LWT - Food Science and Technology 148 (2021) 111785

Available online 26 May 20210023-6438/© 2021 Elsevier Ltd. All rights reserved.

Initial purification of antimicrobial fermentation metabolites from Paecilomyces cicadae and its antimicrobial mechanism

Qi-Wen Cen a,1, Zheng-Yun Wang a,1, Zhen-Xing Tang b, Yu Zhang a, Tao Chen a, Da-Wei Xue a, Ming-Feng Xu a, Xue-Lian Bai a, Ting Zhou a, Lu-E Shi a,*

a School of Life and Environmental Sciences, Hangzhou Normal University, Hangzhou, Zhejiang, 311121, China b College of Culinary Art, Tourism College of Zhejiang, Hangzhou, Zhejiang, 311231, China

A R T I C L E I N F O

Keywords: P. cicadae Antimicrobial compounds Purification Antimicrobial mechanism

A B S T R A C T

In present study, the antimicrobial compounds (AMCs) from Paecilomyces cicadae (P. cicadae) were initially purified, and its antimicrobial mechanism was investigated. The results showed that the molecular weight of AMCs in crude protein extracts was below 10 kDa. The minimum inhibitory concentration (MIC) of crude protein extracts against Escherichia coli (E. coli) was 0.050 mg/mL. After E. coli was treated by crude protein extracts, we found that it could disrupt the structure of cell membrane, change the content of whole-cell or membrane proteins. In addition, crude protein extracts with certain concentrations also could effectively interact with bacterial DNA. Quantitative real-time PCR (qRT-PCR) results indicated that the expression levels of flagellar biosynthesis genes fliP, fliO, flgD and flhB were down-regulated, whereas dppF and dnaJ which are associated with the transport across the membrane and the interaction with dnaK, respectively, were up-regulated when E. coli was exposed to crude protein extracts. The present findings suggested that AMCs from P. cicadae showed a potential value for the development of antibacterial products.

1. Introduction

The discovery of new products from fermentation metabolites has been one of research hot topics in recent years (Berdy, 2005). With the rapid development of screening and isolation technologies for natural products, many novel compounds have been discovered. Until now, many kinds of microbial metabolites such as polysaccharide, peptide and glycoprotein, have been reported (Donadio et al., 2002; Gomes et al., 2001; Tong et al., 2009). These metabolites present diverse bio-logical activities due to their complexity of chemical structure. For human beings, above mentioned metabolites can be developed as active additives in food industry to improve our health.

As we know, antibiotics abuse can cause bacterial resistance (Zhang, Wu, et al., 2017; Zheng et al., 2015). At present, antibiotic resistance has been a global public health challenge as it significantly increases the difficulty in the clinical treatment for the inflammatory (Martínez, 2012). More than 70% of the hospital-related bacterial isolates are resistant to most of antibiotics (Sivakumar, Priya, & Doble, 2009). Multiple antibiotic resistant strains in hospital environment are much

easier to cause super-infection phenomena (Zheng et al., 2015). There-fore, it is necessary to find novel and green antimicrobial agents. AMCs produced by many kinds of organisms, have received more attention owing to their great antimicrobial activity and established safety (Cleveland, Montville, Nes, & Chikindas, 2001). AMCs show broad-spectrum antimicrobial activities against Gram-positive or Gram-negative bacteria, fungi, and some viruses, even display cytotoxic activity on certain cancer cells, which are promising alternatives to classical antibiotics for the treatment of antibiotic resistant infections (Frew & Stock, 2011; Kang, Kim, Seo, & Park, 2017; Klubthawee, Adi-sakwattana, Hanpithakpong, Somsri, & Aunpad, 2020). The evidence has showed that AMCs have good antibacterial activity against highly antibiotic-resistant bacteria identified from human infections (Fry, 2018). In addition to antimicrobial activity, AMCs also exhibit immu-nomodulatory ability, anti-biofilm formation ability, and anti-inflammatory activity (Haney, Mansour, & Hancock, 2017; Kang et al., 2017).

Cordyceps cicadae (C. cicadae) belonging to the Clavicipitaceae family and the genus Codyceps, is a kind of entomogenous fungus that can

* Corresponding author. E-mail address: shilue@126.com (L.-E. Shi).

1 Qi-Wen Cen and Zheng-Yun Wang contributed equally to this work and was regarded as co-first author.

Contents lists available at ScienceDirect

LWT

journal homepage: www.elsevier.com/locate/lwt

https://doi.org/10.1016/j.lwt.2021.111785 Received 19 February 2021; Received in revised form 11 May 2021; Accepted 21 May 2021

LWT 148 (2021) 111785

2

parasitize Lepidoptera larvae, and form fruiting bodies on the surfaces of the insects (Nxumalo, Elateeq, & Sun, 2020). It is mainly distributed in Europe, North America, Asia (especially in China) (Nxumalo et al., 2020; Olatunji et al., 2016, 2016). In China, C. cicadae has been used as traditional Chinese medicine (TCM) with a history of over 1,600 years (Nxumalo et al., 2020). To date, the studies that have been done on C. cicadae, mainly focusing on biological evaluation, the analysis of certain chemical constituents, cultivation and fermentation processes (Lu, Jiang, Mu, Hou, & Wang, 2006; Nxumalo et al., 2020). A variety of bioactive compounds including polysaccharides, cordycepin, myriocin, and nucleosides, have been isolated from C. cicadae, providing multiple benefits to our immune, circulatory and respiratory systems (Ke & Lee, 2018; Li et al, 2014, 2018; Weng, Chou, Lin, Tsai, & Kuo, 2002; Xu, Mo, Yu, & Mao, 2010; Zheng et al., 2015). The cultivation of C. cicadae MP12, with the main focus on the production of adenosine and cordy-cepin, was reported by Wang, Guo, Zhang, and Wu (2012). In our pre-vious work, the extraction technology for polysaccharide from C. cicadae was investigated. The results showed that the best extraction conditions for polysaccharide were that extraction temperature of 90 ◦C, solid-liquid ratio of 1:40 (g:mL), extraction time of 1 h and extraction 3 times (Cen et al., 2018). Moreover, the antibacterial activity and mechanism of C. cicadae polysaccharide against E. coli were also studied in our group. C. cicadae polysaccharide could exert good antibacterial activity by destroying the structure of bacterial cells, increasing the cell permeability which resulted in the release of cell components including proteins and electrolytes, and thus led to the death of cells (Zhang, Wu, et al., 2017). However, many factors, such as limited yield, slow growth, immoderate exploitation etc., severely hinder the utilization of wild C. cicadae resources.

P. cicadae is usually regarded as the anamorph stage of C. cicadae, which has attracted considerable attention due to its diversity of bioactive properties, such as anti-microbial, anti-oxidant, anti-aging, anti-tumor, anti-inflammatory, ameliorating renal function and immu-nomodulatory abilities (Ke & Lee, 2018; Wang et al., 2017, 2019, 2019). Chyau et al. (2014) reported that P. cicadae could significantly decrease Cyclosporine A-induced apoptosis in renal tubular cells, and improve the clearance rate of urea and creatinine. On the one hand, P. cicadae pos-sesses similar bioactive compounds and medical values with C. cicadae. On the other hand, compared to C. cicadae, P. cicadae is much easier to be cultivated by artificial fermentation technology, and the production cost of cultivated P. cicadae is much lower (Li et al., 2018). Therefore, P. cicadae is used as a potentially alternative source to C. cicadae. Although the antimicrobial activity of P. cicadae is reported, its anti-microbial mechanism has not been fully understood. Therefore, it is necessary to study further. In our preliminary study, the fermentation metabolites of P. cicadae with antibacterial ability was observed. In present research, initial purification of the fermentation metabolites of P. cicadae was carried out, and the antimicrobial mechanism of isolated crude compounds was mainly studied. E. coli, a major Gram-negative pathogen, was chosen as an indicator microorganism as it was a sus-ceptible strain to P. cicadae fermentation metabolites. The obtained re-sults would build the foundation for the development of novel antimicrobials from P. cicadae fermentation metabolites.

2. Materials and methods

2.1. Microorganisms and reagents

P. cicadae obtained from fermentation engineering lab of Hangzhou Normal University, was isolated from C. cicadae. The strain was grown on Potato Dextrose Agar (PDA) at 28 ◦C for 5–8 days, and then stored at 4 ◦C before use. The spores were aseptically harvested using sterile single-use loops, suspended into sterile distilled water, and then diluted to ~106 spores/mL. The spore suspension used as fermentation inoc-ulum, was inoculated into liquid medium. E. coli (ATCC 35218), as the indicator microorganism, was obtained from our lab as well. All

chemicals and solvents used in present study were all of analytical grade.

2.2. Fermentation metabolites of P. cicadae

Each 250-mL Erlenmeyer flask containing 100 mL of PDA (200 g/L potato extract, 20 g/L glucose, 15 g/L peptone and 0.30 g/L KH2PO4) liquid medium, was incubated with 5.0 mL of spore suspensions in a rotary shaker at 28 ◦C, 160 rpm. After 120-h fermentation, fermentation broth was filtered by two layers of cotton gauze. The filtrate was centrifuged at 10,000 g for 10 min, and finally the supernatant was collected, and used for the following experiments.

2.3. Purification of antimicrobial compounds

Salting-out method was employed to extract crude protein from fermentation metabolites. Solid ammonium sulfate was added into 10 mL fermentation supernatant until a final concentration reached 60%. The solution was allowed to stand overnight at 4 ◦C. After centrifuga-tion, the precipitated crude protein and the supernatant were obtained. The supernatant was filtered through 0.22 μm membrane filters. For the precipitated crude protein, it was dissolved in 1.0 mL sterile distilled water, and then soluble section was filtered through 0.45 μm membrane filters. After that, the sample was applied to a Sephadex G-50 gel filtration chromatography column (1.6 cm × 30 cm) pre-equilibrated with distilled water. The injection volume was 3.0 mL. The mobile phase was distilled water, passing through the column at a flow rate of 0.50 mL/min. The eluate was monitored by UV detector at wavelength 280 nm, and collected at intervals of 1.0 mL per tube. Each peak was assayed for protein concentration and antimicrobial activity against E. coli.

2.4. Characteristics of antibacterial compounds

Antimicrobial activity was detected by Oxford cup assay according to previous references (Miao et al., 2015; Zhang, Wu, et al., 2017).

Protein concentration was determined using bovine serum albumin (BSA) protein assay kit (Sangon Biotech, Shanghai, China) (Bradford, 1976).

In order to assess the purity and molecular weight of compounds in each peak, sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was carried out in accordance with Liu et al. (2018).

2.5. Antimicrobial mechanisms of crude protein extracts against E. coli

2.5.1. Determination of MIC To study the antimicrobial mechanism, MIC against E. coli was

measured by turbidimetric method (Zhang, Wu, et al., 2017). 100 μL overnight cultured E. coli solution and 2.0 mL two-fold serial dilutions of crude protein extracts at various concentrations were mixed, respec-tively. Sterile water was used as the control. After the mixture was incubated on a rotary shaker at 37 ◦C, 200 rpm for 4 h, the absorbance of the mixture was measured at 600 nm. The bacteriostatic rate was calculated as follows:

Bacteriostatic rate (%) = (1-AX/A0) × 100

Where, AX was the absorbance of experimental group, A0 was the absorbance of control group.

2.5.2. Morphological analysis of E. coli The morphological changes of E. coli exposed to crude protein ex-

tracts were examined by employing previous literature with slight modifications (Sun et al., 2018). In brief, 2.0 mL E. coli at logarithmic growth phase was treated by 5.0 mL crude protein extracts at 4, 8 and 16 × MIC concentrations in 100 mL Luria-Bertani (LB) broth, respec-tively. E. coli treated with sterile water was used as the control. The

Q.-W. Cen et al.

LWT 148 (2021) 111785

3

mixture was incubated in a rotary shaker at 200 rpm, 37 ◦C for 9 h, and then centrifuged to collect the precipitated bacteria. The precipitated bacteria was washed three times with 0.10 M pH 7.2 phosphate buffered saline (PBS), and then immobilized with 4.0% glutaraldehyde at 4 ◦C for 72 h. Afterwards, the immobilized bacteria was washed with PBS, dehydrated, freeze-dried and coated with gold by a sputtering tech-nique. Finally, it was observed through scanning electron microscopy (SEM) operated at 25 kV.

2.5.3. Whole-cell proteins and membrane proteins analysis Effect of crude protein extracts on whole-cell proteins of E. coli was

performed according to the protocol described by Zhang, Wu, et al. (2017) with minor modifications. After E. coli was treated by crude protein extracts, whole-cell proteins of E. coli were obtained using bac-terial protein extraction kit (Sangon Biotech, Shanghai, China). E. coli cells were treated by crude protein extracts at 37 ◦C for 4 h, and centrifuged at 5,000 g for 10 min. Then, the obtained E. coli cells were washed twice with PBS, and re-suspended in lysis solutions of 200 μL protease inhibitor solution and 80 μL lysozyme for 30 min. After that, 20 μL DNase/RNase was added, and incubated for 10 min. Finally, it was centrifuged at 3,000 g for 15 min to obtain whole-cell proteins. The mixture of 5.0 μL whole-cell proteins and 20 μL of sample buffer (pH 6.8; 1.0 M Tris-HCl, 50% glycerol, 10% SDS, 10% β-mercaptoethanol, and 0.10% bromophenol blue), was boiled for 10 min, and then cooled to room temperature (Frank et al., 2003; Zhang et al., 2017). The prepared samples were loaded on SDS-polyacrylamide gel, and run at 80 V through the stacking gel for 30 min and at 110 V through the separating gel for 80 min, respectively. The gel was dyed with Coomassie Brilliant Blue R 250 for 1 h, and then decolorized with decolorizing solution. Finally, the gel bands were visualized through the gel documentation system.

Effect of crude protein extracts on membrane proteins of E. coli was analyzed by SDS-PAGE following previous methods with some appro-priate modifications (Cui, Bai, Sun, Abdel-Samie, & Lin, 2018; Li, Sun, Feng, & Mo, 2015). The treated E. coli cells by crude protein extracts were washed twice with PBS, and re-suspended in 4.0 mL of PBS con-taining 8.0% Triton X-114 at 4 ◦C for 3 h. After that, the supernatants were incubated at 37 ◦C for 2 h, and centrifuged at 3,000 g for 15 min for phase separation. The separated organic phase was mixed with 36 mL anhydrous alcohol, and incubated at 4 ◦C for 10 h. Afterwards, mem-brane proteins were collected via centrifugation, and then dissolved in 20 μL sterile water. The loading buffer consisted of 1.0 M pH 6.8 Tris-HCl, 50% glycerol, 10% SDS, 10% β-mercaptoethanol, and 0.10% bromophenol blue. 5.0 μL of the loading buffer was mixed with mem-brane protein samples. The mixture was boiled for 10 min, cooled to room temperature, and then subjected to SDS-PAGE with the same protocol as whole-cell proteins analysis.

2.5.4. Gel retardation assay To investigate the combining ability of crude protein extracts to

bacterial genome DNA, an agarose gel retardation assay was performed following the work of Li, Liu, Chen, and Li (2020) with some minor modifications. Briefly, E. coli genome DNA was extracted by rapid bac-terial genomic DNA isolation kit (Sangon Biotech, Shanghai, China) according to the instructions. 5.0 μL of DNA sample was incubated with equal volume of crude protein extracts at 30 ◦C for 10 min, meanwhile sterile water was set as the control. After the incubation, the mixture was analyzed by 0.80% agarose gel electrophoresis. The gel was run at 100 V for 25 min, and visualized under UV illuminator.

2.5.5. Quantitative real-time PCR analysis To investigate gene expression in E. coli by qRT-PCR, E. coli treated

by crude protein extracts was used for total RNA extraction by UNlQ-10 column trizol total RNA isolation kit (Sangon Biotech, Shanghai, China) according to the instructions. Subsequently, cDNA was obtained from reverse-transcribed PCR. The target genes were quantified using a

StepOnePlus Real-Time PCR System (Applied Biosystems, Carlsbad, CA). Primers for qRT-PCR were designed using primer 5.0 software, and synthesized by Sangon Biotech (Shanghai, China). Primers were listed in Table 1. The 16S rRNA gene was used as an internal reference gene. Each qRT-PCR reaction mixture was composed of: SybrGreen qPCR Master Mix: 10 μL, cDNA template: 2.0 μL, Forward Primer: 0.40 μL (10 μM), Reverse Primer: 0.40 μL (10 μM), ddH2O: 7.2 μL in the final volume of 20 μL. The thermal cycling parameters were as follows: initial dena-turation at 95 ◦C for 3 min, 45 cycles of (95 ◦C denaturation for 7 s, 57 ◦C annealing for 10 s, and 72 ◦C extension for 15 s).

2.6. Statistical analysis

All experiments were conducted in triplicates. Data were presented as mean ± standard deviation (SD) and graphically analyzed by Microsoft Excel 2019. Analyses were performed by SPSS 15.0 software. P < 0.05 were considered to be statistically significant.

3. Results and discussion

3.1. Purification of antimicrobial compounds

AMCs are parts of the innate immune system, naturally occurring in almost all kinds of life being including microorganisms, plants and an-imals (Bulet, Hetru, Dimarcq, & Hoffmann, 1999; Carvalho & Gomes, 2009; Zasloff, 2002). They can eliminate enveloped viruses, pathogenic bacteria, fungi and parasites through various physiological defensive mechanisms, and hence can be used as therapeutic agents (Reddy, Yedery, & Aranha, 2004; Tang, Prodhan, Biswas, Le, & Sekaran, 2018). Fungi, one of original sources of AMCs, can produce a wide range of AMCs with bacteria as the main target (Fry, 2018). A novel antibacterial peptide derived from Pseudoplectania nigrella could effectively kill Mycobacterium tuberculosis (M. tuberculosis) in vitro, and decreased the bacterial load in a murine tuberculosis infection model. In addition, it also showed intracellular activity towards M. tuberculosis. The authors indicated that it could be developed as a promising drug in clinical treatment (Glegola-Madejska et al., 2018).

In this study, crude protein extracts obtained from P. cicadae fermentation metabolites exerted antimicrobial ability. The results showed that 23 absorption peaks were obtained by gel filtration chro-matography (Fig. 1A). All peaks were collected, and investigated for the antimicrobial activity against E. coli. As showed in Table 2, only three peaks (peak 16, 17, 18) showed antimicrobial activity. Peak 17 was with an inhibition zone diameter of 17.8 mm, exhibited the highest inhibitory activity compared to the other peaks. Furthermore, except peak 16, 17, 18, the other peaks did not show any inhibitory ability against the growth of E. coli. The protein concentrations of peak 16, 17 and 18 were calculated as 32.0, 29.0 and 0.30 mg/mL, respectively (Table 2). As showed in Fig. 1B, the protein pattern on SDS-PAGE was found to be

Table 1 Genes and primers used for qRT-PCR.

Genes Primers Sequence (5′-3′) Length (bp)

16S rRNA 16S 338F ACTCCTACGGGAGGCAGCAG 197 16S 518R ATTACCGCGGCTGCTGG

fliP fliP-F TTTTCAACTCGCTGGTCACG 238 fliP-R CGAGGCAGATTTAGGGTTGTT

flgD flgD-F AAACCAGGACCCGACCAA 136 flgD-R CGACTGGCTGTTATCAATCTGT

fliO fliO-F AACCGCATTTCAGATAGGCTT 219 fliO-R TCAGGTGTCATTTTGCCTCTCT

dppF dppF-F GATGGATTTGCAGCAGGAGTT 149 dppF-R GCGGGTTATTGAAGATTTGGT

dnaJ dnaJ-F AACAACCTGTATTGCGAAGTCC 98 dnaJ-R ACTTTCAGTTTGACGCGACC

flhB flhB-F CGATGGATTTGGTAGGGCTAT 156 flhB-R GGTCACCTTCGCTTTGTTTG

Q.-W. Cen et al.

LWT 148 (2021) 111785

4

similar for the samples of crude protein extracts and fermentation su-pernatants, and initial purified protein extracts (peak 16, 17 and 18), which was emerged as a single homogenous band (Fig. 1B). By comparing its relative mobility with the standard proteins, the molec-ular weight of initial purified protein extracts was below 10 kDa (Fig. 1B, Lane 1–5). The results indicated that protein extracts with molecular weight less than 10 kDa was mainly contributed to antimi-crobial activity in the active peaks. Also, a predominant band with below 10 kDa molecular weight was observed in the electrophoretic analysis of crude protein extracts and fermentation supernatants (Fig. 1B, Lane 6, 7), respectively, suggesting that antimicrobial activity of fermentation metabolites might be attributed to protein extracts with low molecular weight (<10 kDa). AMCs from many other sources have been reported. Kollakalnaduvil Raghavan et al., 2021 reported that

MFAP9 with strong anti-biofilm ability, was purified from marine Aspergillus fumigatus BTMF9. The molecular mass of MFAP9 was found to be ~ 3 kDa.

3.2. MIC of crude protein extracts against E. coli

MIC is defined as the lowest concentration of antimicrobial agent that completely inhibits the discernible growth of tested microorganisms (Tang et al., 2018). Crude protein extracts were dissolved in cultured E. coli solution, and then serially diluted to a final concentration of 51.95, 25.98, 12.99, 6.49, 3.25, 1.62, 0.81, 0.41, 0.20, 0.10, 0.05 and 0.025 mg/mL. After investigation, the corresponding bacteriostatic rates against E. coli were 70.03%, 57.93%, 42.06%, 34.05%, 29.72%, 25.93%, 19.76%, 16.48%, 7.21%, 4.26%, 1.39% and 0, respectively. According to MIC results, the inhibition effect was dose-dependent, which was positively correlated with the concentration of crude protein extracts. With the decrease of protein concentration, antimicrobial rate gradually decreased. In present study, MIC value of crude protein extracts against E. coli was around 0.050 mg/mL. Comparing the results with our pre-vious study, MIC value of C. cicadae polysaccharide against E. coli was 0.10 mg/mL, which was two-fold higher than that of crude protein ex-tracts in present study (Zhang, Wu, et al., 2017). Therefore, it was indicated that crude protein extracts showed a higher antimicrobial ability against E. coli compared to C. cicadae polysaccharide.

Fig. 1. Purification of crude protein extracts from P. cicadae fermentation. (A) Elution profile of gel filtration (Sephadex G-50) column; (B) SDS-PAGE analysis. Lane M: protein marker; Lane 1–2: purified crude protein extracts (peak 16); Lane 3–4: puri-fied crude protein extracts (peak 17); Lane 5: purified crude protein extracts (peak 18); Lane 6: crude protein extracts obtained from ammonium sulfate precipitation method; Lane 7: fermentation supernatants of P. cicadae.

Table 2 Antimicrobial ability and protein concentration of each peak after the purifi-cation by Sephadex G-50 column chromatography.

Peak Inhibition zone diameter (mm) Protein concentration (mg/mL)

1–15 0.0 – 16 10.8 32.0 17 17.8 29.0 18 9.5 0.3 19–23 0.0 –

Q.-W. Cen et al.

LWT 148 (2021) 111785

5

3.3. Morphological changes of E. coli

Many various antimicrobial mechanisms of AMCs have been re-ported, which include the damage of cell wall, the change of the mem-brane permeability, the change of the contents of proteins and nucleic acid, the inhibition of enzyme activity and the synthesis of nucleic acid etc (Balamayooran, Batra, Fessler, ; Zhang, Wu, et al., 2017). To illus-trate the antimicrobial action of crude protein extracts of P. cicadae, effect of crude protein extracts of P. cicadae on the morphology of E. coli was visualized by SEM (Fig. 2). The control E. coli displayed a regular, smooth and intact surface morphology, and no disruptions were observed. Most of them were dispersed individually without any adherence to each other (Fig. 2A). In contrast, after treated with crude protein extracts, E. coli cells started to assemble together, and the surface exhibited wrinkles at 4 × MIC (Fig. 2B). With the increase of the con-centrations of crude protein extracts, wrinkled skin of E. coli was more obvious at 8 × MIC (Fig. 2C). When the concentrations of crude protein extracts increased to 16 × MIC, cell debris was observed that indicated that cytoplasmic leakage occurred (Fig. 2D). It is well known that cell membrane as a selective permeability barrier, is an important structural component of bacteria, protecting bacteria from detrimental substances (Babii et al., 2016; Lv, Liang, Yuan, & Li, 2011; Meng et al., 2016). It is also one of major action sites of various antibacterial agents (Eom et al., 2014). The SEM results indicated that crude protein extracts could cause the significant deformation of bacterial morphology, destroyed the membrane of bacterial cells, and thus led to cytoplasmic leakage. It was consistent with the previous reports that cell surface morphology was changed after AMCs were interacted with cells (Ma, Guo, Fu, & Jin, 2020; Pan et al., 2019). It is indicated that piscidins could kill bacteria through generating holes to impair the normal function of cytomem-brane, or targeting to some certain receptors to trigger their diverse biological effects (Hancock & Sahl, 2013; Nicholls, Madera, & Hancock, 2010). Pan et al. (2019) observed the aggregation of S. aureus, the appearance of many filaments, overgrowed granules and the holes on cell membrane after S. aureus was treated by piscidin 5 from Larimichthys coreca. In fact, many researchers have found that bacteriostatic agents can affect cell division, cell wall biosynthesis and many other

physiological activities after they enter the bacterial cell through dis-rupting cell membrane (Trimble, Mlynarcik, Kolar, & Hancock, 2016). A typical example is the antimicrobial action of ε-Polylysine (ε-PL) on Shewanella putrefaciens. Through acting on the bacterial cell membrane, ε-PL could increase membrane permeability, and inhibit enzyme activity associated with respiratory metabolism and cell metabolism. This ulti-mately led to the inhibition of cell growth, or the induction of cell death (Lan, Zhang, Liu, Chen, & Xie, 2019).

3.4. Whole-cell proteins and membrane proteins of E. coli

The damage of cell membrane may cause the penetration of intra-cellular proteins, and eventually leads to the bacterial lysis (Fry, 2018). SDS-PAGE patterns of treated whole-cell proteins of E. coli by crude protein extracts were showed in Fig. 3A. The control group exhibited clear and bright protein bands (Fig. 3, Lane A). Compared to the control group, protein bands of the experimental groups were with lighter color. When E. coli was exposed to crude protein extracts with higher con-centration, the color of protein bands would be lighter (Fig. 3). It was indicated that there was a gradual decline in total whole-cell proteins content with the increase of the concentration of crude protein extracts. Natural and synthetic antibacterials can interrupt the synthesis of bac-terial protein, especially via targeting the ribosome (Sonenberg & Hin-nebusch, 2009). Therefore, one probable reason for the results might be that protein biosynthesis in E. coli was disturbed after crude protein extracts were added. In addition, due to the disruption of the cell membrane integrity after E. coli was treated by crude protein extracts (Fig. 2), the leakage of intracellular components might result in the decrease of the level of total whole-cell proteins. The reduced amount of whole-cell proteins might lead to an imbalance distribution of the composition in bacteria, thus further increasing the antimicrobial ac-tivity of crude protein extracts.

Usually, membrane protein is toxic to E. coli, thereby severely decrease its growth. It is generally assumed that the overexpression of membrane protein can affect membrane integrity and cell viability, and thus inhibit cell growth and division (Wagner, Bader, Drew, & de Gier, 2006; Zhang et al., 2017). The overexpression may also lead to the

Fig. 2. SEM of E. coli treated with crude protein extracts from P. cicadae. (A) control group; (B) 4 × MIC treated; (C) 8 × MIC treated; (D) 16 × MIC treated.

Q.-W. Cen et al.

LWT 148 (2021) 111785

6

saturation of protein sorting and translocation machineries, possibly through preventing the biosynthesis of endogenous proteins (Wagner et al., 2007). As showed in Fig. 3B, the protein profiles of the control group (Lane A) were blank, however, the protein profiles of experi-mental groups were significantly different. The differentiation of protein bands was observed among experimental groups. The protein patterns were lighter when E. coli was treated by crude protein extracts with higher concentration. Therefore, it could be inferred that crude protein extracts could effectively destabilize the membrane proteins, destroy cell membrane, and change membrane permeability. As a consequence, the content of membrane protein changed after E. coli was treated by crude protein extracts. Similarily, Lin, Gu, Li, Vittayapadung, and Cui (2018) found that ε-PL could act on the cytoplasmic membrane of Lis-teria monocytogenes, and led to the destruction of the integrity of the membrane and the leakage of intracellular constituents, including en-zymes and soluble proteins.

3.5. Genome DNA binding activity

Besides the membrane-target mechanism, AMCs can pass through cell membrane, and thus affect intracellular targets. Many reports have

proposed that AMCs can show an antimicrobial ability through binding to intracellular targets, such as DNA, RNA or proteins (Graf et al., 2017; Kragol et al., 2001; Park, Kim, & Kim, 1998; Park, Yi, Matsuzaki, Kim, & Kim, 2000). Generally, intracellular mechanisms mainly contain the inhibition of DNA, RNA, and protein synthesis, the disruption of other cellular synthetic processes, and the reduction of possible apoptosis (Fry, 2018). Thus, the disruption of cell membrane may be not an uniquely antimicrobial mechanism for crude protein extracts. The other mechanisms also may be involved. DNA is an essential biological macromolecule for the normal organism function, carrying the neces-sary genetic information for the biosynthesis of RNA and protein (Yin et al., 2020).

To verify the intracellular-target mechanism, the binding affinity of P. cicadae crude protein extracts with the bacterial genome DNA was investigated. The results of agarose gel electrophoresis were showed in Fig. 4. The bands of two samples (Fig. 4, Lane A and B) showed similar profiles. The band brightness became gradually lighter in lane C and D (Fig. 4), which indicated that the retardation for genome DNA occurred when the concentration of crude protein extracts reached to 8 × MIC or 16 × MIC. With the increase of the concentration of crude protein ex-tracts, the interaction with bacterial genome DNA became stronger,

Fig. 3. SDS-PAGE patterns of mycoproteins (A) and membrane proteins (B) of E. coli treated with crude protein extracts from P. cicadae. (A) Lane M: protein marker; Lane A: control group; Lane B: 4 × MIC treated; Lane C: 8 × MIC treated; Lane D: 16 × MIC treated. (B) Lane M: protein marker; Lane A: control group; Lane B: 16 ×MIC treated; Lane C: 8 × MIC treated; Lane D: 4 × MIC treated.

Fig. 4. Inhibition of the electrophoretic migration of E. coli genome DNA by crude protein extracts from P. cicadae. Lane M: DNA marker; Lane A: control group; Lane B: 4 × MIC treated; Lane C: 8 × MIC treated; Lane D:16 × MIC treated.

Q.-W. Cen et al.

LWT 148 (2021) 111785

7

resulting in a dose-dependent decrease of DNA mobility as showed in agarose gel electrophoresis (Fig. 4). Here, we assumed that after destroying cell membrane, crude protein extracts could enter into cells, and then bind to bacterial genome DNA as an intracellular target in vitro. So, through disturb the gene transcription and translation, it would affect normal physiological functions of cells. Pan et al. (2019) found that Lc-P5L could interact with genome DNA after damaging the mem-brane. It is notable that some AMCs such as TFPI-2-derived peptide TC38 did not cause the membrane damage of Vibrio vulnificus, but rather could penetrate into the cells to interact with nucleic acids, such as genome DNA and RNA, and thus led to the death of the bacteria by disturbing the normal function and metabolism (Zhang, Yue, et al., 2017).

3.6. Gene expression profile of E. coli

In order to ascertain the antimicrobial mechanisms of crude protein extracts at the molecular level, qRT-PCR was used to detect the expression of relevant genes in E. coli. Compared to the reference gene of the mRNA, the relative changes in the expression of mRNA for target genes were measured by the relative quantitative method (Azadi, Ebrahimi, Khaledi, & ). The control group was treated with an equal volume of sterile water, and the detected expression level of 16SrRNA in the control group was set as 1.0. As showed in Fig. 5, the expression

levels of six genes involved in flagellar biosynthesis, protein folding and substrate translocation across membranes, were measured. Compared to the control group, the expression levels of four genes associated with flagellar biosynthesis, namely fliP, fliO, flgD and flhB, were down-regulated, when E. coli was exposed to crude protein extracts. The flagellin proteins are highly associated with the biofilm formation of microorganisms (Bange et al., 2010; Weber-Sparenberg et al., 2006). Biofilm formation is also regulated by quorum sensing system, which can help microorganisms to acclimate the living environments, espe-cially in unfavorable environments (Taylor, Yeung, & Hancock, 2014). The expression level of dppF, encoding one of ATP-binding components in ATP-binding cassette (ABC) transporter, was up-regulated after E. coli was treated by crude protein extracts (Fig. 5). ABC transporters could utilize the energy generated by ATP hydrolysis to drive the translocation of structurally diverse solutes across the membrane barriers (Kaul & Pattan, 2011; Letoffe, Heuck, Delepelaire, Lange, & Wandersman, 2009). The expression levels of dnaJ, encoding dnaJ chaperone, were up-regulated when the concentrations of crude protein extracts were at 8 × or 16 × MIC (Fig. 5). DnaJ chaperone is a typical member of the heat shock protein 40 family which is a cochaperone of the bacterial Hsp70 dnaK, participating in the operation of diverse cellular functions, such as protein folding, release and transport, membrane lipid composition, cell division as well as biofilm formation (Grudniak, Włodkowska, & ;

Fig. 5. Relative gene expression levels of E. coli treated with crude protein extracts from P. cicadae.

Q.-W. Cen et al.

LWT 148 (2021) 111785

8

Mayhew & Hartl, 1996; McCarty & Walker, 1994; Sienczyk, Skło-dowska, Grudniak, & Wolska, 2004). Our obtained results indicated that AMCs from P. cicadae might inhibit the biosynthesis of flagellar, and promote various physiological processes such as the translocation of diverse substrates across membranes and protein folding. Ye et al. (2013) showed that ε-PL could induce the bacterial oxidative stress response as indicated by the up-regulation of ROS-related genes oxyR and sodA, triggered DNA damage response (SOS response) by regulating the expression of genes recA and lexA, and reduced the transcript levels of virulence genes eaeA and espA. These findings suggested that AMCs could regulate the expression levels of different genes related to various physiological and biochemical processes.

4. Conclusions

It is the first time to extract AMCs from P. cicadae fermentation metabolites, and investigate its antimicrobial mechanism in present study. Antimicrobial behaviour of initial purified crude extracts from P. cicadae fermentation metabolites might be due to the protein com-ponents with a low molecular weight (below 10 KDa). Crude protein extracts could cause irreversible damage of cell membrane, and led to the change of the contents of whole-cell and membrane proteins. Crude protein extracts also might bind with cellular DNA, and thus affected the expression of related genes. In brief, all studied mechanisms caused the cellular abnormal physiological and biochemical processes, and even-tually resulted in cell death. This antimicrobial behavior of AMCs from P. cicadae fermentation metabolites was an complex process in dose- dependent manner. In future study, in order to make the utmost of P. cicadae, crude protein extracts from P. cicadae fermentation metab-olites should be purified further through employing other chromato-graphic techniques. What’s more, the chemical structures of purified antimicrobial compounds, are also needed to be identified.

Credit author statement

Qi-Wen Cen: Experimental design, Data curation, Formal analysis, Writing – review & editing. Zheng-Yun Wang: Experimental design, Data curation, Formal analysis. Zhen-Xing Tang: Supervision, Writing – review & editing. Yu Zhang: Experimental design, Data curation, Formal analysis. Tao Chen: Data curation, Formal analysis. Da-Wei Xue: Writing – review & editing Ming-Feng Xu: Writing – review & editing. Xue-Lian Bai: Writing – review & editing. Ting Zhou: Writing – review & editing. Lu-E Shi: Supervision, Experimental design, guidance and Editing.

Declaration of competing interest

The authors declare no competing financial interests.

Acknowledgments

This work was supported by National Undergraduate Innovation and Entrepreneurship Training Program, Scientific Research Innovation Team Project of Toursim of College of Zhejiang ( 2021TDDS03) and the Project from Sichuan State Key Laboratory of Culinary Science (No. PRKX201917).

References

Azadi, M., Ebrahimi, A., Khaledi, A., & Esmaeili, D. (2019). Study of inhibitory effects of the mixture of cinnamon and ginger extracts on cagA gene expression of Helicobacter pylori by Real-Time RT-PCR technique. Gene Reports, 17, 100493.

Babii, C., Bahrin, L., Neagu, A., Gostin, I., Mihasan, M., Birsa, L., et al. (2016). Antibacterial activity and proposed action mechanism of a new class of synthetic tricyclic flavonoids. Journal of Applied Microbiology, 120, 630–637.

Balamayooran, G., Batra, S., Fessler, M., Happel, K., & Jeyaseelan, S. (2010). Mechanisms of neutrophil accumulation in the lungs against bacteria. American Journal of Respiratory Cell and Molecular Biology, 43, 5–16.

Bange, G., Kümmerer, N., Engel, C., Bozkurt, G., Wild, K., & Sinning, I. (2010). FlhA provides the adaptor for coordinated delivery of late flagella building blocks to the type III secretion system. Proceedings of the National Academy of Sciences of the United States of America, 107, 11295–11300.

Berdy, J. (2005). Bioactive microbial metabolites. Journal of Antibiotics, 58, 1–26. Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram

quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry, 72, 248–254.

Bulet, P., Hetru, C., Dimarcq, J., & Hoffmann, D. (1999). Antimicrobial peptides in insects; structure and function. Developmental & Comparative Immunology, 23, 329–344.

Carvalho, A. O., & Gomes, V. M. (2009). Plant defensins–prospects for the biological functions and biotechnological properties. Peptides, 30, 1007–1020.

Cen, Q., Song, Y., Chen, T., Tu, Z., Bai, X., & Shi, L. (2018). Optimization of extraction technology for polysaccharide from Cordyceps cicadae and the preliminary investigation of its antibacterial activity. Journal of Hangzhou Normal University (Natural Science Edition), 3, 269–274.

Chyau, C. C., Chen, C. C., Chen, J. C., Yang, T. C., Shu, K. H., & Cheng, C. H. (2014). Mycelia glycoproteins from Cordyceps sobolifera ameliorate cyclosporine-induced renal tubule dysfunction in rats. Journal of Ethnopharmacology, 153, 650–658.

Cleveland, J., Montville, T. J., Nes, I. F., & Chikindas, M. L. (2001). Bacteriocins: Safe, natural antimicrobials for food preservation. International Journal of Food Microbiology, 71, 1–20.

Cui, H., Bai, M., Sun, Y., Abdel-Samie, M. A., & Lin, L. (2018). Antibacterial activity and mechanism of Chuzhou chrysanthemum essential oil. Journal of Functional Foods, 48, 159–166.

Donadio, S., Monciardini, P., Alduina, R., Mazza, P., Chiocchini, C., Cavaletti, L., et al. (2002). Microbial technologies for the discovery of novel bioactive metabolites. Journal of Biotechnology, 99, 187–198.

Eom, S. H., Lee, D. S., Jung, Y. J., Park, J. H., Choi, J. I., Yim, M. J., et al. (2014). The mechanism of antibacterial activity of phlorofucofuroeckol-A against methicillin- resistant Staphylococcus aureus. Applied Microbiology and Biotechnology, 98, 9795–9804.

Frank, N. Y., Pendse, S. S., Lapchak, P. H., Margaryan, A., Shlain, D., Doeing, C., et al. (2003). Regulation of progenitor cell fusion by ABCB5 P-glycoprotein, a novel human ATP-binding cassette transporter. Journal of Biological Chemistry, 278, 47156–47165.

Frew, L., & Stock, S. J. (2011). Antimicrobial peptides and pregnancy. Reproduction, 141, 725–735.

Fry, D. E. (2018). Antimicrobial peptides. Surgical Infections, 19, 804–811. Glegola-Madejska, I., Tenland, E., Lerm, M., Puthia, M., Schmidtchen, A., Davoudi, M.,

et al. (2018). A novel derivative of the fungal antimicrobial peptide plectasin is active against Mycobacterium tuberculosis. Tuberculosis, 113, 231–238.

Gomes, R. C., Semedo, L. T. A., Soares, R. M. A., Linhares, L. F., Ulhoa, C. J., Alviano, C. S., et al. (2001). Purification of a thermostable endochitinase from Streptomyces RC1071 isolated from a cerrado soil and its antagonism against phytopathogenic fungi. Journal of Applied Microbiology, 90, 653–661.

Graf, M., Mardirossian, M., Nguyen, F., Seefeldt, A. C., Guichard, G., Scocchi, M., et al. (2017). Proline-rich antimicrobial peptides targeting protein synthesis. Natural Product Reports, 34, 702–711.

Grudniak, A. M., Włodkowska, J., & Wolska, K. I. (2015). Chaperone DnaJ influences the formation of biofilm by Escherichia coli. Polish Journal of Microbiology, 64, 279–283.

Hancock, R. E., & Sahl, H. G. (2013). New strategies and compounds for anti-infective treatment. Current Opinion in Microbiology, 16, 519–521.

Haney, E. F., Mansour, S. C., & Hancock, R. E. (2017). Antimicrobial peptides: An introduction. In P. R. Hasnen (Ed.), Antimicarobial peptides (pp. 3–22). Humana Press.

Kang, H. K., Kim, C., Seo, C. H., & Park, Y. (2017). The therapeutic applications of antimicrobial peptides (AMPs): A patent review. Journal of Microbiology, 55, 1–12.

Kaul, G., & Pattan, G. (2011). MsbA ATP-binding cassette (ABC) transporter of E. coli: Structure and possible flippase mechanism. Indian Journal of Biochemistry & Biophysics, 48, 7–13.

Ke, B. J., & Lee, C. L. (2018). Cordyceps cicadae NTTU 868 mycelium prevents CCl4- induced hepatic fibrosis in BALB/c mice via inhibiting the expression of pro- inflammatory and pro-fibrotic cytokines. Journal of Functional Foods, 43, 214–223.

Klubthawee, N., Adisakwattana, P., Hanpithakpong, W., Somsri, S., & Aunpad, R. (2020). A novel, rationally designed, hybrid antimicrobial peptide, inspired by cathelicidin and aurein, exhibits membrane-active mechanisms against Pseudomonas aeruginosa. Scientific Reports, 10, 9117.

Kollakalnaduvil Raghavan, R. M., Ali Pannippara, M., Kesav, S., Mathew, A., G Bhat, S., Hatha Aa, M., et al. (2021). MFAP9: Characterization of an extracellular thermostable antibacterial peptide from marine fungus with biofilm eradication potential. Journal of Pharmaceutical and Biomedical Analysis, 194, 113808.

Kragol, G., Lovas, S., Varadi, G., Condie, B. A., Hoffmann, R., & Otvos, L., Jr. (2001). The antibacterial peptide pyrrhocoricin inhibits the ATPase actions of DnaK and prevents chaperone-assisted protein folding. Biochemistry, 40, 3016–3026.

Lan, W., Zhang, N., Liu, S., Chen, M., & Xie, J. (2019). ε-polylysine inhibits Shewanella putrefaciens with membrane disruption and cell damage. Molecules, 24, 3727.

Letoffe, S., Heuck, G., Delepelaire, P., Lange, N., & Wandersman, C. (2009). Bacteria capture iron from heme by keeping tetrapyrrol skeleton intact. Proceedings of the National Academy of Sciences of the United States of America, 106, 11719–11724.

Li, T., Liu, Q., Chen, H., & Li, J. (2020). Antibacterial activity and mechanism of the cell- penetrating peptide CF-14 on the gram-negative bacteria, Escherichia coli. Fish & Shellfish Immunology, 100, 489–495.

Li, X. Y., Luo, Q. F., Wei, C. K., Li, D. F., Li, J., & Fang, L. (2014). MiRNA-107 inhibits proliferation and migration by targeting CDK8 in breast cancer. International Journal of Clinical and Experimental Medicine, 7, 32–40.

Q.-W. Cen et al.

LWT 148 (2021) 111785

9

Lin, L., Gu, Y., Li, C., Vittayapadung, S., & Cui, H. (2018). Antibacterial mechanism of ε-poly-lysine against Listeria monocytogenes and its application on cheese. Food Control, 91, 76–84.

Li, Y., Sun, X., Feng, J., & Mo, H. (2015). Antibacterial activities and membrane permeability actions of glycinin basic peptide against Escherichia coli. Innovative Food Science & Emerging Technologies, 31, 170–176.

Liu, S., Murtaza, A., Liu, Y., Hu, W., Xu, X., & Pan, S. (2018). Catalytic and structural characterization of a browning-related protein in oriental sweet melon (Cucumis Melo var. Makuwa Makino). Frontiers in Chemistry, 23, 354.

Li, L., Zhang, T., Li, C., Xie, L., Li, N., Hou, T., et al. (2018). Potential therapeutic effects of Cordyceps cicadae and Paecilomyces cicadae on adenine-induced chronic renal failure in rats and their phytochemical analysis. Drug Design, Development and Therapy, 13, 103–117.

Lu, B. Z., Jiang, Z. M., Mu, H. Z., Hou, G. L., & Wang, C. L. (2006). Experimental study of effect on lung cancer cells of Cordyceps cicadae crude extracts. Science and Technology of Traditional Chinese Medicine, 13, 328–329.

Lv, F., Liang, H., Yuan, Q., & Li, C. (2011). In vitro antimicrobial effects and mechanism of action of selected plant essential oil combinations against four food-related microorganisms. Food Research International, 44, 3057–3064.

Ma, B., Guo, Y., Fu, X., & Jin, Y. (2020). Identification and antimicrobial mechanisms of a novel peptide derived from egg white ovotransferrin hydrolysates. LWT- Food Science and Technology, 131, 109720.

Martínez, J. L. (2012). Bottlenecks in the transferability of antibiotic resistance from natural ecosystems to human bacterial pathogens. Frontiers in Microbiology, 2, 265.

Mayhew, M., & Hartl, F. (1996). Molecular chaperone proteins. Escherichia coli & Salmonella typhimurium. Cellular & Molecular Biology, 1, 217–261.

McCarty, J. S., & Walker, G. C. (1994). DnaK mutants defective in ATPase activity are defective in negative regulation of the heat shock response: Expression of mutant DnaK proteins results in filamentation. Journal of Bacteriology, 176, 764–780.

Meng, X., Li, D., Zhou, D., Wang, D., Liu, Q., & Fan, S. (2016). Chemical composition, antibacterial activity and related mechanism of the essential oil from the leaves of Juniperus rigida Sieb. et Zucc against Klebsiella pneumoniae. Journal of Ethnopharmacology, 194, 698–705.

Miao, J., Xu, M., Guo, H., He, L., Gao, X., Dimarco-Crook, C., et al. (2015). Optimization of culture conditions for the production of antimicrobial substances by probiotic Lactobacillus paracasei subsp. Tolerans FX-6. Journal of Functional Foods, 18, 244–253.

Nicholls, E. F., Madera, L., & Hancock, R. E. (2010). Immunomodulators as adjuvants for vaccines and antimicrobial therapy. Annals of the New York Academy of Sciences, 1213, 46–61.

Nxumalo, W., Elateeq, A. A., & Sun, Y. (2020). Can Cordyceps cicadae be used as an alternative to Cordyceps militaris and Cordyceps sinensis? - a review. Journal of Ethnopharmacology, 257, 112879.

Olatunji, O. J., Feng, Y., Olatunji, O. O., Tang, J., Ouyang, Z., & Su, Z. (2016). Cordycepin protects PC12 cells against 6-hydroxydopamine induced neurotoxicity via its antioxidant properties. Biomedicine & Pharmacotherapy, 81, 7–14.

Olatunji, O. J., Feng, Y., Olatunji, O. O., Tang, J., Ouyang, Z., Su, Z., et al. (2016). Neuroprotective effects of adenosine isolated from Cordyceps cicadae against oxidative and ER stress damages induced by glutamate in PC12 cells. Environmental Toxicology and Pharmacology, 44, 53–61.

Pan, Y., Zheng, L., Mao, Y., Wang, J., Lin, L., Su, Y., et al. (2019). The antibacterial activity and mechanism analysis of piscidin 5 like from Larimichthys crocea. Developmental & Comparative Immunology, 92, 43–49.

Park, C. B., Kim, H. S., & Kim, S. C. (1998). Mechanism of action of the antimicrobial peptide buforin II: Buforin II kills microorganisms by penetrating the cell membrane and inhibiting cellular functions. Biochemical and Biophysical Research Communications, 244, 253–257.

Park, C. B., Yi, K. S., Matsuzaki, K., Kim, M. S., & Kim, S. C. (2000). Structure-activity analysis of buforin II, a histone H2A-derived antimicrobial peptide: The proline hinge is responsible for the cell-penetrating ability of buforin II. Proceedings of the National Academy of Sciences of the United States of America, 97, 8245–8250.

Reddy, K. V. R., Yedery, R. D., & Aranha, C. (2004). Antimicrobial peptides: Premises and promises. International Journal of Antimicrobial Agents, 24, 536–547.

Sienczyk, J., Skłodowska, A., Grudniak, A., & Wolska, K. I. (2004). Influence of DnaK and DnaJ chaperones on Escherichia coli membrane lipid composition. Polish Journal of Microbiology, 53, 121–123.

Sivakumar, P. M., Priya, S., & Doble, M. (2009). Synthesis, biological evaluation, mechanism of action and quantitative structure-activity relationship studies of chalcones as antibacterial agents. Chemical Biology & Drug Design, 73, 403–415.

Sonenberg, N., & Hinnebusch, A. G. (2009). Regulation of translation initiation in eukaryotes: Mechanisms and biological targets. Cell, 136, 731–745.

Sun, X., Zhou, T., Wei, C., Lan, W., Zhao, Y., Pan, Y., et al. (2018). Antibacterial effect and mechanism of anthocyanin rich Chinese wild blueberry extract on various foodborne pathogens. Food Control, 94, 155–161.

Tang, S. S., Prodhan, Z. H., Biswas, S. K., Le, C. F., & Sekaran, S. D. (2018). Antimicrobial peptides from different plant sources: Isolation, characterisation, and purification. Phytochemistry, 154, 94–105.

Taylor, P. K., Yeung, A. T. Y., & Hancock, R. E. W. (2014). Antibiotic resistance in Pseudomonas aeruginosa biofilms: Towards the development of novel anti-biofilm therapies. Journal of Biotechnology, 191, 121–130.

Tong, H., Xia, F., Feng, K., Sun, G., Gao, X., Sun, L., et al. (2009). Structural characterization and in vitro antitumor activity of a novel polysaccharide isolated from the fruiting bodies of Pleurotus ostreatus. Bioresource Technology, 100, 1682–1686.

Trimble, M. J., Mlynarcik, P., Kolar, M., & Hancock, R. E. W. (2016). Polymyxin: Alternative mechanisms of action and resistance. Cold Spring Harbor Perspectives in Medicine, 6, a025288.

Wagner, S., Baars, L., Ytterberg, A. J., Klussmeier, A., Wagner, C. S., Nord, O., et al. (2007). Consequences of membrane protein overexpression in Escherichia coli. Molecular & Cellular Proteomics, 6, 1527–1550.

Wagner, S., Bader, M. L., Drew, D., & de Gier, J. W. (2006). Rationalizing membrane protein overexpression. Trends in Biotechnology, 24, 364–371.

Wang, Y. J., Guo, Y. B., Zhang, L. Q., & Wu, J. (2012). Characterizations of a new Cordyceps cicdae isolate and production of adenosine and cordycepin. Brazilian Journal of Microbiology, 43, 449–455.

Wang, Y., He, P., He, L., Huang, Q., Cheng, J., Li, W., et al. (2019). Structural elucidation, antioxidant and immunomodulatory activities of a novel heteropolysaccharide from cultured Paecilomyces cicadae (Miquel.) Samson. Carbohydrate Polymers, 216, 270–281.

Wang, Y., Mei, X., Liu, Z., Li, J., Zhang, X., Wang, S., et al. (2019). Chemical constituent profiling of Paecilomyces cicadae liquid fermentation for Astragli Radix. Molecules, 24, 2948.

Wang, J., Nie, S., Cui, S. W., Wang, Z., Phillips, A. O., Phillips, G. O., et al. (2017). Structural characterization and immunostimulatory activity of a glucan from natural cordyceps sinensis. Food Hydrocolloids, 67, 139–147.

Weber-Sparenberg, C., Poplau, P., Brookman, H., Rochon, M., Mockel, C., Nietschke, M., et al. (2006). Characterization of the type III export signal of the flagellar hook scaffolding protein FlgD of Escherichia coli. Archives of Microbiology, 186, 307–316.

Weng, S. C., Chou, C. J., Lin, L. C., Tsai, W. J., & Kuo, Y. C. (2002). Immunomodulatory functions of extracts from the Chinese medicinal fungus Cordyceps cicadae. Journal of Ethnopharmacology, 83, 79–85.

Xu, H. J., Mo, Z. H., Yu, J. W., & Mao, X. B. (2010). Separation and purification of anti- fungal compound from Cordyceps cicadae. Natural Product Research and Development, 22, 794-764.

Ye, R., Xu, H., Wan, C., Peng, S., Wang, L., Xu, H., et al. (2013). Antibacterial activity and mechanism of action of epsilon-poly-l-lysine. Biochemical and Biophysical Research Communications, 439, 148–153.

Yin, L., Chen, J., Wang, K., Geng, Y., Lai, W., Huang, X., et al. (2020). Study the antibacterial mechanism of cinnamaldehyde against drug-resistant Aeromonas hydrophila in vitro. Microbial Pathogenesis, 145, 104208.

Zasloff, M. (2002). Antimicrobial peptides of multicellular organisms. Nature, 415, 389–395.

Zhang, Y., Wu, Y. T., Zheng, W., Han, X. X., Jiang, Y. H., Hu, P. L., et al. (2017). The antibacterial activity and antibacterial mechanism of a polysaccharide from Cordyceps cicadae. Journal of Functional Foods, 38, 273–279.

Zhang, M., Yue, B., Zhang, A. H., Wang, G. H., Liu, Y., Zhou, S., et al. (2017). TC38, a teleost TFPI-2 peptide that kills bacteria via penetration of the cell membrane and interaction with nucleic acids. Fish & Shellfish Immunology, 64, 104–110.

Zheng, W., Zhang, Y., Lu, H. M., Li, D. T., Zhang, Z. L., Tang, Z. X., et al. (2015). Antimicrobial activity and safety evaluation of Enterococcus faecium KQ 2.6 isolated from peacock feces. BMC Biotechnology, 15, 30.

Q.-W. Cen et al.