rate. In PMSM, however, glutamine enhanced growth(P � 0.001), and malate resulted in a prolonged lag phase, whichmay explain why glutamine has such a potent impact on swarmingin this medium, while malate does not promote swarming.

To further examine the possible relationship between growthand swarming in PMSM, all five swarming cues were used alone orin various combinations and assessed for their effect on growthrate and the ability to promote swarming in different PMSM for-mulations (see Table S1 in the supplemental material). Sixty out of180 formulations allowed for the development of at least oneswarm ring, but growth was enhanced in only 25 of these 60 for-mulations. Overall, no correlation was found between growth rateand swarm diameter, even when analyzing only conditions thatenhanced growth, allowed for swarming, or contained glutamine(Pearson R2 values of 0.06225, 0.04772, and 0.0001201, respec-tively). Thus, even though glutamine tends to enhance growth,there is no correlation between growth rate and swarming on low-salt LB agar or PMSM.

When urine was used as the growth medium, none of the

swarming cues enhanced the growth rate for P. mirabilis HI4320,but arginine dramatically decreased the optical density at whichstationary phase was achieved (P � 0.001). Notably, buffering ofthe urine prior to the addition of arginine restored growth to asimilar level as that in plain urine, and the ureC mutant did notexhibit a growth defect when cultured with arginine. As argininecatabolism results in the production of urea, which would lead tothe activation of urease and subsequent production of ammonia,the growth defect for P. mirabilis HI4320 but not the ureC mutantin urine containing arginine is likely due to a pH increase. Thismay also explain why arginine promotes swarming at acidic toneutral pHs but not basic pH.

Overall, the ureC mutant exhibited growth similar to that ofHI4320 in LB agar and PMSM but did not grow as well in urine,likely due to the inability to utilize urea as a nitrogen source. Insupport of this hypothesis, the ureC mutant exhibited dramati-cally enhanced growth in urine containing glutamine (P � 0.001),a readily utilized nitrogen source. Interestingly, malate also en-hanced the growth of the ureC mutant in urine (P � 0.001), whileit did not impact the growth of the parental strain and actuallydecreased the growth of both strains in PMSM, which may explainwhy malate is a swarming cue for the ureC mutant on urine agarbut does not promote swarming on PMSM. However, taken to-

FIG 5 Swarming and response to cues are influenced by pH and urea. (A) Diameter of the first (R1), second (R2), and third (R3) swarm rings to the consolidationzone and total swarm diameter for P. mirabilis HI4320 on swarm agar buffered with HEPES to pH 5, 6, 7, 8, or 9. Dashed lines indicate average swarm ringdiameters at pH 7. (B) Diameter of the first (R1), second (R2), and third (R3) swarm rings and total swarm diameter for P. mirabilis HI4320 on swarm agarcontaining increasing concentrations of urea. Dashed lines indicate average swarm ring diameters in the absence of urea. (C) Swarm colony diameter on low-saltLB agar buffered with HEPES and adjusted to pH 6, 7, 8, or 9 prior to adding the swarming cues. The dashed line indicates the swarm colony diameter onunsupplemented LB agar at pH 7. (D) Swarm colony diameter on low-salt LB agar containing the cues and supplemented with increasing concentrations of urea.The dashed line indicates the swarm colony diameter on unsupplemented LB agar. Error bars represent means and standard deviations for three independentexperiments with three replicates each.




http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

gether, the data clearly show that arginine, histidine, and ornithinepromote swarming without affecting the growth rate, regardless ofthe type of medium, and even though glutamine and malate alterthe growth rate, this effect is not correlated with a propensity forswarming.

Putrescine synthesis by at least one pathway is required forswarming in response to the cues. Two of the swarming cues(ornithine and arginine) and one factor that promoted an increasein the swarm colony diameter but was not considered a swarmingcue (agmatine) are all part of putrescine biosynthesis in P. mira-bilis (33). While putrescine itself was not identified as a swarmingcue in this study, putrescine synthesis is known to be an importantfactor in swarming (23). Therefore, ornithine, arginine, and ag-matine could promote swarming strictly by promoting putrescinesynthesis when added in excess to normally nonpermissive media.

P. mirabilis HI4320 generates putrescine through two mainpathways: agmatine is produced from arginine via arginine decar-boxylase (SpeA), and putrescine is then generated from agmatinevia agmatinase (SpeB), or putrescine can be generated directlyfrom ornithine via ornithine decarboxylase (SpeF) (33). To deter-mine the role of these pathways in swarming and the response tothe cues, speB and speF single mutants were constructed to inter-rupt each separate pathway and a speBF double mutant was con-structed to block both known pathways for putrescine synthesis.Interestingly, the speF mutant exhibited swarming similar to thatexhibited by the parental strain on swarm agar, while the speB andspeBF mutants were severely impaired (Fig. 7A). Arginine decar-boxylase and agmatinase therefore appear to be part of the pri-mary pathway for putrescine synthesis under these conditions.

The speB mutant also failed to swarm in response to arginine,agmatine, glutamine, histidine, and malate but was capable ofswarming in response to ornithine, indicating that ornithine likelycomplements the agmatinase defect by allowing for the generationof putrescine via ornithine decarboxylase (Fig. 7B). In contrast,the speF mutant swarmed to a level similar to that of the parentalstrain on arginine, agmatine, ornithine, and malate but exhibited

significantly reduced swarming on glutamine and histidine. Thisfinding suggests that while ornithine decarboxylase is not part ofthe primary pathway for putrescine synthesis under normal cir-cumstances, it may be required for a full response to swarmingcues that are not directly involved in putrescine biosynthesis. Asexpected, the speBF double mutant failed to swarm in response toany of the compounds, indicating that at least one pathway forputrescine synthesis must be intact for P. mirabilis HI4320 toswarm in response to the cues.

Importantly, all observed defects for the speB mutant could becomplemented with putrescine at a concentration low enough asto not alter swarming of the parental strain or to allow swarmingin response to the noncue glycine (Fig. 7C and D). This concen-tration of putrescine fully restored swarming to the level observedfor the parental strain, and the combination of arginine and pu-trescine allowed for significantly more swarming by the speB mu-tant than by P. mirabilis HI4320. Taken together with the findingthat putrescine alone is not sufficient to promote swarming for P.mirabilis HI4320 or the speB mutant, the data indicate that whileornithine and arginine are involved in putrescine synthesis andcan complement putrescine synthesis and swarming defects in themutants, they also likely promote swarming through a mechanismthat is unrelated to the production of putrescine.

Swarming in response to the cues requires pathways in-volved in amino acid metabolism. As putrescine biosynthesis didnot fully explain how the cues promote swarming and because theidentified cues are either amino acids or a TCA cycle intermediate,we wanted to explore the role of amino acid catabolic pathways inresponse to the swarming cues. Metabolism of many amino acidsrequires TCA cycle intermediates, and our laboratory recently de-termined that P. mirabilis HI4320 likely uses a complete oxidativeTCA cycle and anaerobic respiration for energy during swarming(27). Swarming still occurs when aerobic respiration is inhibitedby sodium azide (NaN3), but only mutations affecting aerobicrespiration significantly alter swarming periodicity (26, 27). Tofirst determine if aerobic respiration is required for swarming in

FIG 6 Swarming cues do not uniformly enhance growth rate. Growth curves were determined for P. mirabilis HI4320 and the ureC mutant in plain LB medium,PMSM, and urine compared to media containing individual swarming cues at a final concentration of 20 mM. Graphs are representative of three independentexperiments with five replicates each.

Armbruster et al.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

response to the cues, NaN3 was added to low-salt LB agar at aconcentration low enough to permit growth on LB agar but highenough to inhibit growth in broth culture (0.005%, wt/vol) (Fig.8A) (27). Arginine, histidine, malate, and ornithine were all capa-ble of promoting swarming on plates containing 0.005% NaN3,but glutamine was not, indicating that the ability of glutamine topromote swarming could require aerobic respiration.

To further explore the role of aerobic respiration and the TCAcycle in the response to the swarming cues, isogenic mutants withdefects in metabolism were tested for their ability to swarm onlow-salt LB agar supplemented with each individual swarming cue(Table 1 and Fig. 8B). Disruption of succinate dehydrogenase,encoded by sdhB, decreased swarming in response to ornithine

and increased the swarm diameter on LB agar containing glu-tamine or malate. The decreased swarming with ornithine may bea manifestation of the altered swarm pattern previously observedfor this mutant (25, 27), or it may indicate that this step in the TCAcycle is required for the full response to ornithine. However, in-creased swarming with glutamine and malate suggests that a lossof sdhB enhances swarming in response to these particular cues. Inthe absence of succinate dehydrogenase, P. mirabilis could stilloperate a reductive, branched TCA cycle utilizing fumarate reduc-tase. Even though fumarate reductase (FrdA) was not required forswarming under any condition tested (Fig. 8B) (27), we cannotrule out a possible role in the sdhB mutant under conditions ofexcess malate or glutamine.

FIG 7 Putrescine synthesis is required for swarming in response to the cues. (A) Diameter of the first ring, second ring, and the total swarm for P. mirabilisHI4320 compared to the speB, speF, and speBF mutants on swarm agar. Dashed lines indicate average swarm ring diameters for P. mirabilis HI4320. (B) Swarmcolony diameter of P. mirabilis HI4320 and the putrescine synthesis mutants on low-salt LB agar supplemented with compounds involved in putrescine synthesis(arginine, agmatine, and ornithine) compared to swarming cues that are not related to putrescine synthesis (glutamine, histidine, and malate). The dashed lineindicates the average swarm ring diameter for P. mirabilis HI4320. (C) Swarm colony diameter for the speB mutant compared to P. mirabilis HI4320 on a swarmagar or low-salt LB agar spread plate with phosphate-buffered saline (PBS) or 2.5 mmol putrescine and supplemented with glycine, arginine, glutamine, orhistidine. The dashed line indicates the average swarm ring diameter for the speB mutant on unsupplemented low-salt LB agar. (D) Representative imagesshowing the ability of putrescine to complement the swarming defects of the speB mutant on swarm agar versus low-salt LB agar with arginine. Error barsrepresent means and standard deviations for three independent experiments with three replicates each. Significance was determined by comparing the swarmdiameter of the mutants to that of HI4320 in panels A and B and PBS to putrescine in panel C. �, P � 0.05; ��, P � 0.01; ��, P � 0.001.




http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

Disruption of fumarase, encoded by fumC, decreased swarm-ing in response to both arginine and ornithine but had no signif-icant impact on the response to the other cues. As the aberrantswarming of the fumC mutant could be complemented by theaddition of malate on swarm agar (27), and this mutant did notexhibit a defect on low-salt LB agar supplemented with malate, it isclear that excess malate promotes a complete oxidative TCA cyclerather than driving production of fumarate. FumC is also clearlyimportant for swarming in response to arginine and ornithine,possibly because fumarate is produced as a by-product of orni-thine degradation and arginine biosynthesis. Interestingly, an-other TCA cycle intermediate, alpha-ketoglutarate, is closely as-sociated with glutamine and glutamate metabolism via glutamatedehydrogenase (GhdA). However, mutation of gdhA had no effecton swarming in response to any of the cues, indicating that glu-tamine most likely does not promote swarming by entering theTCA cycle via this route.

L-Glutamine is required for P. mirabilis swarming. In addi-tion to determining the metabolic pathways required for the re-sponse to each cue, we also wanted to determine if the function ofthe amino acid swarming cues is enantiomer specific (Fig. 9A).

Interestingly, D-arginine and D-glutamine did not promoteswarming on low-salt LB agar, while D-histidine and D-ornithineallowed for a similar level of swarming as the L-enantiomers. Theresponse to arginine and glutamine may therefore be related to therole of these amino acids in protein synthesis, while the responseto histidine and ornithine does not appear to be enantiomer spe-cific. However, it is important to note the D-histidine and D-orni-thine preparations may contain trace L-enantiomer contami-nants.

To address the contribution of amino acid synthesis to theinitiation of swarming, isogenic mutants with defects in arginine(argG and argH), glutamine (glnA), and histidine (hisG) biosyn-thesis were first tested for normal swarming on swarm agar(Fig. 9B). Disruption of arginine biosynthesis at either step did notsignificantly impact swarming. However, disruption of glutaminebiosynthesis completely inhibited normal swarming, and disrup-tion of histidine biosynthesis resulted in a decreased swarm ringdiameter. This finding was unexpected, as LB agar contains ap-proximately 1 mM L-histidine and 0.6 mM L-glutamine (43). Asthe glnA mutant exhibited only a modest growth defect in LBbroth (data not shown), the severe swarming defect is not due to

FIG 8 Swarming in response to the cues requires pathways involved in amino acid catabolism. (A) Swarm colony development in response to the cues on low-saltLB agar compared to LB agar containing 0.005% NaN3. The dashed line indicates the average swarm colony diameter on unsupplemented LB agar. (B) Diameterof swarms developed by P. mirabilis HI4320 isogenic mutants with defects in amino acid catabolism on low-salt LB agar containing arginine, glutamine, histidine,malate, or ornithine. The dashed line indicates the average swarm colony diameter on unsupplemented LB agar. Error bars represent means and standarddeviations for three independent experiments with three replicates each. Statistical significance was determined by comparing mutants to the parental strainunder each condition. �, P � 0.05; ��, P � 0.01; ��, P � 0.001.

Armbruster et al.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

impaired growth. GlnA is the glutamine synthetase component ofthe glutamine synthetase-glutamate synthase (GS-GOGAT) path-way for nitrogen assimilation and regulation of the glutaminepool, indicating that glutamine synthesis or sensing and respond-ing to glutamine levels are critical for swarming.

Importantly, swarming by the glnA mutant could be com-pletely restored with the addition of L-glutamine but not D-glu-tamine or L-glutamate (Fig. 9C and D and data not shown). Res-toration of noticeable swarming for the glnA mutant required aslittle as 1 �mol excess L-glutamine, but full complementation ofthe defect required approximately 10 �mol excess L-glutamine(see Fig. S5 in the supplemental material). Similarly, the additionof histidine to swarm agar complemented the swarming defect for

the hisG mutant, indicating that these swarming defects were dueto glutamine and histidine auxotrophy rather than downstreameffects of the mutations. Notably, the glnA and hisG mutants wereable to swim through Mot agar, although the glnA mutant had aslight but statistically significant decrease in swimming diameter,indicating that the requirement for glutamine synthetase and his-tidine biosynthesis is specific for swarming (see Fig. S6 in the sup-plemental material).

Amino acid synthesis mutants were also tested for their abilityto respond to the swarming cues on low-salt LB agar (Fig. 9D).Both arginine biosynthesis mutants and the histidine biosynthesismutant responded to the cues in a manner similar to that of theparental strain, indicating that regardless of the role of these bio-

FIG 9 Excess L-glutamine is required for normal swarming and for response to the other cues. (A) Swarm colony diameter of P. mirabilis HI4320 on low-salt LBagar supplemented with L-amino acid swarming cues compared to D-amino acids. The dashed line indicates the average swarm colony diameter on unsupple-mented LB agar. (B) Diameter of the first (R1), second (R2), and third (R3) swarm rings that developed on normal swarm agar for P. mirabilis HI4320 and theargG, argH, glnA, and hisG isogenic amino acid synthesis mutants. Swarm ring diameters for the glnA mutant complemented with L-glutamine and the hisGmutant complemented with L-histidine are also shown. Dashed lines indicate average swarm ring diameters for P. mirabilis HI4320. (C) Representative imagesof P. mirabilis HI4320, the glnA mutant on plain swarm agar compared to agar supplemented with glutamine, and the hisG mutant on plain swarm agar comparedto agar supplemented with histidine. (D) Swarm colony diameter of P. mirabilis HI4320 and amino acid synthesis mutants on low-salt LB agar with swarmingcues. The dashed line indicates the average swarm colony diameter for P. mirabilis HI4320 on unsupplemented LB agar. Error bars represent means and standarddeviations for three independent experiments with three replicates each. Significance was determined by comparing the swarm diameter of the mutants to thatof P. mirabilis HI4320 under each condition. �, P � 0.05; ��, P � 0.01; ��, P � 0.001.




http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

synthetic pathways during normal swarming, their defects areovercome by an excess of any of the swarming cues on low-salt LBagar. In contrast, the glnA mutant was unable to initiate swarmingon low-salt LB agar in response to any of the cues except glu-tamine, indicating that the requirement for glutamine cannot beovercome by an excess of other swarming cues. Therefore, argi-nine and histidine biosynthesis is not required for initiation ofswarming in response to cues on LB agar, but L-glutamine must beeither synthesized or exogenously provided in excess of the �0.6mM present in LB agar to allow for initiation of swarming, regard-less of whether or not the medium would normally be permissivefor swarming.

DISCUSSION

P. mirabilis swarming has intrigued scientists since the discoveryof the swarm cell in 1885 (44), particularly for the cyclic nature ofswarm cell differentiation, advancement of the swarm raft, andconsolidation, all of which result in the characteristic bull’s-eyepattern on 1.5% agar. Despite extensive research, the underlyingmechanisms for coordination of swarm cell differentiation andthe multicellular interactions required for swarming in P. mirabi-lis are still not fully understood. Due to the cell density require-ments for swarming, it seems probable that swarm cell differenti-ation is controlled by quorum sensing. However, no knownquorum-sensing systems appear to be involved in regulation ofthis behavior (45, 46). Investigation of factors capable of promot-ing swarming may therefore provide new insight into how thisbehavior is both regulated and coordinated. We have identifiedfour compounds not previously connected to motility in P. mira-bilis that are all present in human urine (arginine, histidine,malate, and ornithine) and confirmed the ability of glutamine topromote swarming under nonpermissive conditions. Further-more, we provide the first evidence that glutamine in excess of�0.6 mM is a basic requirement for initiation of swarming onswarm agar in addition to being a cue that promotes swarmingunder normally nonpermissive conditions. While none of thesecues are typical quorum-sensing molecules, they are capable ofpromoting and sustaining the multicellular process of swarmingand may therefore be related to sensory networks for determiningwhen conditions are appropriate for swarming. Alternatively, P.mirabilis may need a certain threshold level of these compounds topromote metabolic pathways required for swarming or forchanges in cell wall composition required for swarm cell differen-tiation.

Our criteria for swarming-specific cues included not only theability to induce swarming on nonpermissive media but also thatthe cues should be broadly active in different P. mirabilis isolates,

have no impact on swimming motility, and be functional underphysiologically relevant conditions. Indeed, the majority ofCaUTI clinical isolates were capable of swarming in response to allfive cues, none of the identified swarming cues enhanced swim-ming motility, all of the cues were active across a wide pH rangeand in the presence of millimolar concentrations of urea, and all ofthe cues promoted swarming on urine solidified with 1.5% agar aslong as urease activity was inhibited. As these swarming cues are allpresent in normal human urine (Table 3), and swarming on urineagar required less than 0.1 mM the cues, it is tempting to speculatethat P. mirabilis senses the concentration of these factors in itsenvironment and modulates swarming on the catheter based ontheir relative abundance. However, this hypothesis has yet to betested directly, and further investigation will be necessary to ana-lyze the importance of these compounds during CaUTI. Further-more, the variability in the effect of the swarming cues on swim-ming motility, swarming on permissive agar (swarm agar), theswarm patterns that develop on different types of media, growthin different types of media, and the metabolic requirements for theresponse to the cues (summarized in Table 4) would suggest thatthese compounds promote swarming through different mecha-nisms.

Putrescine has been proposed as a potential extracellularswarming signal for P. mirabilis, as the production of this poly-amine via arginine decarboxylase (SpeA) and agmatinase (SpeB)is required for effective swarming, and the accumulation of pu-trescine reduces speA expression (23). Two of the identified cues(arginine and ornithine) contribute to putrescine biosynthesis inP. mirabilis (33), making it tempting to speculate that they induceswarming by promoting putrescine biosynthesis; however, ourdata do not support this conclusion. Putrescine production by atleast one pathway was required for P. mirabilis swarming undernormal conditions, but the finding that excess putrescine alonewas not sufficient to promote swarming indicates that the abilityof arginine and ornithine to promote swarming may be unrelatedto putrescine synthesis. Furthermore, arginine and ornithine haddifferent influences on swimming motility and swarm patterns onnormal swarm agar and different pH and urea tolerance, and thegenetic requirements for the response to these cues differ, indicat-ing that they likely promote swarming by unrelated mechanisms(Table 3).

In Serratia liquefaciens, coordination of swarming requiressensing and integration of several signals, including relative con-centrations of amino acids, culture density, surface recognition,and cell-cell interactions (47). Unlike P. mirabilis, swarming in S.liquefaciens cannot be induced by the addition of single amino

TABLE 4 Summary of swarming cue characteristicsb

Cue% of CaUTIisolates with cue

Swarming

Growth rateLB containingNaN3

Genes required forresponseSwarm agar PMSM agar

Urineagara Mot agar

Arginine 89 2 � � 2 �/� � speB, fumC, glnAGlutamine 94 Required,1 � � �/� 1 PMSM,1 urinea � speB, speFHistidine 94 Beneficial, �/� � � �/� �/� � speB, speF, glnAMalate 94 �/� � � �/� 2 PMSM,1 urinea � speB, glnAOrnithine 100 �/� � � �/� �/� � speB, sdhB, fumC, glnAa Tested with the ureC mutant.b �, promotes swarming; �, no swarming; �/�, no change;1, increased;2, decreased.

Armbruster et al.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

acids. However, the requirement for sensing and integrating nu-merous signals to coordinate swarming appears to hold true for P.mirabilis, particularly as surface contact appears to be a require-ment for the ability of the cues to promote swarming. As individ-ual amino acids can promote P. mirabilis swarming in PMSM butmalate promotes swarming only when other requirements are met(i.e., in a rich medium), a hierarchy of proswarming signals mayexist such that as long as certain signals are present, other signalswould no longer be necessary. If this is indeed the case, the in-volvement of quorum-sensing signals in regulation of swarmingmay warrant revisiting using minimal medium, as the originalstudies were conducted with LB medium (45), which would satisfythe requirements for a solid surface as well as sufficient concen-trations of amino acids and the ability to carry out anaerobic res-piration using a complete oxidative TCA cycle (27).

Few connections between histidine and motility exist in theliterature outside the role of histidine in phosphotransfer relays.Histidine supports swarming by Pseudomonas aeruginosa, al-though glutamine did not promote swarming in this species, andarginine repressed swarming, indicating that there are clear differ-ences in swarming cues between species (48, 49). In P. mirabilis,the leucine-responsive regulatory protein Lrp, which is part of afamily of transcription factors linking gene regulation to metabo-lism, contributes to the regulation of swarming (50, 51). Further-more, the activity of P. mirabilis Lrp is regulated by the relativeabundance of serine, threonine, isoleucine, leucine, methionine,and histidine (52). Thus, the ability of histidine to promoteswarming may be related to the modulation of Lrp activity, al-though this hypothesis has yet to be fully explored.

With respect to malate, this cue was capable of promotingswarming only as long as all metabolic requirements for normalswarming were met (i.e., sufficient nutrients and the presence ofamino acids, a complete oxidative TCA cycle, and putrescine syn-thesis). Therefore, the function of malate appears to be linkedprimarily to the metabolic status of the cell and may simply sup-port the capacity for anaerobic respiration using the completeoxidative TCA cycle, thus fueling the appropriate pathway of en-ergy metabolism required for swarming (27). This would also ex-plain the finding that malate promotes swarming only on complexmedium and not minimal medium, as other metabolic require-ments for swarming, such as the presence of amino acids in themedium, are not satisfied in PMSM. However, if malate promotesswarming strictly by supporting the oxidative TCA cycle, it mightbe expected that other TCA cycle intermediates would have a sim-ilar capacity to promote swarming, yet our screen did not identifyany other TCA cycle intermediates as swarming cues. Therefore,the requirement for malate may be to fuel a particular reaction orto prevent accumulation of other metabolic intermediates, such asfumarate. As PMSM contains a small amount of citrate, P. mira-bilis may utilize the citrate in this medium as a carbon and energysource in addition to glycerol, possibly by operating the glyoxylateshunt or the phosphoenolpyruvate (PEP) glyoxylate cycle. If this isthe case, excess malate would interfere with the function of thesepathways, providing an alternate explanation for the failure of thiscue to promote swarming on PMSM.

A previous investigation into the nutritional requirements forswarming identified glutamine as one of seven amino acids thatmade minimal medium permissive for swarming, and the abilityto promote swarming was correlated with decreased generationtime in liquid culture (29). In the present study, all four amino

acid swarming cues made minimal medium permissive forswarming, but only glutamine enhanced the growth rate in thismedium. Furthermore, glutamine did not enhance the growthrate in LB broth, even though it promoted swarming on low-saltLB agar, and a detailed analysis of different formulations of min-imal medium revealed overall that there is no correlation betweengrowth rate and swarming for P. mirabilis HI4320.

The finding that P. mirabilis requires glnA to swarm underpermissive conditions as well as under nonpermissive conditionsindicates that glutamine synthetase is critical for swarming in thisspecies. Glutamine synthetase is part of the GS-GOGAT system,normally used for nitrogen assimilation under nitrogen-limitingconditions, while glutamate dehydrogenase (gdhA) is utilizedwhen nitrogen is abundant. As LB medium should not represent anitrogen-limited growth medium, either P. mirabilis is utilizingGS-GOGAT under conditions that normally favor glutamate de-hydrogenase or nitrogen may actually be limited during prepara-tion for swarming. However, as the glnA mutant was fully com-plemented by L-glutamine and not glutamate or any of the othercues, the data indicate that the swarming defect is not due strictlyto a lack of glutamate production but relates more specifically toglutamine levels. This is also in agreement with the finding thatglutamate was not identified as a swarming cue. It was furtherdetermined that P. mirabilis requires glutamine in excess of �0.6mM in LB agar to swarm, indicating that the ability of this aminoacid to promote swarming is likely related to the sensing of glu-tamine levels or to maintaining the glutamine pool for synthesis ofother compounds, such as tryptophan, purine nucleotides, orUDP-acetyl-D-glucosamine, for cell wall biosynthesis.

During infection of the murine urinary tract, P. mirabilis in-creases expression levels of gdhA and decreases expression levels ofglnA (53), suggesting an inverse requirement for these enzymesduring infection and swarming. Furthermore, mutation of gdhAresults in a fitness defect in the bladder, kidneys, and spleen (53).While the fitness of a glnA mutant has yet to be assessed in themouse model of infection, in vivo transcriptome data suggest thatglutamine synthetase may not contribute significantly to infec-tion. However, the requirement for glnA and excess glutamine forswarming may represent a new target for prevention of P. mirabilisswarming on catheters. Future work will focus on determining themechanisms of action of each swarming cue to understand howProteus mirabilis utilizes these factors to sense and respond to theenvironment, thus gaining new insight into the regulation ofswarming and potentially identifying new targets to preventswarming on catheters.

ACKNOWLEDGMENTS

We acknowledge helpful comments and critiques from members of theMobley laboratory and the Department of Microbiology and Immunol-ogy, especially Christopher Alteri, Rachel Spurbeck, and Alejandra Yep-Rodriguez. We also acknowledge technical assistance from SamanthaAntczak.

This research was supported by the National Institute of Allergy andInfectious Diseases of the National Institutes of Health under award num-bers R01AI059722 and F32AI102552 and utilized directed metabolomicscore services supported by NIH grant DK089503 awarded to the Univer-sity of Michigan.

The content is solely the responsibility of the authors and does notnecessarily represent the official views of the National Institutes of Health.




http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

REFERENCES1. Klevens RM, Edwards JR, Richards CL, Jr, Horan TC, Gaynes RP,

Pollock DA, Cardo DM. 2007. Estimating health care-associated infec-tions and deaths in US hospitals, 2002. Public Health Rep. 122:160 –166.

2. Hooton TM, Bradley SF, Cardenas DD, Colgan R, Geerlings SE, RiceJC, Saint S, Schaeffer AJ, Tambayh PA, Tenke P, Nicolle LE. 2010.Diagnosis, prevention, and treatment of catheter-associated urinary tractinfection in adults: 2009 international clinical practice guidelines from theInfectious Diseases Society of America. Clin. Infect. Dis. 50:625– 663.

3. Jacobsen SM, Stickler DJ, Mobley HLT, Shirtliff ME. 2008. Complicatedcatheter-associated urinary tract infections due to Escherichia coli and Pro-teus mirabilis. Clin. Microbiol. Rev. 21:26 –59.

4. Mathur S, Sabbuba NA, Suller MT, Stickler DJ, Feneley RC. 2005.Genotyping of urinary and fecal Proteus mirabilis isolates from individualswith long-term urinary catheters. Eur. J. Clin. Microbiol. Infect. Dis. 24:643– 644.

5. Warren JW, Tenney JH, Hoopes JM, Muncie HL, Anthony WC. 1982.A prospective microbiologic study of bacteriuria in patients with chronicindwelling urethral catheters. J. Infect. Dis. 146:719 –723.

6. Nicolle LE. 2005. Catheter-related urinary tract infection. Drugs Aging22:627– 639.

7. Mobley HLT, Warren JW. 1987. Urease-positive bacteriuria and obstruc-tion of long-term urinary catheters. J. Clin. Microbiol. 25:2216 –2217.

8. Griffith DP, Musher DM, Itin C. 1976. Urease. The primary cause ofinfection-induced urinary stones. Invest. Urol. 13:346 –350.

9. Li X, Zhao H, Lockatell CV, Drachenberg CB, Johnson DE, MobleyHLT. 2002. Visualization of Proteus mirabilis within the matrix of urease-induced bladder stones during experimental urinary tract infection. In-fect. Immun. 70:389 –394.

10. Hoeniger JFM. 1965. Development of flagella by Proteus mirabilis. J. Gen.Microbiol. 40:29 – 42.

11. Williams FD, Schwarzhoff RH. 1978. Nature of the swarming phenom-enon in Proteus. Annu. Rev. Microbiol. 32:101–122.

12. Allison C, Hughes C. 1991. Bacterial swarming: an example of prokary-otic differentiation and multicellular behaviour. Sci. Prog. 75:403– 422.

13. Jones BV, Young R, Mahenthiralingam E, Stickler DJ. 2004. Ultrastruc-ture of Proteus mirabilis swarmer cell rafts and role of swarming in cathe-ter-associated urinary tract infection. Infect. Immun. 72:3941–3950.

14. Sabbuba N, Hughes G, Stickler DJ. 2002. The migration of Proteusmirabilis and other urinary tract pathogens over Foley catheters. BJU Int.89:55– 60.

15. Armbruster CE, Mobley HLT. 2012. Merging mythology and morphol-ogy: the multifaceted lifestyle of Proteus mirabilis. Nat. Rev. Microbiol.10:743–754.

16. Morgenstein RM, Szostek B, Rather PN. 2010. Regulation of gene ex-pression during swarmer cell differentiation in Proteus mirabilis. FEMSMicrobiol. Rev. 34:753–763.

17. Rather PN. 2005. Swarmer cell differentiation in Proteus mirabilis. Envi-ron. Microbiol. 7:1065–1073.

18. Belas R, Suvanasuthi R. 2005. The ability of Proteus mirabilis to sensesurfaces and regulate virulence gene expression involves FliL, a flagellarbasal body protein. J. Bacteriol. 187:6789 – 6803.

19. Cusick K, Lee YY, Youchak B, Belas R. 2012. Perturbation of FliLinterferes with Proteus mirabilis swarmer cell gene expression and differ-entiation. J. Bacteriol. 194:437– 447.

20. Morgenstein RM, Clemmer KM, Rather PN. 2010. Loss of the waaLO-antigen ligase prevents surface activation of the flagellar gene cascade inProteus mirabilis. J. Bacteriol. 192:3213–3221.

21. Morgenstein RM, Rather PN. 2012. Role of the Umo proteins and the Rcsphosphorelay in the swarming motility of the wild type and an O-antigen(waaL) mutant of Proteus mirabilis. J. Bacteriol. 194:669 – 676.

22. Hatt JK, Rather PN. 2008. Characterization of a novel gene, wosA, regu-lating FlhDC expression in Proteus mirabilis. J. Bacteriol. 190:1946 –1955.

23. Sturgill G, Rather PN. 2004. Evidence that putrescine acts as an extracel-lular signal required for swarming in Proteus mirabilis. Mol. Microbiol.51:437– 446.

24. Liaw S-J, Lai H-C, Wang W-B. 2004. Modulation of swarming andvirulence by fatty acids through the RsbA protein in Proteus mirabilis.Infect. Immun. 72:6836 – 6845.

25. Himpsl SD, Lockatell CV, Hebel JR, Johnson DE, Mobley HLT. 2008.Identification of virulence determinants in uropathogenic Proteus mirabi-lis using signature-tagged mutagenesis. J. Med. Microbiol. 57:1068 –1078.

26. Falkinham JO, III, Hoffman PS. 1984. Unique developmental character-istics of the swarm and short cells of Proteus vulgaris and Proteus mirabilis.J. Bacteriol. 158:1037–1040.

27. Alteri CJ, Himpsl SD, Engstrom MD, Mobley HL. 2012. Anaerobicrespiration using a complete oxidative TCA cycle drives multicellularswarming in Proteus mirabilis. mBio 3(6):e00365–12. doi:10.1128/mBio.00365-12.

28. Rauprich O, Matsushita M, Weijer CJ, Siegert F, Esipov SE, Shapiro JA.1996. Periodic phenomena in Proteus mirabilis swarm colony develop-ment. J. Bacteriol. 178:6525– 6538.

29. Jones HE, Park RW. 1967. The influence of medium composition on thegrowth and swarming of Proteus. J. Gen. Microbiol. 47:369 –378.

30. Wilkerson ML, Niederhoffer EC. 1995. Swarming characteristics of Pro-teus mirabilis under anaerobic and aerobic conditions. Anaerobe 1:345–350.

31. Naylor PGD. 1964. Effect of electrolytes or carbohydrates in sodium chlo-ride deficient medium on formation of discrete colonies of Proteus and theinfluence of these substances on growth in liquid culture. J. Appl. Bacte-riol. 27:422– 431.

32. Allison C, Lai HC, Gygi D, Hughes C. 1993. Cell differentiation ofProteus mirabilis is initiated by glutamine, a specific chemoattractant forswarming cells. Mol. Microbiol. 8:53– 60.

33. Pearson MM, Sebaihia M, Churcher C, Quail MA, Seshasayee AS,Luscombe NM, Abdellah Z, Arrosmith C, Atkin B, Chillingworth T,Hauser H, Jagels K, Moule S, Mungall K, Norbertczak H, RabbinowitschE, Walker D, Whithead S, Thomson NR, Rather PN, Parkhill J, MobleyHLT. 2008. Complete genome sequence of uropathogenic Proteus mirabilis, amaster of both adherence and motility. J. Bacteriol. 190:4027–4037.

34. Vinogradov E, Perry MB. 2000. Structural analysis of the core region oflipopolysaccharides from Proteus mirabilis serotypes O6, O48 and O57.Eur. J. Biochem. 267:2439 –2446.

35. Belas R, Erskine D, Flaherty D. 1991. Transposon mutagenesis in Proteusmirabilis. J. Bacteriol. 173:6289 – 6293.

36. Pearson MM, Mobley HLT. 2007. The type III secretion system of Proteusmirabilis HI4320 does not contribute to virulence in the mouse model ofascending urinary tract infection. J. Med. Microbiol. 56:1277–1283.

37. Kugler F, Graneis S, Schreiter PP, Stintzing FC, Carle R. 2006. Deter-mination of free amino compounds in betalainic fruits and vegetables bygas chromatography with flame ionization and mass spectrometric detec-tion. J. Agric. Food Chem. 54:4311– 4318.

38. Lorenz MA, Burant CF, Kennedy RT. 2011. Reducing time and increas-ing sensitivity in sample preparation for adherent mammalian cellmetabolomics. Anal. Chem. 83:3406 –3414.

39. Norden AG, Sharratt P, Cutillas PR, Cramer R, Gardner SC, Unwin RJ.2004. Quantitative amino acid and proteomic analysis: very low excretionof polypeptides �750 Da in normal urine. Kidney Int. 66:1994 –2003.

40. Zaura DS, Metcoff J. 1969. Quantification of seven tricarboxylic acidcycle and related acids in human urine by gas-liquid chromatography.Anal. Chem. 41:1781–1787.

41. Markowski P, Baranowska I, Baranowski J. 2007. Simultaneous deter-mination of L-arginine and 12 molecules participating in its metaboliccycle by gradient RP-HPLC method: application to human urine samples.Anal. Chim. Acta 605:205–217.

42. Fujihara M, Obara H, Watanabe Y, Ono HK, Sasaki J, Goryo M,Harasawa R. 2011. Acidic environments induce differentiation of Proteusmirabilis into swarmer morphotypes. Microbiol. Immunol. 55:489 – 493.

43. Sezonov G, Joseleau-Petit D, D’Ari R. 2007. Escherichia coli physiology inLuria-Bertani broth. J. Bacteriol. 189:8746 – 8749.

44. Hauser G. 1885. Uber Fäulnissbacterien und deren Beziehungen zur Sep-ticämie; ein Beitrag zur Morphologie der Spaltpilze. Vogel, Leipzig, Germany.

45. Schneider R, Lockatell CV, Johnson D, Belas R. 2002. Detection andmutation of a luxS-encoded autoinducer in Proteus mirabilis. Microbiol-ogy 148:773–782.

46. Belas R, Schneider R, Melch M. 1998. Characterization of Proteus mira-bilis precocious swarming mutants: identification of rsbA, encoding a reg-ulator of swarming behavior. J. Bacteriol. 180:6126 – 6139.

47. Eberl L, Winson MK, Sternberg C, Stewart GS, Christiansen G, ChhabraSR, Bycroft B, Williams P, Molin S, Givskov M. 1996. Involvement ofN-acyl-L-hormoserine lactone autoinducers in controlling the multicellularbehaviour of Serratia liquefaciens. Mol. Microbiol. 20:127–136.

48. Kohler T, Curty LK, Barja F, van Delden C, Pechere JC. 2000. Swarmingof Pseudomonas aeruginosa is dependent on cell-to-cell signaling and re-quires flagella and pili. J. Bacteriol. 182:5990 –5996.

Armbruster et al.



http://jb.asm.org/

Dow

nloaded from

http://dx.doi.org/10.1128/mBio.00365-12

http://dx.doi.org/10.1128/mBio.00365-12

http://jb.asm.org

http://jb.asm.org/

49. Bernier SP, Ha DG, Khan W, Merritt JH, O’Toole GA. 2011. Modula-tion of Pseudomonas aeruginosa surface-associated group behaviors byindividual amino acids through c-di-GMP signaling. Res. Microbiol. 162:680 – 688.

50. Calvo JM, Matthews RG. 1994. The leucine-responsive regulatory pro-tein, a global regulator of metabolism in Escherichia coli. Microbiol. Rev.58:466 – 490.

51. Hay NA, Tipper DJ, Gygi D, Hughes C. 1997. A nonswarming mutant ofProteus mirabilis lacks the Lrp global transcriptional regulator. J. Bacteriol.179:4741– 4746.

52. Hart BR, Blumenthal RM. 2011. Unexpected coregulator range for theglobal regulator Lrp of Escherichia coli and Proteus mirabilis. J. Bacteriol.193:1054 –1064.

53. Pearson MM, Yep A, Smith SN, Mobley HLT. 2011. Transcriptome ofProteus mirabilis in the murine urinary tract: virulence and nitrogen as-similation gene expression. Infect. Immun. 79:2619 –2631.

54. Jones BD, Lockatell CV, Johnson DE, Warren JW, Mobley HL. 1990.Construction of a urease-negative mutant of Proteus mirabilis: analysis ofvirulence in a mouse model of ascending urinary tract infection. Infect.Immun. 58:1120 –1123.




http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

Initiation of Swarming Motility by Proteus mirabilis Occurs in … · (4). Once bacteria have...

Documents

Transcript of Initiation of Swarming Motility by Proteus mirabilis Occurs in … · (4). Once bacteria have...