1

Inhibition of host translation by virus infection in

vivo

Classification: Biological Sciences

René Toribio and Iván Ventoso*

Departamento de Virología y Microbiología. Centro de Biología Molecular “Severo

Ochoa” (UAM-CSIC). Nicolás Cabrera 1. Universidad Autónoma de Madrid.

Cantoblanco 28049. Madrid. Spain

Keywords: Virus, Translation, eIF2 phosphorylation, PKR.

Abbreviations: SV, Sindbis virus; pfu, plaque-forming unit; PKR, dsRNA-dependent

protein kinase; eIFs, eukaryotic initiation factors, DLP, downstream hairpin loop; IF,

immunofluorescence.

*To whom correspondence should be addressed. E-mail: iventoso@cbm.uam.es

2

Abstract

Infection of cultured cells with lytic animal viruses often results in the selective

inhibition of host protein synthesis, whereas viral mRNA is efficiently translated under

these circumstances. This phenomenon, called shut off, has been well described at

molecular level for some viruses, but there is not yet any direct or indirect evidences

supporting the idea that it also should operate in animals infected with viruses. To

address this issue, we constructed recombinant Sindbis virus (SV) expressing reporter

mRNA, whose translation is sensitive or resistant to virus-induced shut off. As found in

cultured cells, replication of SV in mouse brain was associated to a strong

phosphorylation of eukaryotic initiation factor eIF2 that prevented translation of

reporter mRNA (luciferase and EGFP). Translation of these reporters was restored in

vitro, in vivo and ex vivo when a viral RNA structure termed DLP, present in viral 26S

mRNA, was placed at the 5´ end of reporter mRNAs. By comparing the expression of

shut off-sensitive and -resistant reporters, we unequivocally concluded that replication

of SV in animal tissues is associated with a profound inhibition of non-viral mRNAs

translation. A strategy as simple as that followed here might be applicable to other

viruses to evaluate their interference on host translation in infected animals.

3

\body

Introduction

The interference of animal viruses with host translation was first documented in

the decade of the 1960s in human fibroblasts infected with poliovirus (1) Further studies

revealed that the halt of host translation (or shut off) was a general phenomenon

observed in cells infected with lytic RNA and DNA viruses (2-6). Of the three steps in

protein synthesis, viruses mainly affect the initiation step by hijacking or modifying the

activity of key initiation factors (eIFs) to ensure an efficient translation of viral mRNAs

and the simultaneous decline of host translation (5-8). The main targets of viruses are

components of the cap-binding complex (eIF4F) that are required for the recruitment of

ribosomes to mRNAs. Thus, some picornaviruses (e.g poliovirus and rhinovirus) and

lentiviruses (e.g HIV-1) express proteases that proteolyze the eIF4G (the largest

component of eIF4F) and PABP (polyA binding protein) to dismantle cellular cap-

dependent translation, whereas viral translation continues by the presence of IRES

elements in viral mRNA that allow the recruitment of ribosomes in a cap-independent

manner (2, 9-14). Other Picornaviruses (e.g EMC), Rhabdoviruses (VSV) and

Adenovirus decrease the activity of eIF4E (the cap-binding protein of eIF4F complex)

by promoting its dephosphorylation or/and the activation of its inhibitors 4E-BP1 and 2

(15-17). In other cases, such as Rotavirus and Influenza, viral proteins hijack eIF4G to

redirect it towards viral factories where viral mRNA is being translated (18, 19).

Another important point of translation control in infected cells relies on the

activity of eIF2 that brings the initiator Met-tRNA to 40S ribosomes (20-23). In

response to viral infection, host dsRNA-activated kinase (PKR) phosphorylates eIF2 in

an attempt to block general translation (both cellular and viral) (24-27). However, most

viruses avoid this by expressing products that prevent the activation of PKR in infected

cells (reviewed in (28)). A remarkable exception to this are the members of alphavirus

group (Sindbis and Semliki forest virus). Thus, complete phosphorylation of eIF2 was

found in cultured mouse fibroblasts infected with these viruses, so that only viral

mRNA is translated under these circumstances (22, 29). The presence of a secondary

structure termed DLP located 27 nts downstream from the initiator AUG in viral 26S

transcripts allows this mRNA to be translated by an eIF2-independent mechanism in

infected cells (22, 30).

4

The shut off phenomenon has been extensively studied in cultured cells, but not

in infected animals, so that evidences for virus-induced shut off in vivo are still lacking.

In vitro experiments often require somewhat artefactual conditions such as the use of

highly susceptible cell lines to virus and high multiplicity of infection, two conditions

that are difficult to find during virus replication in animals. Moreover, the analysis of

virus-induced shut off in vivo raises technical difficulties to measure de novo protein

synthesis in a single animal´s cell infected with the virus. Many viruses also interfere

with other steps of host gene expression such as transcription, mRNA transport or

stability (3, 29, 31-35), making it very difficult to attribute a reduction in the synthesis

of host proteins (or of a given host protein used as reporter) to the sole effect on

translation.

We show here that, as occurs in vitro, replication of Sindbis virus in mouse

brains is linked to a phosphorylation of eIF2 that was detected in infected neurons. We

show indirect, but strong evidences that shut off of host translation also occurs in

animals infected with viruses.

Results

Engineered reporter mRNAs that mimic translation of cellular and viral mRNA in

SV-infected cells. We previously reported that as consequence of PKR-induced eIF2

phosphorylation, only viral 26S mRNA that bears DLP structure is translated in

alphavirus-infected cells (Fig.1A and (22)). Like the rest of cellular mRNAs,

heterologous mRNA expressed from a recombinant SV was no longer translated in

infected mouse fibroblasts due to eIF2 phosphorylation (Fig. 1C, 1F and (22)).

Translation of reporter mRNA was easily restored when viral DLP (90 nts in length)

structure was placed at the 5´ end of a coding sequence of these mRNAs, allowing a

translation as efficient as that of viral 26S mRNA (Fig. 1E). We reasoned that, in terms

of translation in SV-infected cells, these reporter mRNAs lacking or containing DLP

structures might behave as bona fide cellular and viral mRNAs, respectively. Moreover,

since these reporter mRNAs are transcribed from a viral promotor, differential

expression should reflect exclusively differences in the rate of translation. Thus, virus-

induced shut off in vivo could be easily inferred by comparing the expression of reporter

genes in animals infected with these two types of viruses (SV-reporter vs SV-DLP

reporter). To validate our experimental approach, we first carried out a detailed

5

characterization of recombinant viruses in cultured cells (Fig.1B). The synthesis of

luciferase and EFGP was strongly inhibited in 3T3 cells infected with recombinant SV-

Luc and SV-EGFP, respectively, as compared with their counterparts that bear the viral

DLP structure (SV-DLP Luc and SV-DLP EGFP). No differences in expression were

detected in PKRo/o

cells, showing that phosphorylation of eIF2 hampered translation of

non-viral mRNAs as described before (22). Next, we quantified the extent of

translational exclusion of EGFP mRNA in SV-infected cells compared to cellular

mRNAs (e.g. !-actin). Thus, we metabolicaly labeled infected cells with [35

S]-Met/Cys

to analyze de novo protein synthesis of EGFP, virus capsid protein (SV C) and cellular

!-actin. In parallel, we also analyzed the steady state levels of their corresponding

mRNAs by northern-blot (Fig. 1E). Infection with all recombinant SV viruses induced a

strong inhibition of !-actin synthesis (>90%) without affecting the levels of its

corresponding mRNA in a significant way (Fig. 1E). Similar amounts of EGFP and

DLP-EGFP mRNAs acumulated in infected cells, but only DLP-EGFP mRNA was

translated. Thus, translation of both EGFP and !-actin mRNAs was inhibited to a

similar extent (>90%) in infected cells. On the contrary, we estimated that translation of

DLP-EGFP mRNA was comparable to 26S mRNA that encodes the structural proteins

of virus (including C protein). Translation of EGFP, however, was almost completely

abrogated when the DLP structure was disrupted by point mutations that destroyed its

secondary structure in SV-"DLP EGFP virus, showing that DLP was essential for

translational resistance to eIF2 phosphorylation.

Shut off induced by SV infection of mouse brain. We next infected mice with

recombinant viruses to compare the reporter activity in whole organs (luciferase) or in

single-infected cells (EGFP). SV shows a marked neurotropism in mice, infecting

neurons of the neocortex and hippocampal regions of brain (36-38). Inoculation of mice

with recombinant viruses by the intranasal route resulted in a rapid replication in brains

over a period of 4 days postinfection, yielding 106-10

7 pfu per brain. First, we

cryosectioned brains of infected animals and the resulting slices were subjected to IF

with anti-SV C and anti-phospho eIF2#. At 3 dpi, viral antigens were detected in groups

of neurons in anterior ventral regions of brain, as well in basolateral areas

corresponding to the pyriform cortex (Fig. 2A). At 4-6 dpi, viral antigens were detected

in areas of the somatosensorial and motor cortex as well in the hippocampus, suggesting

that virus entered via the olfatory bulb to further spread out to upper regions of the

6

cortex. Interestingly, a prominent label of phospho-eIF2# was detected only in regions

of virus replication in wild type animals. We found that up to 90% of areas expressing

viral antigens immunoreacted to phospho-eIF2# antibodies, showing that replication of

SV in animals is also associated with inactivation of eIF2. No phospho-eIF2# staining

was detected in PKRo/o

-infected animals, showing that PKR quinase is also responsable

for eIF2 phosphorylation during SV replication in vivo.

Replication of SV-Luc and SV-DLP Luc in mice, measured by viral yields, was

identical (Fig. 2B). However, only luciferase activity was detected in wild type mice

infected with SV-DLPLuc. These differences in luciferase activity between SV-luc and

SV-DLP Luc were even more marked than in cultured cells (see Fig. 1F), showing that

translation of non-viral mRNA was severely impaired in mouse brain neurons of wild

type animals. As expected, no differences in luciferase activity were detected among

SV-Luc and SV-DLP Luc viruses in PKRo/o

mice (Fig. 2C). We next analyzed the

expression of EGFP in brain neurons of mice infected with SV-EGFP and SV-DLP

EGFP at the peak of virus replication (3 days). Although replication of SV-EGFP and

SV-DLP EGFP was indistinguishable as judged by IF staining of viral antigens, we

found strong differences in EGFP expression among brains of animals infected with

these two viruses (Fig. 3A). For SV-DLP EGFP, about 50% of cells that immunoreacted

with anti-SV C antibodies expressed EGFP, whereas only 5-10% of cells infected with

SV-EGFP showed detectable EGFP expression (Fig. 3). Moreover, the few cells

expressing EGFP from SV-EGFP showed a fluorescence intensity lower than their

counterparts infected with SV-DLP EGFP.

Shut off also operates ex-vivo. Organotypical explants can be easily derived from rat

hippocampus and maintained in culture for a variety of purposes including

electrophysiological studies (39, 40). Moreover, hippocampal slices can be transduced

with non-replicative derivates of Sindbis and Semliki Forest viruses for the expression

of foreigner genes (41, 42). It was interesting, therefore, to test whether shut off also

happened in explanted brain slices after in vitro infection with SV. Thus, slices were

incubated with preparations of SV-EGFP or SV-DLP EGFP viruses (104 pfu each) and

analyzed by IF one day later. Both viruses spread rapidly throughout the explant

infecting an elevated number of neurons, most of them with a pyramidal shape.

Notably, a dramatic difference in number and fluorescent intensity of neurons

expressing EGFP was found among slices infected with SV-EGFP and SV-DLP EGFP

(Fig. 3B). Virtually all cells infected with SV-DLP EGFP simultaneously expressed

7

EGFP (94%), whereas only a very small proportion of neurons infected with SV-EGFP

virus showed EGFP fluorescence (2%). Slices were also incubated with anti-

phosphoeIF2# antibodies, showing that ex vivo infection with SV also triggered eIF2#

phosphorylation, as occurred in vitro and in vivo (supporting figure S2).

Discussion

We show here for the first time that replication of a virus in an animal tissue

resulted in the inactivation of a translation initiation factor (eIF2). Although we

ourselves, as well as other investigators, had already reported a strong activation of

PKR that led to a complete phosphorylation of eIF2 in cultured cells infected with SV

and Semliki forest virus (SFV), there was no experimental evidence supporting the idea

that such an event happened in infected animals. A detailed examination of brains from

infected animals revealed that virtually all groups of neurons expressing viral antigens

also immunoreacted to anti-phosphoeIF2# antibodies. This finding was notable and

showed that replication of SV in animals is intimately linked to PKR-mediated eIF2

phosphorylation. Accordingly, PKR expression in mouse brain has been found

particulary high in the neocortex and hippocampus (http://www.brain-map.org/), where

SV replication was easily detected. Interestingly, phosphorylation of eIF2 in cortical

neurons has been reported to occur during ischemic stress and other pathological

situations such as Alzheimer and Huntington diseases (43-47)

By means of recombinant viruses expressing engineered reporter mRNAs, we

present indirect but solid evidence that translation of non-viral mRNA is strongly

inhibited in infected mouse brain neurons. Virus expressing reporter genes were used in

earlier studies to track replication and spreading of the virus to different organs of

infected animals (37, 41, 48). However, to date, the shut off phenomenon has not been

addressed in vivo, probably due to the technical difficulties that such a study raises. Our

approach is based on the assumption that translation of reporter mRNAs used here

faithfully reflected translation of host and viral mRNAs in infected cells. All results

obtained supported this. First, translation of EGFP and luciferase mRNA was inhibited

to a similar extent as !-actin and the majority of cellular mRNAs in infected cells.

Second, the placement of a DLP structure at the 5´ end of the EGFP coding sequence

restored translation to a level comparable to that of translation in viral 26S mRNA.

Third, the use of a viral promotor that drives the synthesis of reporter mRNA allowed

direct measurement of the effect of virus replication on translation, obviating the

8

perturbations that Sindbis and other viruses exert on cellular transcription (3, 31-33, 49).

In fact, infection with alphavirus also results in a halt of host transcription that can be

separated from the translation shut off phenomenon (49). Despite this, we found that

the steady state levels of abundant host RNA, such as ribosomal or !-actin mRNA, did

not significantly decrease at 6 hpi, when translation of host mRNA was completely

inhibited (Fig.1).

A similar experimental strategy to that described here might be applicable to the

study of shut off in other viruses where the interference with host translational

machinery has been well clarified. This approach requires, however, a previous

knowledge of molecular tricks that allow the mRNA of a given virus to be translated in

an enviroment of general translational inhibition. This has been well described for

picornavirus and roughly clarified for VSV, Influenza, Adenovirus and Rotavirus but

not for others such as Poxvirus (6, 16, 17, 19, 50, 51). Thus, the low dependence of

VSV, Adenovirus and Influenza for the cap binding protein eIF4E might be used to

create reporter mRNA with different translational capabilities in cells infected with

these viruses (52-55). A limitation of the strategy described here is that reporter genes

should be placed under subgenomic promotors in RNA or DNA viruses to create a

transcriptional independence, which excludes picornavirus and other viruses that

initiates transcription exclusively from the end of the genomic strand.

The demostration that shut off also takes place in vivo, at least for alphavirus

could have profound implications for a better understanding of virus-host interactions in

infected animals. Moreover, the ability of viruses to block host translation might be

critically regulating their pathogenic potential by preventing the synthesis of proteins

with antiviral function such as interferons and other inflammatory cytokines.

Finally, the influence of viral DLP on translation of mRNA in SV-infected cells

could improve the expression of foreigner genes from SV-derived vectors, which are

widely used to transduce primary neurons and organotypical explants of brain animals

(41, 42).

9

Materials and Methods

Animals and cell lines. Wild type (Charles River) and PKR knock-out animals (kindly

provided by J. C. Bell, University of Ottawa, Canada, (56)) from 129sv strain were

used. Four-weeks old females were infected by the intranasal route with 5x106-10

7 pfu

of Sindbis virus. 3T3 cells derived from wild type and PKRo/o

animals (27) and BHK21

were grown in DMEN suplemented with bovine serum (3T3) and fetal serum (PKRo/o

and BHK21) as described previously (22). MEFs derived from 129sv mice were

prepared following standard protocols (23).

Construction of Recombinant viruses. Recombinant viruses expressing luciferase or

EGFP mRNAs were constructed in the pT7SV-2p plasmid, an infectious cDNA clone

of the Sindbis virus which carries a second subgenomic promotor at the 3´ of genomic

mRNA, and which has been designed to express foreigner genes (57). The construction

of SV-EGFP has been described (22). For SV-Luc, the luciferase coding sequence was

amplified by PCR with the following primers: 5´ Luc GGGCGCTAGCGGATCCA

ATGGAAGACGCCAAAAAC and 3´ Luc: CGCCGCTAGCTTACAATTTGGACT

TTCCGCC. PCR products were digested with NheI enzyme and cloned into the XbaI

site of pT7SV-2p. For SV-DLP EGFP, we amplified by PCR a DNA fragment

containing the DLP of SV fused in frame to the EGFP coding sequence from plasmid

p5´CEGFP-N1 (22). The primers used were: 5´C SV GCGCGCTAGCATGAA

TAGAGGATTC and 3´ EGFP CGCGCTCTAGATTACTTGTACAGCTCGTC. The

resulting PCR product was cloned into the XbaI site of pT7SV-2p as described above.

For SV-"DLP EGFP, the template for PCR amplification was p5´C"DLP EGFP-N1

plasmid carrying point mutations in DLP region that disrupted the secondary structure

of RNA as described before (22). For SV-DLP Luc, the PCR fragment of luciferase

coding sequence described above was cloned into p5´CEGFP-N1 plasmid using BamHI

and XbaI enzymes. Then, a PCR amplification was done using 5´C SV and 3´ Luc

primers and the resulting fragment was cloned into pT7SV-2p plasmid as described

before. All constructions were verified by sequencing. Infectious RNAs were generated

in vitro by transcription with RNApol T7 and electropored in BHK21 cells as described

10

previously (22). Viruses were collected 2-3 days later when the cytophatic effect was

massive and purified by ultracentrifugation (29K for 4 h) through a sucrose cushion at

4ºC. The resulting viral preparation showed titres of 5x108-10

9 pfu/mL and a high

degree of genetic homogeneity (see supplementary data).

Immunofluorescence (IF). For IF of tissues, brains of infected mice were extracted 3

dpi and fixed overnight with 4% PFA at 4ºC and then hydrated with 30% sucrose for

48h. Brains were cryosectioned at 15 µm, postfixed with PFA at RT for 15´ and

permeabelized with 0.2 % Triton X-100 in PBS for 30´. Sections were treated with

ammonium chloride, blocked in 5% BSA-PBS and incubated overnight at 4ºC with

primary antibodies: anti-C SV (1:300), anti-phosphoeIF2# (Cell Signaling, 1:200).

Sections were washed three times for 15´ with PBS-0,1 Triton X-100 and incubated

with secondary antibodies coupled to Alexa 555 or Alexa 594 for 1h. Finally, sections

were washed as described above, mounted and photographed in a Leika confocal

microscope. For IF of cultures cells growing on coverslips, the protocol was similar

except that primary antibodies were incubated 2h at RT. Western Blot was carried out

essentially as described previously (22).

Metabolic labeling of proteins. Cells growing in 24-well plates were infected with a

moi of 25 pfu/cell and 5:30 h later labeled with 25 µCi/mL of [35

S]-Met/Cys (20) for

30´ in medium lacking methionine. After washing with cold medium, monolayers were

lysed in a sample buffer, boiled and analyzed in a 12% SDS-PAGE followed by

fluorography with 1M salicylate solution and exposure to X-ray film.

Luciferase assays. Brains of mice infected with luciferase-expressing viruses were

homogenated in PBS and extracted with 1 volumen of 2X luciferase lysis buffer

(KH2PO4 15 mM, MgSO4 15 mM, EGTA 4 mM, DTT 4mM and T-X100 1%). After

centrifugation at 10K for 5´, 20µL of lysates were used to measure luciferase activity.

Infection of organotypic slices from rat hippocampus. Hippocampal slices from 6-

day-old rats were prepared as described before (40) and maintained in culture for 1

week before infection with 104-10

5 pfu of the indicated virus. A 2 µL drop of virus

preparation was applied on slices twice, and the drops were allowed to drain away

11

between applications. Virus replication and spreading were checked every 24h by living

examination of EGFP fluorescence. IF analysis was identical to described above, except

for incubations were done on floating sections.

Acknowledgments. We are in debt to J. Mª Almendral for having allowed us to work

at his laboratory since 2005 and J.J. Berlanga and J.A. Esteban for providing us with

mice and organotypical preparations, respectively. Thanks go to J. C. Bell, B.R.

Williams and M. A. Sanz for PKRo/o

mice, PKRo/o

3T3 cells and pT7SV2p plasmid,

respectively. This work was supported in part by grants from the Ministerio de Ciencia

e Innovación (SAF2006-09810) and the Fundación Mutua Madrileña (FMM 2008).

Support from the VIRHOST programme and the Fundación Ramón Areces is also

acknowledged. R.T. was a recipient of the SAF2006-09810 contract and I.V. is a

researcher of Ramón y Cajal Programme.

References

1. Holland JJ & Peterson JA (1964) Nucleic Acid And Protein Synthesis During

Poliovirus Infection Of Human Cells. J Mol Biol 8:556-575.

2. Etchison D, Milburn SC, Edery I, Sonenberg N, & Hershey JW (1982)

Inhibition of HeLa cell protein synthesis following poliovirus infection

correlates with the proteolysis of a 220,000-dalton polypeptide associated with

eucaryotic initiation factor 3 and a cap binding protein complex. J Biol Chem

257(24):14806-14810.

3. Kaariainen L & Ranki M (1984) Inhibition of cell functions by RNA-virus

infections. Annu Rev Microbiol 38:91-109.

4. Gingras AC, Raught B, & Sonenberg N (1999) eIF4 initiation factors: effectors

of mRNA recruitment to ribosomes and regulators of translation. Annu Rev

Biochem 68:913-963.

5. Schneider RJ & Mohr I (2003) Translation initiation and viral tricks. Trends

Biochem Sci 28(3):130-136.

6. Bushell M & Sarnow P (2002) Hijacking the translation apparatus by RNA

viruses. J Cell Biol 158(3):395-399.

7. Thompson SR & Sarnow P (2000) Regulation of host cell translation by viruses

and effects on cell function. Curr Opin Microbiol 3(4):366-370.

8. Pestova TV, et al. (2001) Molecular mechanisms of translation initiation in

eukaryotes. Proc Natl Acad Sci U S A 98(13):7029-7036.

12

9. Gradi A, Svitkin YV, Imataka H, & Sonenberg N (1998) Proteolysis of human

eukaryotic translation initiation factor eIF4GII, but not eIF4GI, coincides with

the shutoff of host protein synthesis after poliovirus infection. Proc Natl Acad

Sci U S A 95(19):11089-11094.

10. Ventoso I, Blanco R, Perales C, & Carrasco L (2001) HIV-1 protease cleaves

eukaryotic initiation factor 4G and inhibits cap-dependent translation. Proc Natl

Acad Sci U S A 98(23):12966-12971.

11. Pelletier J & Sonenberg N (1988) Internal initiation of translation of eukaryotic

mRNA directed by a sequence derived from poliovirus RNA. Nature

334(6180):320-325.

12. Chen CY & Sarnow P (1995) Initiation of protein synthesis by the eukaryotic

translational apparatus on circular RNAs. Science 268(5209):415-417.

13. Joachims M, Van Breugel PC, & Lloyd RE (1999) Cleavage of poly(A)-binding

protein by enterovirus proteases concurrent with inhibition of translation in

vitro. J Virol 73(1):718-727.

14. Kerekatte V, et al. (1999) Cleavage of Poly(A)-binding protein by

coxsackievirus 2A protease in vitro and in vivo: another mechanism for host

protein synthesis shutoff? J Virol 73(1):709-717.

15. Gingras AC, Svitkin Y, Belsham GJ, Pause A, & Sonenberg N (1996)

Activation of the translational suppressor 4E-BP1 following infection with

encephalomyocarditis virus and poliovirus. Proc Natl Acad Sci U S A

93(11):5578-5583.

16. Connor JH & Lyles DS (2002) Vesicular stomatitis virus infection alters the

eIF4F translation initiation complex and causes dephosphorylation of the eIF4E

binding protein 4E-BP1. J Virol 76(20):10177-10187.

17. Huang JT & Schneider RJ (1991) Adenovirus inhibition of cellular protein

synthesis involves inactivation of cap-binding protein. Cell 65(2):271-280.

18. Aragon T, et al. (2000) Eukaryotic translation initiation factor 4GI is a cellular

target for NS1 protein, a translational activator of influenza virus. Mol Cell Biol

20(17):6259-6268.

19. Piron M, Vende P, Cohen J, & Poncet D (1998) Rotavirus RNA-binding protein

NSP3 interacts with eIF4GI and evicts the poly(A) binding protein from eIF4F.

Embo J 17(19):5811-5821.

20. Krishnamoorthy T, Pavitt GD, Zhang F, Dever TE, & Hinnebusch AG (2001)

Tight binding of the phosphorylated alpha subunit of initiation factor 2

(eIF2alpha) to the regulatory subunits of guanine nucleotide exchange factor

eIF2B is required for inhibition of translation initiation. Mol Cell Biol

21(15):5018-5030.

21. Dever TE (2002) Gene-specific regulation by general translation factors. Cell

108(4):545-556.

22. Ventoso I, et al. (2006) Translational resistance of late alphavirus mRNA to

eIF2alpha phosphorylation: a strategy to overcome the antiviral effect of protein

kinase PKR. Genes Dev 20(1):87-100.

23. Berlanga JJ, et al. (2006) Antiviral effect of the mammalian translation initiation

factor 2alpha kinase GCN2 against RNA viruses. Embo J 25(8):1730-1740.

24. Balachandran S, et al. (2000) Essential role for the dsRNA-dependent protein

kinase PKR in innate immunity to viral infection. Immunity 13(1):129-141.

25. Meurs E, et al. (1990) Molecular cloning and characterization of the human

double-stranded RNA-activated protein kinase induced by interferon. Cell

62(2):379-390.

13

26. Stojdl DF, et al. (2000) The murine double-stranded RNA-dependent protein

kinase PKR is required for resistance to vesicular stomatitis virus. J Virol

74(20):9580-9585.

27. Yang YL, et al. (1995) Deficient signaling in mice devoid of double-stranded

RNA-dependent protein kinase. Embo J 14(24):6095-6106.

28. Garcia MA, et al. (2006) Impact of protein kinase PKR in cell biology: from

antiviral to antiproliferative action. Microbiol Mol Biol Rev 70(4):1032-1060.

29. Gorchakov R, Frolova E, Williams BR, Rice CM, & Frolov I (2004) PKR-

dependent and -independent mechanisms are involved in translational shutoff

during Sindbis virus infection. J Virol 78(16):8455-8467.

30. Frolov I & Schlesinger S (1996) Translation of Sindbis virus mRNA: analysis of

sequences downstream of the initiating AUG codon that enhance translation. J

Virol 70(2):1182-1190.

31. Katze MG & Agy MB (1990) Regulation of viral and cellular RNA turnover in

cells infected by eukaryotic viruses including HIV-1. Enzyme 44(1-4):332-346.

32. Rice AP & Roberts BE (1983) Vaccinia virus induces cellular mRNA

degradation. J Virol 47(3):529-539.

33. Inglis SC (1982) Inhibition of host protein synthesis and degradation of cellular

mRNAs during infection by influenza and herpes simplex virus. Mol Cell Biol

2(12):1644-1648.

34. Gustin KE & Sarnow P (2001) Effects of poliovirus infection on nucleo-

cytoplasmic trafficking and nuclear pore complex composition. Embo J 20(1-

2):240-249.

35. Her LS, Lund E, & Dahlberg JE (1997) Inhibition of Ran guanosine

triphosphatase-dependent nuclear transport by the matrix protein of vesicular

stomatitis virus. Science 276(5320):1845-1848.

36. Binder GK & Griffin DE (2001) Interferon-gamma-mediated site-specific

clearance of alphavirus from CNS neurons. Science 293(5528):303-306.

37. Cook SH & Griffin DE (2003) Luciferase imaging of a neurotropic viral

infection in intact animals. J Virol 77(9):5333-5338.

38. Lewis J, Wesselingh SL, Griffin DE, & Hardwick JM (1996) Alphavirus-

induced apoptosis in mouse brains correlates with neurovirulence. J Virol

70(3):1828-1835.

39. Gahwiler BH (1981) Organotypic monolayer cultures of nervous tissue. J

Neurosci Methods 4(4):329-342.

40. Correia SS, et al. (2008) Motor protein-dependent transport of AMPA receptors

into spines during long-term potentiation. Nat Neurosci 11(4):457-466.

41. Ehrengruber MU, et al. (1999) Recombinant Semliki Forest virus and Sindbis

virus efficiently infect neurons in hippocampal slice cultures. Proc Natl Acad

Sci U S A 96(12):7041-7046.

42. Xiong C, et al. (1989) Sindbis virus: an efficient, broad host range vector for

gene expression in animal cells. Science 243(4895):1188-1191.

43. Burda J, et al. (1994) Phosphorylation of the alpha subunit of initiation factor 2

correlates with the inhibition of translation following transient cerebral

ischaemia in the rat. Biochem J 302 (Pt 2):335-338.

44. Onuki R, et al. (2004) An RNA-dependent protein kinase is involved in

tunicamycin-induced apoptosis and Alzheimer's disease. Embo J 23(4):959-968.

45. Bando Y, et al. (2005) Double-strand RNA dependent protein kinase (PKR) is

involved in the extrastriatal degeneration in Parkinson's disease and

Huntington's disease. Neurochem Int 46(1):11-18.

14

46. Peel AL (2004) PKR activation in neurodegenerative disease. J Neuropathol

Exp Neurol 63(2):97-105.

47. Paquet C, et al. (2009) Neuronal phosphorylated RNA-dependent protein kinase

in Creutzfeldt-Jakob disease. J Neuropathol Exp Neurol 68(2):190-198.

48. Rodriguez JF, Rodriguez D, Rodriguez JR, McGowan EB, & Esteban M (1988)

Expression of the firefly luciferase gene in vaccinia virus: a highly sensitive

gene marker to follow virus dissemination in tissues of infected animals. Proc

Natl Acad Sci U S A 85(5):1667-1671.

49. Gorchakov R, Frolova E, & Frolov I (2005) Inhibition of transcription and

translation in Sindbis virus-infected cells. J Virol 79(15):9397-9409.

50. Feigenblum D & Schneider RJ (1993) Modification of eukaryotic initiation

factor 4F during infection by influenza virus. J Virol 67(6):3027-3035.

51. Zhang Y, Feigenblum D, & Schneider RJ (1994) A late adenovirus factor

induces eIF-4E dephosphorylation and inhibition of cell protein synthesis. J

Virol 68(11):7040-7050.

52. Berg DT & Grinnell BW (1992) 5' sequence of vesicular stomatitis virus N-gene

confers selective translation of mRNA. Biochem Biophys Res Commun

189(3):1585-1590.

53. Garfinkel MS & Katze MG (1993) Translational control by influenza virus.

Selective translation is mediated by sequences within the viral mRNA 5'-

untranslated region. J Biol Chem 268(30):22223-22226.

54. Burgui I, Yanguez E, Sonenberg N, & Nieto A (2007) Influenza virus mRNA

translation revisited: is the eIF4E cap-binding factor required for viral mRNA

translation? J Virol 81(22):12427-12438.

55. Cuesta R, Xi Q, & Schneider RJ (2000) Adenovirus-specific translation by

displacement of kinase Mnk1 from cap-initiation complex eIF4F. Embo J

19(13):3465-3474.

56. Abraham N, et al. (1999) Characterization of transgenic mice with targeted

disruption of the catalytic domain of the double-stranded RNA-dependent

protein kinase, PKR. J Biol Chem 274(9):5953-5962.

57. Levis R, Schlesinger S, & Huang HV (1990) Promoter for Sindbis virus RNA-

dependent subgenomic RNA transcription. J Virol 64(4):1726-1733.

15

Figure Legends

Fig.1 In vitro characterization of recombinant SV expressing shut off-sensitive and -

resistant reporter mRNAs. (A) Flow chart showing the main translational alteration in

SV-infected cells (see text for details). (B) Schematic diagram of recombinant SV

expressing reporter mRNAs. The genomic organization of SV RNA is shown, including

the natural and duplicate subgenomic promotors (blue) that drive the synthesis of 26S

mRNA encoding the viral structural proteins and the reporter mRNAs (luciferase or

EGFP), respectively. Arrows show the transcription start site from each promotor. A

downstream hairpin loop structure (DLP) included in the first 90 nts of the 26S mRNA

coding sequence was also placed in the indicated reporter mRNAs. In SV-"DLP EGFP

the secondary structure of DLP was disrupted by point mutations as described before

(22). (C) Western-blot analysis of recombinant SV in wild type (PKR+/+

) and PKRo/o

3T3 cells. Cells were infected with the indicated virus at a moi of 25 pfu/cell and

analyzed at 6 hpi by western-blot with the indicated antibodies. Note that the placement

of 90 nts of the coding sequence of the C protein that includes the DLP increased the

size of EGFP and delayed its electrophoretic mobility. (D) IF of SV expressing the

indicated versions of EGFP in wild type 3T3 cells. Micrographs were taken at 6hpi. (E)

De novo translation of cellular and viral-expressing mRNA in infected cells. Cells were

infected with the indicated virus and labeled with [35

S]Met/Cys at 5:30 hpi for 30´.

Proteins were analyzed by SDS-PAGE and autorradiography. Bands corresponding to

!-actin, SV capside (SV C) and EGFP were quantified by densitometry, corrected for

the number of methionines and cysteines and expressed as percentage of control (mock

for !-actin and DLPEGFP for EGFP). Parallel infections were used for extracting total

RNA and a northern-blot analysis was performed against the indicated mRNAs. (F)

Luciferase activiy of PKR+/+

and PKRo/o

cells infected with the indicated viruses.

Samples were analyzed at 6hpi and luciferase activity was measured as described in

16

materials and methods. The standard deviation from three independent experiments is

shown.

Fig.2. Phosphorylation of eIF2 in mice infected with SV and inhibition of non-viral

translation. (A) Representative IF micrographs of coronal brain sections from wild type

and PKRo/o

mice infected with SV at 3dpi. Adjacent sections were incubated with anti-

SV C or anti-phosphoeIF2# antibodies. 214 out of 238 replication foci scored from

three wild type infected animals showed strong staining of phosphoeIF2# (89%) (right

panel), whereas no eIF2phosphorylation associated to SV replication was detected

in PKRo/o

mice. No immunoreaction of anti-phosphoeIF2# antibodies was detected

away from replication foci in any wild type mouse analyzed. (B) Expression of Luc, but

not of DLP-Luc, was inhibited in brains of wild type animals infected with recombinant

viruses. Mice were infected with the indicated viruses and brain homogenates were

prepared at the indicated times to quantify viral yields (left) and luciferase activity

(right). (C) Translation of luc mRNA was restored in PKRo/o

animals infected with

SV-Luc.

Fig. 3 Inhibition of EGFP expression, but not of DLP-EGFP, in single neurons infected

with recombinant virus in vivo and ex-vivo. (A) Brains of infected animals were

analyzed at 3dpi for simultaneous EGFP fluorescence and anti-SV C reactivity.

Representative micrographs with scale bars are shown. 80 neurons expressing viral

antigens from each virus were scored, and 32 of them showed EGFP fluorescence for

SV-DLP EGFP virus (40%), whereas only 4 neurons infected with SV-EGFP showed

green fluorescence (5%) (lower panel). (B) SV replication and EGFP expression in rat

hippocampal slices infected with the indicated virus and analyzed at 1dpi. Samples were

processed as described above. 372 neurons expressing viral antigens from SV- DLP

EGFP and 1098 from SV EGFP were scored for statistical analysis (lower panel).

SV infection

- host translation inhibited

AAA

A

Luc

- translation of viral 26S mRNAs

PKR activation

structural

genomic mRNADLP

non structural

AAA

Lucreporter AAA

reporter

BC

D

E

DLP

Lucreporter AAA

SV-reporter

SV-DLP reporter

SV- DLP reporter

mock

SV-E

GFP

SV-D

LP EG

FP

SV-

DLP E

GFP

100 2 2.5 3 - 7 100 15

actin synthesisEGFP synthesis

mock

SV-E

GFP

SV-D

LP EG

FPmo

ckSV

-EGF

PSV

-DLP

EGF

P

SV-

DLP E

GFP

SV-

DLP E

GFP

eIF2

PKR

EGFP

SV C

eIF2 PeIF2 P

-actin

EGFPSV C

EGFP mRNA

-actin mRNA

49S mRNA26S mRNA

Mr (kDa)

F

5000

15000

25000

35000

45000

SV-L

uc

SV-L

uc

SV-D

LP L

uc

SV-D

LP L

uc

Luc

ifer

ase

activ

ity(R

LU

/g

of p

rote

in)

SV-E

GFP

SV-D

LP

EG

FPSV

-D

LP

EG

FP

anti-SV C EGFP

PKR+/+ PKRo/o

PKR+/+ PKRo/o

FIG.1

merge

0

0.5

1

1.5

2

2.5

3

0 2 3

1

10

102103104105106107

0 2 3

Luci

fera

se a

ctiv

ity (

arbi

trary

uni

ts)

Vi

rus y

ield

(pfu

/bra

in)

dpi dpi

-eIF2 P-SV C

SV-DLP LucSV-Luc

A

B

FIG.2

PKR+/+

PKRo/o

SV C

+ and

eIF

2p+

0

20

40

60

80

100

PKR+/

+

PKRo/o

0

0,5

1

1,5

2

2,5

3

3,5PKRo/o

SV-L

uc

SV-L

uc

SV-D

LP L

uc

SV-D

LP L

uc

PKR+/+

Luci

fera

se a

ctiv

ity (

arbi

trary

uni

ts)

SV-DLP LucSV-Luc

C

A EGFP-SV CSV

-EG

FPSV

-DL

P E

GFP

B

0

20

40

60

80

100

SV C

+ an

d EG

FP+

SV-E

GFP

SV-D

LP EG

FP

-SV C EGFP

SV-E

GFP

SV-D

LP

EG

FP

SV C

+ an

d EG

FP+

SV-E

GFP

SV-D

LP EG

FP0

10

20

30

40

50

FIG.3

20 µm

merge

600 µm

merge