Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid...
-
date post
21-Dec-2015 -
Category
Documents
-
view
224 -
download
5
Transcript of Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid...
![Page 1: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis.](https://reader036.fdocuments.in/reader036/viewer/2022062320/56649d615503460f94a43025/html5/thumbnails/1.jpg)
Information Aspects of Nucleic Acids Measurement Technologies
• Description of nucleic acid measurement technologies
• Algorithmic, optimization, data analysis problems introduced by these new technologies
![Page 2: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis.](https://reader036.fdocuments.in/reader036/viewer/2022062320/56649d615503460f94a43025/html5/thumbnails/2.jpg)
General Topics
• Optimization of the information measured in an assay or a set of assays.(Expression probe design)
• Optimization of information to resource ratio in molecular level assays.(Multiplexed genotyping assays)
• Biologically driven data analysis(Analysis of gene expression data)
• Algorithms for raw data interpretation(SBH, RE mapping)
![Page 3: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis.](https://reader036.fdocuments.in/reader036/viewer/2022062320/56649d615503460f94a43025/html5/thumbnails/3.jpg)
Nucleic Acid Measurement Technologies (examples)
• Array based hybridization assays (DNA chips)
• MassSpectrometry based techniques
• Restriction enzyme fragmentation and length separation
• Large scale sequencing
![Page 4: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis.](https://reader036.fdocuments.in/reader036/viewer/2022062320/56649d615503460f94a43025/html5/thumbnails/4.jpg)
A Few Basic Concepts of Molecular Biology
• DNA
• Proteins
• The central dogma of cellular biology
• DNA as a sequence of bases
• Watson-Crick –ery
![Page 5: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis.](https://reader036.fdocuments.in/reader036/viewer/2022062320/56649d615503460f94a43025/html5/thumbnails/5.jpg)
Central Dogma
Transcription
mRNA
Cells express different subset of the genesIn different tissues and under different conditions
Gene (DNA)
Translation
Protein
![Page 6: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis.](https://reader036.fdocuments.in/reader036/viewer/2022062320/56649d615503460f94a43025/html5/thumbnails/6.jpg)
DNA
• Carries the code for cellular functioning
• Variation in the code is the source for variation in properties
• Disease and disease susceptibility can be caused by changes in the DNA.
• DNA is the same for all cells of an individual.
![Page 7: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis.](https://reader036.fdocuments.in/reader036/viewer/2022062320/56649d615503460f94a43025/html5/thumbnails/7.jpg)
mRNA and Proteins
• Execute the code• Relative levels are different in
different cells, depending on function and condition
• Are indicative of the state of the cell
![Page 8: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis.](https://reader036.fdocuments.in/reader036/viewer/2022062320/56649d615503460f94a43025/html5/thumbnails/8.jpg)
Watson-Crick Complimentarity
A binds to TC binds to G
AATGCTTAGTCTTACGAATCAG
Perfect match
AATGCGTAGTCTTACGAATCAG
One base mismatch
![Page 9: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis.](https://reader036.fdocuments.in/reader036/viewer/2022062320/56649d615503460f94a43025/html5/thumbnails/9.jpg)
FISH
• Fluorescence In-Situ Hybridiztion
• Fluorecsently labeled probes hybridize to specific chromosomal locations.
• Example application: low resolution localization of an EST.
![Page 10: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis.](https://reader036.fdocuments.in/reader036/viewer/2022062320/56649d615503460f94a43025/html5/thumbnails/10.jpg)
Array Based Hybridization Assays (DNA Chips)
Unknown sequence (target)Many copies.
Array of probes
![Page 11: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis.](https://reader036.fdocuments.in/reader036/viewer/2022062320/56649d615503460f94a43025/html5/thumbnails/11.jpg)
• Target hybs to WC complimentary probes only• Therefore – the fluorescence pattern is indicative of the
target sequence.
Array Based Hyb Assays
![Page 12: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis.](https://reader036.fdocuments.in/reader036/viewer/2022062320/56649d615503460f94a43025/html5/thumbnails/12.jpg)
Thermal Ink Jet Arrays, by Agilent Technologies
cDNA array,Inkjet deposition
In-Situ synthesized oligonucleotide array. 25-60 mers.
![Page 13: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis.](https://reader036.fdocuments.in/reader036/viewer/2022062320/56649d615503460f94a43025/html5/thumbnails/13.jpg)
Expression Profiling
• Given a set of genes of interest, measure the quantities of the corresponding mRNA, in cells in various conditions.
• Assumptions: • base sequences are known• Fluorescence levels are linear with
expression levels• Example computational problem: design
specific and sensitive probes.
![Page 14: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis.](https://reader036.fdocuments.in/reader036/viewer/2022062320/56649d615503460f94a43025/html5/thumbnails/14.jpg)
Specific Probes
…
Input:Querry sequence (m:500-2000).Background message (total length of 50Mb).Probe length (20-70).
Output:For each probe candidate, its distance to the background message.
m
![Page 15: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis.](https://reader036.fdocuments.in/reader036/viewer/2022062320/56649d615503460f94a43025/html5/thumbnails/15.jpg)
In future lectures and mini-projects
we will discuss/study information problems related to designing hybridization based assays and to the interpretation and data analysis of the results.
![Page 16: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis.](https://reader036.fdocuments.in/reader036/viewer/2022062320/56649d615503460f94a43025/html5/thumbnails/16.jpg)
SBH