Induction and characterization of endotoxin tolerance in equine peripheral

blood mononuclear cells in vitro

Linda Frellstedt

Thesis submitted to the faculty of the Virginia Polytechnic Institute and State

University in partial fulfillment of the requirements for the degree of

Master of Science

In

Biomedical and Veterinary Sciences

Martin O. Furr, Committee Chair

Harold C. McKenzie III

Jennifer G. Barrett

June 23, 2010

Leesburg, VA

Keywords:

Endotoxin, endotoxin tolerance, equine, interleukin-10, interleukin-12

Copyright 2010, Linda Frellstedt

Induction and characterization of endotoxin tolerance in equine peripheral blood

mononuclear cells in vitro

Linda Frellstedt

ABSTRACT

Endotoxemia is responsible for severe illness in horses. Individuals can become

unresponsive to the endotoxin molecule after an initial exposure; this phenomenon has been

called developing a state of ‘endotoxin tolerance’ (ET). ET has been induced in horses in vivo;

however, cytokine expression associated with ET has not been investigated. The purpose of this

study was to develop and validate a method for inducing ET in equine peripheral blood

mononuclear cells (PBMCs) in vitro, and to describe the cytokine profile which is associated

with the ET.

Blood was collected from 6 healthy horses and PBMCs were isolated. ET was induced by

culturing cells with three concentrations of endotoxin given to induce ET, and evaluated after a

second dose of endotoxin given to challenge the cells. The relative mRNA expression of IL-10

and IL-12 was measured by use of quantitative PCR.

ET was induced in all cells (n=6) exposed to the 2-step endotoxin challenge. In PBMCs

treated with 1.0 ng/ml of endotoxin followed by challenge with 10 ng/ml of endotoxin, the

relative mRNA expression of IL-10 in tolerized cells was not different from positive control

cells. In contrast, the relative mRNA expression of IL-12 in tolerized cells was decreased by 15-

fold after the second endotoxin challenge compared with positive control cells.

This experiment demonstrated a reliable method for the ex vivo induction of ET in equine

PBMCs. A marked suppression of IL-12 production is associated with ET. The production of IL-

10 was not altered in ET in our model.

iii

DEDICATION

To my parents, Iris and Albert Frellstedt,

and Nancy Beth Anderson.

iv

ACKNOWLEDGEMENTS

I would like to thank the following individuals for their collaboration in this research:

Drs. Martin Furr, Harold McKenzie and Jennifer Barrett for being members of my committee,

and for their mentorship, guidance, and support throughout the study, all of which were very

much appreciated. Dr. Stephen Werre for processing of the statistical data and his advice

concerning data analysis. Elaine Meilahn, Timothy Parmly and Dr. Shea Porr for their help

collecting and processing samples for the study. Zijuan Ma for her help processing samples and

performing laboratory procedures, which was invaluable support and greatly appreciated.

I especially want to thank my parents, Iris and Albert Frellstedt, who have supported me

throughout my life, without their unconditional love, support and confidence in my abilities this

would have never been possible.

Lastly, I want to thank Nancy Beth Anderson for her support during the early stages of this

project. Unfortunately, Hannah is no longer with us here on earth. She taught me to be patient

and kind and to believe in myself. I will always remember you.

v

TABLE OF CONTENTS

DEDICATION ..................................................................................................................................................... III

ACKNOWLEDGEMENTS ................................................................................................................................. IV

TABLE OF CONTENTS ..................................................................................................................................... V

LIST OF FIGURES AND TABLES .................................................................................................................... VI

CHAPTER 1. ENDOTOXEMIA IN HORSES .................................................................................................... 1

ENDOTOXIN ............................................................................................................................................................... 1

ENDOTOXEMIA IN HORSES.......................................................................................................................................... 3

CLINICAL EFFECTS IN HORSES .................................................................................................................................... 5

MECHANISMS OF ENDOTOXIN RECOGNITION AND ACTIVATION .................................................................................. 8

Plasma Proteins .................................................................................................................................................... 8

Membrane-associated molecules ........................................................................................................................ 14

Intracellular Activation Pathways ...................................................................................................................... 16

LPS-INDUCED CELLULAR PRODUCTION OF INFLAMMATORY MEDIATORS ............................................................... 18

Inflammatory mediators ...................................................................................................................................... 19

TREATMENT OF ENDOTOXIC SHOCK IN HORSES ........................................................................................................ 27

ENDOTOXIN TOLERANCE (ET) ................................................................................................................................. 32

Duration of ET .................................................................................................................................................... 32

In vivo ET ............................................................................................................................................................ 34

In vitro ET ........................................................................................................................................................... 35

Mechanisms for induction and maintenance of ET ............................................................................................. 36

CONCLUSION ............................................................................................................................................................ 42

CHAPTER 2. INDUCTION OF ENDOTOXIN TOLERANCE IN VITRO IN EQUINE PBMCS................... 43

MATERIALS AND METHODS ..................................................................................................................................... 45

STATISTICAL ANALYSIS............................................................................................................................................ 49

RESULTS .................................................................................................................................................................. 49

CONCLUSION ............................................................................................................................................................ 51

CHAPTER 3. CHARACTERIZATION OF ENDOTOXIN TOLERANCE IN VITRO IN PBMCS ................ 52

MATERIALS AND METHODS ..................................................................................................................................... 52

STATISTICAL ANALYSIS............................................................................................................................................ 56

RESULTS .................................................................................................................................................................. 57

CHAPTER 4. DISCUSSION .............................................................................................................................. 64

CONCLUSION ............................................................................................................................................................ 67

REFERENCES ................................................................................................................................................... 69

APPENDIX A ..................................................................................................................................................... 85

SEQUENCE INFORMATION FOR PRIMERS AND MGB PROBES FOR REAL TIME PCR ANALYSIS.................................... 85

vi

LIST OF FIGURES AND TABLES

FIGURE 1. BIOCHEMICAL CASCADE INITIATED BY LPS AND OTHER PRO-INFLAMMATORY AGENTS

LEADING TO THE PRODUCTION OF PRO-INFLAMMATORY CYTOKINES. ...................................... 2

FIGURE 2. SCHEMATIC REPRESENTATION OF THE PROGRESSION OF THE INFLAMMATORY PROCESS

AND ASSOCIATED PATHOPHYSIOLOGIC CHANGES IN A HORSE EXPOSED TO GRAM NEGATIVE

BACTERIAL INFECTIONS. .......................................................................................................... 5

FIGURE 3. ACTIVATION OF SIGNAL TRANSDUCTION PATHWAYS AFTER BINDING OF LPS-LBP

COMPLEX TO MEMBRANOUS CD14. ....................................................................................... 18

FIGURE 4. BLOCKAGE/INACTIVATION OF NUMEROUS SIGNAL TRANSDUCTION PATHWAYS RESULT IN

IMPAIRED TRANSLOCATION OF NF-КB AND AP-1 AND DEVELOPMENT OF ENDOTOXIN

TOLERANCE (ET). .................................................................................................................. 39

FIGURE 5. EXPERIMENTAL DESIGN OF PHASE I. . ............................................................................ 48

FIGURE 6. TNF-Α CONCENTRATION FOR POSITIVE CONTROL CELLS AND TOLERIZED CELLS AT

DIFFERENT DOSES OF ENDOTOXIN EXPOSURE. ........................................................................ 50

FIGURE 7. EXPERIMENTAL DESIGN OF PHASE II. . ........................................................................... 54

FIGURE 8. TNF-Α CONCENTRATION FOR NEGATIVE CONTROL CELLS, POSITIVE CONTROL CELLS AND

TOLERIZED CELLS. ................................................................................................................. 57

FIGURE 9. MEAN RELATIVE EXPRESSION OF IL-10 OF EQUINE PBMCS AFTER ENDOTOXIN

EXPOSURE DETERMINED FOR A 24 HOUR PERIOD. ................................................................... 59

FIGURE 10. MEAN RELATIVE EXPRESSION OF IL-12 OF EQUINE PBMCS AFTER ENDOTOXIN

EXPOSURE DETERMINED FOR A 24 HOUR PERIOD. ................................................................... 60

FIGURE 11. CORRELATION BETWEEN TNF-Α CONCENTRATIONS AND MRNA EXPRESSION OF IL-10

IN ALL THREE GROUPS OF CELLS. ............................................................................................ 62

FIGURE 12. CORRELATION BETWEEN TNF-Α CONCENTRATIONS AND MRNA EXPRESSION OF IL-12

IN ALL THREE GROUPS OF CELLS. ............................................................................................ 63

TABLE 1. RELATIVE GENE EXPRESSION 95% CONFIDENCE INTERVAL FOR IL-10 IN EQUINE PBMCS

OVER A 24 HOUR PERIOD. ........................................................................................................ 59

TABLE 2. RELATIVE GENE EXPRESSION 95% CONFIDENCE INTERVAL FOR IL-12 IN EQUINE PBMCS

OVER A 24 HOUR PERIOD. ........................................................................................................ 60

vii

LIST OF ABBREVIATIONS

AP-1 activator protein-1

APCs antigen-presenting cells

BPI bactericidal/permeability increasing protein

bwt bodyweight

CD14 cluster of differentiation no. 14

cDNA complementary deoxyribonucleic acid

DCs dendritic cells

ELISA enzyme-linked immunosorbent assay

ET endotoxin tolerance

HDL high-density lipoprotein

IL interleukin

IRAK1 interleukin-1 receptor-associated kinase 1

IRAK4 interleukin-1 receptor-associated kinase 4

kDa kilodaltons

kg kilograms

LBP lipopolysaccharide binding protein

LPS lipopolysaccharides

MAPK mitogen-activating preotein kinase

mCD14 membrane-bound cluster of differentiation no. 14

MyD88 myeloid differentiation primary response protein 88

NK natural killer

PBMCs peripheral blood mononuclear cells

PCR polymerase chain reaction

PI3K phosphatidylinositol 3-kinases

viii

RNA ribonucleic acid

sCD14 soluble cluster of differentiation no. 14

TAK1 TGF-beta activated kinase 1

TFPI tissue factor pathway inhibitor

TGF-β transforming growth factor β

Th T helper

TIRAP Toll-interleukin 1 receptor domain containing adaptor protein

TLR Toll-like receptor

TNF-α tumor necrosis factor α

TRAF6 TNF receptor-associated factor 6

ix

[this page left blank intentionally]

1

Chapter 1. Endotoxemia in horses

Endotoxin

Endotoxins (lipopolysaccharides, LPS) are unique glycolipids that constitute a major

portion of the outer leaflet of the outer membrane that is unique to gram negative bacteria

(Schultz and Weiss 2007). Endotoxins consist of a highly conserved lipid A region, a core

polysaccharide region and a repeating tetra- or penta-saccharide that constitutes the O-antigen.

Endotoxins induce potent responses in a wide range of host species including humans by rapidly

inducing cellular biosynthesis and release of pro-inflammatory cytokines like tumor necrosis

factor alpha (TNF-α) and other bioactive metabolites and secondarily by rapidly activating

extracellular complement, clotting, and fibrinolytic pathways. Local responses to endotoxin in

tissue generally involve protective inflammatory host-defense cascades but more profound

responses at the systemic level can lead to a pathologic state ranging from fever to the fulminant

sepsis-syndrome with multiorgan failure and high mortality (Schultz and Weiss 2007).

The lipid A moiety is highly conserved among gram-negative bacteria, and is the

component of lipopolysaccharide which binds to LPS-binding protein (LBP) in the plasma,

initiating a cascade of events which results in endotoxic shock (see Figure 1). This is mediated

by a complex series of biochemical processes, initiated by cellular binding, transmembrane

signaling, activation of cytokine expression leading to systemic inflammation and circulatory

shock. Once LPS-LBP complexes are bound to Cluster of Differentiation antigen 14 (CD14) on

the surface of phagocytes, CD14 interacts with Toll-like receptor 4 (TLR-4) resulting in

activation of nuclear factor кB (NF-кB) and mitogen-activated protein kinase (MAPK) signaling

pathways and subsequent production of pro-inflammatory (TNF-α, IL-1, IL-6, IL-8, IL-12) and

2

anti-inflammatory (IL-10, TGF-β) cytokines (Schutt 1999; Werners et al. 2005). TNF-α

represents the most important and most potent pro-inflammatory mediator involved in endotoxic

shock. The pathophysiologic events of gram-negative septic shock are mediated by the

endotoxin-induced systemic overproduction of TNF-α. TNF-α acts alone and by the induction of

IL-1 and numerous more distal mediators, leading to potentially lethal multiorgan tissue damage

(Robinson et al. 1993).

Figure 1. Biochemical cascade initiated by LPS and other pro-inflammatory agents leading to the

production of pro-inflammatory cytokines. The transcription activator nuclear factor (NF)-кB is

normally retained in the cytoplasm in an inactivated state, preventing the unregulated production

of inflammatory mediators. (Used with permission of H.C. McKenzie III, 2010)

3

Endotoxemia in horses

Endotoxemia is defined as the presence of endotoxin (LPS, lipopolysaccharide), which is

derived from gram negative bacteria, in the blood and may result in shock. In equine veterinary

practice, the term endotoxemia is often used to describe the severe systemic inflammatory

response associated with severe illness, regardless of the underlying etiology. Endotoxemia has

been associated with many equine diseases with high mortality. Endotoxemia in equine adults

most commonly results from gastrointestinal diseases (Lavoie et al. 1990) but also may arise

from other gram negative bacterial infections such as peritonitis, pleuritis or metritis (Moore and

Barton 2003). In equine neonates, endotoxemia commonly results from gram negative

septicemia (Lavoie et al. 1990). Approximately 30-40% of horses presented to referral hospitals

with clinical signs of colic and 40-50% of neonatal foals presented with septicemia have

endotoxin in their systemic circulation (Barton et al. 1998b; Steverink et al. 1995). Endotoxemia

in horses with gastrointestinal diseases is strongly correlated with outcome (Thoefner et al. 2001;

Tinker et al. 1997) and represents a common sequel that increases morbidity and mortality (Hunt

et al. 1986).

The abnormalities associated with the clinical syndrome of endotoxemia result from a

nonspecific innate inflammatory response (McKenzie and Furr 2001). This response has been

termed the systemic inflammatory response syndrome (SIRS) (McKenzie and Furr 2001). SIRS,

which represents a common terminal phase of the inflammatory response characterized by

malignant global activation of multiple pro-inflammatory pathways, is defined by the presence of

two or more of the following abnormalities: fever or hypothermia (rectal temperature greater

than 39.2°C or less than 37.2°C), tachycardia (heart rate greater than 60 beats per minute),

tachypnea (respiratory rate greater than 30 breaths per minute) or hypocapnia (partial pressure of

4

arterial carbon dioxide less than 32 mmHg), leukocytosis or leukopenia (leukocyte greater than

12,500 or less than 4,000 cells/ul), or increased numbers of immature forms of granulocytes

(greater than 10% band neutrophils) (McKenzie and Furr 2001). The changes associated with

SIRS can lead to shock, which is characterized by severe hypotension not responsive to

intravenous fluid therapy. Shock can result in hypoperfusion and organ dysfunction such that

homeostasis cannot be maintained without intervention, a process termed multiorgan dysfunction

syndrome (MODS). MODS is a progressive syndrome with initial dysfunction in the

cardiovascular system, followed by of other body systems, resulting in the development of

refractory hypotension, lactic acidosis, and oliguria, often progressing to death (McKenzie and

Furr 2001) (see Figure 2).

While SIRS in horses has traditionally been referred to as endotoxemia, it has become

apparent that patients with gram positive bacterial infections, viral infections, trauma,

hypovolemia, hemorrhage, and immunologic and drug reactions may exhibit a syndrome of

severe systemic inflammation that is clinically identical to that associated with endotoxemia.

This has made it clear that the severe inflammatory response observed in all of these conditions

is induced by production of pro-inflammatory substances including pro-inflammatory mediators

and cytokines (tumor necrosis factor-α (TNF-α), interleukin-1 (IL-1), interleukin-6 (IL-6))

(McKenzie and Furr 2001). The inflammatory process itself results solely from the production of

endogenous mediators in response to the underlying insult. In summary, endotoxemia is a serious

and devastating clinical condition in horses that leads to development of SIRS followed by

MODS and eventually death due to an overwhelming systemic inflammatory response.

5

Figure 2. Schematic representation of the progression of the inflammatory process and associated

pathophysiologic changes in a horse exposed to gram negative bacterial infections. (Used with

permission of H.C. McKenzie III, 2010)

Clinical effects in horses

Numerous studies have been published describing the clinical effects of endotoxin

infusion. In general, the signs are similar, but vary with endotoxin dose, duration and route of

administration. In horses, clinical signs of endotoxemia consist of tachycardia, abdominal pain,

diarrhea, hyperglycemia, thrombocytopenia, systemic hypotension and decreased systemic

vascular resistance (Lavoie et al. 1990). Endotoxin infusion (0.5 µg/kg bwt) in equine neonates

has been shown to lead to depression, anorexia, increased rectal temperature, and initial

6

leukopenia followed by leukocytosis, hypoglycemia, increased prothrombin time, increased

partial thromboplastin time (aPTT), hypertension, increased pulmonary and systemic vascular

resistance and mild hypoxemia (Lavoie et al. 1990). Marked variations in clinical signs were

observed but shock was not induced. In this study, foals appeared healthy once LPS infusion was

discontinued. Adult horses given endotoxin (0.1 µg/kg bwt) (E. coli O55:B5) exhibited

abdominal discomfort, depression, anorexia, pyrexia, tachycardia, tachypnea, altered mucus

membrane color, loss of borgorygmi and sweating (Semrad and Moore 1987). Clinical signs

varied significantly between individuals. Morris et al. infused horses with endotoxin (E. coli

O55:B5) at a dose of 30 ng/kg bwt in 1L of sterile 0.9% saline over 1 hour with the aim of

inducing sublethal endotoxemia (Morris et al. 1992). The horses developed lethargy, fever,

tachycardia and leukopenia which returned to baseline 6 to 8 hours after the endotoxin infusion.

Similar results were observed by Veenman et al., however the duration of effects were more

persistent and severe when endotoxin was given at a dose of 2 µg/kg bwt endotoxin (E. coli

O55:B5) in 60 ml 0.9% saline intravenously over a 2 hour period (Veenman et al. 2002). The

ponies exhibited fever for 1 to 5 days, inappetence for 24 hours, hyperlactatemia,

hemoconcentration, and transient leukopenia.

In a slightly different protocol, Burrows et al. administered endotoxin (E. coli O26:B6)

intravenously (150 µg/kg bwt) once (group 1), intraperitoneally (300 µg/kg bwt) once (group 2),

or intraperitoneally (100 µg/kg bwt) four times in 3 hour intervals (group 3) (Burrows 1979).

The horses which received intravenous endotoxin exhibited tachycardia, tachypnea, weakness,

ataxia and transient recumbency within minutes after the endotoxin administration. Depression

and anorexia were apparent for 3 to 4 days. Four horses received a single intraperitoneal dose of

endotoxin. The onset of clinical symptoms was slower in this group. Depression, sweating and

7

cold extremities were observed in all of these horses. Recumbency was noted in three of the four

horses that subsequently died. The fourth horse exhibited anorexia and depression for 3 to 4 days

before it recovered completely. In the third group, repeated intraperitoneal administration of

endotoxin resulted in delayed anorexia and depression of prolonged duration (several days to

weeks). Only one horse became recumbent for a short time. Common observations in all three

groups included the development of transient fever, hemoconcentration, neutropenia,

hyperglycemia, and hyperlactatemia. Mortality varied significantly between the 3 groups (group

1 - 30% mortality, group 2 - 75% mortality, group 3 - 20% mortality) as well as the severity of

clinical symptoms (Burrows 1979).

Ward et al. demonstrated endotoxemia in horses after intravenous (2, 4, 6 and 6 µg/kg

bwt) or intraperitoneal (10, 20, 30 and 30 µg/kg bwt) administration of increasing sublethal LPS

doses (E. coli O55:B5) in 6 hour intervals (Ward et al. 1987). Clinical symptoms included

abdominal discomfort, depression, sweating, recumbency, altered mucus membrane color,

increased capillary refill time, diarrhea, and absent borgorygmi. Barton et al. showed that the

intravenous infusion of 20 ng/kg bwt of endotoxin (E. coli O55:B5) in 500 ml of 0. 9% sterile

saline over a 30-minute period resulted in fever, tachycardia, tachypnea and leukopenia (Barton

et al. 1998a). All of these studies document that a wide range of low doses of endotoxin (20

ng/kg bwt to 400 µg/kg bwt) induces clinical symptoms in horses. However, depending on the

dose and route of administration of LPS, the magnitude and character of the clinical symptoms

vary markedly.

These observations are in contrast to studies performed in mice, rats and rabbits. In

horses 300 µg of LPS/kg bwt given intraperitoneally is lethal (Burrows 1979), whereas in mice

and rats 20 to 25 mg of LPS/kg bwt given intraperitoneally is 100% lethal (Haziot et al. 1996;

8

Sanchez-Cantu et al. 1989). A number of studies are listed here to further explain observations in

other species. Mice exposed to 10 mg/kg bwt of LPS (E. coli o55:B5) intraperitoneally showed

lethargy, inappetence and tachypnea (Zhang et al. 2009). Another study showed that

intraperitoneal injection of 1 mg of LPS in wild type mice resulted in development of shock and

only 20% survival within 1 to 5 days after LPS injection (Takeuchi et al. 1999). The intravenous

administration of 100 µg of LPS in mice resulted in 100% survival, whereas intravenous

administration of 200 µg of LPS resulted in only 25% survival within 72 hours after LPS

exposure (Berg et al. 1995). Gerard et al. showed that intravenous administration of 500 µg of

LPS resulted in 50% lethality within 72 hours (Gerard et al. 1993), contrasting Marchant et al.

who reported this dose being sublethal and having a 100% survival rate (Marchant et al. 1994).

Rats were injected intraperitoneally with different doses of LPS and were followed for 72 hours

after the LPS challenge (Sanchez-Cantu et al. 1989). Naïve rats showed a median lethal dose of

20 to 25 mg/kg of LPS in this study. Rabbits administered 3 doses of LPS (5 µg/kg bwt) (E. coli

O55:B5) within a 24-hour period developed severe organ injury and/or death within 24 hours of

the last LPS administration (Schimke et al. 1998). The lethality within this group was 33% and

all three LPS injections were required to produce lethal endotoxemia. From these results it is

clear that horses are much more sensitive to the effects of LPS in comparison to mice, rats or

rabbits.

Mechanisms of endotoxin recognition and activation

Plasma Proteins

Plasma proteins play an important role in mediating responses of cells to bacterial LPS.

A number of plasma proteins can bind to LPS and either facilitate or neutralize the effects of

LPS on cells. These include:

9

Lipopolysaccharide-binding protein (LBP). LPS-binding protein (LBP) is an LPS

transfer protein that facilitates binding of LPS not only to CD14 but also to lipoproteins (Wurfel

et al. 1994). LBP is a 58 kDa glycoprotein synthesized in the liver as an acute-phase protein and

constitutively secreted into the blood stream (Kirschning et al. 1997a). During an acute-

inflammatory reaction, serum protein concentrations of LBP rise 5- to 100-fold, depending upon

species (Kirschning et al. 1997a). LBP binds with high affinity to the lipid A moiety of LPS,

thereby forming LPS-LBP complexes which interact with membrane bound CD14 and stimulate

macrophages and other CD14-positive cells. LBP can also act as an opsonin to enhance binding

of macrophages to LPS or LPS-coated particles and gram negative bacteria (Kirschning et al.

1997a; Schumann et al. 1990). This binding occurs via a cellular receptor, CD14, which is

mobile in the plane of the cell membrane and consecutively triggers an inflammatory response.

This function is crucial for controlling infections, and induces monocytic TNF-α production

(Jack et al. 1997; Schumann et al. 1990). LBP enhances the ability of the host to detect LPS

early in infection. In vivo, LBP is not required for the clearance of LPS but is essential for the

rapid induction of an inflammatory response (TNF-α production) by LPS and gram negative

bacteria (Jack et al. 1997). In addition, LBP restores the ability of LPS-tolerant macrophages to

respond to secondary LPS challenge (Mathison et al. 1993). Likely mechanisms for the reduced

responsiveness of these macrophages to LPS include defective recognition of LPS or deficiency

in LPS-specific signal transduction pathways. This phenomenon was only exhibited when the

cells where tolerized in the absence of LBP (Mathison et al. 1993) which is an unlikely scenario

in vivo.

LBP in plasma is associated with lipoproteins, suggesting an important role for LBP in

the neutralization of LPS by plasma (Wurfel et al. 1994). High-density lipoprotein (HDL)

10

particles alone, reconstituted from highly purified components, were unable to bind or neutralize

LPS. Addition of LBP to HDL enabled rapid, potent, dose-dependent binding and neutralization

of LPS by HDL. LBP enables neutralization of LPS by facilitating its diffusion from LPS

vesicles and micelles into HDL (Wurfel et al. 1994). A dominant role for LBP in the

neutralization of LPS might be inferred from the observation that LBP is an acute phase reactant,

rising from <5 µg/ml to >60 µg/ml after LPS challenge (Calvano et al. 1994).

One study in horses determined that LBP concentrations in horses with abdominal pain

were higher than in normal horses but LBP concentration did not correlate with outcome or

specific disease process (Vandenplas et al. 2005). In this study LBP concentration also did not

correlate with the presence of systemic endotoxin. Controversial observations regarding the

function of LBP in sepsis have been published (Villar et al. 2009; Zweigner et al. 2001). In low

concentrations LBP is believed to enhance the recognition of LPS, thereby activating the innate

immune system (Zweigner et al. 2001) and having a protective role in severe sepsis. In contrast,

high concentrations of LBP in severe sepsis lead to excessive inflammation (Villar et al. 2009).

LBP is an indicator of severity of lung injury and mortality in humans with severe sepsis (Villar

et al. 2009). Forty eight hours after the onset of severe sepsis increased LBP concentrations were

identified and associated with worse outcome and the highest probability of developing sepsis-

induced acute respiratory distress syndrome (ARDS) (Villar et al. 2009). Zweigner et al.

reported contrary findings; high LBP concentrations had an inhibitory role in the LPS-induced

inflammatory response (Zweigner et al. 2001).

This data leads to the conclusion that moderate concentrations of LBP have a protective

role in endotoxemia resulting in activation of the innate immune system. Once extremely high

concentrations of LBP are observed, these lead to the induction of excessive inflammation

11

resulting in SIRS and poor outcome. These effects also depend on the availability of downstream

receptors and mediators, therefore an accurate outcome cannot be predicted for each individual.

From research conducted in horses, we know that LBP concentrations are increased in

endotoxemia but no correlation with outcome was proven. Further research is needed in this field

to characterize the role of LBP at different concentrations in horses.

Septin. Septin is a plasma protein complex that binds LPS and mediates its recognition

by CD14 receptors. Septin has been identified in human plasma and resembles LBP in several

aspects (Wright 1994). In contrast to LBP, it is comprised of multiple protein species which must

be simultaneously present to enable its activity. At least two protein species have to be combined

to ‘activate’ septin and to cause LPS effects. LPS is then bound by phagocytes and induces

dramatic alterations in the function of leukocyte integrins on polymorph nucleated cells and

secretion of TNF-α by monocytes. Septin activity is blocked by addition of protease inhibitors

since proteolytic activities are required for opsonization by septin, whereas the function of LBP

is not affected (Wright et al. 1992). Septin appears to be important for cellular responses to low

concentrations of endotoxin that occur in blood during sepsis (LPS < 0.1 ng/ml) (Wright et al.

1992). There are no studies that have evaluated the role of septin in horses.

Bactericidal/permeability-increasing protein (BPI). Another soluble protein that binds

endotoxin is BPI. BPI belongs to a conserved family of lipid-transfer proteins that includes as its

closest relative, the LPS-binding protein (LBP). The primary structures of human LBP and BPI

are approximately 45% identical (Kirschning et al. 1997b; Schumann et al. 1990). BPI has been

studied mostly in humans and rabbits; no studies have examined the role of BPI in horses. BPI is

mainly expressed in bone marrow in myeloid precursors of neutrophils and stored in primary

granules. It can also be detected on the surface of neutrophils and monocytes, presumably

12

originating from degranulation of neighboring activated neutrophils. BPI is a single-chain

cytotoxic cationic protein with a molecular weight of ca. 55 kDa. BPI binds endotoxin close to

the lipid A region. The N-terminal domain of BPI is responsible for the endotoxin-neutralizing

properties, whereas the C-terminal domain of BPI is needed for BPI-dependent delivery of intact

gram negative bacteria and cell-free endotoxin-rich particles to specific host cells (Schultz and

Weiss 2007). The binding of BPI to LPS results in the inability of LPS to interact with CD14

receptors. Thus, BPI is a potent LPS neutralizing protein that may limit innate immune responses

during gram negative infections (Wittmann et al. 2008). BPI has proven to be protective against

lethal and sub-lethal challenges with gram negative bacteria and endotoxin (Wittmann et al.

2008). Presentation of endotoxin most likely occurs with endotoxin still being an integral

component of the outer membrane of gram negative bacteria. The presence of other innate

immune-stimulating and antigenic components within the outer membrane makes them primary

targets for clearance and resolution of gram negative bacteria/endotoxin-driven inflammation but

also potentially important vehicles for delivery of antigenic material to APCs (Schultz and Weiss

2007). BPI is found in plasma in much lower concentrations than LBP. LBP and BPI compete

for LPS binding and this competition determines the response of the organism to LPS.

High-density lipoproteins (HDL). Plasma lipoproteins, particularly high-density

lipoproteins (HDL), bind and neutralize LPS (Munford et al. 1981; Rudbach and Johnson 1964;

Ulevitch et al. 1979); by acting synergistically with LBP (Wurfel et al. 1994). HDL particles

alone, reconstituted from highly purified components, were unable to bind or neutralize purified

LPS. Addition of LBP to HDL, however enabled rapid, potent, dose-dependent binding and

neutralization of LPS by HDL (Wurfel et al. 1994). LBP enables neutralization of LPS by

facilitating its diffusion from LPS vesicles and micelles into HDL (Wurfel et al. 1994).

13

Disaggregation of LPS precedes the binding of LPS to HDL and results in lipoprotein-bound

LPS which is less toxic. In vivo studies have revealed that rats naturally have high

concentrations of HDL and are therefore more resistant to LPS than other species (Munford et al.

1981).

Soluble CD14 receptor (sCD14). CD14 is present in a soluble form (sCD14) in blood or

as a glycosylphosphatidylinositol (GPI)-linked form (mCD14) on the cell surface of monocytes,

macrophages and neutrophils (Werners et al. 2005). Binding of LPS to soluble CD14 (sCD14)

prevents LPS binding to membrane-bound CD14 (mCD14) thereby inhibiting cellular activation.

However, sCD14-LPS complexes can activate cells which do not themselves express mCD14,

however extremely high concentrations of LPS (ten times the lethal dose) are required to activate

endothelial cells via sCD14-LPS complexes (Haziot et al. 1996). This is unlikely to have

biological significance in vivo. In addition sCD14 may act as a shuttle molecule like LBP to

transfer LPS to HDL, thus neutralizing its toxic effects (Schutt 1999). It appears that sCD14

most importantly is involved in neutralization of LPS in vivo.

Plasma protease inhibitor. Tissue factor pathway inhibitor (TFPI) is a Kunitz type

plasma protease inhibitor that inhibits factor Xa and the factor VIIa/tissue factor catalytic

complex, and thereby results in feedback inhibition of the coagulation cascade. Kunitz type

plasma protease inhibitors are proteins that function as protease inhibitors and are specific for

either trypsin or chymotrypsin. Proteins from the Kunitz family contain from 170 to 200 amino

acid residues and one or two intra-chain disulfide bonds. TFPI exists in three different pools (1)

associated with lipoproteins, (2) stored in platelets, and (3) associated with endothelium such that

it can be released into circulation by heparin. TFPI binds to endotoxin in vitro and prevents the

interaction of endotoxin with LBP and CD14, thereby blocking the cellular responses (Park et al.

14

1997). But it is important to point out that once sCD14-LPS complexes were formed, TFPI could

not block the cellular responses, therefore it is only effective pre-LPS-exposure. Natural TFPI

concentrations may not be sufficient for the attenuation of the response to endotoxin but the

administration of TFPI may be considered as a treatment option (Park et al. 1997). Animals

treated with TFPI in experimental settings showed a significantly decreased IL-6 response

(Creasey et al. 1993). It has also been shown that TFPI concentrations are significantly increased

in septic patients leading to the attenuation of responses to endotoxin (Carson et al. 1991;

Sandset et al. 1989; Takahashi et al. 1995; Warr et al. 1989).

The listed plasma proteins have not been investigated in detail in the horse. Their

neutralizing effects of LPS seem to be efficacious when exposed to minor amounts of LPS but

inadequate when exposed to overwhelming gram negative bacterial infections leading to

systemic endotoxemia and endotoxic shock. LBP plays a major role in binding LPS, forming

LPS-LBP complexes and activating the downstream inflammatory cascade.

Membrane-associated molecules

Membrane-bound CD14 (mCD14). Cluster of differentiation antigen 14 (CD 14) is a 55

kDa glycoprotein that is attached to the cell membrane of monocytes, macrophages, and

neutrophils via a phosphatidylinositol (PI) glycan anchor. The PI glycan anchor is essential for

the presence of CD14 on the cell surface (Wright et al. 1990). CD14 is responsible for the

recognition of LBP and binding of LPS-LBP complexes (Wright et al. 1990). Once LPS-LBP

complexes are bound to CD14, LPS is integrated into the phospholipid layer of the cell

membrane. LPS and gram negative bacteria can be internalized by this LBP-dependent pathway.

CD14 is necessary for the blood monocytes to respond to low concentrations of LPS (0.01-1

15

ng/ml) in order to induce an innate immune response. At LPS concentrations of > 10 ng/ml in

vitro the synthesis of TNF-α is induced without the presence of LBP or CD14.

LPS, TNF-α, and IFN-ɣ upregulate CD14 expression on human myeloid cells in vitro

(Schutt 1999). Inhibition of the CD14 pathway represents an experimental method to prevent

septic shock (Leturcq et al. 1996) in primates and rabbits (Schimke et al. 1998). The

administration of CD14-antibodies was effective in preventing septic shock even when

administered after LPS exposure. In horses infused with endotoxin, the expression of CD14 on

PBMCs increases and a correlation between this enhanced expression and the clinical signs of

endotoxic shock was reported (Kiku et al. 2003). CD14 is involved in the clearance of gram

negative pathogens during infection and improves the sensitivity of the immune system to

infection (Haziot et al. 1994).

Toll-like receptors (TLRs). Toll-like receptor 4 (TLR4) is the principal LPS-signal-

transduction molecule (Hirschfeld et al. 2000). TLRs are essential pattern recognition receptors

in cells of the innate immune system. TLRs consist of an extracellular domain containing

multiple leucine-rich repeats (LRRs), a transmembrane domain and an intracellular

Toll/interleukin-1 receptor domain (TIR) (Rock et al. 1998). In mammalian species, there are at

least 11 cloned TLRs. Toll-like receptor 4 (TLR4) was first characterized in man and is

expressed predominantly in cells from the innate immune system (Fujihara et al. 2003). After

ligand binding, TLR4 dimerizes and undergoes conformational changes necessary for the

recruitment of downstream signaling molecules (Akira and Takeda 2004). LPS-associated

proteins (LAPs) are cell-surface proteins, such as heat shock protein 70 (Hsp70), Hsp90 and

chemokine receptor 4 (CXCR4), which are distinct from CD14 and TLRs and can bind LPS both

dependently and independently of mCD14 (Triantafilou et al. 2001). Downstream signal

16

transduction through TLRs is dependent on myeloid differentiation primary response gene 88

(MyD88), a cytoplasmic adapter protein. MyD88 is associated with the serine-threonine protein

kinase interleukin-1 receptor-associated kinase (IRAK). IRAK is then phosphorylated and

associated with the tumor necrosis factor-associated factor 6 (TRAF-6) adapter protein, which

then activates two pathways, one being the mitogen-activated protein kinase (MAPK) pathway

and the other being the nuclear factor-kappa B (NF-κB) pathway (Chaplin 2010; Medzhitov and

Janeway 2000) (see Figure 3).

Myeloid differentiation protein 2 (MD2). LPS signaling through TLR4 also depends on

the presence of MD2 on the cell surface (Gruber et al. 2004; Nagai et al. 2002). TLR4 and MD2

are processed through the trans- Golgi-apparatus secretory pathway and reside on the cell surface

as a mature protein complex (Latz et al. 2002; Werners et al. 2005). After binding of LPS to

LBP and CD14, LPS is recognized by MD2 which binds the lipid A part of LPS (Werners et al.

2005). MD2 then associates with the extracellular domain of TLR4 thereby activating

intracellular phosphorylation cascades including the MAPK and NF-кB activation pathways

leading to the production of pro-inflammatory cytokines (Werners et al. 2005). Both pathways

(MAPK and NF-кB) result in increased DNA transcription and production of various

inflammatory mediators, including cytokines such as TNF-α, IL-6, and IL-1 (Werners et al.

2005).

Intracellular Activation Pathways

Nuclear factor-kappa B (NF-κB) pathway. Nuclear factor-kappa B (NF-κB) is a nuclear

transcription factor that plays a significant role in the induction of pro-inflammatory mediators.

17

In its inactivated state, it is normally bound to inhibitor κB (I κB). As a result of this binding, it

remains localized to the cytosolic compartment. Activation of NF-κB is mediated by a serine

kinase known as inhibitor κB kinase (IKK). IKK itself is activated by the binding of

lipopolysaccharide (LPS) to the Toll-like receptor 4 (TLR4) or via the effects of TNF-α or IL-1.

Once activated, serine phosphorylation of I κB results in its destruction and the subsequent

nuclear translocation of NF-κB (Marik and Raghavan 2004) which initiates the transcription of a

number of genes that are involved in the inflammatory response (See Figure 3). NF-κB family is

composed of various members, p50 (NF-κB1), p52 (NF-κB2), p65 (RelA), RelB and c-Rel,

which can form homo- and heterodimers (Ryseck et al. 1992; Schmitz and Baeuerle 1991).

Numerous studies have shown that the transactivator form of NF-κB is the p65 subunit whereas

the p50/p50 homodimer has a minimal transactivation capacity (Fan and Cook 2004; Franzoso et

al. 1992). Upon LPS stimulation, p50/p65 heterodimer complex is predominant, which leads to

gene transactivation (Fan and Cook 2004) and transcription of cytokine mRNA.

Mitogen-activated protein kinase (MAPK, MAP3K) pathway. Five distinct groups of

MAPKs have been characterized, of which the extracellular regulated signaling kinase 1 and 2

(ERK), c-Jun amino-terminale kinases (JNK) and p38 are the most extensively studied (Werners

et al. 2005) (see Figure 3). The MAPKs are regulated by phosphorylation cascades upon LPS

stimulation and each different group of MAPKs has different effects. The p38 proteins regulate

environmental stresses and release of inflammatory cytokines (Werners et al. 2005). The

transcription factor activator protein 1 (AP-1) is activated by the MAPKs and translocates into

the nucleus where it upregulates gene expression and controls cellular processes including

differentiation, proliferation and apoptosis.

18

Figure 3. Activation of signal transduction pathways after binding of LPS-LBP complex to

membranous CD14. A number of protein kinases are involved in the signal transduction from the

toll-like receptor to the final translocation of NF-кB and AP-1 into the nucleus followed by

production of inflammatory mediators and cytokines. (TIRAP-Toll-interleukin 1 receptor domain

containing adaptor protein; IRAK1-Interleukin-1 receptor-associated kinase 1; IRAK4-

Interleukin-1 receptor-associated kinase 4; TRAF6-TNF receptor-associated factor 6; TAK1-

TGF-beta activated kinase 1; PI3K-phosphatidylinositol 3-kinases; AP-1-activator protein 1)

LPS-induced Cellular Production of Inflammatory Mediators

A wide variety of cytokines and inflammatory mediators are induced by cellular exposure

to endotoxin and cellular activation via the preceding mechanisms. Three of the most commonly

studied cytokines, TNF-α, IL-1 and IL-6, have common effects in the defense against pathogens.

19

They induce pyrexia and promote the antibacterial activity of leukocytes. IL-6 induces the

production of acute phase proteins in the liver. Their ultimate function is to aid removal of the

pathogens by the body’s phagocytic cells (Werners et al. 2005). However, overexpression may

result in deleterious effects resulting from the derangement of the normal function of the

cytokine network leading to septic shock, multiple organ failure and death.

Inflammatory mediators

TNF-α. TNF-α is the earliest mediator of the LPS response (MacKay et al. 1991). Its

production is induced within 15-30 minutes after LPS administration and usually peaks at 90-120

minutes after LPS exposure. TNF-α possesses cytotoxic activity and is a potent inducer of fever

and the production of several other pro-inflammatory cytokines.

TNF-α is synthesized as a 26 kDa type II transmembrane precursor that is displayed on

the plasma membrane. The TNF-α precursor is proteolytically cleaved to yield a biologically

active 17 kDa mature TNF-α that forms a trimer in solution. During the interaction of effector

and target cells, membrane-bound pro- TNF-α in the effector cells binds TNF-α receptors on the

target cells, and induces TNF-α responses via receptor aggregation (Kriegler et al. 1988). Pro-

TNF-α is a more potent activator of TNF-α receptor II than mature TNF-α (Grell et al. 1994).

TNF-α is produced by numerous immune cells (monocytes/macrophages, NK cells, Kupffer

cells, B cells, and T cells) in response to an assortment of activating stimuli. The most important

stimuli are LPS, T-cell receptor activation, crosslinking of surface immunoglobulin, viral

infections, parasites, and the presence of IL-1 and TNF-α.

20

The expression of TNF-α is tightly controlled, because systemic overproduction of TNF-

α activates inflammatory responses, and mediates hypotension, diffuse coagulation, and

widespread tissue damage (Wang et al. 2003). TNF-α is a pleiotropic pro-inflammatory cytokine

that exerts multiple biologic effects. TNF-α induces fever and anorexia via hypothalamic centers.

Cardiovascular effects include the increased permeability of vascular endothelial cells resulting

in capillary leakage syndrome, enhanced tissue factor expression and suppression of protein C

resulting in endotoxic shock which may lead to multiple organ failure and death. TNF-α

expression also has been found to induce insulin resistance, gastrointestinal ischemia, colitis,

hepatic necrosis and decreased albumin production.

TNF-α is the most important and most proximal mediator of the severe systemic

inflammatory response and the administration of TNF-α antibodies prevents the development of

septic shock (Barton et al. 1998a). High TNF-α and/or IL-6 concentrations have been associated

with an unfavorable outcome (Barton and Collatos 1999; MacKay et al. 1991; Steverink et al.

1995). IL-10 blocks the in vitro and in vivo production of TNF-α and decreases LPS toxicity as

well as LPS-induced mortality in humans and mice (Gerard et al. 1993). Upregulation of TNF-α,

IL-1 and IL-6 and their detrimental effects have been described in horses with endotoxemia

(MacKay and Socher 1992; Morris et al. 1992; Veenman et al. 2002). MacKay et al. evaluated

TNF-α as a marker of cytotoxicity after endotoxin infusion. One anesthetized adult horse was

given a possibly lethal dose of 100 µg of LPS/kg bwt (E. coli O111:B4) in order to quantify

TNF-α production in response to LPS. The horse was euthanized 2 hours after the LPS infusion.

TNF-α was first detected 30 minutes after the LPS infusion and was still increasing (4,910 U/ml)

at the time of euthanasia. They also exposed 3 foals to a high dose of 5 µg of LPS/kg bwt

intravenously 30 minutes after administration of flunixin meglumine (1.1 mg/kg bwt) which is

21

known to minimize the clinical effects of LPS without reducing the TNF-α response. TNF-α was

first detected 30 minutes after the LPS infusion, peaked within 2 hours at 2,668 ±797 U/ml), and

then decreased rapidly to baseline. These foals exhibited fever, tachycardia and tachypnea within

2 to 4 hours after the LPS infusion. Four adult horses received 30 ng of LPS/kg bwt/h

intravenously for 4 hours. This infusion resulted in mild clinical signs of transient fever and

leukopenia. TNF-α was detected within 1 hour of LPS infusion, peaked within 2 hours at 15-20

U/ml, and decreased to baseline rapidly.

Recently, several in vivo and in vitro studies have examined the expression of pro-

inflammatory cytokines in response to LPS in horses. Neuder et al. reported an increased

expression of TNF-α, IL-1, IL-6 and IL-8 in equine PBMCs after exposure to 10 ng/ml LPS in

vitro (Neuder et al. 2009). Sun et al. exposed equine monocytes to 100 pg/ml LPS in vitro and

reported an increased expression of TNF-α, IL-1, IL-8, IL-10 and COX-2 (Sun et al. 2010).

Nieto et al. described the pro-inflammatory cytokine profile in horses after infusion of 30 ng/kg

LPS (Nieto et al. 2009). The expression of IL-1α, IL-1β, IL-6, IL-8, and TNF-α were increased

after LPS administration and peaked at 60 minutes post-infusion except for IL-6 which peaked at

90 minutes post-LPS. This also confirms that IL-6 expression is induced by other cytokines that

are synthesized early after LPS exposure.

IL-1. IL-1 is a pro-inflammatory cytokine that is synthesized as precursor molecule

without a signal peptide. After removal of N-terminal amino acids by specific proteases, the

resulting peptides are called ‘mature’ forms. The 31 kDa precursor form of IL-1β is biologically

inactive and requires cleavage by a specific intracellular cysteine protease. The mature form of

IL-1β is a 17.5 kDa molecule. Other proteases can also process the IL-1β precursor

extracellularly into an active cytokine (Coeshott et al. 1999). Membrane-bound IL-1α is

22

biologically active and is found on the surface of monocytes and B lymphocytes. IL-1 initiates

the COX-2 pathway, type 2 phospholipase A and inducible NO synthase (iNOS) resulting in the

production of large amounts of PGE2, PAF and NO. IL-1 also promotes the infiltration of

inflammatory and immunocompetent cells into the extravascular space (Dinarello 2003).

IL-1-deficient mice are characterized by absence of acute phase response, anorexia,

pyrexia, and are incapable of IL-6 expression but still respond to LPS exposure (Zheng et al.

1995). Therefore we can conclude that IL-1 is a strong downstream mediator in endotoxemia but

LPS effects are not IL-1 dependent.

IL-6. Interleukin-6 is a 21-28 kDa glycoprotein cytokine produced by various cells

including fibroblasts, endothelial cells, T and B lymphocytes, mesangial cells, and keratinocytes;

however, the main sources of IL-6 are monocytes and macrophages (Robinson et al. 1993). IL-6

plays a key role in host defense, regulating antigen-specific immune responses, hematopoiesis,

cellular differentiation, and the acute phase reaction subsequent to inflammatory insult

(Robinson et al. 1993). The concentration of IL-6 in compartmentalized body fluids and in the

circulation is high in animals with infectious, traumatic, autoimmune, and neoplastic diseases

(Hirano 1992; Van Snick 1990). Gram negative bacterial endotoxin is a potent stimulus for IL-6

production, acting either directly (Fong et al. 1989) or indirectly through induction of other

cytokines, such as IL-1 and TNF-α (Fong et al. 1989; Shalaby et al. 1989).

Serum IL-6 concentration is high during endotoxemia, and measurement of IL-6

concentration has been evaluated as a prognostic indicator in clinical cases of bacterial sepsis and

endotoxemic shock (Hack et al. 1989; Morris et al. 1992). In endotoxemic shock, IL-6 is

significantly elevated at the onset and rapidly decreases as endotoxic shock progresses. The

23

expression of IL-6 is associated with the concentration of TNF-α and correlated with the clinical

outcome (Calandra et al. 1991; Yoshimoto et al. 1992). In horses, IL-6 concentrations have

predictive value for unfavorable outcome and the simultaneous presence of increased LPS and

TNF-α (Steverink et al. 1995). Increased concentrations of IL-6 have been associated with a poor

clinical condition and outcome in horses (Steverink et al. 1995).

The role of IL-6 in endotoxemia has not been fully defined. Potentially beneficial effects

of IL-6 production during endotoxemia have been described and include decreased production of

TNF-α and IL-6 by monocytes, and inducing production of the full range of acute-phase

proteins, including protease inhibitors that are postulated to limit tissue damage (Robinson et al.

1993). Other studies, however, have indicated that IL-6 may contribute to the pathogenic effects

of gram negative infections or intravenous administration of TNF-α and that administration of

IL-6 antagonists may be beneficial in endotoxemia (Leon et al. 1992; Starnes et al. 1990). LPS

infusion in neonatal foals led to an increased production of IL-6 (Robinson et al. 1993). A group

of colostrum fed foals developed higher concentrations faster than colostrum deprived foals;

therefore high IL-6 concentrations are thought to be immunostimulatory and may protect foals

from septicemia (Robinson et al. 1993). These findings lead to the conclusion that IL-6

concentrations of less than 50 ng/l have immunostimulatory effects but IL-6 concentrations of

equal or greater than 50 ng/l are associated with overwhelming inflammation and poor outcome.

IL-12. IL-12 is an important regulator of the inflammatory response to endotoxin and is

essential for clearance of intracellular toxins and infections. IL-12 is mainly produced by

antigen-presenting cells (APCs), including monocytes, macrophages and dendritic cells (DCs)

(Kalinski et al. 2003). IL-12 production is induced by pathogen-related products signaling via

CD14, TLR-2, TLR-9, CD11b/CD18, and by phagocytosis of bacteria (Kalinski et al. 2003).

24

Pathogen-related agents capable of inducing IL-12 production include bacterial LPS, whole

bacteria, nucleic acids, RNA, lipoteichoic acid, heat shock proteins and microparticulate

ingestion (Kalinski et al. 2003; Sutterwala et al. 1997). The second type of IL-12 inducing

stimulus is the interaction of APCs with T helper (Th) cells (Kalinski et al. 2003). Biologically

active IL-12 is composed of two subunits, p35 and p40 (Kalinski et al. 2003). IL-12 secretion by

macrophages can be up- or downregulated by other cytokines. IFN-ɣ and IL-1β enhance IL-12

production through co-stimulatory effects (Kalinski et al. 2003). IL-4, IL-10, IL-13,

glucocorticoids, PGE2, histamine, TGF-β, and IFN-α inhibit the production of IL-12 (Kalinski et

al. 2003; Sutterwala et al. 1997). IL-12 production is strongly enhanced in IL-10 deficient mice

(Kalinski et al. 2003).

IL-12 enhances cell-mediated (type-1) immunity, Th1-type responses to CD4+ T cells and

functions of B cells, APCs, vascular and stromal cells (Kalinski et al. 2003). IL-12 is the primary

and by far the best studied Th1 inducing factor (in mice and humans) (O'Garra and Arai 2000).

The lack of IL-12 results in an inability to develop Th1 responses and to fight intracellular

infections (Kalinski et al. 2003; Stobie et al. 2000). IL-12 enhances the production of IL-10 by B

cells (Skok et al. 1999) and T helper cells (Assenmacher et al. 1998) which represents a negative

feedback mechanism for prevention of IL-12 mediated damage during chronic inflammation. IL-

12 enhances cytolytic effector function via proliferation of NK and T cells (Kalinski et al. 2003).

IL-12 also prevents apoptosis of T cells, NK cells, APCs and DCs (Kalinski et al. 2003). IL-12

promotes B cell production of IL-10, initiating a B cell-dependent shift from Th1 to Th2

responses (Skok et al. 1999). IL-12 promotes nuclear localization of NF-κB and may prime

murine DCs for IL-12 production (Grohmann et al. 1998). IL-12 acts as a macrophage

25

chemoattractant (Kalinski et al. 2003). The expression of IL-12 has not been investigated in

horses and therefore not been associated with equine endotoxemia.

IL-10. IL-10 is an 18-21 kDa polypeptide produced by

activated T cells, B cells,

monocytes/macrophages, mast cells and keratinocytes in response to many pathogens (bacterial

wall components, parasites, fungi, viral components) (Ding et al. 2003). IL-12 can induce IL-10

mRNA expression and protein synthesis in NK cells. In severe infections and stress conditions,

cytokines, hormones and arachidonic acid derivates are released and upregulate IL-10 synthesis

in monocytes, macrophages and T cells (Ding et al. 2003; Marchant et al. 1994). Elevated IL-10

expression is associated with septicemia in humans (Marchant 1994).

IL-10 is a key regulator of immune responses (Ding et al. 2003). IL-10 inhibits monocyte

and macrophage synthesis of IL-1α, IL-1β, IL-6, IL-8, IL-12, TNF-α and reactive oxygen and

nitrogen intermediates (de Waal Malefyt et al. 1991). IL-10 is involved in antigen presentation to

Th1 cells, chemokine expression by monocytes and the bactericidal response of macrophages to

IFN-ɣ. IL-10 inhibits NK cell production of IFN-ɣ and T cell-dependent responses of B cells

(Ding et al. 2003). In sum, it suppresses multiple immune responses through actions on T cells,

B cells, and APCs and shifts the immune response from Th1 to Th2 (Ding et al. 2003). The shift

to a Th2 response counteracts the pro-inflammatory effects of the Th1 response and establishes a

well-balanced Th1 and Th2 response that is suited to the immune challenge which is especially

important for the development of endotoxin tolerance.

IL-10 has been shown to effectively modulate the cytokine syndrome caused by

endotoxin by inhibiting the production of pro-inflammatory cytokines (Ding et al. 2003). IL-10

has protective effects in experimental endotoxemia, and exogenous administration rescues mice

26

from LPS-induced toxic shock, which is correlated with reduced levels of serum TNF-α (Gerard

et al. 1993; Howard et al. 1993). IL-10 inhibits production of TNF-α, regulates hemodynamic

parameters, microvascular permeability and reduces mortality in experimental murine

endotoxemia (Hickey et al. 1998; Standiford et al. 1995). Mice treated with anti-IL-10 from birth

or IL-10 deficient mice are more susceptible to endotoxin induced shock then normal mice (Berg

et al. 1995). Limited data is available regarding the expression of IL-10 in equine PBMCs after

in vitro LPS exposure (Sun et al. 2010; Sykes et al. 2005).

TGF-β. Transforming growth factor-β (TGF-β) is synthesized as a 390-amino-acid

glycosylated pre-protein that contains a 29-amino-acid hydrophobic signal sequence which is

cleaved, resulting in pro-TGF-β1 (Derynck et al. 1985). After further cleavage and

homodimerization the biologically active 25 kDa dimeric polypeptide of TGF-β is derived. TGF-

β is a potent inducer of apoptosis but also exhibits anti-apoptotic and pro-survival actions. TGF-β

inhibits ceramide-induced apoptosis, induces liver atrophy and apoptotic cell death in the liver.

NF-κB promotes cell survival and anti-apoptotic effects on hepatocytes and lymphocytes. TGF-β

increases I κB (via CD40) which is correlated with NF-κB downregulation and apoptosis,

therefore TGF-β has a critical role in promoting cell survival. Limited data is available in the

literature concerning TGF-β expression in human and murine models of endotoxemia (de Waal

Malefyt et al. 1991; Karp et al. 1998; Randow et al. 1995). In the horse, the expression of TGF-

β has not been investigated in models of endotoxemia.

27

Treatment of endotoxic shock in horses

No therapeutic agents to date are efficacious in protecting patients from endotoxin-

mediated tissue damage and organ failure (Russell 2006). Supportive care including intravenous

fluid therapy, anti-inflammatory drugs, broad spectrum antimicrobials, polymyxin B,

hyperimmune plasma and DMSO are commonly employed (Sykes and Furr 2005; Werners et al.

2005).

Nonsteroidal anti-inflammatory drugs (NSAIDs). Nonsteroidal anti-inflammatory drugs

are commonly used in the treatment of endotoxemia, of which the most important is probably

flunixin meglumine. Low doses of flunixin (0.25 mg/kg bwt q8hr) inhibited eicosanoid

production and suppressed blood lactate elevation without masking all of the physical

manifestations of endotoxemia necessary for accurate clinical evaluation of the horse's status

(Semrad et al. 1987). Flunixin meglumine is effective if given pre-endotoxin exposure but has

little impact once responses are already initiated (Semrad and Moore 1987). Pretreatment with

1.1 mg/kg bwt of flunixin meglumine is more effective than low dose flunixin meglumine

treatment at ameliorating tachycardia, tachypnea and fever induced by LPS (Moore et al. 1981)

and has been shown to increase time till death in fatal models of endotoxemia in the horse (Ewert

et al. 1985; Templeton et al. 1987). Flunixin meglumine at 1.1 mg/kg bwt maintained

cardiovascular function and peripheral perfusion during experimental endotoxemia in ponies

(Ward et al. 1987).

Pentoxifylline. Pentoxifylline inhibits TNF-α, IL-6 and tissue factor activity in a dose-

dependent manner following in vitro exposure of equine whole blood to LPS (Barton and Moore

28

1994) with the most significant effects occurring when pentoxifylline was administered one hour

prior to LPS exposure. Reproduction of these effects in vivo in the horse have only shown

minimal positive effects on clinical signs (prevention of pyrexia and tachypnea) but no effect on

TNF-α or IL-6 expression (Barton et al. 1997). In this study, pentoxifylline was administered

intravenously immediately after endotoxin infusion. Therefore, we can conclude that

pentoxifylline has only limited beneficial effects when administered after the endotoxin

exposure.

Glucocorticoids. Glucocorticoids (GCs) are physiological inhibitors of inflammatory

reactions and are used in the treatment of many inflammatory disorders. Glucocorticoids bind to

the cytosolic glucocorticoid receptor (GP). Once this receptor is activated it translocates into the

nucleus where it interacts with specific transcription factors (AP-1 and NF-кB) and prevents the

transcription of pro-inflammatory genes. GCs inhibit the production of inflammatory cytokines,

including TNF-α and IL-10, by LPS activated monocytes/macrophages and protect animals from

LPS-induced lethality (Beutler et al. 1986; Fantuzzi et al. 1994; Gonzalez et al. 1993; Marchant

et al. 1996). Endogenous GCs are produced during the course of inflammatory responses,

including endotoxic shock (Marchant et al. 1996). Inhibition of the biosynthesis or effects of

endogenously produced GCs in mice increases LPS-induced TNF-α production and lethality

(Fantuzzi et al. 1995; Gonzalez et al. 1993; Marchant et al. 1996). Marchant et al. showed that

methylprednisolone inhibited TNF-α production in a murine model of endotoxemia (Marchant et

al. 1996). Low dose methylprednisolone (2 and 20 mg/kg) had no effect on IL-10 expression but

high doses of methylprednisolone (50 mg/kg) significantly increased serum levels of IL-10 in

this model (Marchant et al. 1996). Weichhart et al. stated that the route of corticosteroid

administration is important in determining its efficacy in treatment of endotoxic shock

29

(Weichhart et al.). Intraperitoneal administration of dexamethasone failed to prevent endotoxin-

induced death (Weichhart et al.), whereas subcutaneous administration of dexamethasone

completely inhibited LPS-induced lethality in mice (Weichhart et al.). Intravenous

administration of methylprednisolone is used in equine neonates to treat SIRS, however use of

corticosteroids in adults is usually discouraged due to the risk of laminitis.

Polymyxin B. Polymyxin B is a basic cationic cyclic polypeptide antimicrobial with a

broad range of activity against gram negative bacteria that also neutralizes LPS (Morresey and

Mackay 2006). Polymyxin B functions as a chelating agent, binding the lipid A subunit of LPS

in a ratio of 1:1, thereby neutralizing it (Morresey and Mackay 2006). Interaction of LPS with

humoral and cellular receptors is prevented, and initiation of a pro-inflammatory cascade is

avoided. Polymyxin B has dose-dependent effects. At high doses (equal to or greater than 15,000

units/kg bwt) the drug is a bactericidal antimicrobial with predominantly gram negative spectrum

of activity. At these high doses polymyxin B has neurotoxic and nephrotoxic side effects in

horses. At lower doses (1,000 to 5,000 units/kg bwt) the drug binds the lipid A component of

LPS and safely and effectively reduces or eliminates LPS-induced events (Barton et al. 2004).

Treatment with polymyxin B prior to and after LPS exposure reduced fever, tachycardia and

serum TNF-α concentration in horses (Barton et al. 2004; Parviainen et al. 2001).

New therapeutics. While promising new therapeutics are currently being studied, they

have not been evaluated in clinical patients. A synthetic lipid A analogue E5564 (Figueiredo et

al. 2008), a phospholipid emulsion (Moore et al. 2007) and a selective MAPK inhibitor (specific

p38 MAPK inhibitor) (Neuder et al. 2009) have been investigated in equine PBMCs in vitro and

inhibited the expression of pro-inflammatory cytokines.

30

Figueiredo et al. reported the effectiveness of synthetic lipid A analogue E5564 treatment

in horses. The hydrophobic lipid A region of LPS is responsible for initiating various innate

immune responses that result in development of the SIRS. Because the lipid A region is

conserved among a variety of gram negative bacteria, this molecule is an attractive target for the

development of LPS antagonists (Figueiredo et al. 2008). The compound E5531 has been

successfully used as an LPS antagonist in murine and human cells (Figueiredo et al. 2008) in

experimentally induced endotoxemia. E5531 induces strong pro-inflammatory responses in

equine cells and can therefore not be used in horses (Figueiredo et al. 2008). E5564 is a second

generation synthetic lipid A analogue. It is more potent, has longer duration of action, and is

more stable than E5531 (Figueiredo et al. 2008). E5564 blocks the action of LPS at its cell-

surface receptor (TLR4) and prevents the induction of cellular mediators in rodents and humans

(Figueiredo et al. 2008). The efficacy of E5564 was evaluated in an in vitro experiment. E5564

inhibited the LPS-induced production of inflammatory cytokines (TNF-α, IL-1β, IL-6, IL-10) in

a concentration-dependent manner (Figueiredo et al. 2008). Therefore, E5564 appeared to be the

first lipid A analogue that has potential as an effective therapeutic agent in horses with

endotoxemia. Further studies are needed to support its clinical use in equine patients (Figueiredo

et al. 2008). The synthetic lipid A analogue E5564 is currently being evaluated in phase III

clinical trials in humans (Figueiredo et al. 2008).

Moore et al. investigated the administration of a phospholipid emulsion as a possible new

therapeutic in endotoxemia. As described earlier, HDLs neutralize LPS (Wurfel et al. 1997) and

human patients with low serum concentrations of lipoproteins have an increased risk for

infection and reduced prognosis for survival (Gordon et al. 1996). Administration of

phospholipid emulsions in endotoxemia has resulted in improved survival (Goldfarb et al. 2003)

31

and significant attenuation of LPS effects in humans (Gordon et al. 2005) and horses (Winchell

et al. 2002). Winchell et al. reported gross hemolysis in horses given the phospholipid emulsion

(200 mg/kg) intravenously (Winchell et al. 2002). Moore et al. administered a lower dose of the

phospholipid emulsion (100 mg/kg) reducing hemolysis, yet still achieving attenuation of LPS

effects. The horses received 30 ng/kg of LPS (E. coli O55:B5) immediately after the

phospholipid emulsion was given. Improved clinical scores, prevention of pyrexia and

tachycardia, and reduced production of TNF-α were reported in treated horses (Moore et al.

2007). Further in vivo studies are required to evaluate its effectiveness in clinical settings.

Neuder et al. investigated a specific p38 MAPK pathway inhibitor for treatment of

endotoxemia in horses. The p38 MAPK pathway is a member of MAPK signal transduction

pathway in the cellular downstream cascade of induction of pro-inflammatory cytokine

production after LPS exposure. SB203580 and SB202190 are specific p38 MAPK inhibitors and

decrease protein and mRNA expression of COX-2 in LPS-stimulated equine leukocytes (Neuder

et al. 2009). In an in vitro experiment, equine PBMCs were treated with SB203580 or SB202190

and then exposed to LPS (10 ng/ml) (E. coli O55:B5) for 2 or 4 hours. SB203580 significantly

decreased IL-1β and IL-8 mRNA expression. SB202190 significantly decreased TNF-α and IL-6

mRNA expression. The p38 MAPK inhibitors exhibited differences in specificity and potency,

and further studies are needed to evaluate these as potential therapeutics in equine endotoxemia.

Research. Given that the toxicity of endotoxin is due to its ability to produce widespread

over-stimulation of immune response cells, one approach which is currently being investigated in

humans and laboratory animals is immunologic manipulation to attenuate the host response to

endotoxin. Following the observation that a low dose of endotoxin can mitigate future host

32

responses to endotoxin, further studies to develop ‘endotoxin tolerance’ as a therapeutic modality

are underway.

Endotoxin Tolerance (ET)

Endotoxin Tolerance (ET) is defined as a reduced capacity of the host (in vivo) or of

cultured macrophages/monocytes (in vitro) to respond to LPS activation following a first

exposure to this stimulus (Fan and Cook 2004). ET was first studied by Beeson in a rabbit model

(Beeson 1947). ET is not a whole scale down-regulation of signaling protein and inflammatory

mediators, since LPS tolerant animals and cells still respond to LPS challenge by expressing

specific genes and proteins. Instead, ET appears to be a specific adaptive response that is

mediated by a complex, regulated process (Fan and Cook 2004; West and Heagy 2002). The

result of ET is a profound reduction in the clinical signs associated with endotoxin exposure, a

phenomenon that has obvious potential clinical applications.

ET is characterized by inhibition of LPS-responsive inflammatory pathways including:

TNF-α, IL-8 and IL-12 production, IL-1 and IL-6 release, COX-2 activation, MAPK activation

and NF-кB translocation (Werners et al. 2005). The inhibition of TNF-α production has become

a useful phenotypic marker of endotoxin tolerance due to its central role as a mediator of LPS-

induced inflammation, and its down-regulation during ET.

Duration of ET

Endotoxin tolerance occurs in two stages: early phase endotoxin tolerance (EPET) and

late phase endotoxin tolerance (LPET) (Allen et al. 1996; Greisman et al. 1969). EPET, which is

a transient phenomenon that occurs within hours to days and does not involve production of

antibodies to endotoxin, has been demonstrated in the horse as well as in humans and rabbits

33

{Allen, 1996 #361;(Greisman et al. 1969). Altered host responses after the second dose of

endotoxin included a decreased duration of fever, attenuated TNF-α response and decreased

mortality (Allen et al. 1996; Greisman et al. 1969; Rayhane et al. 1999). The early phase of ET

is associated with a down-regulation of LPS-induced inflammatory mediator production. EPET

occurs within 48 hours of endotoxin exposure and then rapidly wanes. The late phase of ET is

mediated by anti-endotoxin antibodies against the ‘O’ domain and common core antigens, which

blunt the release of endogenous pyrogen from macrophages (Greisman et al. 1969). LPET was

described in rabbits, humans and rats (Greisman et al. 1969; Mulholland et al. 1965; Sanchez-

Cantu et al. 1989). LPET develops after the initial 48 hours after endotoxin exposure and reaches

its maximum effectiveness at 8 to 10 days post endotoxin exposure. Recovery of responsiveness

to LPS was observed at day 20 post endotoxin exposure in rats (Sanchez-Cantu et al. 1989). In

rabbits ET lasted for up to 34 days (Mulholland et al. 1965). In human volunteers duration of ET

for as long as 17 weeks was described (Neva and Morgan 1950). In these studies, humans and

animals were exposed to a wide dose range (0.25µg to 250 µg of LPS in rats and rabbits; 0.001

to 0.3 µg/kg bwt in humans; 0.5 to 50 µg/kg bwt in rabbits) of different kinds of endotoxin (E.

coli O127:B8; Salmonella enteritidis; Salmonella typhimurium endotoxin; Salmonella typhosa

endotoxin; Pseudomonas endotoxin) (Greisman et al. 1969; Mulholland et al. 1965; Sanchez-

Cantu et al. 1989). Thus, the duration of ET depends on the dose of endotoxin administered as

well as the kind of endotoxin given. It was also shown that in LPET ‘cross-tolerance’ can be

induced between bacterial endotoxins from different gram negative bacterial species (Greisman

et al. 1969).

34

The mechanisms for the induction and maintenance of endotoxin tolerance are not

completely understood, but recent investigations have also demonstrated a critical role for the

cytokines IL-12, IL-10 and TGF-β (Shnyra et al. 1998). Tolerization is accomplished without

significant effect upon resistance to infections. Resistance to gram negative infections,

phagocytosis, and fungal infections, for example, are actually enhanced in tolerized laboratory

rodents (West and Heagy 2002).

In vivo ET

ET has been induced in many animal models and in vitro studies. Rats that received a

pretreatment exposure to endotoxin in vivo survived a subsequent challenge of endotoxin that

was 100% lethal for naïve rats (Sanchez-Cantu et al. 1989). This was associated with markedly

decreased concentrations of circulating TNF-α in pretreated rats. In this study, duration of ET

was also assessed. Maximal refractory effects to LPS were reached on days 3 to 5 after the

induction of ET (Sanchez-Cantu et al. 1989). A slow recovery of the responsiveness to LPS

followed this period; on day 20 full responsiveness to LPS was re-established (Sanchez-Cantu et

al. 1989). ET was induced in mice with the following protocol: priming dose of 25 µg of LPS

given in the footpad followed by 200 µg of LPS intravenously 24 hours later. This protocol

resulted in development of ET and decreased TNF-α production.

The phenomenon of endotoxin tolerance has also been demonstrated in the horse.

Pretreatment with a single dose of 50 ng/kg bwt of O55:B5 E. coli LPS was associated with an

attenuated clinical response and decreased endogenous production of TNF-α in horses given a

subsequent LPS challenge (50 ng/kg bwt of LPS) (Allen et al. 1996). Fevers and changes in

blood pressure and respiratory rate were all blunted in horses on secondary exposure. In addition,

the endogenous TNF-α response was almost completely eliminated in horses after the second,

35

challenge, infusion of LPS. Burrows et al. injected 4 doses of 100 µg/kg bwt of LPS (E. coli

O26:B6) intraperitoneally at 3 hour intervals into adult ponies (Burrows 1979). These ponies

(group 3) were compared to two groups of ponies who received a single dose of LPS either

intravenously (group1) or intraperitoneally (group 2). Depression and anorexia were observed in

all 3 groups but were least marked in group 3. Fever was most significant in group 3 but lethality

was markedly decreased in group 3 (20% lethality) compared to the other 2 groups and

suggested a reduced LPS response after repeated LPS exposure (Burrows 1979). It is clear;

therefore that endotoxin tolerance can be induced in the horse, yet the mechanisms of this

phenomenon have not been systematically investigated in the horse.

In vitro ET

ET was induced in murine peritoneal macrophages by incubation with a tolerizing dose

of 10 ng/ml of LPS for 20 hours, followed by incubation with a challenge dose of 10 ng/ml of

LPS for up to 2 hours (Medvedev et al. 2000). In tolerized murine peritoneal macrophages the

MAPK pathway, degradation of I кBα and I кBβ, and activation of the transcription factors NF-

кB and AP-1 were inhibited, suggesting that ET results from impaired function of common LPS

signaling intermediates (Medvedev et al. 2000). In a different model, murine peritoneal

macrophages were pretreated with a range of LPS (E. coli O111:B4) concentrations of 0.1 to 10

ng/ml for 6 hours, and then stimulated with 1 µg/ml of LPS for 24 hours. A marked reduction in

TNF-α production was observed (Shnyra et al. 1998). ET resulted in down-regulation of IL-12

and up-regulation of IL-10. The peak of Il-12 production coincided with the peak in TNF-α

production; significant correlation between the levels of IL-12 and TNF-α was also observed

(Shnyra et al. 1998). ET was demonstrated in porcine CD14 positive monocytes in vitro after

pretreatment with either 0.1, 1 or 10 µg/ml of LPS (Salmonella typhimurium L 2262) for 20

36

hours followed by exposure to 10 µg/ml of LPS for 4 and 24 hours. Development of ET was

associated with reduced production of TNF-α and IL-8. ET was induced in several in vitro

experiments with human cells. Human monocytes were cultured with 100 ng/ml of LPS

(Salmonella enteritidis) for 24 hours followed by a second exposure to LPS (10 µg/ml) for 24

hours (Peck et al. 2004). In tolerized cells, production of TNF-α was decreased to less than 1%

of non-tolerized cells (Peck et al. 2004). IL-6 production was increased in tolerized cells

compared to non-tolerized cells. However, no change was observed in IL-1β and IL-8 production

(Peck et al. 2004). In another study, human dendritic cells were pretreated with 1 ng/ml LPS

(Salmonella typhimurium) for 24 hours, and then stimulated with 1 µg/ml of LPS (Karp et al.

1998). ET was successfully induced, TNF-α and IL-12 production were markedly reduced.

Mechanisms for induction and maintenance of ET

Several mechanisms and pathways are involved in the development of ET. Experimental

evidence suggests that alterations in signal transduction after repeated exposure to endotoxin are

critical to development of ET (West et al. 1996; West et al. 1997; Ziegler-Heitbrock et al. 1994)

(see Figure 4).

LBP and CD14. High concentrations of LBP and sCD14 have been associated with

neutralization of endotoxin in septic human patients (Kitchens et al. 2001). Increased expression

of mCD14 (Ziegler-Heitbrock et al. 1994) and sCD14 (Labeta et al. 1993) is associated with the

development of ET and has been described in animals and humans. Other models reported no

change in mCD14 expression in humans, rabbits and mice (Mathison et al. 1993; McCall et al.

1993; Ziegler-Heitbrock et al. 1997). In 2003, Heagy et al. reported that mCD14 is not involved

in the development of ET in human monocytes (Heagy et al. 2003).

37

TLR and downstream signal transduction. Upregulation of TLR4 after LPS exposure

has been described (Jiang et al. 2000) leading to NF-кB activation. Decreased phosphorylation

of the MAP kinase pathway (Durando et al. 1998; Medvedev et al. 2001; Ropert et al. 2001;

West et al. 2000), and IRAK pathway (Li et al. 2000) lead to impaired pro-inflammatory

cytokine expression. Sato et al. described down regulation of the cell surface (TLR)4-MD2-

complex in ET which resulted in decreased inflammatory cytokine production, blocked

activation of IRAK or NF-кB, and altered TLR4-MyD88 dependent signaling (Sato et al. 2000).

Inhibition of TLR4 expression was also reported in macrophages from mice and hamsters

(Medvedev et al. 2001; Nomura et al. 2000).

Nuclear factor кB (NF-кB) pathway. Inhibition of the NF-кB pathway has been

described in ET and is caused by an increased level of the inactive p50 homodimer relative to the

active p50/p65- heterodimer. ET leads to a suppressed degradation of I кBα and I кBβ and

impaired LPS-stimulated activation of the transcription factor of NF-кB, (Kastenbauer and

Ziegler-Heitbrock 1999; Medvedev et al. 2000; Wahlstrom et al. 1999; West et al. 2000;

Ziegler-Heitbrock 1995) and an increased expression of I кBα or impaired degradation of I кBα

(Blackwell et al. 1997; Kohler and Joly 1997; Medvedev et al. 2001; Shames et al. 1998;

Wahlstrom et al. 1999).

Ligation of the macrophage Fcɣ receptor. From research in laboratory rodents, it

appears that tolerance to endotoxin can be manipulated and induced by means other than

endotoxin exposure. For example, macrophages can be tolerized to endotoxin by ex vivo ligation

of the macrophage Fcɣ receptor with IgG-opsonized erythrocytes (Gerber and Mosser 2001). In

addition, adoptive transfer of the tolerized macrophages induced resistance to a lethal endotoxin

dose in recipients. This was associated with upregulation of IL-10 and down regulation of IL-12

38

(Gerber and Mosser 2001; Sutterwala et al. 1997). These may prove to be clinically applicable

methods of inducing endotoxin tolerance in horses, but the fundamental phenomenon needs

further investigation in the horse.

IL-1. Mice pretreated with IL-1 prior to LPS exposure developed ET. In this study, TNF-

α expression remained elevated; therefore, a different mechanism for ET induction was

suspected than in ET associated with low TNF-α expression (Leon et al. 1992).

39

Figure 4. Blockage/inactivation of numerous signal transduction pathways result in impaired

translocation of NF-кB and AP-1 and development of endotoxin tolerance (ET). LPS may be

neutralized prior to interacting with LBP and CD14.

IL-12. It has been demonstrated in numerous studies in humans and laboratory animals

that exposure to endotoxin results in the release of the pro-inflammatory cytokine IL-12 (Shnyra

et al. 1998). Pretreatment (priming) of human PBMCs with LPS blocked IL-12 production (Karp

et al. 1998). In murine peritoneal macrophages that were primed IL-12 expression was down-

regulated (Shnyra et al. 1998), this down-regulation is associated with improved survival

(Heinzel et al. 1994; Karp et al. 1998; Wysocka et al. 1995; Zisman et al. 1997). In humans it

has been shown that IL-12 suppression associated with ET may result in impaired bacterial

40

clearance and an inability to respond appropriately to secondary infections in survivors of sepsis

(Karp et al. 1998). IL-12 suppression in ET is caused by a different mechanism than TNF-α

suppression and is not dependent on IL-10 or TGF-β in mice or humans (Karp et al. 1998;

Sutterwala et al. 1997). The response of IL-12 to single or repeated endotoxin administration in

the horse is not reported.

IL-10. IL-10 is an anti-inflammatory cytokine which regulates the response to endotoxin

and can prevent endotoxic shock. In IL-10 deficient mice the lethal dose of endotoxin was 20

times lower than in normal mice (Berg et al. 1995). When ET was induced in IL-10 deficient

mice the tolerizing dose was 100 times lower than in normal mice. Despite these findings, IL-10

does not appear to be a main effector of ET (Berg et al. 1995) but a critical component of the

host’s natural defense against pathological responses to LPS. IL-10 downregulates the

production of pro-inflammatory cytokines, mainly TNF-α, and reduces LPS toxicity and

mortality in ET in mice and humans (de Waal Malefyt et al. 1991; Flohe et al. 1999; Gerard et

al. 1993; Howard et al. 1993; Marchant et al. 1994). IL-10 mediates protection in the earliest

phase of the LPS response but ET does not appear to be IL-10 dependent. IL-10 was produced

within 18-24 hours in vitro; but in vivo IL-10 peaks at the same time as TNF-α (Beutler et al.

1986).

IL-10 is required for development of ET in human monocytes (de Waal Malefyt et al.

1991; Gerard et al. 1993; Howard et al. 1993; Randow et al. 1995) in vitro. In murine cells

controversial findings have been reported. In a model of ET in murine peritoneal macrophages

IL-10 was up-regulated (Shnyra et al. 1998). Administration of IL-10 has been shown to

reproduce some aspects of ET but IL-10 knockout mice could still be tolerized in one study

(Berg et al. 1995; Cavaillon and Adib-Conquy 2006).

41

In one study of ex vivo endotoxin stimulated equine PBMCs, IL-10 was found to peak 6

hours after endotoxin exposure, coincident with TNF-α peak, then to persist for up to 24 hours,

while TNF-α mRNA concentration decreased (Sykes et al. 2005). No data regarding IL-10

expression in ET in equine cells exist.

TGF-β. TGF-β functions in close relationship with IL-10. Only few studies have

investigated its importance in endotoxemia and ET. Recently, rabbit macrophages (Mathison et

al. 1990) or human monocytes and macrophage cell lines (Ziegler-Heitbrock et al. 1992) have

been shown to acquire a status of ET by preculture with low doses of LPS in vitro. The anti-

inflammatory mediators IL-10 and TGF-β seem to be of critical importance in this in vitro

tolerance (Flohe et al. 1999). Antibodies against IL-10 and TGF-β interfered with the

development of an in vitro tolerance in human monocytes (Randow et al. 1995) but did not

prevent the suppression of IL-12 expression. Therefore, IL-10 and TGF-β have essential roles in

the development of ET in humans (Karp et al. 1998; Randow et al. 1995). The production of

TGF-β has not been investigated in the horse following endotoxin exposure or in ET.

Although the mechanisms of induction and maintenance of ET are not completely

understood, from these studies it is clear that at least one mechanism for the maintenance of

endotoxin tolerance is the reciprocal modulation of IL-10 and IL-12 responses. Further research

in this field is needed to characterize this relationship more specifically.

42

Conclusion

The current literature offers substantial information regarding endotoxemia and ET in

different species. From published studies, we know that substantial differences exist in the

immune response to LPS across species. Therefore, species-specific research is clearly needed.

Equine endotoxemia has been examined closely and is well characterized; but little is known

about the production of IL-12 and anti-inflammatory cytokines in equine endotoxemia. ET has

been induced in horses but poorly investigated. No information regarding the expression of IL-12

and anti-inflammatory cytokines such as IL-10 and TGF-β exists. The goals of this study were to

establish an in vitro model of ET in equine PBMCs and to characterize the expression of IL-12

and IL-10 in tolerized equine PBMCs.

43

Chapter 2. Induction of Endotoxin Tolerance in vitro in equine PBMCs

The pathophysiologic derangements associated with the presence of circulating LPS in horses

cause significant morbidity and mortality in the horse (Allen et al. 1996). While gastrointestinal

diseases remain the leading cause of death in horses (Tinker et al. 1997) mortality within this

group is related to the degree of endotoxemia (Thoefner et al. 2001). It has been reported that

30% of horses examined for colic at referral institutions, and 50% of septicemic foals, have

detectable concentrations of endotoxin in their blood at the time of admission (Barton 2003).

While gastrointestinal diseases are common clinical conditions in which endotoxemia arises,

endotoxemia also results from a number of other clinical settings, including grain overload, gram

negative bacterial pleuropneumonia, peritonitis and uterine infections.

In the horse, as in other species, most of the clinical signs associated with endotoxemia

are due to the presence of circulating cytokines (Moore 1998). Although endotoxin stimulates an

array of cytokine and inflammatory mediators, only a few key cytokines have been described in

equine endotoxemia. Tumor necrosis factor-α (TNF-α), IL-1 and IL-6 are key pro-inflammatory

cytokines released during endotoxemia in horses (Moore 1998; Steverink et al. 1995; Veenman

et al. 2002). These cytokines are important in the onset and development of septic shock and a

direct relationship between blood concentrations of TNF-α, IL-6 and mortality has been

established in horses, humans and rodents (Steverink et al. 1995; Veenman et al. 2002). TNF-α

is important in the pathogenesis of sepsis, as indicated by its increased concentration during

experimental and natural sepsis and by the fact that administration of exogenous TNF-α mimics

the clinical and pathological changes of sepsis (Moore and Morris 1992; Veenman et al. 2002).

The importance of TNF-α in horses with endotoxemia is demonstrated by the observation that

44

horses with gastrointestinal disease exhibit an increased concentration of TNF-α in serum and

peritoneal fluid (Barton et al. 1996; Steverink et al. 1995).

In species other than the horse it has been demonstrated that anti-inflammatory cytokines

are also stimulated following endotoxin exposure, including IL-4, IL-10, IL-11, IL-13, TGF-β,

soluble TNF-α receptors and IL-1 receptor antagonist (Krishnagopalan et al. 2002; Roy 2004).

The expression of pro-and anti-inflammatory cytokines other than TNF-α, IL-1 and IL-6 are

poorly reported in the equine literature. IL-10 mRNA has been shown to be up-regulated in

horses after exposure to endotoxin (Sykes and Furr 2005; van den Hoven et al. 2006) . It is likely

that this cytokine plays a key role in down-regulation of the profound inflammatory response to

endotoxin.

A phenomenon called ‘endotoxin tolerance’ (ET) represents a reduced capacity of

animals or cells to respond to LPS activation following a first exposure to this stimulus. ET is

associated with improved clinical signs and decreased mortality. ET has been induced in horses

in vivo but the cytokine profile associated with ET in horses has not been investigated.

The blunted response to endotoxin in ET has potential clinical utility in manipulating the

cellular response to endotoxin in equine patients. Endotoxin tolerance represents a novel

approach to the treatment of endotoxemia in the horse. The experiment described below is

intended to demonstrate that endotoxin tolerance can be induced in horses in vitro, and to

describe the cytokine responses which are associated with its development, and necessary for its

maintenance. Once this mechanism is established, protocols can be devised and tested to induce

this phenomenon in horses experiencing clinical endotoxemia. The establishment of a

45

mechanism and testing platform (in vitro tolerization), as described in this report, is a critical

first step in that process.

The purpose of the study was to describe a method for inducing endotoxin tolerance in

equine PBMCs in vitro, and to investigate part of the cytokine profile associated with endotoxin

tolerance, specifically, TNF-α, IL-12 and IL-10. Tolerance was defined as a reduction in TNF-α

production by greater than 75% when compared to non-tolerized positive control cells. Once the

tolerizing protocol was determined, the experiment was repeated and the cytokine profile of

tolerized PBMCs was examined by quantitative PCR. The hypothesis was that mRNA

expression of IL-12 and IL-10 from tolerized cells differs from that of positive control cells.

Materials and Methods

Horses

Six healthy mature horses were used. Horses ranged from 5 to 20 years of age. There were two

mares and four geldings in the group. The horses were maintained in one group on pasture

turnout with free choice access to water at all times. None of the horses received any medication

during the study period and none of them had previously been exposed to endotoxin for

experimental studies. The study was conducted at the Marion duPont Scott Equine Medical

Center.

All horses were determined to be healthy by physical examination, complete blood cell count

and serum biochemistry prior to inclusion in the study. The protocol was approved by the

Virginia Tech Institutional Animal Care and Use Committee.

Blood collection, PBMC recovery and cell culture

46

Sixty ml of blood were collected aseptically from the left jugular vein of the horses into lithium

heparinized vacutainersa and gently mixed. Peripheral blood mononuclear cells (PBMCs) were

isolated as previously described (Sykes et al. 2005). Briefly, the heparinized blood was

centrifuged at 600 x g for 10 minutes at 20°C. The buffy coat was aspirated and suspended in 8

ml of RPMI 1640 incomplete mediumb. Next 2 to 3 ml of this suspension was gently layered

onto 4 ml of ficoll-hypaque (Lymphoprep®c) (density 1.077 g/ml) in 15 ml conical, sterile screw

top vialsd and centrifuged at 350 x g for 30 minutes at 20°C. This method was repeated for the

entire sample. The mononuclear cells were recovered from the Lymphoprep®-cell interface by

gentle aspiration, resuspended in incomplete RPMI 1640 medium and centrifuged at 600 x g 5

minutes. The cells were washed in incomplete RPMI 1640 medium three times, then

resuspended in RPMI 1640 complete medium consisting of RPMI 1640 incomplete mediumb,

10% heat-inactivated fetal bovine serum (FBS)e, penicillin

f (50 IU/ml), streptomycin

f (50 IU/ml),

HEPES buffer (25 mmol) and L-glutamineg. Cell counts were determined using a

hemocytometerh. Cell viability was assessed with trypan blue staining

i. 0.5 ml of the cell

suspension was mixed with 0.1 ml of 0.4% Trypan blue stain. This was allowed to stand for 5

minutes at room temperature (15-25°C). A hemocytometer was used to count viable cells.

Absolute cell counts were determined and cell suspensions were diluted in complete RPMI 1640

medium to a concentration of 1 x 106 viable cells/300 µl, which was placed into each well of a

multiwell culture plate for subsequent determination of TNF-α production at 12 hours.

The experiment comprised three experimental groups: a tolerized group, a negative control group

and a positive control group. In this study, negative control cells are defined as cells that had not

been exposed to endotoxin at any time point. Positive control cells were cells that had not been

tolerized but did receive the ‘challenge’ dose of endotoxin. Tolerized cells were those cells that

47

received a low ‘tolerizing’ dose of endotoxin subsequently followed by a second ‘challenge’

dose of endotoxin.

Prior to tolerization, cells were incubated with either 0.1 ng/ml, 1 ng/ml or 10 ng/ml of

endotoxin. The doses of LPS (Lipopolysaccharides from E. coli O55:B5)k were selected based

on previously published work (Barton et al. 1996; Shnyra et al. 1998; Sykes et al. 2005). LPS

was dissolved in incomplete RPMI 1640 medium at a final concentration of 1 mg/ml. Complete

RPMI 1640 medium was added to all wells to achieve a total volume of 1 ml. The plates were

incubated at 37°C with 5% carbon dioxide (CO2) for 6 hours then centrifuged at 3500 RPM for 3

minutes after which the supernatant was aspirated. The cells were washed 3 times with 0.9%

NaCl then resuspended in complete RPMI 1640 medium. Positive control and tolerized cells then

received a ‘challenge’ dose of either 1 ng/ml, 10 ng/ml or 100 ng/ml of endotoxin. The plates

were incubated at 37°C with 5% CO2 for 6 hours, after which supernatant from each well was

removed, placed in polypropylene tubes and frozen at -70°C until assayed. Treatments were

replicated 3 times.

48

Figure 5. Experimental design of phase I. Negative control cells were not exposed to LPS (not

shown). Positive control cells were exposed to ‘challenge’ doses of LPS only. Tolerized cells

received 2 doses of endotoxin (‘tolerizing’ and ‘challenge’ dose) 6 hours apart.

TNF-α assay

Cell culture supernatants were assayed for TNF-α concentration with a commercially available

equine TNF-α assayl. The assay was performed as previously described (Sun et al. 2008).

ELISA plates were prepared as described. Briefly, TNF-α antibodies were reconstituted in

carbonate/bicarbonate buffer (1:100 dilution) and 100 µl were added to each well of a 96-well

plate and incubated overnight at room temperature (22-25°C). The following day, the plates were

washed 3 times, and incubated for 1 hour with 300 µl of blocking buffer with 4% bovine serum

albumine in Dulbecco’s PBS

m. After washing 3 times, 100 µl of 1:100 detection antibody was

added and the plates incubated for 1 hour at room temperature, after which they were washed

49

three times with wash buffer (300 µl per well). 100 µl of Streptavidin-Horseradish Peroxidase

(SA-HRP) (1:400) was added to each well then incubated for 30 minutes at room temperature.

After washing, 100 µl of TMB Substrate solution was added to each well and the plates were

incubated in the dark for 20 minutes at room temperature. After the addition of 100 µl of Stop

Solution (Sulfuric Acid) the absorbance was measured at 405nm using a micoplate readero. Cells

were considered to be tolerized if the TNF-α concentration was reduced by more than 75% of the

positive control sample for the same horse.

Statistical analysis

Data were entered into a desktop computer, and after data entry validation, analysis was

performed with a computerized statistical package: SASp. Differences of TNF-α expression

between treatment groups and treatment time were evaluated by use of mixed-model repeated

measures ANOVA. Pair-wise comparisons were made on significant differences identified with

ANOVA using Tukey’s post hoc test. TNF-α concentrations were reported as means ± SD.

Results were considered significant at a value of P < 0.05.

Results

TNF-α was produced by all cells exposed to endotoxin (positive control cells and tolerized cells).

The magnitude of TNF-α production showed a wide variability between individual horses and

between the dosages of endotoxin.

ET in tolerized cells was defined as reduction of TNF-α production by greater than 75%

compared to positive control cells. Reduction in TNF-α production ranged from 75% to 100%,

and was observed in all cells treated with all 3 tolerizing doses. A statistically significant

difference in TNF-α concentration (P < 0.0001) was identified between positive control cells and

50

tolerized cells. There was no statistical difference present between the different ‘tolerizing’ and

‘challenge’ doses that were used to induce ET. From these results, we chose a ‘tolerizing’ dose

of 1 ng/ml of LPS and a ‘challenge’ dose of 10 ng/ml of LPS for the second phase of the study.

TNF-α concentration

Figure 6. TNF-α concentration for positive control cells and tolerized cells at different doses of

endotoxin exposure. Data presented as mean ± SD. Asterisk (*) denotes statistically significant

difference (P < 0.0001) between positive control cells and tolerized cells.

51

Conclusion

An in vitro model for induction of ET was successfully developed. The ‘tolerizing’ dose of 1

ng/ml of endotoxin followed by a ‘challenge dose’ of 10 ng/ml of endotoxin was associated with

ET most reliably. This protocol can be recommended for in vitro induction of ET for further

evaluation and characterization of ET.

52

Chapter 3. Characterization of Endotoxin Tolerance in vitro in PBMCs

Materials and Methods

Horses

Six healthy mature Thoroughbred mares were used for the study. Horses ranged from 10 to 19

years of age. The horses were maintained in one group on pasture turnout with free choice access

to water at all times at the Middleburg Agricultural Research and Extension (MARE) center.

None of the horses received any medication during the study period and none of them had been

exposed to endotoxin previously for experimental studies. The study was conducted at the

Middleburg Agricultural Research and Extension (MARE) center and the Marion duPont Scott

Equine Medical Center.

All horses were determined to be healthy by physical examination, complete blood cell count

and serum biochemistry prior to inclusion in the study. The protocol for the project was approved

by the Virginia Tech Institutional Animal Care and Use Committee.

Blood collection

Seven hundred ml of blood were collected aseptically into heparinizedq blood collection bags

r

from the left jugular veins of the Thoroughbred mares. The blood was gently mixed in the

collection bags and immediately transported to the Marion duPont Scott Equine Medical Center.

Blood was transferred into 50 ml sterile conical tubes for centrifugation and PBMCs were

isolated as described in Chapter 2. Absolute cell counts were determined as described above and

cells were suspended in complete RPMI 1640 medium at a concentration of 1 x 106 cells/200 µl.

Cell culture and sample collection

53

Based on the results from Phase I, a ‘tolerizing’ dose of 1 ng/ml of endotoxin and a ‘challenge’

dose of 10 ng/ml of endotoxin were selected for induction and testing of endotoxin tolerance,

respectively.

The three treatment groups included: a tolerized group, a positive control group and a negative

control group: all samples were cultured in triplicates. Three million cells were put into each well

of a 48 well culture plate and the total volume was adjusted to 1 ml by the addition of complete

RPMI 1640 media. Cells were tolerized by incubation with 1 ng/ml of LPS and incubated at

37°C with 5% CO2 for 6 hours. Following this, the plates were centrifuged at 3500 RPM for 3

minutes and the supernatant and cell pellets were recovered, protease inhibitors was added

(1:100) to the supernate and it was stored at -70°C until assayed. The cell pellets were used

immediately for RNA isolation and cDNA synthesis. The cells to be used for challenge testing

were resuspended in incomplete RPMI 1640 and were washed as described above. Then the cells

were resuspended in complete RPMI 1640 medium and the challenge dose of 10 ng/ml of

endotoxin was added to the positive control and tolerized samples. The total volume in each well

was 1 ml. Plates were incubated at 37°C with 5% CO2. After 6, 12 and 24 hours the cell culture

supernatants and cell pellets were recovered as described above. Protease inhibitor was added to

the cell culture supernatants according to the manufacturer’s instructions, the samples were

frozen immediately at -70°C until assayed. The cell pellets were used immediately for RNA

isolation and cDNA synthesis.

54

Figure 7. Experimental design of phase II. Negative control cells were not exposed to LPS (not

shown). Positive control cells were exposed to ‘challenge’ dose of LPS only. Tolerized cells

received 2 doses of endotoxin (‘tolerizing’ and ‘challenge’ dose) 6 hours apart. Culture medium

and cell pellets were collected at 4 time points from all cell groups.

RNA isolation, cDNA synthesis and gene expression

The RNA isolation was performed with a commercially available kitt using the technique

previously described by Sykes et al. (Sykes et al. 2005). Briefly, cell pellets were disrupted and

homogenized in guanidium lysis buffer, precipitated with ethanol and purified by use of a

commercially available column based protocol. This protocol included an on-column DNaseu

digestion and a subsequent RNA cleanup procedure to exclude genomic template contamination.

RNA concentration was measured by optical density at 260 nm (spectrophotometer). RNA

quality was assessed by gel electrophoresis on a denaturing agarose gelv. One microgram of

55

RNA in each sample was converted to cDNA with a commercial transcription kitw and oligo (dT)

primers using the manufacturer’s protocol. Briefly, 1 µg of total RNA was mixed with Reverse

Transcription Master Mix containing Reverse Transcription buffer, Deoxynucleotide

Triphosphate mix, Reverse Transcription random primers, Multiscribe™ Reverse Transcriptase

and nuclease-free water. Mixtures of each sample were placed in each well of a multiwell plate

and cDNA was synthesized in triplicates. The mixtures were incubated at 25°C for 10 minutes,

then 37°C for 2 hours and heated at 85°C for 5 minutes. The samples were stored at -70°C until

used for PCR analysis.

The expression of IL-10 and IL-12 was quantified by real-time PCRy. Triplicate samples

recovered from each experimental group at time 0, 6, 12 and 24 were used and target cDNAs

were amplified via real-time PCR by use of Taq DNA polymerase (TaqMan®)x and equine gene

specific primers designed from available published sequences (Garton et al. 2002) (Appendix A).

Real-time quantitative PCR assay was performed in triplicate for IL-10 and IL-12 and G3PDH

was used as an endogenous standard. All reactions were run as single-plex, and the relative gene

expression was quantified by use of the 2-ΔΔCt

method. Amplification of 2 µl of cDNA was

performed in a 25 µl PCR containing 900 nmol of each primer, 250 nmol of TaqMan probe and

12.5 µl of TaqMan® Gene Expression Master Mixx. Amplification and detection were performed

using a 7500 Real Time PCR systemy. The samples were amplified in a combined thermocycler-

fluorometer for 2 minutes at 50°C, 10 minutes at 95°C, and then 40 cycles of 15 seconds at 95°C

and 60 seconds at 60°C.

Each sample was assayed in triplicate, and the mean value was used for comparison. To account

for variation in the amount and quality of starting material, all the results were normalized to

56

G3PDH expression. The threshold cycle values for each gene were compared with their

respective standard curves to generate a relative transcript level.

TNF-α assay

The cell culture supernatant samples were thawed and assayed as described in Chapter 2 using a

commercially available TNF-α ELISA screening kit.

Statistical analysis

TNF-α concentrations were reported as mean ± SD. Differences of gene expression between

treatment groups and treatment time were evaluated by use of mixed-model repeated measures

ANOVA. Pair-wise comparisons were made on significant differences identified with ANOVA

using Tukey’s post hoc test. A commercial statistical programz was used to perform analysis.

Relative gene expression data were presented as 2-ΔΔCT

and confidence intervals were reported.

Pearson’s correlation analysis was performed to evaluated correlation between TNF-α

concentrations and mRNA expression of IL-10 and IL-12. Values of P < 0.05 were considered

significant.

57

Results

TNF-α concentration

Figure 8. TNF-α concentration for negative control cells, positive control cells and tolerized

cells. Data presented as mean ± SD. Numbers represent the mean TNF-α concentration for each

group at the different time points. Asterisk (*) denotes statistically significant difference (P <

0.0001) between positive control cells and tolerized cells. Negative control cells did not produce

any TNF-α at time 0. Positive control cells did not produce any TNF-α at time 0.

TNF-α was produced in minimal amounts by negative control cells after 6, 12 and 24 hours of

cell culture. The positive control cells and tolerized cells expressed TNF-α after endotoxin

exposure. There was a significant difference (P < 0.0001) in TNF-α secretion between positive

control cells and tolerized cells. Endotoxin tolerance was induced in all tolerized cells that were

58

exposed to the 2-step endotoxin challenge. TNF-α secretion was decreased by greater than 85%

in tolerized cells compared to positive control cells.

Gene expression of IL-10 and IL-12

A 2.4-fold increase in IL-10 expression was identified in tolerized cells when compared to

negative and positive control cells at time 0 (Fig. 9). No statistically significant difference in IL-

10 expression was observed between positive control cells and tolerized cells at time 6, 12 and

24, but tolerized cells showed decreased IL-10 expression when compared with positive control

cells at time 6 and 12 (Fig.9). Negative control cells produced significantly less IL-10 at time 6,

12 and 24 when compared to positive control cells and tolerized cells. Significant effects of time

(P<0.0001) and treatment (P<0.0001) were identified. When time and treatment effects were

considered significant differences (P<0.0273) were observed between treatment groups within

the 24 hour period. Our hypothesis regarding the mRNA expression of IL-10 was not confirmed.

The mRNA expression of IL-10 from tolerized cells did not statistically differ from that of

positive control cells at time 6, 12 and 24. A statistically significant difference between tolerized

cells and positive control cells was only identified at time 0 when positive control cells had not

been exposed to endotoxin yet.

59

Figure 9. Mean relative expression of IL-10 of equine PBMCs after endotoxin exposure

determined for a 24 hour period. Asterisk (*) denotes difference (P<0.025) between tolerized

cells and negative control/positive control cells at time 0. Dagger (†) denotes difference

(P<0.025) between negative control cells and positive control/tolerized cells at time 6, 12 and 24.

Negative control cells at time 0 are used as baseline value with relative expression of 1.

Table 1. Relative gene expression 95% confidence interval for IL-10 in equine PBMCs over a 24

hour period.

Time Negative Control Cells Positive Control Cells Tolerized Cells 95% Lower 95% Upper 95% Lower 95% Upper 95% Lower 95% Upper

0 0.184327334 0.904608 0.482941953 2.370095143 1.182687 5.804177

6 0.174527903 0.896944 0.118919277 0.611156583 0.300564 1.544676

12 0.175752384 0.903236 0.117853042 0.605676933 0.295794 1.520161

24 0.149011447 0.765808 0.17058665 0.876688432 0.504981 2.595228

60

Figure 10. Mean relative expression of IL-12 of equine PBMCs after endotoxin exposure

determined for a 24 hour period. Asterisk (*) denotes difference (P<0.0002) between tolerized

cells and negative control/positive control cells at time 0. Dagger (†) denotes difference

(P<0.0001) between positive control cells and negative control/tolerized cells at time 6, 12 and

24. Dagger (‡) denotes difference (P<0.0005) between negative control cells and tolerized cells

at time 6 and 12. Negative control cells at time 0 are used as baseline value with relative

expression of 1.

Table 2. Relative gene expression 95% confidence interval for IL-12 in equine PBMCs over a 24

hour period.

Time Negative Control Cells Positive Control Cells Tolerized Cells 95% Lower 95% Upper 95% Lower 95% Upper 95% Lower 95% Upper

0 0.077989519 0.507322075 0.0467685401 3.042295056 2.351222949 15.29471296

6 0.074594438 0.512308122 0.004825063 0.033138112 0.024682215 0.169515308

12 0.078176729 0.536910985 0.011938825 0.081994815 0.058273581 0.400217891

24 0.314765788 2.161784085 0.04388319 0.301385939 0.053198364 0.365361741

61

A 5-fold increase in IL-12 expression was identified in tolerized cells when compared to

negative and positive control cells at time 0 (Fig. 10). At time 6, 12 and 24 tolerized cells

produced significantly less IL-12 than positive control cells (P<0.0001). A 15-fold decrease in

IL-12 expression in tolerized cells compared with positive control cells was identified at time 6.

A 6.6-fold decrease in IL-12 expression in tolerized cells compared with positive control cells

was identified at time 12. Negative control cells produced significantly less IL-12 at time 6, 12

and 24 when compared to positive control cells (P<0.0001) and at time 6 and 12 when compared

to tolerized cells (P<0.0005). Significant effects of time (P<0.0001) and treatment (P<0.0001)

were identified. When time and treatment effects were considered significant differences

(P<0.0001) were observed between treatment groups within the 24 hour period. Our hypothesis

regarding the mRNA expression of IL-12 was confirmed. The mRNA expression of IL-12 from

tolerized cells differed significantly from that of positive control cells at all time points.

62

Correlation between TNF-α concentration and mRNA expression of IL-10 and IL-12

TNF-α concentrations did not correlate with mRNA expression of IL-10 (r = -0.115, P = 0.337)

(Fig. 11). A weak inverse correlation of TNF-α concentrations with mRNA expression of IL-12

was identified (r = -0.324, P = 0.005) (Fig. 12).

Figure 11. Correlation between TNF-α concentrations and mRNA expression of IL-10 in all

three groups of cells. Pearson’s correlation coefficient r = -0.115 with P = 0.337.

63

Figure 12. Correlation between TNF-α concentrations and mRNA expression of IL-12 in all

three groups of cells. Pearson’s correlation coefficient r = -0.324 with P = 0.005.

64

Chapter 4. Discussion

This study demonstrated that in vitro ET can be induced in equine PBMCs. A protocol

for successful induction of ET in vitro was identified and was successfully repeated. ET was

previously induced in vivo in horses and other species (Allen et al. 1996; Berg et al. 1995;

Sanchez-Cantu et al. 1989). In vitro ET was induced in PBMCs from humans, mice, and pigs

(Cagiola et al. 2006; de Waal Malefyt et al. 1991; Karp et al. 1998; Medvedev et al. 2000;

Wysocka et al. 1995). This study provides an in vitro model for ET which can be used for further

studies in equine PBMCs for investigation of cytokine characteristics in ET in horses.

TNF-α was used as a marker of endotoxemia and endotoxin tolerance and proved to be a

reliable indicator of ET in this experiment. Quantification of TNF-α concentration in cell culture

supernatant was an easy and time-efficient procedure. ET was defined as a reduction of TNF-α

by equal to or greater than 75% compared to non-tolerized cells. In previous studies, TNF-α has

been used as a phenotypic marker of ET and its production was decreased by 98-100% in most

studies (Allen et al. 1996; Peck et al. 2004). TNF-α production peaks at 90-120 minutes after

LPS exposure and was measured at that time in referenced studies (Allen et al. 1996; Peck et al.

2004). In our model, TNF-α concentrations were measured prior to and 6, 12 and 24 hours after

LPS exposure. Therefore, it is likely that the TNF-α peak was missed, and we are unsure of the

magnitude of TNF-α suppression at the peak. Our time points for sample collection were chosen

to optimally assess the expression of other cytokines (IL-10 and IL-12) at the same time. These

cytokines have been reported to reach their peak within 2 to 6 hours after LPS exposure (Beutler

et al. 1986; Durez et al. 1993; van der Poll et al. 1994). While the magnitude of TNF-α

suppression at the likely peak response was not determined, it is clear that tolerance was induced,

and it is unlikely that this impacted the overall conclusions of the study.

65

At time 0 the IL-10 expression of tolerized cells was increased compared to negative and

positive control cells because these cells had been exposed to endotoxin. Previously it has been

described that IL-10 expression is increased after LPS exposure (de Waal Malefyt et al. 1991;

Flohe et al. 1999; Marchant 1994; van der Poll et al. 1994). This increased IL-10 production is

endotoxin-dose dependent (de Waal Malefyt et al. 1991) and is induced by pro-inflammatory

cytokines including IL-1, IL-6 and TNF-α (van der Poll et al. 1994; Wanidworanun and Strober

1993). Enhanced production of IL-10 in endotoxemia and sepsis likely represents an attempt of

the host to counteract excessive activity of pro-inflammatory cytokines (van der Poll et al. 1994).

IL-10 is a potent inhibitor of LPS-induced TNF-α production in vivo and in vitro (de Waal

Malefyt et al. 1991; Fiorentino et al. 1991; Hawkins et al. 1998) in dose-dependent fashion and

has been shown to protect mice from endotoxin shock (Gerard et al. 1993; Marchant 1994). IL-

10 induces the shift from pro- to anti-inflammatory cytokines (de Waal Malefyt and Moore

1998). IL-10 expression remained increased compared to negative control cells once ET was

induced and slightly decreased compared to positive control cells. A continued expression of IL-

10 was observed during the 24 hour period. This up-regulated IL-10 expression was not

statistically significantly different from IL-10 expression in positive control cells. The

upregulation of IL-10 expression prior to the LPS challenge dose and its continued expression

thereafter suggest that these levels were sufficient in order to induce ET and to regulate a well-

balanced Th1 and Th2 response in our model. Hawkins et al. suggested that IL-10 has potential

as a novel anti-inflammatory agent for clinical application in horses since it suppressed the

expression of pro-inflammatory cytokines in their study (Hawkins et al. 1998). Our results

support this suggestion but further studies are needed to evaluate the benefit of IL-10 in vivo.

66

LPS-induced IL-10 expression by monocytes in vitro occurs 24 to 48 hours after LPS

exposure (de Waal Malefyt et al. 1991), but IL-10 serum levels in vivo were already raised 3-6

hours after endotoxin challenge (Durez et al. 1993; van der Poll et al. 1994) indicating that other

factors or cells may contribute to IL-10 production in vivo. Therefore, it is possible that we

missed the peak IL-10 expression in our study since we did not collect any samples after 24

hours of LPS exposure.

IL-12 expression increases rapidly (within 3 hours) after LPS exposure (Karp et al. 1998;

Sutterwala et al. 1997; van der Poll et al. 1997; Wysocka et al. 1995). Once ET was induced IL-

12 expression was decreased (Karp et al. 1998; Wysocka et al. 1995). Our study confirmed these

results. IL-12 expression was strongly up-regulated after LPS exposure and then decreased

progressively. Low IL-12 increases the susceptibility to infection by intracellular bacteria

(Sutterwala et al. 1997) but overproduction of IL-12 can be detrimental and may lead to

exacerbated disease. Therefore, IL-12 expression needs to be tightly regulated in order to provide

a well-balanced Th1 and Th2 response.

Future studies should include in vitro experiments of ET in equine PBMCs with the

addition of IL-10 antibodies in order to evaluate its importance for the development of ET in

equine PBMCs. Addition of recombinant IL-10 in models of endotoxemia should also be

examined in order to assess the utility of IL-10 as a future therapeutic in equine endotoxemia.

TGF-β is another potent anti-inflammatory cytokine which should be evaluated in equine

endotoxemia and ET in order to characterize its importance for the development of ET. Ligation

of macrophage receptors has been evaluated in rodents and represents a possible therapeutic for

treatment of endotoxemia/induction of ET. The utility of this procedure should be assessed in

equine PBMCs.

67

Conclusion

An in vitro model for induction of ET in equine PBMCs was successfully developed. An

increased expression of IL-12 was associated with endotoxin exposure. IL-12 expression is

suppressed in ET in equine PBMCs. IL-10 expression was up-regulated after endotoxin exposure

and continued up-regulated expression of IL-10 was observed in endotoxin tolerant equine

PBMCs. Further studies are required to assess the importance of IL-10 for development of ET in

equine PBMCs.

68

_____________________________________________________________________________

a BD Vacutainer Lithium Heparin, BD Biosciences, Franklin Lakes, NJ

b RPMI 1640 medium, Hepes modification, Sigma-Aldrich, St. Louis, MO

c Lymphoprep™, Accurate Chemical & Scientific Corp., Westbury, NY

d 15ml conical, polypropylene tubes, BD Labware, Franklin Lakes, NJ

e Fetal Bovine Serum, Sigma-Aldrich, St. Louis, MO

f Penicillin-streptomycin solution, Sigma-Aldrich, St. Louis, MO

g L-glutamine, Sigma-Aldrich, St. Louis, MO

h Hemocytometer, Hausser Scientific, Horsham, PA

I Trypan blue, Sigma-Aldrich, St. Louis, MO

k Lipopolysacchararides from Escherichia coli O55:B5, Sigma-Aldrich, St. Louis, MO

l Equine TNF-α screening set, Thermo Scoentific, Rockford, IL

m Dulbecco’s PBS, HyClone®, HyClone Laboratories, Logan, Utah

n Tween®20, Acros Organics, Morris Plains, NJ

o BIO-RAD Model 550, Bio-Rad Laboratories, Hercules, CA

p SAS, SAS Institute, Cary, NC

q Heparin sodium, APP Pharmaceuticals, Schaumburg, IL

r Fenwal® transfer pack container, Baxter Healthcare Corporation, Deerfield, IL

s Protease inhibitor, Sigma-Aldrich, St. Louis, MO

t RNA isolation kit (RNeasy®), Qiagen Sciences, MD

u RNase-free DNase, Qiagen GmbH, Hilden, Germany

v Agarose BP160-100, Fisher Scientific, Fair Lawn, NJ

w High Capacity cDNA Reverse transcription kit, Applied Biosystems, Foster City, CA

x TaqMan® Gene Expression Master Mix, Applied Biosystems, Foster City, CA

y 7500 Real-Time PCR System, Applied Biosystems, Foster City, CA

z SAS PROC GLIMMIX, and JMP, SAS Institute Inc., Cary, NC

69

REFERENCES

Akira, S. and Takeda, K. (2004) Toll-like receptor signalling. Nat Rev Immunol 4, 499-511.

Allen, G.K., Campbell-Beggs, C., Robinson, J.A., Johnson, P.J. and Green, E.M. (1996)

Induction of early-phase endotoxin tolerance in horses. Equine Vet J 28, 269-274.

Assenmacher, M., Lohning, M., Scheffold, A., Richter, A., Miltenyi, S., Schmitz, J. and

Radbruch, A. (1998) Commitment of individual Th1-like lymphocytes to expression of

IFN-gamma versus IL-4 and IL-10: selective induction of IL-10 by sequential stimulation

of naive Th cells with IL-12 and IL-4. J Immunol 161, 2825-2832.

Barton, M.H. (2003) Endotoxemia. In: Current Therapy in Equine Medicine, Ed: N.E. Robinson,

Saunders, St. Louis. pp 104-111.

Barton, M.H., Bruce, E.H., Moore, J.N., Norton, N., Anders, B. and Morris, D.D. (1998a) Effect

of tumor necrosis factor antibody given to horses during early experimentally induced

endotoxemia. Am J Vet Res 59, 792-797.

Barton, M.H. and Collatos, C. (1999) Tumor necrosis factor and interleukin-6 activity and

endotoxin concentration in peritoneal fluid and blood of horses with acute abdominal

disease. J Vet Intern Med 13, 457-464.

Barton, M.H., Collatos, C. and Moore, J.N. (1996) Endotoxin induced expression of tumour

necrosis factor, tissue factor and plasminogen activator inhibitor activity by peritoneal

macrophages. Equine Vet J 28, 382-389.

Barton, M.H. and Moore, J.N. (1994) Pentoxifylline inhibits mediator synthesis in an equine in

vitro whole blood model of endotoxemia. Circ Shock 44, 216-220.

Barton, M.H., Moore, J.N. and Norton, N. (1997) Effects of pentoxifylline infusion on response

of horses to in vivo challenge exposure with endotoxin. Am J Vet Res 58, 1300-1307.

Barton, M.H., Morris, D.D., Norton, N. and Prasse, K.W. (1998b) Hemostatic and fibrinolytic

indices in neonatal foals with presumed septicemia. J Vet Intern Med 12, 26-35.

Barton, M.H., Parviainen, A. and Norton, N. (2004) Polymyxin B protects horses against

induced endotoxaemia in vivo. Equine Vet J 36, 397-401.

Beeson, P.B. (1947) Tolerance to Bacterial Pyrogens : I. Factors Influencing Its Development. J

Exp Med 86, 29-38.

70

Berg, D.J., Kuhn, R., Rajewsky, K., Muller, W., Menon, S., Davidson, N., Grunig, G. and

Rennick, D. (1995) Interleukin-10 is a central regulator of the response to LPS in murine

models of endotoxic shock and the Shwartzman reaction but not endotoxin tolerance. J

Clin Invest 96, 2339-2347.

Beutler, B., Krochin, N., Milsark, I.W., Luedke, C. and Cerami, A. (1986) Control of cachectin

(tumor necrosis factor) synthesis: mechanisms of endotoxin resistance. Science 232, 977-

980.

Blackwell, T.S., Blackwell, T.R. and Christman, J.W. (1997) Induction of endotoxin tolerance

depletes nuclear factor-kappaB and suppresses its activation in rat alveolar macrophages.

J Leukoc Biol 62, 885-891.

Burrows, G.E. (1979) Equine Escherichia coli endotoxemia: comparison of intravenous and

intraperitoneal endotoxin administration. Am J Vet Res 40, 991-998.

Cagiola, M., Giulio, S., Miriam, M., Katia, F., Paola, P., Macri, A. and Pasquali, P. (2006) In

vitro down regulation of proinflammatory cytokines induced by LPS tolerance in pig

CD14+ cells. Vet Immunol Immunopathol 112, 316-320.

Calandra, T., Gerain, J., Heumann, D., Baumgartner, J.D. and Glauser, M.P. (1991) High

circulating levels of interleukin-6 in patients with septic shock: evolution during sepsis,

prognostic value, and interplay with other cytokines. The Swiss-Dutch J5

Immunoglobulin Study Group. Am J Med 91, 23-29.

Calvano, S.E., Thompson, W.A., Marra, M.N., Coyle, S.M., de Riesthal, H.F., Trousdale, R.K.,

Barie, P.S., Scott, R.W., Moldawer, L.L. and Lowry, S.F. (1994) Changes in

polymorphonuclear leukocyte surface and plasma bactericidal/permeability-increasing

protein and plasma lipopolysaccharide binding protein during endotoxemia or sepsis.

Arch Surg 129, 220-226.

Carson, S.D., Haire, W.D., Broze, G.J., Jr., Novotny, W.F., Pirrucello, S.J. and Duggan, M.J.

(1991) Lipoprotein associated coagulation inhibitor, factor VII, antithrombin III, and

monocyte tissue factor following surgery. Thromb Haemost 66, 534-539.

Cavaillon, J.M. and Adib-Conquy, M. (2006) Bench-to-bedside review: endotoxin tolerance as a

model of leukocyte reprogramming in sepsis. Crit Care 10, 233.

Chaplin, D.D. (2010) Overview of the immune response. J Allergy Clin Immunol 125, S3-23.

Coeshott, C., Ohnemus, C., Pilyavskaya, A., Ross, S., Wieczorek, M., Kroona, H., Leimer, A.H.

and Cheronis, J. (1999) Converting enzyme-independent release of tumor necrosis factor

alpha and IL-1beta from a stimulated human monocytic cell line in the presence of

activated neutrophils or purified proteinase 3. Proc Natl Acad Sci U S A 96, 6261-6266.

71

Creasey, A.A., Chang, A.C., Feigen, L., Wun, T.C., Taylor, F.B., Jr. and Hinshaw, L.B. (1993)

Tissue factor pathway inhibitor reduces mortality from Escherichia coli septic shock. J

Clin Invest 91, 2850-2860.

de Waal Malefyt, R., Abrams, J.S., Bennett, B., Figdor, C.G. and de Vries, J.E. (1991)

Interleukin 10 (IL10) inhibits cytokine synthesis by human monocytes: an autoregulatory

role of IL-10 produced by monocytes. J. Exp. Med. 174, 1209-1220.

de Waal Malefyt, R. and Moore, K.W. (1998) Interleukin-10. In: The Cytokine Handbook, Ed:

W.A. Thomson, Academic Press Limited, San Diego. pp 333-364.

Derynck, R., Jarrett, J.A., Chen, E.Y., Eaton, D.H., Bell, J.R., Assoian, R.K., Roberts, A.B.,

Sporn, M.B. and Goeddel, D.V. (1985) Human transforming growth factor-beta

complementary DNA sequence and expression in normal and transformed cells. Nature

316, 701-705.

Dinarello, C.A. (2003) Interleukin-1 Family. In: The Cytokine Handbook, Eds: W.A. Thomson

and M.T. Lotze, Elsevier, London. pp 643-668.

Ding, Y., Fu, S., Zamarin, D. and Bromberg, J. (2003) Interleukin-10. In: The Cytokine

Handbook, Eds: A.W. Thomson and M.T. Lotze, Elsevier, London. pp 603-625.

Durando, M.M., Meier, K.E. and Cook, J.A. (1998) Endotoxin activation of mitogen-activated

protein kinase in THP-1 cells; diminished activation following endotoxin desensitization.

J Leukoc Biol 64, 259-264.

Durez, P., Abramowicz, D., Gerard, C., Van Mechelen, M., Amraoui, Z., Dubois, C., Leo, O.,

Velu, T. and Goldman, M. (1993) In vivo induction of interleukin 10 by anti-CD3

monoclonal antibody or bacterial lipopolysaccharide: differential modulation by

cyclosporin A. J Exp Med 177, 551-555.

Ewert, K.M., Fessler, J.F., Templeton, C.B., Bottoms, G.D., Latshaw, H.S. and Johnson, M.A.

(1985) Endotoxin-induced hematologic and blood chemical changes in ponies: effects of

flunixin meglumine, dexamethasone, and prednisolone. Am J Vet Res 46, 24-30.

Fan, H. and Cook, J.A. (2004) Molecular mechanisms of endotoxin tolerance. J Endotoxin Res

10, 71-84.

Fantuzzi, G., Demitri, M.T. and Ghezzi, P. (1994) Differential effect of glucocorticoids on

tumour necrosis factor production in mice: up-regulation by early pretreatment with

dexamethasone. Clin Exp Immunol 96, 166-169.

Fantuzzi, G., Di Santo, E., Sacco, S., Benigni, F. and Ghezzi, P. (1995) Role of the

hypothalamus-pituitary-adrenal axis in the regulation of TNF production in mice. Effect

of stress and inhibition of endogenous glucocorticoids. J Immunol 155, 3552-3555.

72

Figueiredo, M.D., Moore, J.N., Vandenplas, M.L., Sun, W.C. and Murray, T.F. (2008) Effects of

the second-generation synthetic lipid A analogue E5564 on responses to endotoxin in

[corrected] equine whole blood and monocytes. Am J Vet Res 69, 796-803.

Fiorentino, D.F., Zlotnik, A., Mosmann, T.R., Howard, M. and O'Garra, A. (1991) IL-10 inhibits

cytokine production by activated macrophages. J Immunol 147, 3815-3822.

Flohe, S., Dominguez Fernandez, E., Ackermann, M., Hirsch, T., Borgermann, J. and Schade,

F.U. (1999) Endotoxin tolerance in rats: expression of TNF-alpha, IL-6, IL-10, VCAM-1

AND HSP 70 in lung and liver during endotoxin shock. Cytokine 11, 796-804.

Fong, Y., Moldawer, L.L., Marano, M., Wei, H., Tatter, S.B., Clarick, R.H., Santhanam, U.,

Sherris, D., May, L.T., Sehgal, P.B. and et al. (1989) Endotoxemia elicits increased

circulating beta 2-IFN/IL-6 in man. J Immunol 142, 2321-2324.

Franzoso, G., Bours, V., Park, S., Tomita-Yamaguchi, M., Kelly, K. and Siebenlist, U. (1992)

The candidate oncoprotein Bcl-3 is an antagonist of p50/NF-kappa B-mediated

inhibition. Nature 359, 339-342.

Fujihara, M., Muroi, M., Tanamoto, K., Suzuki, T., Azuma, H. and Ikeda, H. (2003) Molecular

mechanisms of macrophage activation and deactivation by lipopolysaccharide: roles of

the receptor complex. Pharmacol Ther 100, 171-194.

Garton, N.J., Gilleron, M., Brando, T., Dan, H.H., Giguere, S., Puzo, G., Prescott, J.F. and

Sutcliffe, I.C. (2002) A novel lipoarabinomannan from the equine pathogen Rhodococcus

equi. Structure and effect on macrophage cytokine production. J Biol Chem 277, 31722-

31733.

Gerard, C., Bruyns, C., Marchant, A., Abramowicz, D., Vandenabeele, P., Delvaux, A., Fiers,

W., Goldman, M. and Velu, T. (1993) Interleukin 10 reduces the release of tumor

necrosis factor and prevents lethality in experimental endotoxemia. J Exp Med 177, 547-

550.

Gerber, J.S. and Mosser, D.M. (2001) Reversing lipopolysaccharide toxicity by ligating the

macrophage Fc gamma receptors. J Immunol 166, 6861-6868.

Goldfarb, R.D., Parker, T.S., Levine, D.M., Glock, D., Akhter, I., Alkhudari, A., McCarthy, R.J.,

David, E.M., Gordon, B.R., Saal, S.D., Rubin, A.L., Trenholme, G.M. and Parrillo, J.E.

(2003) Protein-free phospholipid emulsion treatment improved cardiopulmonary function

and survival in porcine sepsis. Am J Physiol Regul Integr Comp Physiol 284, R550-557.

Gonzalez, J.C., Johnson, D.C., Morrison, D.C., Freudenberg, M.A., Galanos, C. and Silverstein,

R. (1993) Endogenous and exogenous glucocorticoids have different roles in modulating

endotoxin lethality in D-galactosamine-sensitized mice. Infect Immun 61, 970-974.

73

Gordon, B.R., Parker, T.S., Levine, D.M., Feuerbach, F., Saal, S.D., Sloan, B.J., Chu, C.,

Stenzel, K.H., Parrillo, J.E. and Rubin, A.L. (2005) Neutralization of endotoxin by a

phospholipid emulsion in healthy volunteers. J Infect Dis 191, 1515-1522.

Gordon, B.R., Parker, T.S., Levine, D.M., Saal, S.D., Wang, J.C., Sloan, B.J., Barie, P.S. and

Rubin, A.L. (1996) Low lipid concentrations in critical illness: implications for

preventing and treating endotoxemia. Crit Care Med 24, 584-589.

Greisman, S.E., Young, E.J. and Carozza, F.A., Jr. (1969) Mechanisms of endotoxin tolerance.

V. Specificity of the early and late phases of pyrogenic tolerance. J Immunol 103, 1223-

1236.

Grell, M., Krammer, P.H. and Scheurich, P. (1994) Segregation of APO-1/Fas antigen- and

tumor necrosis factor receptor-mediated apoptosis. Eur J Immunol 24, 2563-2566.

Grohmann, U., Belladonna, M.L., Bianchi, R., Orabona, C., Ayroldi, E., Fioretti, M.C. and

Puccetti, P. (1998) IL-12 acts directly on DC to promote nuclear localization of NF-

kappaB and primes DC for IL-12 production. Immunity 9, 315-323.

Gruber, A., Mancek, M., Wagner, H., Kirschning, C.J. and Jerala, R. (2004) Structural model of

MD-2 and functional role of its basic amino acid clusters involved in cellular

lipopolysaccharide recognition. J Biol Chem 279, 28475-28482.

Hack, C.E., De Groot, E.R., Felt-Bersma, R.J., Nuijens, J.H., Strack Van Schijndel, R.J.,

Eerenberg-Belmer, A.J., Thijs, L.G. and Aarden, L.A. (1989) Increased plasma levels of

interleukin-6 in sepsis. Blood 74, 1704-1710.

Hawkins, D.L., MacKay, R.J., MacKay, S.L. and Moldawer, L.L. (1998) Human interleukin 10

suppresses production of inflammatory mediators by LPS-stimulated equine peritoneal

macrophages. Vet Immunol Immunopathol 66, 1-10.

Haziot, A., Ferrero, E., Kontgen, F., Hijiya, N., Yamamoto, S., Silver, J., Stewart, C.L. and

Goyert, S.M. (1996) Resistance to endotoxin shock and reduced dissemination of gram-

negative bacteria in CD14-deficient mice. Immunity 4, 407-414.

Haziot, A., Rong, G.W., Bazil, V., Silver, J. and Goyert, S.M. (1994) Recombinant soluble

CD14 inhibits LPS-induced tumor necrosis factor-alpha production by cells in whole

blood. J Immunol 152, 5868-5876.

Heagy, W., Hansen, C., Nieman, K. and West, M.A. (2003) Evidence for a CD14- and serum-

independent pathway in the induction of endotoxin-tolerance in human monocytes and

THP-1 monocytic cells. Shock 19, 321-327.

Heinzel, F.P., Rerko, R.M., Ling, P., Hakimi, J. and Schoenhaut, D.S. (1994) Interleukin 12 is

produced in vivo during endotoxemia and stimulates synthesis of gamma interferon.

Infect Immun 62, 4244-4249.

74

Hickey, M.J., Issekutz, A.C., Reinhardt, P.H., Fedorak, R.N. and Kubes, P. (1998) Endogenous

interleukin-10 regulates hemodynamic parameters, leukocyte-endothelial cell

interactions, and microvascular permeability during endotoxemia. Circ Res 83, 1124-

1131.

Hirano, T. (1992) The biology of interleukin-6. Chem Immunol 51, 153-180.

Hirschfeld, M., Ma, Y., Weis, J.H., Vogel, S.N. and Weis, J.J. (2000) Cutting edge:

repurification of lipopolysaccharide eliminates signaling through both human and murine

toll-like receptor 2. J Immunol 165, 618-622.

Howard, M., Muchamuel, T., Andrade, S. and Menon, S. (1993) Interleukin 10 protects mice

from lethal endotoxemia. J Exp Med 177, 1205-1208.

Hunt, J.M., Edwards, G.B. and Clarke, K.W. (1986) Incidence, diagnosis and treatment of

postoperative complications in colic cases. Equine Vet J 18, 264-270.

Jack, R.S., Fan, X., Bernheiden, M., Rune, G., Ehlers, M., Weber, A., Kirsch, G., Mentel, R.,

Furll, B., Freudenberg, M., Schmitz, G., Stelter, F. and Schutt, C. (1997)

Lipopolysaccharide-binding protein is required to combat a murine gram-negative

bacterial infection. Nature 389, 742-745.

Jiang, Q., Akashi, S., Miyake, K. and Petty, H.R. (2000) Lipopolysaccharide induces physical

proximity between CD14 and toll-like receptor 4 (TLR4) prior to nuclear translocation of

NF-kappa B. J Immunol 165, 3541-3544.

Kalinski, P., Storkus, W.J., Thomson, A.W. and Lotze, M.T. (2003) Interleukin-12 Family (IL-

12, 23, 12RA and 27). In: The Cytokine Handbook, Eds: A.W. Thomson and M.T. Lotze,

Elsevier, London. pp 383-408.

Karp, C.L., Wysocka, M., Ma, X., Marovich, M., Factor, R.E., Nutman, T., Armant, M., Wahl,

L., Cuomo, P. and Trinchieri, G. (1998) Potent suppression of IL-12 production from

monocytes and dendritic cells during endotoxin tolerance. Eur J Immunol 28, 3128-3136.

Kastenbauer, S. and Ziegler-Heitbrock, H.W. (1999) NF-kappaB1 (p50) is upregulated in

lipopolysaccharide tolerance and can block tumor necrosis factor gene expression. Infect

Immun 67, 1553-1559.

Kiku, Y., Kusano, K., Miyake, H., Fukuda, S., Takahashi, J., Inotsume, M., Hirano, S.,

Yoshihara, T., Toribio, R.E., Okada, H. and Yoshino, T.O. (2003) Flow cytometric

analysis of peripheral blood mononuclear cells induced by experimental endotoxemia in

horse. J Vet Med Sci 65, 857-863.

75

Kirschning, C., Unbehaun, A., Lamping, N., Pfeil, D., Herrmann, F. and Schumann, R.R.

(1997a) Control of transcriptional activation of the lipopolysaccharide binding protein

(LBP) gene by proinflammatory cytokines. Cytokines Cell Mol Ther 3, 59-62.

Kirschning, C.J., Au-Young, J., Lamping, N., Reuter, D., Pfeil, D., Seilhamer, J.J. and

Schumann, R.R. (1997b) Similar organization of the lipopolysaccharide-binding protein

(LBP) and phospholipid transfer protein (PLTP) genes suggests a common gene family of

lipid-binding proteins. Genomics 46, 416-425.

Kitchens, R.L., Thompson, P.A., Viriyakosol, S., O'Keefe, G.E. and Munford, R.S. (2001)

Plasma CD14 decreases monocyte responses to LPS by transferring cell-bound LPS to

plasma lipoproteins. J Clin Invest 108, 485-493.

Kohler, N.G. and Joly, A. (1997) The involvement of an LPS inducible I kappa B kinase in

endotoxin tolerance. Biochem Biophys Res Commun 232, 602-607.

Kriegler, M., Perez, C., DeFay, K., Albert, I. and Lu, S.D. (1988) A novel form of

TNF/cachectin is a cell surface cytotoxic transmembrane protein: ramifications for the

complex physiology of TNF. Cell 53, 45-53.

Krishnagopalan, S., Kumar, A. and Parrillo, J.E. (2002) Myocardial dysfunction in the patient

with sepsis. Curr Opin Crit Care 8, 376-388.

Labeta, M.O., Durieux, J.J., Spagnoli, G., Fernandez, N., Wijdenes, J. and Herrmann, R. (1993)

CD14 and tolerance to lipopolysaccharide: biochemical and functional analysis.

Immunology 80, 415-423.

Latz, E., Visintin, A., Lien, E., Fitzgerald, K.A., Monks, B.G., Kurt-Jones, E.A., Golenbock,

D.T. and Espevik, T. (2002) Lipopolysaccharide rapidly traffics to and from the Golgi

apparatus with the toll-like receptor 4-MD-2-CD14 complex in a process that is distinct

from the initiation of signal transduction. J Biol Chem 277, 47834-47843.

Lavoie, J.P., Madigan, J.E., Cullor, J.S. and Powell, W.E. (1990) Haemodynamic, pathological,

haematological and behavioural changes during endotoxin infusion in equine neonates.

Equine Vet J 22, 23-29.

Leon, P., Redmond, H.P., Shou, J. and Daly, J.M. (1992) Interleukin 1 and its relationship to

endotoxin tolerance. Arch Surg 127, 146-151.

Leturcq, D.J., Moriarty, A.M., Talbott, G., Winn, R.K., Martin, T.R. and Ulevitch, R.J. (1996)

Antibodies against CD14 protect primates from endotoxin-induced shock. J Clin Invest

98, 1533-1538.

Li, L., Cousart, S., Hu, J. and McCall, C.E. (2000) Characterization of interleukin-1 receptor-

associated kinase in normal and endotoxin-tolerant cells. J Biol Chem 275, 23340-23345.

76

MacKay, R.J., Merritt, A.M., Zertuche, J.M., Whittington, M. and Skelley, L.A. (1991) Tumor

necrosis factor activity in the circulation of horses given endotoxin. Am J Vet Res 52,

533-538.

MacKay, R.J. and Socher, S.H. (1992) Anti-equine tumor necrosis factor (TNF) activity of

antisera raised against human TNF-alpha and peptide segments of human TNF-alpha. Am

J Vet Res 53, 921-924.

Marchant, A. (1994) Interleukin-10 production during septicaemia. Lancet 343, 707-708.

Marchant, A., Amraoui, Z., Gueydan, C., Bruyns, C., Le Moine, O., Vandenabeele, P., Fiers, W.,

Buurman, W.A. and Goldman, M. (1996) Methylprednisolone differentially regulates IL-

10 and tumour necrosis factor (TNF) production during murine endotoxaemia. Clin Exp

Immunol 106, 91-96.

Marchant, A., Bruyns, C., Vandenabeele, P., Ducarme, M., Gerard, C., Delvaux, A., De Groote,

D., Abramowicz, D., Velu, T. and Goldman, M. (1994) Interleukin-10 controls

interferon-gamma and tumor necrosis factor production during experimental

endotoxemia. Eur J Immunol 24, 1167-1171.

Marik, P.E. and Raghavan, M. (2004) Stress-hyperglycemia, insulin and immunomodulation in

sepsis. Intensive Care Med 30, 748-756.

Mathison, J., Wolfson, E., Steinemann, S., Tobias, P. and Ulevitch, R. (1993)

Lipopolysaccharide (LPS) recognition in macrophages. Participation of LPS-binding

protein and CD14 in LPS-induced adaptation in rabbit peritoneal exudate macrophages. J

Clin Invest 92, 2053-2059.

Mathison, J.C., Virca, G.D., Wolfson, E., Tobias, P.S., Glaser, K. and Ulevitch, R.J. (1990)

Adaptation to bacterial lipopolysaccharide controls lipopolysaccharide-induced tumor

necrosis factor production in rabbit macrophages. J Clin Invest 85, 1108-1118.

McCall, C.E., Grosso-Wilmoth, L.M., LaRue, K., Guzman, R.N. and Cousart, S.L. (1993)

Tolerance to endotoxin-induced expression of the interleukin-1 beta gene in blood

neutrophils of humans with the sepsis syndrome. J Clin Invest 91, 853-861.

McKenzie, H.C. and Furr, M.O. (2001) Equine Neonatal Sepsis: The Pathophysiology of Severe

Inflammation and Infection. Compendium Continuing Education for Veterinarians:

Equine Edition 23, 661-672.

Medvedev, A.E., Henneke, P., Schromm, A., Lien, E., Ingalls, R., Fenton, M.J., Golenbock, D.T.

and Vogel, S.N. (2001) Induction of tolerance to lipopolysaccharide and mycobacterial

components in Chinese hamster ovary/CD14 cells is not affected by overexpression of

Toll-like receptors 2 or 4. J Immunol 167, 2257-2267.

77

Medvedev, A.E., Kopydlowski, K.M. and Vogel, S.N. (2000) Inhibition of lipopolysaccharide-

induced signal transduction in endotoxin-tolerized mouse macrophages: dysregulation of

cytokine, chemokine, and toll-like receptor 2 and 4 gene expression. J Immunol 164,

5564-5574.

Medzhitov, R. and Janeway, C., Jr. (2000) Innate immunity. N Engl J Med 343, 338-344.

Moore, J.N. (1998) An update on endotoxaemia Part I: mechanisms and pathways. . Equine Vet

Educ 10, 300-306.

Moore, J.N. and Barton, M.H. (2003) Treatment of endotoxemia. Vet Clin North Am Equine

Pract 19, 681-695.

Moore, J.N., Garner, H.E., Shapland, J.E. and Hatfield, D.G. (1981) Prevention of endotoxin-

induced arterial hypoxaemia and lactic acidosis with flunixin meglumine in the conscious

pony. Equine Vet J 13, 95-98.

Moore, J.N. and Morris, D.D. (1992) Endotoxemia and septicemia in horses: experimental and

clinical correlates. J Am Vet Med Assoc 200, 1903-1914.

Moore, J.N., Norton, N., Barton, M.H., Hurley, D.J., Reber, A.J., Donovan, D.C., Vandenplas,

M.L., Parker, T.S. and Levine, D.M. (2007) Rapid infusion of a phospholipid emulsion

attenuates the effects of endotoxaemia in horses. Equine Vet J 39, 243-248.

Morresey, P.R. and Mackay, R.J. (2006) Endotoxin-neutralizing activity of polymyxin B in

blood after IV administration in horses. Am J Vet Res 67, 642-647.

Morris, D.D., Moore, J.N., Crowe, N. and Moldawer, L.L. (1992) Effect of experimentally

induced endotoxemia on serum interleukin-6 activity in horses. Am J Vet Res 53, 753-

756.

Mulholland, J.H., Wolff, S.M., Jackson, A.L. and Landy, M. (1965) Quantitative studies of

febrile tolerance and levels of specific antibody evoked by bacterial endotoxin. J Clin

Invest 44, 920-928.

Munford, R.S., Hall, C.L. and Dietschy, J.M. (1981) Binding of Salmonella typhimurium

lipopolysaccharides to rat high-density lipoproteins. Infect Immun 34, 835-843.

Nagai, Y., Akashi, S., Nagafuku, M., Ogata, M., Iwakura, Y., Akira, S., Kitamura, T., Kosugi,

A., Kimoto, M. and Miyake, K. (2002) Essential role of MD-2 in LPS responsiveness and

TLR4 distribution. Nat Immunol 3, 667-672.

Neuder, L.E., Keener, J.M., Eckert, R.E., Trujillo, J.C. and Jones, S.L. (2009) Role of p38

MAPK in LPS induced pro-inflammatory cytokine and chemokine gene expression in

equine leukocytes. Vet Immunol Immunopathol 129, 192-199.

78

Neva, F.A. and Morgan, H.R. (1950) Tolerance to the actions of enteric bacilli in patients

covalescent from typhoid and paratyphoid fevers. J Lab Clin Med 35, 911.

Nieto, J.E., MacDonald, M.H., Braim, A.E. and Aleman, M. (2009) Effect of lipopolysaccharide

infusion on gene expression of inflammatory cytokines in normal horses in vivo. Equine

Vet J 41, 717-719.

Nomura, F., Akashi, S., Sakao, Y., Sato, S., Kawai, T., Matsumoto, M., Nakanishi, K., Kimoto,

M., Miyake, K., Takeda, K. and Akira, S. (2000) Cutting edge: endotoxin tolerance in

mouse peritoneal macrophages correlates with down-regulation of surface toll-like

receptor 4 expression. J Immunol 164, 3476-3479.

O'Garra, A. and Arai, N. (2000) The molecular basis of T helper 1 and T helper 2 cell

differentiation. Trends Cell Biol 10, 542-550.

Park, C.T., Creasey, A.A. and Wright, S.D. (1997) Tissue factor pathway inhibitor blocks

cellular effects of endotoxin by binding to endotoxin and interfering with transfer to

CD14. Blood 89, 4268-4274.

Parviainen, A.K., Barton, M.H. and Norton, N.N. (2001) Evaluation of polymyxin B in an ex

vivo model of endotoxemia in horses. Am J Vet Res 62, 72-76.

Peck, O.M., Williams, D.L., Breuel, K.F., Kalbfleisch, J.H., Fan, H., Tempel, G.E., Teti, G. and

Cook, J.A. (2004) Differential regulation of cytokine and chemokine production in

lipopolysaccharide-induced tolerance and priming. Cytokine 26, 202-208.

Randow, F., Syrbe, U., Meisel, C., Krausch, D., Zuckermann, H., Platzer, C. and Volk, H.D.

(1995) Mechanism of endotoxin desensitization: involvement of interleukin 10 and

transforming growth factor beta. J Exp Med 181, 1887-1892.

Rayhane, N., Fitting, C. and Cavaillon, J.M. (1999) Dissociation of IFN-gamma from IL-12 and

IL-18 production in endotoxin tolerance J Endotoxin Res 5, 319-324.

Robinson, J.A., Allen, G.K., Green, E.M., Garner, H.E., Loch, W.E. and Walsh, D.M. (1993)

Serum interleukin-6 concentrations in endotoxin-infused neonatal foals. Am J Vet Res 54,

1411-1414.

Rock, F.L., Hardiman, G., Timans, J.C., Kastelein, R.A. and Bazan, J.F. (1998) A family of

human receptors structurally related to Drosophila Toll. Proc Natl Acad Sci U S A 95,

588-593.

Ropert, C., Almeida, I.C., Closel, M., Travassos, L.R., Ferguson, M.A., Cohen, P. and

Gazzinelli, R.T. (2001) Requirement of mitogen-activated protein kinases and I kappa B

phosphorylation for induction of proinflammatory cytokines synthesis by macrophages

indicates functional similarity of receptors triggered by glycosylphosphatidylinositol

79

anchors from parasitic protozoa and bacterial lipopolysaccharide. J Immunol 166, 3423-

3431.

Roy, M.F. (2004) Sepsis in adults and foals. Vet Clin North Am Equine Pract 20, 41-61.

Rudbach, J.A. and Johnson, A.G. (1964) Restoration of Endotoxin Activity Following Alteration

by Plasma. Nature 202, 811-812.

Russell, J.A. (2006) Management of sepsis. N Engl J Med 355, 1699-1713.

Ryseck, R.P., Bull, P., Takamiya, M., Bours, V., Siebenlist, U., Dobrzanski, P. and Bravo, R.

(1992) RelB, a new Rel family transcription activator that can interact with p50-NF-

kappa B. Mol Cell Biol 12, 674-684.

Sanchez-Cantu, L., Rode, H.N. and Christou, N.V. (1989) Endotoxin tolerance is associated with

reduced secretion of tumor necrosis factor. Arch Surg 124, 1432-1435; discussion 1435-

1436.

Sandset, P.M., Roise, O., Aasen, A.O. and Abildgaard, U. (1989) Extrinsic pathway inhibitor in

postoperative/posttraumatic septicemia: increased levels in fatal cases. Haemostasis 19,

189-195.

Sato, S., Nomura, F., Kawai, T., Takeuchi, O., Muhlradt, P.F., Takeda, K. and Akira, S. (2000)

Synergy and cross-tolerance between toll-like receptor (TLR) 2- and TLR4-mediated

signaling pathways. J Immunol 165, 7096-7101.

Schimke, J., Mathison, J., Morgiewicz, J. and Ulevitch, R.J. (1998) Anti-CD14 mAb treatment

provides therapeutic benefit after in vivo exposure to endotoxin. Proc Natl Acad Sci U S

A 95, 13875-13880.

Schmitz, M.L. and Baeuerle, P.A. (1991) The p65 subunit is responsible for the strong

transcription activating potential of NF-kappa B. EMBO J 10, 3805-3817.

Schultz, H. and Weiss, J.P. (2007) The bactericidal/permeability-increasing protein (BPI) in

infection and inflammatory disease. Clin Chim Acta 384, 12-23.

Schumann, R.R., Leong, S.R., Flaggs, G.W., Gray, P.W., Wright, S.D., Mathison, J.C., Tobias,

P.S. and Ulevitch, R.J. (1990) Structure and function of lipopolysaccharide binding

protein. Science 249, 1429-1431.

Schutt, C. (1999) CD14. Int J Biochem Cell Biol 31, 545-549.

Semrad, S.D., Hardee, G.E., Hardee, M.M. and Moore, J.N. (1987) Low dose flunixin

meglumine: effects on eicosanoid production and clinical signs induced by experimental

endotoxaemia in horses. Equine Vet J 19, 201-206.

80

Semrad, S.D. and Moore, J.N. (1987) Effects of multiple low doses of flunixin meglumine on

repeated endotoxin challenge in the horse. Prostaglandins Leukot Med 27, 169-181.

Shalaby, M.R., Waage, A., Aarden, L. and Espevik, T. (1989) Endotoxin, tumor necrosis factor-

alpha and interleukin 1 induce interleukin 6 production in vivo. Clin Immunol

Immunopathol 53, 488-498.

Shames, B.D., Meldrum, D.R., Selzman, C.H., Pulido, E.J., Cain, B.S., Banerjee, A., Harken,

A.H. and Meng, X. (1998) Increased levels of myocardial IkappaB-alpha protein promote

tolerance to endotoxin. Am J Physiol 275, H1084-1091.

Shnyra, A., Brewington, R., Alipio, A., Amura, C. and Morrison, D.C. (1998) Reprogramming

of lipopolysaccharide-primed macrophages is controlled by a counterbalanced production

of IL-10 and IL-12. J Immunol 160, 3729-3736.

Skok, J., Poudrier, J. and Gray, D. (1999) Dendritic cell-derived IL-12 promotes B cell induction

of Th2 differentiation: a feedback regulation of Th1 development. J Immunol 163, 4284-

4291.

Standiford, T.J., Strieter, R.M., Lukacs, N.W. and Kunkel, S.L. (1995) Neutralization of IL-10

increases lethality in endotoxemia. Cooperative effects of macrophage inflammatory

protein-2 and tumor necrosis factor. J Immunol 155, 2222-2229.

Starnes, H.F., Jr., Pearce, M.K., Tewari, A., Yim, J.H., Zou, J.C. and Abrams, J.S. (1990) Anti-

IL-6 monoclonal antibodies protect against lethal Escherichia coli infection and lethal

tumor necrosis factor-alpha challenge in mice. J Immunol 145, 4185-4191.

Steverink, P.J., Sturk, A., Rutten, V.P., Wagenaar-Hilbers, J.P., Klein, W.R., van der Velden,

M.A. and Nemeth, F. (1995) Endotoxin, interleukin-6 and tumor necrosis factor

concentrations in equine acute abdominal disease: relation to clinical outcome. Journal of

Endotoxin Research 2, 289-299.

Stobie, L., Gurunathan, S., Prussin, C., Sacks, D.L., Glaichenhaus, N., Wu, C.Y. and Seder, R.A.

(2000) The role of antigen and IL-12 in sustaining Th1 memory cells in vivo: IL-12 is

required to maintain memory/effector Th1 cells sufficient to mediate protection to an

infectious parasite challenge. Proc Natl Acad Sci U S A 97, 8427-8432.

Sun, W.C., Moore, J.N., Hurley, D.J., Vandenplas, M.L., Fortes, B., Thompson, R. and Linden,

J. (2010) Differential modulation of lipopolysaccharide-induced expression of

inflammatory genes in equine monocytes through activation of adenosine A2A receptors.

Vet Immunol Immunopathol 134, 169-177.

Sun, W.C., Moore, J.N., Hurley, D.J., Vandenplas, M.L., Linden, J., Cao, Z. and Murray, T.F.

(2008) Adenosine A2A receptor agonists inhibit lipopolysaccharide-induced production

of tumor necrosis factor-alpha by equine monocytes. Vet Immunol Immunopathol 121,

91-100.

81

Sutterwala, F.S., Noel, G.J., Clynes, R. and Mosser, D.M. (1997) Selective suppression of

interleukin-12 induction after macrophage receptor ligation. J Exp Med 185, 1977-1985.

Sykes, B.W., Furr, M. and Giguere, S. (2005) In vivo pretreatment with PGG-glucan fails to alter

cytokine mRNA expression of equine peripheral blood mononuclear cells exposed to

endotoxin ex vivo. Vet Ther 6, 67-76.

Sykes, B.W. and Furr, M.O. (2005) Equine endotoxaemia--a state-of-the-art review of therapy.

Aust Vet J 83, 45-50.

Takahashi, H., Sato, N. and Shibata, A. (1995) Plasma tissue factor pathway inhibitor in

disseminated intravascular coagulation: comparison of its behavior with plasma tissue

factor. Thromb Res 80, 339-348.

Takeuchi, O., Hoshino, K., Kawai, T., Sanjo, H., Takada, H., Ogawa, T., Takeda, K. and Akira,

S. (1999) Differential roles of TLR2 and TLR4 in recognition of gram-negative and

gram-positive bacterial cell wall components. Immunity 11, 443-451.

Templeton, C.B., Bottoms, G.D., Fessler, J.F., Ewert, K.M., Roesel, O.F., Johnson, M.A. and

Latshaw, H.S. (1987) Endotoxin-induced hemodynamic and prostaglandin changes in

ponies: effects of flunixin meglumine, dexamethasone, and prednisolone. Circ Shock 23,

231-240.

Thoefner, M.B., Ersboll, A.K., Jensen, A.L. and Hesselholt, M. (2001) Factor analysis of the

interrelationships between clinical variables in horses with colic. Prev Vet Med 48, 201-

214.

Tinker, M.K., White, N.A., Lessard, P., Thatcher, C.D., Pelzer, K.D., Davis, B. and Carmel,

D.K. (1997) Prospective study of equine colic incidence and mortality. Equine Vet J 29,

448-453.

Triantafilou, K., Triantafilou, M. and Dedrick, R.L. (2001) Interactions of bacterial

lipopolysaccharide and peptidoglycan with a 70 kDa and an 80 kDa protein on the cell

surface of CD14+ and CD14- cells. Hum Immunol 62, 50-63.

Ulevitch, R.J., Johnston, A.R. and Weinstein, D.B. (1979) New function for high density

lipoproteins. Their participation in intravascular reactions of bacterial

lipopolysaccharides. J Clin Invest 64, 1516-1524.

van den Hoven, R., Duvigneau, J.C., Hartl, R.T. and Gemeiner, M. (2006) Clenbuterol affects

the expression of messenger RNA for interleukin 10 in peripheral leukocytes from horses

challenged intrabronchially with lipopolysaccharides. Vet Res Commun 30, 921-928.

82

van der Poll, T., Jansen, J., Levi, M., ten Cate, H., ten Cate, J.W. and van Deventer, S.J.H.

(1994) Regulation of Interleukin 10 Release by Tumor Necrosis Factor in Humans and

Chimpanzees. J. Exp. Med. 180, 1985-1988.

van der Poll, T., Jansen, P.M., Montegut, W.J., Braxton, C.C., Calvano, S.E., Stackpole, S.A.,

Smith, S.R., Swanson, S.W., Hack, C.E., Lowry, S.F. and Moldawer, L.L. (1997) Effects

of IL-10 on systemic inflammatory responses during sublethal primate endotoxemia. J

Immunol 158, 1971-1975.

Van Snick, J. (1990) Interleukin-6: an overview. Annu Rev Immunol 8, 253-278.

Vandenplas, M.L., Moore, J.N., Barton, M.H., Roussel, A.J. and Cohen, N.D. (2005)

Concentrations of serum amyloid A and lipopolysaccharide-binding protein in horses

with colic. Am J Vet Res 66, 1509-1516.

Veenman, J.N., Dujardint, C.L., Hoek, A., Grootendorst, A., Klein, W.R. and Rutten, V.P.

(2002) High volume continuous venovenous haemofiltration (HV-CVVH) in an equine

endotoxaemic shock model. Equine Vet J 34, 516-522.

Villar, J., Perez-Mendez, L., Espinosa, E., Flores, C., Blanco, J., Muriel, A., Basaldua, S., Muros,

M., Blanch, L., Artigas, A. and Kacmarek, R.M. (2009) Serum lipopolysaccharide

binding protein levels predict severity of lung injury and mortality in patients with severe

sepsis. PLoS One 4, e6818.

Wahlstrom, K., Bellingham, J., Rodriguez, J.L. and West, M.A. (1999) Inhibitory kappaBalpha

control of nuclear factor-kappaB is dysregulated in endotoxin tolerant macrophages.

Shock 11, 242-247.

Wang, H., Czura, C.J. and Tracey, K.J. (2003) Tumor necrosis factor. In: The Cytokine

Handbook, Eds: A.W. Thomson and M.T. Lotze, Elsevier, London. pp 837-860.

Wanidworanun, C. and Strober, W. (1993) Predominant role of tumor necrosis factor-alpha in

human monocyte IL-10 synthesis. J Immunol 151, 6853-6861.

Ward, D.S., Fessler, J.F., Bottoms, G.D. and Turek, J. (1987) Equine endotoxemia:

cardiovascular, eicosanoid, hematologic, blood chemical, and plasma enzyme alterations.

Am J Vet Res 48, 1150-1156.

Warr, T.A., Rao, L.V. and Rapaport, S.I. (1989) Human plasma extrinsic pathway inhibitor

activity: II. Plasma levels in disseminated intravascular coagulation and hepatocellular

disease. Blood 74, 994-998.

Weichhart, T., Brandt, O., Lassnig, C., Muller, M., Horl, W.H., Stingl, G. and Saemann, M.D.

The anti-inflammatory potency of dexamethasone is determined by the route of

application in vivo. Immunol Lett 129, 50-52.

83

Werners, A.H., Bull, S. and Fink-Gremmels, J. (2005) Endotoxaemia: a review with implications

for the horse. Equine Vet J 37, 371-383.

West, M.A., Clair, L. and Bellingham, J. (1996) Role of calcium in lipopolysaccharide-

stimulated tumor necrosis factor and interleukin-1 signal transduction in naive and

endotoxin-tolerant murine macrophages. J Trauma 41, 647-652.

West, M.A., Clair, L., Kraatz, J. and Rodriguez, J.L. (2000) Endotoxin tolerance from

lipopolysaccharide pretreatment induces nuclear factor-kappaB alterations not present in

C3H/HeJ mice. J Trauma 49, 298-305.

West, M.A. and Heagy, W. (2002) Endotoxin tolerance: A review. Crit Care Med 30, S64-S73.

West, M.A., LeMieur, T., Clair, L., Bellingham, J. and Rodriguez, J.L. (1997) Protein kinase C

regulates macrophage tumor necrosis factor secretion: direct protein kinase C activation

restores tumor necrosis factor production in endotoxin tolerance. Surgery 122, 204-211;

discussion 211-202.

Winchell, W.W., Hardy, J., Levine, D.M., Parker, T.S., Gordon, B.R. and Saal, S.D. (2002)

Effect of administration of a phospholipid emulsion on the initial response of horses

administered endotoxin. Am J Vet Res 63, 1370-1378.

Wittmann, I., Schonefeld, M., Aichele, D., Groer, G., Gessner, A. and Schnare, M. (2008)

Murine bactericidal/permeability-increasing protein inhibits the endotoxic activity of

lipopolysaccharide and gram-negative bacteria. J Immunol 180, 7546-7552.

Wright, S.D. (1994) Septin, an activity in plasma that enables CD14-dependent recognition of

LPS. Prog Clin Biol Res 388, 53-57.

Wright, S.D., Ramos, R.A., Patel, M. and Miller, D.S. (1992) Septin: a factor in plasma that

opsonizes lipopolysaccharide-bearing particles for recognition by CD14 on phagocytes. J

Exp Med 176, 719-727.

Wright, S.D., Ramos, R.A., Tobias, P.S., Ulevitch, R.J. and Mathison, J.C. (1990) CD14, a

receptor for complexes of lipopolysaccharide (LPS) and LPS binding protein. Science

249, 1431-1433.

Wurfel, M.M., Kunitake, S.T., Lichenstein, H., Kane, J.P. and Wright, S.D. (1994)

Lipopolysaccharide (LPS)-binding protein is carried on lipoproteins and acts as a

cofactor in the neutralization of LPS. J Exp Med 180, 1025-1035.

Wurfel, M.M., Monks, B.G., Ingalls, R.R., Dedrick, R.L., Delude, R., Zhou, D., Lamping, N.,

Schumann, R.R., Thieringer, R., Fenton, M.J., Wright, S.D. and Golenbock, D. (1997)

Targeted deletion of the lipopolysaccharide (LPS)-binding protein gene leads to profound

suppression of LPS responses ex vivo, whereas in vivo responses remain intact. J Exp

Med 186, 2051-2056.

84

Wysocka, M., Kubin, M., Vieira, L.Q., Ozmen, L., Garotta, G., Scott, P. and Trinchieri, G.

(1995) Interleukin-12 is required for interferon-gamma production and lethality in

lipopolysaccharide-induced shock in mice. Eur J Immunol 25, 672-676.

Yoshimoto, T., Nakanishi, K., Hirose, S., Hiroishi, K., Okamura, H., Takemoto, Y., Kanamaru,

A., Hada, T., Tamura, T., Kakishita, E. and et al. (1992) High serum IL-6 level reflects

susceptible status of the host to endotoxin and IL-1/tumor necrosis factor. J Immunol 148,

3596-3603.

Zhang, J., Qu, J.M. and He, L.X. (2009) IL-12 suppression, enhanced endocytosis and up-

regulation of MHC-II and CD80 in dendritic cells during experimental endotoxin

tolerance. Acta Pharmacol Sin 30, 582-588.

Zheng, H., Fletcher, D., Kozak, W., Jiang, M., Hofmann, K.J., Conn, C.A., Soszynski, D.,

Grabiec, C., Trumbauer, M.E., Shaw, A. and et al. (1995) Resistance to fever induction

and impaired acute-phase response in interleukin-1 beta-deficient mice. Immunity 3, 9-19.

Ziegler-Heitbrock, H.W. (1995) Molecular mechanism in tolerance to lipopolysaccharide. J

Inflamm 45, 13-26.

Ziegler-Heitbrock, H.W., Blumenstein, M., Kafferlein, E., Kieper, D., Petersmann, I., Endres, S.,

Flegel, W.A., Northoff, H., Riethmuller, G. and Haas, J.G. (1992) In vitro desensitization

to lipopolysaccharide suppresses tumour necrosis factor, interleukin-1 and interleukin-6

gene expression in a similar fashion. Immunology 75, 264-268.

Ziegler-Heitbrock, H.W., Petersmann, I. and Frankenberger, M. (1997) p50 (NF-kappa B1) is

upregulated in LPS tolerant P388D1 murine macrophages. Immunobiology 198, 73-80.

Ziegler-Heitbrock, H.W., Wedel, A., Schraut, W., Strobel, M., Wendelgass, P., Sternsdorf, T.,

Bauerle, P.A., Haas, J.G. and Riethmuller, G. (1994) Tolerance to lipopolysaccharide

involves mobilization of nuclear factor kappa B with predominance of p50 homodimers.

J Biol Chem 269, 17001-17004.

Zisman, D.A., Kunkel, S.L., Strieter, R.M., Gauldie, J., Tsai, W.C., Bramson, J., Wilkowski,

J.M., Bucknell, K.A. and Standiford, T.J. (1997) Anti-interleukin-12 therapy protects

mice in lethal endotoxemia but impairs bacterial clearance in murine Escherichia coli

peritoneal sepsis. Shock 8, 349-356.

Zweigner, J., Gramm, H.J., Singer, O.C., Wegscheider, K. and Schumann, R.R. (2001) High

concentrations of lipopolysaccharide-binding protein in serum of patients with severe

sepsis or septic shock inhibit the lipopolysaccharide response in human monocytes. Blood

98, 3800-3808.

85

APPENDIX A

Sequence information for primers and MGB probes for real time PCR analysis.

Gene of Interest Forward Primer Reverse Primer

Interleukin-10 GTCGGAGATGATCCAGTTTTACCT AGTTCACGTGCTCCTTGATGTC

T Interleukin-12p40 TGCTGTTCACAAGCTCAAGTATGA GGGTGGGTCTGGTTTGATGA

G3PDH GGTGGAGCCAAAAGGGTCAT TTCACGCCCATCACAAACAT

Gene of Interest Probe

Interleukin-10 TGCCCCAGGCTGAGAACCACG

Interleukin-12p40 CTACACCAGCGGCTTCTTCATCAGGG

G3PDH TCTCTGCTCCTTCTGCTGATGCCCC