INDEPENDENT TRANSCRIPTION OF A FUNCTIONAL

LUCERNE TRANSIENT STREAK VIRUS SATELLITE RNA

AND ITS PACKAGING REQUIREMENT(S)

By

Feiyuan Liu

A thesis submitted in conformity with the requirements

for the Degree of Master of Science

Graduate Department of Cell and Systems Biology

University of Toronto

© Copyright by Feiyuan Liu 2014

II

Independent Transcription of A Functional

Lucerne Transient Streak Virus Satellite

RNA and Its Packaging Requirement(s)

Feiyuan Liu

Degree of Master of Science

Department of Cell and Systems Biology

University of Toronto

2014

The satellite RNA of Lucerne Transient Streak Virus (LTSV) is a 322-nucleotide,

single-stranded circular RNA. To investigate whether interactions between genomic

and satellite RNA are important for satellite packaging into the helper virus capsid

protein, transgenic plants were generated which contained turnip rosette virus

capsid protein gene and LTSV satellite dimer sequence in tandem. Results of the

RT-PCR and western blotting revealed that the ribozyme was functional in vivo and

generated the unit length of monomeric LTSV circular RNA. This was confirmed by an

infectivity assay results showing that the LTSV circular RNA was infectious when

inoculated into plants with the turnip rosette helper virus. However, the TRoV capsid

protein (CP) failed to be expressed in transgenic plants. Lack of TRoV mRNA for

capsid protein in transgenic plants is probably due to the presence of the ribozyme

which resulted in the destabilization and consequent degradation of CP TRoV mRNA.

III

Acknowledgements

I would like to sincerely thank Dr. Mounir AbouHaidar for all of his expertise,

guidance, and support throughout this project. Thank you for the valuable

opportunity to conduct research in your laboratory and learn from the best.

Many thanks go to Dr. Maurice Ringuette and Dr. Eiji Nambara who have supported

me as members of my supervisory committee.

I am very grateful to Tauqeer Ahmad, a wonderful colleague, for all of his helpful

advice and unreserved assistance. I have learned a great deal from him and I wish

him the very best of luck in all of his endeavors. Thanks also go to my colleagues:

Alex Mosa and Reem Merwas.

Finally, I am especially thankful to my family, for all of their love, support, and

confidence. To them, I owe all of my accomplishments.

IV

Table of Contents

ABSTRACT ······················································································································· i

ACKNOWLEDGEMENTS ································································································· ii

TABLE OF CONTENTS ···································································································· iii

LIST OF FIGURES ··········································································································· vi

LIST OF TABLES ··········································································································· viii

LIST OF ABBREVIATIONS ······························································································· ix

1 LITERATURE REVIEW ··································································································1

1.1 Overview ··········································································································1

1.2 Sobemoviruses ·································································································2

1.2.1 General Features ····················································································2

1.2.2 Genome Organization ············································································4

1.3 Lucerne Transient Streak Virus ········································································5

1.3.1 Biological Properties ··············································································5

1.3.2 Main Diseases ······················································································6

1.4 Viroids and Plant Virus Satellites ································································6

1.4.1 Viroids ····································································································6

1.4.2 Viroid-like Satellite RNAs ····································································7

1.4.3 Satellite RNA of Lucerne Transient Streak Virus ····································7

1.4.4 Sequence and Structure of LTSV Satellite RNA ······························8

1.4.5 Replication of the viroids and satellite RNAs ·································9

V

1.4.6 Ribozyme Activity ··············································································13

2 INTRODUCTION ········································································································16

3 MATERIALS AND METHODS ·····················································································18

3.1 Molecular Techniques ····················································································18

3.1.1 Plasmid DNA Isolation from E. coli ················································18

3.1.2 Gel Electrophoresis ············································································19

3.1.3 Phenol-Chloroform DNA/RNA Purification ·······································19

3.1.4 Polymerase Chain Reaction ······························································20

3.1.5 Reverse Transcription (RT) – Polymerase Chain Reaction ············21

3.1.6 Preparation of Competent Cells and Transformation of

A. tumefaciens ····················································································22

3.2 Confirmation of Transgenic Plant ······························································23

3.2.1 Chromosomal DNA Extraction from Plant Tissue··························23

3.2.2 Total RNA Extraction from Plant Tissue ·········································24

3.2.3 DNase Treatment ···············································································25

3.3 Generation of Antibodies and Immunoblotting ·······································25

3.3.1 Electroelution of Protein From SDS-PAGE Gels ·····························25

3.3.2 Polyclonal Antibody Production ·······················································26

3.3.3 Total Protein Extraction ····································································27

3.3.4 Protein Quantitation ··········································································27

3.3.5 SDS-PAGE Gel ·····················································································29

3.3.6 Western Blotting ················································································30

VI

3.4 Infectivity Assay of TRoV and LTSV sat RNA ··········································31

3.5 Transient Infectivity Assay ··········································································31

4 RESULTS ····················································································································32

4.1 Production of Transgenic N. Benthamiana Plants ···································32

4.2 Confirmation of Transgenic Plants ·····························································33

4.2.1 Detection of Transgene DNA in Chromosomal DNA of

Transgenic N. Benthamiana Plants ······················································34

4.2.2 Analysis of Transcription Products in

Transgenic Plants ·················································································39

4.3 Antibody Generation and Immunoblotting ···············································45

4.3.1 Protein Purification ············································································45

4.3.2 Western Blotting ················································································46

4.4 Agrobacterium Mediated Transient Infectivity Assay ······························50

4.5 Infectivity Assay of TRoV and LTSV sat RNA ··········································51

5 DISCUSSION ··············································································································56

6 CONCLUSIONS ·········································································································61

7 FUTURE DIRECTIONS ······························································································62

8 REFERENCES ·············································································································63

VII

List of Figures

Figure 1: Sobemovirus genome organization ·······························································5

Figure 2: Rolling-circle model for the replication of circular RNAs ·····························10

Figure 3: Rolling-circle mechanism for viroid replication ···········································11

Figure 4: The probable cleavage mechanism of the hammerhead ribozyme,

and potential catalytic strategies ································································15

Figure 5: Proposed secondary structure of the positive (plus) and negative

(minus) sense hammerhead domains for LTSV sat RNA ·····························15

Figure 6: Schematic representation of TROVCP_LTSVsat constructs ··························33

Figure 7: Transgenic seeds screening ··········································································34

Figure 8: PCR confirmation of capsid protein transgene in

TROVCP_LTSVsat transgenic N. benthamiana ·············································36

Figure 9: PCR confirmation of LTSV satRNA transgene in

TROVCP_LTSVsat transgenic N. benthamiana ·············································37

Figure 10: PCR confirmation of Green fluorescent protein transgene in

TROVCP_LTSVsat transgenic N. benthamiana ·············································38

Figure 11: Quality check of total RNA from transgenic N. benthamiana ···················39

Figure 12: Quality of RNA samples before and after DNase treatment ·····················41

Figure 13: PCR and RT-PCR results of genomic and transcripts of

TRoV capsid protein, LTSV sat RNA and GFP construct in

transgenic N. benthamiana plants ······························································43

VIII

Figure 14: SDS-PAGE of purified TRoV capsid protein·················································45

Figure 15: Bradford assay showing concentrations of protein

samples (in μg/ml) ······················································································47

Figure 16: Western blotting using anti-TRoV antisera across dilution of

purified virus and total protein extracts to detect the

presence of the TRoV capsid protein ··························································49

Figure 17: Schematic representation of TROVCP constructs ······································50

Figure 18: Confirmation of the expression of the TRoV capsid

protein in N. benthamiana plant using western blotting ···························51

Figure 19: Quality of total RNA extraction from turnip plant ·····································52

Figure 20: RT-PCR results of transcripts of TRoV capsid protein in

turnip plants after infectivity assay ·····························································54

Figure 21: RT-PCR results of transcripts of LTSV satellite RNA in

turnip plants after infectivity assay ·····························································55

Figure 22: Diagram showing how the CP mRNA could be degraded ··························60

IX

List of Tables

Table 1: Viruses of genus Sobemovirus and their biological properties ·······················3

Table 2: Amount of reagent and spectrophotometer Reading of

different concentration of BSA protein ·························································28

Table 3: Spectrophotometer reading of RNA ···························································· 40

Table 4: Bradford Assay to quantitate the amount of proteins used for

western blotting ····························································································46

Table 5: Protein concentration for western blotting ···················································48

Table 6: Nucleotide sequences of forward (F) and reverse (R) primers

used for confirmation of transgene presence ··············································70

X

List of Abbreviations

aa amino acid

AMV Alfalfa mosaic virus

A. tumefaciens Agrobacterium tumefaciens

ASBVd avocado sunblotch viroid

APS Ammonium persulfate

ATP adenosine triphosphate

bp base pair

BSA bovine serum albumin

CCC RNA covalently closed circular ribonucleic acid

cDNA complementary DNA

CfMV cocksfoot mottle virus

CTAB hexadecyltrimethylammonium bromide

CP capsid protein

DNA Deoxyribonucleic acid

dNTP 2’-deoxyribonucleotide triphosphate

DEPC diethylpyrocarbonate

DNase deoxyribonuclease

E. coli Escherichia coli

EDTA ethylenediaminetetra-acetate

g gram

XI

g gravitational constant (9.8m/s2)

HCl hydrochloric acid

HDV hepatitis delta virus

HHR hammerhead ribozyme

kb kilo base pair

kDA kilodalton

LB Luria-Bertani (media)

LTSV lucerne transient streak virus

M molar

mA milliampere

min minute

mg milligram

MgCl2 magnesium chloride

mM millimolar

mRNA messenger ribonucleic acid

mRNP messenger ribonucleoprotein particles

MS Murashige and Skoog (media)

N. benthamiana Nicotiana benthamiana

NaCl sodium chloride

ng nanogram

nm nanometer

nc RNA non-coding ribonucleic acid

XII

nt nucleotide

OD optical density

ORF open reading frame

PAGE polyacrylamide gel electrophoresis

pCambia Cambia plasmid strain 1300

PCR polymerase chain reaction

pol polymerase

PSTVd potato spindle tuber viroid

RdRp RNA-dependet RNA polymerase

RNA ribonucleic acid

RNase ribonuclease

rpm revolutions per minute

rRNA ribosomal ribonucleic acid

RT-PCR reverse transcription – polymerase chain reaction

RYMV rice yellow mottle virus

sat RNA satellite ribonucleic acid

SBMV Southern bean mosaic virus

SCMoV subterranean clover mottle virus

SDS sodium dodecyl sulfate

sgRNA subgenomic RNA

SNMoV solanum nodiflorum mottle virus

SoMV sowbane mosaic virus

XIII

ssRNA single-stranded RNA

TE-1 1:10 dilution of 10mM Tris-HCl (pH 8), and 1Mm

EDTA

TLS tRNA-like structure

TMV Tobacco mosaic virus

Tnos nopaline synthase terminator

TRAMP complex Trf4/Air2/Mtr4p Polyadenylation complex

Tris tris(hydroxymethyl) aminomethane

tRNA transfer ribonucleic acid

TRoV turnip rosette virus

UTR untranslated region

µg microgram

µl microliter

V volt

VPg viral protein genome-linked

VS Varkud satellite

VTMoV Velvet tobacco mottle virus

1

1 Literature Review

1.1 OVERVIEW

Viruses are replicative particles composed of nucleic acids and proteins. Lacking

the cellular organelles required for translation, viruses parasitize host cells to

propagate. The cellular pathologies induced by viral infection are contingent on

both innate replicative requirements, as well as host cell responses. Constituting

an evolutionary ancient vehicle for nucleic acid replication, viruses have been

identified to parasitize all domains of living organisms (Koonin et al., 2006).

Plant viral pathogen potentiated disease is responsible for major global losses in

crop yield and quality, estimated $60 billion loss each year (Wei et al., 2010). The

majority of plant viruses have positive single-stranded RNA (ss RNA) genome

which is encapsidated in either rod-like or icosahedral capsid protein. Plants

cannot move, so plant-to-plant transmission necessitates vectors, which are

commonly insects. Within plant hosts, the impermissivity of cell walls requires

intercellular transport of virions to occur via plasmodesmata. However, physical

modification of plasmodesmata is required for virion transport. Plant viruses thus

commonly possess various movement proteins involved in expanding the

plasmodesmata pore (Oparka et al., 2001).

2

1.2 SOBEMOVIRUSES

1.2.1 GENERAL FEATURES

Sobemoviruses are plant viruses named after their type species, Southern

bean mosaic virus (SBMV). This virus group was established according to

similarities in protein subunit molecular weight, capsid protein stabilization,

sedimentation coefficient and distribution in the cell (Hull, 1977). Viruses in

the genus Sobemovirus are icosahedral particles of about 30 nm in diameter

(Hull, 1995). Virions contain capsid protein (approximately 30 kDa), genomic

RNA, and one subgenomic RNA (sg RNA) molecule (Hull, 1995). The capsid

protein is made of 180 subunits patterned in T=3 symmetry (Hull, 1995). The

genome of the virus is a single-stranded positive-sense RNA molecule

between 4 to 4.5 kb in size, with a viral protein genome-linked protein (VPg)

at the 5’ terminus and a non-polyadenylated 3’ end (Hull, 1995).

Sobemoviruses currently contain 11 species whose natural host range is quite

narrow, but include both monocotyledonous and dicotyledonous, (Zaumeyer

& Hareter, 1943) and are transmitted by vectors or by seeds (Table 1).

In addition to their genomic RNA, some Sobemovirus also encapsidate a

viroid-like satellite RNA (sat RNA) that relys on helper virus for replication and

packaging. The presence of sat RNA has been reported for lucerne transient

streak virus (LTSV), rice yellow mottle virus (RYMV), subterranean clover

mottle virus (SCMoV), solanum nodiflorum mottle virus (SNMoV), and velvet

tobacco mottle virus (VTMoV) (Sehgal et al., 1993; Collins et al., 1998; Francki

3

et al., 1983; Gould & Hatta, 1981). The length of these circular sat RNA range

from 220 to 390 nucleotides (nt). RYMV sat RNA (220 nt) which known as the

smallest naturally occurring viroid-like RNA known today (Collins et al., 1998).

Interactions between sat RNA, helper virus, and host plants significantly

influence the infectivity of the satellite.

Table1. Viruses of genus Sobemovirus and their biological

properties. Adapted from Tamm & Truve, 2000a.

4

1.2.2 GENOME ORGANIZATION

The genome of the Sobemovirus shows similarity amongst members of the

genus. Their genome isacompact and majority of the openareading frames

(ORFs) overlap. The genome contains four protein-coding ORFs. A small ORF 1

at the 5’ end, and a large polyprotein ORF 2 are translatedafrom genomic

RNA, while ORF 3, which encodes for the viral coat protein, is translated from

a subgenomic RNA. ORF 1 encodes for P1, which is responsibleafor virus

movement (Sivakumaran et al., 1998; Chowdhury & Savakumaran, 2011), and

also seems to be participated in gene silencing (Voinnet et al., 1999; Lacombe

et al., 2010). The sequences of the P1 amino acid are significantly different

from different species and the encoded protein is around 12 to 24 kilo Dalton

(KD) (Tamm & Truve, 2000). ORF 2 is comprised of ORF 2a and ORF 2b, which

encode the polyprotein consisting of a serine protease,

RNA-dependent-RNA-polymerase (RdRp), a VPg protein and other products

called P10 and P8 (Mäkinen et al., 2000; Nair & Savithri, 2010).

For many years, sobemoviruses were thought to have two different genome

organizations. Some were thought to have the organization like Figure 1,

while, in other sobemoviruses, ORF2a and ORF2b were fused intoaone long

ORF, with theaORF3aoverlapathe region between ORF2a and ORF2b.

However Meier and Truve (2007) demonstrated that all sobemoviruses have

genomes organized in accordance with the model presented in Figure 1.

Previous inconsistencies are dueato sequencing error. The presence of two

5

short 5’ ORFs (1a and 1b) in LTSV and TRoV was shown to be sequence error

(Sõmera & Truve, 2013).

Another functionalaORF (ORFx) wasaidentified in the sobemoviruses (Ling et

al., 2013). ORFx, whichaoverlaps the 5’ terminal of ORF2a in the +2 reading

frame and extends to upstream of ORF2a, (shown in Figure 1) isaconserved in

all sobemoviruses. Mutations that disrupt the expression of ORFxaeliminate

viral infectiousness (Ling et al., 2013).

Figure 1: Sobemovirus genome organization. Map of the∼4.45 kb RYMV genome. ORF1 (P1),

ORF2a (Pro-VPg-P10-P8 polyprotein) and ORF2b (RdRp) are translated from the genomic

RNAthrough both leaky scanning and ribosomal frameshifting. ORF3 which is encoded for the

viral capsid protein is translated from a subgenomic RNA. The newly identified ORFx (X, pink) is

thought to be translated using leaky scanning, a Adapted from Ling et al., 2013.

1.3 LUCERNE TRANSIENT STREAK VIRUS

1.3.1 BIOLOGICAL PROPERTIES

Lucerne Transient Streak Virus belongs to Sobemovirus. The genome of the

LTSV is a single-stranded messenger-sense RNA molecule approximately 4.5

kb in size with a VPg at the 5’ end (Hull, 1988). Similar to other

sobemoviruses, the capsid of LTSV is composed of 180 protein subunits

according to T=3 symmetry with a molecular weight of 32 KDa (Forster &

Jones, 1979).

6

1.3.2 MAIN DISEASES

LTSV naturally cause disease in lucerne and can be a great economic burden

on commercial lucerne crops. To date, three isolates have been identified:

Australian (Blackstock, 1978), Canadian (Paliwal, 1983), and New Zealand

(Forster & Jones, 1979). These three isolates are distinguished based on their

host range and symptom. The natural method of transmission of LTSV is

unknown, however, chewing insects are suspected as the most likely vector

(Blackstock, 1978; Paliwal, 1983; Forster & Jones, 1979).

LTSV infected lucerne plants generally develop chlorotic streaks centered on

the main lateral vein of leaflets. Leaf distortion around the streak appears

mostly on newly expended leaves and the symptoms weaken when plants are

grown in temperate condition (Blackstock, 1978; Paliwal, 1983; Forster &

Jones, 1979). LTSV cause 18% loss in dry matter of plant growth in one year of

growth in the field (Blackstock, 1978).

1.4 VIROIDS AND PLANT VIRUS SATELLITES

1.4.1 VIROIDS

Viroids are chracterized by the following characteristics: they are circular

single-strand RNAs between 246-401 nt long. They show a high degree of

secondary structure which results in a distinct rod-like double-stranded

structure with small single-stranded loop-out region (Sänger et al., 1976). No

ORFs exist in their sequences and no viroid specific product has been

detected. As lack of coding product, viroids are extensively dependent on

7

host encoded protein for replication (Diener, 2001).

1.4.2 VIROID-LIKE SATELLITE RNAs

Satellites are RNA molecules unable to replicate without the assistance of a

specific helper virus. They are not needed for the replication of their helper

virus and their sequence was not homology with the helper virus genome

(Roossinck et al., 1992). It is believed that RNA polymerase encoded by helper

virus as well as host encoded factors is responsible for the satellite replication.

The satellite usually interferes with helper virus synthesis and therefore either

ameliorating or exacerbating effect on the diseases symptoms caused by their

helper virus (Collmer & Howell, 1992; Roossinck et al., 1992).

Satellite RNAs associated with four Sobemoviruses: VTMoV, SNMoV, SCMoV

and LTSV, have certain properties similar to viroids (Gould, 1981; Gould &

Hatta, 1981; Tien et al., 1981). For they are all small circular single-stranded

RNA but they form the double strand like structure. However the main

difference between these satellites and viroids is that satellite RNAs are

replicated with the help of the helper virus and they are also packaged into

the helper virus coat protein. While viroids replicate totally with plant host

enzymes and they don’t need the capsid protein for their packaging.

1.4.3 SATELLITE RNA OF LUCERNE TRANSIENT STREAK VIRUS

The 322-nt RNA which is encapsidated with LTSV particles has been

characterized as satellite RNA (satRNA) due to it needs of the helper virus for

replication. Paliwal (1984) confirmed that LTSV sat RNA was unable to

8

replicate without the suitable helper virus on Trigonella foenum-graecum and

Trifolium incarnatum.

Several interesting interactions between LTSV sat RNA, host plant and helper

virus have been illustrated. The replication of the SNMoV sat RNA can be

supported by LTSV (Jones & Mayo, 1984). However, SNMoV cannot support

the replication of the LTSV sat RNA (Jones & Mayo, 1984). Furthermore, the

replication of the LTSV sat RNA is also supported by sobemoviruses which are

naturally don’t have the sat RNAs, including Cocksfoot mottle virus (CfMV),

SBMV, Sowbane mosaic virus (SoMV), and Turnip rosette virus (TRoV)

(AbouHaidar & Paliwal, 1988; Paliwal, 1984; Sehgal et al., 1993). Replication

of LTSV sat RNA also shows host specificity. For instance, TRoV can support

the replication of the LTSV sat RNA in Brassica rapa, Raphanus raphanistrum

and Sinapsis arvensis, but not in Thlapsi arvense or Nicotiana bigelovii (Sehgal

et al., 1993a).

1.4.4 SEQUENCE AND STRUCTURE OF LTSV SATELLITE RNA

Sequence analyses showed that the three known isolates of LTSV sat RNA

share the high scale similarity. Both the New Zealand and Australian isolates

are 324-nt in size and share 98% sequence similarity (Keese et al., 1983),

while the Canadian isolate is a 322-nt RNA with only 80% sequence

homology to the other 2 types of sat RNA (AbouHaidar & Paliwal,

1988). The primary sequences of the three sat RNA isolates can be predicted

up to seven ORFs, there is very little amino acid (aa) conservation within

9

the ORFs and no in vitro translation products have been

identified (Morris-Krsinich & Forster, 1983). Therefore, LTSV sat RNAs

are considered to lack of translation products in vivo (AbouHaidar & Paliwal,

1988).

Secondary structure three LTSV sat RNA isolates predict wide-ranging internal

base-pairing of the circular RNAs (up to 70%) and suggest a double stranded

structure which is similar to the viroids. In both the positive- and

negative-sense strands of LTSV, the right one-third of the molecule can fold

into alternative hammerhead structures which have the self-splicing function

(Forster &Symons, 1987a; Sheldon & Symons, 1989) (Figure 6).

1.4.5 REPLICATION OF THE VIROIDS AND SATELLITE RNAs

The replication of viroids and viroid-like satellite RNAs from plants occurs in

different cell components (nucleus, chloroplast and cytoplasm) using

rolling-circle mechanism (Figure 2). The replication has three steps including

RNA polymerization (replication), cleavage and ligation (Flores et al., 2011).

Viroids rely on the DNA-dependent RNA polymerase of the host plant for

replication, so this process occurs in the same place where these subcellular

enzymes are located. Early study showed that both positive and negative

polarities of potato spindle tuber viroid (PSTVd) circular RNAs were detected

in nuclear fractions, which indicates nuclear RNA polymerase was functional

in the replication of PSTVd (Flores et al., 2005). Similar results were also

confirmed to the other members of the family Pospiviroidae which usually

10

refer to as nuclear viroid (Qi & Ding, 2003). Similar experiments have been

conducted to avocado sunblotch viroid (ASBVd) and other members of the

family Avsunviroidae, revealed that both positive and negative sense strands

accumulated in plastids, indicating Avsunviroidae family which refer to as

chloroplastic viroids which dependent on chlroplastic RNA polymerase for

replication (Figure 3)(Flores et al., 2005; Navarro et al., 1999). On the other

hand, viroid-like satellite RNAs depend on their helper virus encoded

RNA-dependent RNA polymerase for replication, so their replications most

probably co-occur with their helper viruses which replicate in membranous

vesicles connected with cytoplasm (Kopek et al., 2007). However, due to lack

of evidence, it is possible that helper virus may contribute proteins

redirecting host RNA polymerase to synthesis satellite RNAs.

11

12

As for RNA polymerization, multimeric RNAs were produced through

transcription of the circular templates of one or both polarities, catalyzed by

either RNA-dependent RNA polymerase of the helper virus or

DNA-dependent RNA polymerase of the host plant (Flores et al., 2011). The

cleavage or (self-cleavage) of the multmeric RNA intermediates into their

monomeric counterpart may occur in positive sense as well as both polarities

due to two mechanisms of rolling-circle replication, and this procedure is

catalyzed by either host encoded enzymes or by its own ribozyme (Flores et

al., 2011). The family Pospiviroidae most probably using asymmetric

rolling-circle mechanism for replication. Evidence showed that the cleavage of

the multimeric positive sense RNAs is determined by a specific RNA

conformation (Gas et al., 2007; Gas et al., 2008). Recent data supported a

double-stranded structure makes specific phosphodiester bonds easy to be

cut by RNase III-like enzyme, typically generating 5’-P and 3’-OH terminal(Gas

et al., 2007; Gas et al., 2008). Meanwhile, replication of the family

Avsunviroidae is supposed to follow symmetric rolling-circle mechanism.

Furthermore, the self-cleavage of the multimeric positive sense and negative

sense RNAs to its monomeric form is catalyzed by cis-acting hammerhead

ribozyme (Huthins et al., 1986; Prody et al., 1986). Circularization of the

unit-length linear RNA appears to be catalyzed by enzymes of the host or by

its own ribozyme activity (splicing/ligation). In the family Pospiviroidae,

recent data revealed that the cleavage of the multimeric positive sense RNA

13

into the monermeric sense and the self-ligation to form the circular monomer

most probably catalyzed by RNase III like enzyme (Gas et al., 2007). While in

the family Avsunviroidae, monomeric RNA resulting from self-cleavage

ribozyme activity result in the product which contains 5’-OH and 2’,

3’-phosphodiester end which require tRNA ligase for self-circularization

(Englert et al., 2007; Martinez et al., 2009).

1.4.6 RIBOZYME ACTIVITY

Ribozymes are RNA molecules which are able to catalyzing specific chemical

reaction. The ribozymes are a group of relatively small RNA (50-150 nt)

species (Lilley, 2005) that, dependent on presence of the metal ions, perform

a site-specific cleavage via a trans-esterification reaction to their own

phosphodiester backbone (Wilson & Lilley, 2009). Mainly there are four

members of ribozymes: hammerhead, hairpin, hepatitis delta virus (HDV),

and Varkud satellite (VS). Though each type have different sequence and

structure, they can conduct the same reaction. The general mechanism of the

ribozymes is 2’ oxygen nucleophile attacks the nearby phosphate in the RNA

backbone, resulting in cleavage product one with 2’, 3’-cyclic phosphate and

the other have 5’ hydroxyl end, which is similar to some of the protein

ribonucleases (Figure 4). Unlike protein ribonucleases, ribozymes only cleave

at a specific location, using base-pairing and tertiary interaction to help align

the cleavage site within the catalytic core (Doherty & Doudna, 2001).

The hammerhead ribozyme (HHR) is a small catalytic RNA motif capable of

14

endonucleolytic (self-) cleavage. It is composed of a catalytic core of

conserved nucleotides flanked by three helices, two of which form essential

tertiary interaction for fast self-scission under physiological conditions. The

hammerhead ribozyme was discovered in satellite RNA of plant virus, where

it works as site-specific self-cleaving unit in the processing of single-stranded

RNA transcripts result from rolling-circle replication (Forster & Symons, 1987;

Hazeloff & Gerlach, 1988). The active ribozyme is transiently formed during

replication to promote monomeric cleavage, while a later alternate folding

promotes ligation during monomer circularization (Flores et al., 2004).

Satellite RNA of LTSV also contains hammerhead ribozyme motif (Figure 5).

For both polarities of the sat RNAs, the sequence near the cleavage site can

be folded into a hammerhead secondary structure. The activity of the

hammerhead ribozyme was shown to be also functional in vitro. Though such

activity is quite low (Collins et al, 1998).

15

16

2 Introduction

A majority of plant viruses are single-stranded RNA viruses. Some RNA viruses

also contain divided genome. Generally the genomes of those viruses are

packaged into a capsid protein. Additionally, certain plant viruses have been

described to be associated with replication-dependent satellite nucleic acids.

Satellites can be divided into two groups: 1) satellite viruses may encode for their

own protein (satellite viruses) but they rely on the helper virus for replication. 2)

Satellite RNAs which rely on their helper viruses for encapsidation and replication.

Satellites normally share little or no sequence homology to their helper viruses,

which distinguish them from subgenomic RNA (Murant & Mayo, 1982). To the

extent they utilize viral replication machinery; satellites can be characterized as

parasitic. Satellite co-infection does not predict severity of host symptoms. In

most plants, sat RNA’s reduce helper virus replication, thereby attenuating

disease symptoms. However, certain hosts do present increased symptom

severity in satellite virus co-infection.

One class of satellite circular RNAs which exist as circular, single-stranded, highly

self-complementary viroid-like RNAs was baptized as Virusoids. They rely on

the helper virus for replication and encapsidation (Symons, 1991). The secondary

structure of virusoids is similar to the structure of the viroids, which are also

small circular highly complementary plant pathogens that rely on host RNA

polymerase for replication (Flores et al., 2005). The satellite of LTSV relies on the

17

helper virus for both replication and encapsidation, and hitherto no translational

products have been reported for LTSV sat RNA. The replication of LTSV sat RNA is

catalyzed by the RNA-dependent RNA polymerase of the helper virus (LTSV and

TRoV) through rolling–circle mechanism. During the process of rolling-circle

mechanism, the hammerhead secondary motif embedded in LTSV sat RNA

putatively catalyzed self-cleavage to generate unit length RNA from a multimeric

precursor. The hammerhead ribozyme is a single-folded strand of RNA which

undergoes autocatalytic self-cleavage (and ligation). Elucidation of the

self-cleavage of the ribozyme activity of LTSV satellite would be important in

understanding the replication mechanism.

The small circular LTSV sat RNA is naturally found packaged together with the

viral genomic RNA into the icosahedral viral capsid (Forster & Jones, 1979).

However, viral packaging is exclusive for these RNA molecules; no cellular RNAs

(mRNA, tRNA, etc.) have been found in nucleic acid extracts of virions. The aim of

the thesis is to determine whether or not a functional satellite RNA can be

produced in plants without the helper virus. Furthermore, we determine whether

a satellite/capsid protein system is functional without any other helper virus

sequence. Data obtained will help to understand the interaction between

genomic and satellite RNAs in LTSV satellite packaging and capsid protein

assembly, and whether sense-directionality (positive and negative-sense LTSV

satellite RNAs) influences satellite RNA packaging ability. The stability of mRNA

lacking either the cap or poly (A) tail was also explored.

18

3 Materials and Methods

3.1 MOLECULAR TECHNIQUES

3.1.1 PLASMID DNA ISOLATION FROM E.COLI (MINI-PREP)

A 50% glycerol stock of Escherichia coli (strain DH5α) was used to inoculate 4

ml of LB media (1% tryptone, 0.5% bacto yeast extract and 1% sodium

chloride [pH 7.5]) supplemented with the appropriate antibiotic and the cells

were cultured in a 37℃ shaker overnight. Then the culture was divided into

1.5 ml and plasmid DNA was extracted.

E. coli cells were centrifuged at 12,000 g for 5 minutes. The supernatant was

decanted and pellet was resuspended in 100μl of Solution I (50mM glucose,

10mM EDTA [pH 8.0], 25mM Tris-HCl [pH 8.0]) stored at 4℃. After 10 minutes

incubation at room temperature, 200μl of freshly prepared SolutionⅡ (0.2N

sodium hydroxide and 1% sodium dodecyl sulphate) was added to each

sample to promote lysis of bacterial cell, degradation of cellular RNA. The

solution was thoroughly mixed by inverting the tubes. Then the samples were

chilled on ice for 20 minutes. 150μl of SolutionⅢ (3M sodium acetate [pH

4.8]) was added to each sample and thoroughly mixed before incubating for

45 minutes on ice. Then the samples were centrifuged at 12,000 g for 10

minutes at 4℃, the supernatant was then transferred to a new tube.

0.6 volume of isopropanol was added to each sample to precipitate plasmid

DNA. The samples were mixed by Vortex and incubated at room temperature

19

for 1 hour. Plasmid DNA was pelleted by centrifugation at 12,000 g for 5

minutes and then washed with 70% ethanol followed by 95% ethanol and air

dry to allow the evaporation of the remaining ethanol. The pellets were

resuspended in 50μl of TE-1 buffer and stored at -20℃.

3.1.2 GEL ELECTROPHORESIS

DNA and RNA samples were analyzed using electrophoresis. 1X TBE buffer

(0.1M Tris base, 0.5 M Boric acid, and 2mM EDTA [pH 8.0]) was used for

running buffer and agarose gel (1-2%) preparation. DNA or RNA samples were

dissolved or diluted in TE-1 buffer (1mM Tris-HCl [pH 8.0] and 0.1mM EDTA

[pH 8.0]) to a final volume of 8μl, mixed with 2μl of loading dye (0.25%

bromophenol blue, 20% glycerol). The whole volume of the sample was

loaded into the well and then subjected to electrophoresis at a constant

current 50mA and voltage 120V. Electrophoresis was stopped when the

bromophenol had migrated 3/5 down the agarose gel, then the gel was

stained with 1% ethidium bromide and observed under ultraviolet light

(300nm) with a trans-illuminator.

3.1.3 PHENOL-CHLOROFORM DNA/RNA PURIFICATION

Phenol-chloroform extraction was performed to purify the nucleic acid.

DNA/RNA was dissolved in 50μl of TE-1; an equal volume of water saturated

phenol was added to the sample. The sample was thoroughly mixed by vortex

and then centrifuged at 10,000g for 2 minutes. 40μl of the top phase was

transferred to a new tube and meanwhile 50μl of TE-1 was added to the

20

original tube. The tube was “vortexed” to mix and centrifuged for 2 minutes.

Again the 50μl of top phase was transferred to the new tube. The original

tube was then discarded.

Two volume of water saturated chloroform (stored at 4℃) was added to the

new tube which contain the transferred top phase to remove phenol. The

tube was inverted several times to thoroughly mix and centrifuged for 2

minutes. The bottom phase (chloroform) was removed and then this step was

repeated. After the second time the chloroform was removed, the aqueous

phase which contains DNA/RNA was transferred to a new tube. Sodium

acetate was added to 0.1M final concentration. Two and a half volume of 95%

ethanol (store at -20℃) was added to improve DNA/RNA precipitation. The

sample was thoroughly mixed and stored at -20℃ overnight or 3 hours at

-80 . The DNA/RNA was centrif℃ uged at 10,000g for 10 minutes at -4 . The ℃

supernatant was discarded and the pellet was first washed with 70% ethanol

then 95% ethanol. The sample was allowed to air dry until all ethanol had

evaporated.

3.1.4 POLYMERASE CHAIN REACTION

Polymerase Chain Reaction (PCR) was used for confirmation of gene presence

in the chromosomal DNA of transgenic plant. A 25μl was prepared using

12.5μl of PCR Master Mix, 2X (Promega) (50 unites/ml Taq polymerase

supplied in a proprietary reaction buffer [pH 8.5], 400μM dATP, 400μM dGTP,

400μM dCTP, 400μM dTTP, 3mM MgCl2), 1μl each of 10μM forward and

21

reverse primers, 1-3μl of DNA template (plasmid, chromosomal DNA or

cDNA), add autoclaved water to final volume 25μl. The mixture was mixed

and 30μl of mineral oil was added to the surface of the mixture to prevent

the evaporation during PCR. PCR conditions are as followed:

Temperature Time(min:sec) Number of cycles

94℃ 3:00 1X

94℃ 0:30 35X

Primer specific annealing temperature 0:30 35X

72℃ 1:00 35X

72℃ 10:00 1X

4℃ forever

3.1.5 REVERSE TRANSCRIPTION (RT)-POLYMERASE CHAIN REACTION

The confirmation of viral presence in plant tissues and transgene

transcription in transgenic plant was achieved by RT-PCR following RNA

extraction. RNA was first reverse transcribed into cDNA: 1000ng of total RNA

was dissolved in 11μl of DEPC-treated water, mixed with 1μl of 10μM gene

specific reverse primer. The sample was boiled for 3 minutes and then

quickly chilled on ice for 5 minutes. The following reagents were added: 5μl

M-MLV RT 5X Reaction buffer (250mM Tris-HCl [pH 8.3 at 25℃], 375mM KCl,

15mM MgCl2, and 50mM DTT), 1.25μl 10μM dATP, 1.25μl 10μM dCTP, 1.25μl

10μM dCTP, 1.25μl 10μM dTTP and 1μl M-MLV RT (H-) Point Mutant

(100units). Add DEPC-treated water to a 25μl final volume. The sample was

22

then mixed and incubated at 40℃ for 60 minutes. Then the reaction was

inactivated by heating at 80℃ for 15 minutes. Once the first-strand synthesis

was completed, 2μl of prepared cDNA sample was used as template for PCR.

3.1.6 PREPARATION OF COMPETENT CELLS AND TRANSFORMATION OF A.

TUMEFACIENS

A glycerol stock of Agrobacteria tumefaciens (strain GV3101), was used to

inoculate 4 mL of LB media and supplemented with 30 µg/ml Gentamycin.

The culture was grow overnight on a 28°C shaker. Next day, 1 ml of the

culture was added to 25 ml fresh LB media supplemented with Gentamycin

(30µg/ml). The cells were set on a 28°C shaker for an additional 4 hours, until

OD595 reached 0.4-0.6. The culture was then chilled on ice for 20 minutes and

split into two tubes of 10 ml before centrifuging at 3,000 g for 15 minutes at

4°C. The supernatant was then discarded and the pellet was resuspended in 1

ml of ice-cold 20mM calcium chloride solution. 100µl aliquots of this

suspension were distributed into pre-chilled tubes and left on ice for 15

minutes. 50ng of plasmid phenol-chloroform extracted DNA from E.coli mini

prep of confirmed clone was then added to cells.

Next, cells were frozen by immersing tubes containing competent A.

tumefaciens and desired plasmid into liquid nitrogen for 5 minutes, followed

by a thawing period of 5 minutes at 37°C. After the addition of 1 ml LB media

to each sample, tubes were incubated for 3 hours at 28°C with gentle shaking.

Cells were then pelleted by centrifugation at 12 000 g for 1 minute at room

23

temperature, and 1 mL of supernatant was discarded. Cells were

resuspended in the remaining 100 µL supernatant and evenly plated on LBA

plates supplemented with 50µl/ml Kanamycin and 30 µg/ml Gentamycin (for

selection). Plates were inverted and incubated at 28°C for 2-3 days (until

appearance of colonies), then stored at 4°C. Single colonies were selected

and grown in 4 mL LB media supplemented with 50 µl/ml Kanamycin and 30

µg/ml Gentamycin in a 28°C shaker. Cells were pelleted by centrifuge at

10,000g for 5 minutes, resuspended the pellet in 10mM MES

[2-(N-morpholino) ethanesulfonic acid] pH 5.7, 10mM MgCl2 (pH 5.7) and

100µM Acetosyringone. The cells were incubated at room temperature for 5

hours at a shaker (100 rpm). The cells were then pelleted by centrifuge at

10,000g for 3 minutes. The pellet was then resuspended in 1ml 10mM MES

buffer and ready for infiltration.

3.2 CONFIRMATION OF THE TRANSGENIC PLANT

3.2.1 CHROMOSOMAL DNA EXTRACTION FROM PLANT TISSUE

CTAB buffer (2% CTAB [hexadecyltrimethylammonium bromide], 20mM EDTA,

100mM Tris-HCl [pH 8.0], 1.4M NaCl) was pre-heat at 65 water bath. 0.1g ℃

fresh young leaf was ground with 400μl CTAB buffer as well as 20μl

β-mercaptoethanol (added just before grinding). The CTAB/plant tissue

mixture was transferred to a new 1.5ml tube with 1ml tip. The tube was

incubated at 65℃ for 30 minutes (invert tube gently every 10 minutes). After

30 minutes incubation, 400μl chloroform: Iso amyl alcohol was added to the

24

tube, and mixed by inverting several times until the color of chloroform

become green. The sample was centrifuged at 14,000g for 10 minutes. The

supernatant was carefully transferred to a new tube without disturbing the

interference protein. 1 volume of Isopropanol (store at 4℃) was added and

mixed by inverting several times. The tube was centrifuged at 10,000g for 5

minutes and the supernatant was discarded. The pellet was washed 2 times

with 70% ethanol and then air dry to allow ethanol evaporated. The pellet

was then dissolved in 50μl TE-1 for future use.

3.2.2 TOTAL RNA EXTRACTION FROM PLANT TISSUE

To confirm transgenic plant as well as viral presence in infected plant tissues,

total RNA was extracted. Mortar and pestle were treated with bleach and

then cooled with liquid nitrogen. Subsequently the leaf sample was added to

the mortar and frozen with liquid nitrogen before homogenized as fine

powder. The frozen powder was quickly transferred to a sterile DEPC-treated

1.5ml tube which contain 500μl of 25:24:1 phenol: chloroform: isoamyl

alcohol solution, vortex to mix, another 500μl of 0.1M Tris-HCl (pH 7.4) was

added to the mixture and again vortex to mix (all solutions were treated with

DEPC). The mixture was centrifuged at 10,000g for 5 minutes. Supernatant

(450μl) was transferred to new DEPC-treated tube and washed twice with 2

volumes (900μl) of water saturated chloroform. After the second time

remove chloroform, the tube which only contains the top phase was

centrifuged at 10,000g for 2 minutes to further remove chloroform residual.

25

The supernatant was transferred to a new 1.5ml DEPC-treated tube. 3M

sodium acetate (pH 5.2) was added to the sample to a 0.1M final

concentration along with 2-2.5 volumes of ice-cold 95% ethanol. The sample

was thoroughly mixed by inverting several times and incubated at -20 ℃

overnight or 3 hours at -80 . RNA sample was then pelleted ℃ by centrifuge at

4 for 20 minutes. ℃ The pellet was first washed with 70% ethanol then 95%

ethanol. The sample was allowed to air dry until all ethanol had evaporated.

Then the pellet was dissolved in TE-1 buffer for further use.

3.2.3 DNASE TREATMENT

To ensure the accuracy of RT-PCR analysis, RNA sample was treated with

DNase I prior to cDNA synthesis. RNA pellet was dissolved in 21.5μl of sterile

DEPC-treated water; 2.5μl of 10X reaction buffer was added (100mM Tris-Hcl,

25mM MgCl2, 5mM CaCl2, pH 7.6 at 25℃). 1μl of DNase I (2000units/ml) was

added to the mixture, mix thoroughly and then incubated at 37 for 30 ℃

minutes. All protein including DNase I was removed by phenol-chloroform

extraction before RT-PCR.

3.3 GENERATION OF ANTIBODYS AND IMMUNOBLOTTING

3.3.1 ELECTROELUTION OF PROTEIN FROM SDS-PAGE GELS

Electroelution have been extensively used to purify protein. In this method,

protein zones are localized after electrophoresis by staining with Coomassie

brilliant blue. The gel pieces which contain protein of interest were then

excised and placed in an electroelution chamber where the proteins are

26

transferred in an electric field from the gel into the solution and concentrated

over a dialysis membrane. The SDS-PAGE gel was run according to a standard

method until a maximum separation of protein of interest was obtained. One

vertical strip on the side of the gel was cut and stained in Coomassie blue, the

rest of the gel still sitting in the running buffer. The stained piece of gel was

realigning to the rest of the gel, a long horizontal slice at the level of the band

of interest was cut. The long strip was cut into about 1cm pieces and put into

electroelution chamber. The electroelution was performed at 100V overnight.

Once the elution was completed, the eluate was removed from the

electroelution chamber. The purified protein was then concentrated and

stored at -80℃ for polyclonal antibody production.

3.3.2 POLYCLONAL ANTIBODY PRODUCTION

Two-month old female rabbit was used for the polyclonal antibody

production. 5-10ml of pre-immune blood was collected from the marginal ear

vein in rabbit just a few days before the injection. Clipper blade was used to

cut a large rectangle on rabbit back covering the proposed injection sites. The

injection site was disinfected with 70% ethyl alcohol. 0.5ml of purified TRoV

(2.3mg/ml) was combined with 0.5ml Freund’s Incomplete Adjuvant (FIA) and

mixed thoroughly by pipetting. The mixed sample was then injected

subcutaneously to a volume of 0.2ml per site into 5 shaved sites. Another

booster injection was given at two weeks intervals following the same

procedure. Exsanguination was performed after 2 weeks following the second

27

booster injection, with approximate 100ml of blood was harvested using

cardiac puncture. Blood was divided into two 50ml tubes and left undisturbed

overnight at 4 to allow clotting. Tubes were centrif℃ uged at 10,000g for 10

minutes the next day; the serum was transferred to a new tube and stored at

-80 .℃

3.3.3 TOTAL PROTEIN EXTRACTION

Leaf samples were added to autoclaved mortars with liquid nitrogen and

ground to a fine powder. The powder was transferred to a new 1.5ml tube

which contains 100μl Protein Extraction Buffer (50mM Tris-HCl [pH 7.5],

15mM MgCl2, 0.1mM Phenylmethanesulfonyl fluoride [PMSF] (added just

before use), 18% glycerol, 2% Triton X-100, 0.5% NP40, and 0.7%

β-mercaptoethanol [added just before use]) with a flame-sterilized scapula.

The sample was thoroughly mixed by vortex, and then centrifuged at 10,000g

for 5 minutes. The supernatant was transferred to a new tube and stored at

-20 .℃

3.3.4 PROTEIN QUANTITATION

The standard protein curve which is a plot of the protein concentration of

known amounts of BSA protein versus their OD595 values was made before

determine the concentration of crude extraction sample. 7 known protein

concentration showed in Table 2 was used to generate the standard curve

and each concentration was made up in duplicate to generate the standard

curve. The standard curve reagents ware prepared according to the Table 2.

28

All samples were incubated 5 minutes at room temperature before measure

the OD595. Set up the UV spectrophotometer to 595 nm, blank with 1 ml of

ddH2O. The reading of the spectrophotometer was recorded in the Table 2 to

create the standard curve. The protein extraction sample was prepared,

mixed and incubated for 5 minutes and then measure the OD595. Then

concentration of the crude sample can be determined using standard curve.

Table 2: Amount of reagent and spectrophotometer

Reading of different concentration of BSA protein

Sample

name

Amount of

BSA

Volume of

1mg/ml

BSA

Volume of

ddH2O

Volume of

Bradford

Reagent

OD595 Average

OD595 from

2 replicates

0 0μg 0μl 200μl 800μl 0.434 0.446

0 0μg 0μl 200μl 800μl 0.458

1 1μg 1μl 199μl 800μl 0.476 0.4915

1 1μg 1μl 199μl 800μl 0.507

2.5 2.5μg 2.5μl 197.5μl 800μl 0.700 0.6675

2.5 2.5μg 2.5μl 197.5μl 800μl 0.635

5 5μg 5μl 195μl 800μl 0.754 0.7425

5 5μg 5μl 195μl 800μl 0.731

7.5 7.5μg 7.5μl 192.5μl 800μl 0.975 0.9725

7.5 7.5μg 7.5μl 192.5μl 800μl 0.970

10 10μg 10μl 190μl 800μl 1.097 1.094

10 10μg 10μl 190μl 800μl 1.091

20 20μg 20μl 180μl 800μl 1.421 1.3905

20 20μg 20μl 180μl 800μl 1.360

30 30μg 30μl 170μl 800μl 2.003 1.995

30 30μg 30μl 170μl 800μl 1,987

29

3.3.5 SDS-PAGE GEL

The gel cassette was first set up in the casting stand, the comb was placed in

between the two plates and the place where is about 1 centimeter down

from the teeth of the comb was marked a short line as the position of the

height of the resoling gel.

12% resolving gel was made by combining 3.3ml of ddH2O, 2.5ml 1.5M

Tris-HCl (pH 8.8), 100μl of 10% SDS, and 4ml of 30%

Acrylamide/Bisacrylamide (29:1). These reagents were mixed gently without

introducing any air bubbles. 100μl of 10% Ammonium persulfate (APS) and

5μl of T.E.M.E.D. were added just right before casting. Wait for 30 minutes

until the gel was polymerized. After the resolving gel was fully polymerized, 5%

stacking gel was made by combining 1.7ml of ddH2O, 315μl of 1 M Tris-HCl

(pH 6.8), 25μl 10% SDS, and 415μl 30% acrylamide/bisacrylamide (29:1). 25μl

of 10% APS and 5μl of T.E.M.E.D. were added to the stacking gel solution and

mixed gently right before casting. Then the comb was slowly inserted wait for

30 minutes until the stacking gel was polymerized.

The crude protein extracts samples were retrieved from -20℃. 40μl of the

each sample and 10μl of 5X SDS loading dye (250mM Tris-HCl [pH 6.8], 10%

SDS, 1.42M β-mercaptoethanol, 50% glycerol) was mixed in a new tube and

then boiled for 5 minutes in the boiled water. After centrifuged at 10,000g for

5 minutes, 40μl of each sample was loaded into the well. Gel electrophoresis

was performed at 100 V for 20 minutes, and then increase the voltage to 150

30

V until the blue dye reached the bottom with 1X SDS-PAGE electrophoresis

buffer (5mM Tris-HCl [pH 8.3], 50mM glycine, 0.5% SDS).

3.3.6 WESTERN BLOTTING

Transfer sandwich was set up using nitrocellulose membrane, pre-wet in 1X

transfer buffer (38.7mM glycine, 0.5M Tris, 20% methanol); the SDS-PAGE gel

was on the side of the black portion of transfer cassette while the

nitrocellulose membrane was on the top of gel towards the transparent side.

Both the transfer cassette and the loaded transfer sandwich were placed into

the transfer chamber, such that the black side of cassette faced the black side

of transfer sandwich. Transfer was performed at 100V for one hour. After

transferring, the membrane was blocked in 50ml of TBS buffer (50mM

Tris-HCl [pH 7.5], 150mM NaCl) with 5% skimmed milk for five hours. Then

100μl of primary antibody was added to a new tube which contains 50ml of

TBS with 0.5% skimmed milk. The membrane was incubated in this solution

overnight at 4 in a shaker.℃

Next day, membrane was washed 4 times with 50ml TBS containing 0.05%

Tween-20, 10 minutes for each washing. Then the membrane was incubated

two hours with 10μl of alkaline phosphatase conjugated affinity with 15ml of

TBS with 0.5% skimmed milk. The treated membrane was then washed with 3

times TBS-tween-20, each washing 10 minutes then a final washing with TBS

only for 10 minutes. Alkaline phosphatase substrate was added to the treated

membrane to let the result come out.

31

3.4 INFECTIVITY ASSAYS OF TRoV AND LTSV sat RNA

Turnip plants, grow under standard conditions in a greenhouse, were used for

infectivity assay. Turnip leaf samples which already infected with TRoV was

retrieved from -20℃, and grinding well in a sterilized mortar with Phosphate

buffer to obtain TRoV virion. For test, two week-old healthy leaves were

mechanically inoculated, two leaves per plant, lightly dust with

Carborundum, then brushed with TRoV virion, LTSV sat RNA, or both by

cotton gently. Inoculated plants were then returned to the greenhouse and

maintained until newly-grown, naïve leaves were collect.

3.5 TRANSIENT INFECTIVITY ASSAY

Plants were removed from the growth chamber and placed under white

fluorescent lamp for 1 hour before infiltration. Two large leaves were then

labeled prior to infiltration. Resuspended Agrobacterium samples were then

siphoned in a 1ml syringe (no needle). The region of the leaf to be infiltrated

was prepared by gently rubbing a small region of the underside of the leaf

with a syringe (needle removed). The tip of the syringe was placed against

the underside of the marked region and the plunger was gently press down

with the finger supporting the upper side of the leaf. The infiltration was

repeated for the other area of the same leaf until the whole leaf was

infiltrated. Infiltrated plants were place back to the growth chamber under

normal growth conditions. After 72 hours, the plants were ready for the

subsequent experiment.

32

4 RESULTS:

4.1 PRODUCTION OF TRANSGENIC N. BENTHAMIANA PLANTS

To examine the independent packaging ability of LTSV sat RNA, a construct

had been previously constructed in the lab with the TRoV capsid protein gene

and LTSV satellite dimer sequence in tandem. The TRoV capsid gene was

cloned using a forward primer with an incorporated KpnI sequence and a

reverse primer containing an XbaI restriction site; the insert incorporated the

natural start and stop codons of the capsid protein gene. The confirmed

constructs were subsequently used for sub-cloning with the LTSV satellite

dimer insert. Prospective forward- and negative- sense clones were

confirmed by sequencing. The transgenic plant which has forward sense LTSV

sat dimer clone (Figure 6a) was named TROVCP_LTSVsatF while the plant

which contains reverse sense LTSV sat dimer clone (Figure 6b) was named

TROVCP_LTSVsatR. TROVCP_LTSVsatF and TROVCP_LTSVsatR are identical

except for the LTSV satellite (positive sense F and negative sense R).

33

Figure 6: Schematic representation of TROVCP_LTSVsat constructs. The TRoV capsid protein

gene (TROVCP) is cloned between the KpnI and XbaI restriction sites of modified pCambia 1300,

and the LTSV satellite dimer insert is cloned at the XbaI site; both forward (F) and reverse (R)

orientations are produced. SmaI restriction sites were used to determine orientation of LTSV

satellite dimer insert. All elements downstream of the cauliflower mosaic virus (CaMV) 35S

promoter are destined for transcription, ending at the nopaline synthase terminator (Tnos).

TROVCP possesses independent translational start and stop (TAG, indicated) codons. sGFP

denotes synthetic green fluorescent protein. Thick arrows indicate the nucleotide sequence of

LTSV dimer (clockwise orientation represents positive-sense sequence of LTSV and counter

clockwise represents the negative-sense). Thin arrows represent the locations of ribozyme splice

sites.

4.2 CONFIRMATION OF TRANSGENIC PLANTS

Seeds from one line of transgenic N. benthamiana were selected and

screened on 20μg/ml Hygromycin in 1/2 x Murashige & Skoog (MS) medium

(Figure 7). Germinating plants were considered putative transgenics and were

transferred to the soil. Resistance to the antibiotic Hygromycin was used as a

selection marker to distinguish between transgenic and non-transgenic plants

(Figure 7 (a) and (b)).

34

Figure 7: Transgenic seeds screening. (a) Seeds of transgenic N. benthamiana were screened on

20μg/ml Hygromycin in 1/2 x MS medium; (b) Seeds of wild type N. benthamiana were screened

on 20μg/ml Hygromycin in 1/2 x MS medium.

4.2.1 DETECTION OF TRANSGENE DNA IN CHROMOSOMAL DNA OF

TRANSGENIC N. BENTHAMIANA PLANTS

After four week of growth, transgenic N. benthamiana, leaf samples were

collected for chromosomal DNA extraction and PCR confirmation for the

presence of transgene. Three different sets of primers were used in these

experiments: a) primers to detect the CP protein (750 bp), b) primers to

detect the LTSV satellite RNA (200 bp and 522bp) and c) primers to detect the

GFP gene (760 bp).

Forward primer (TROVCP_F) and reverse primer (TROVCP_R) were used for

PCR amplification of the CP gene. A 750 base pair (bp) product was

obtained from the chromosomal DNA of the transgenic plants (Figure 8). In

lane B, RT-PCR product of TRoV infected turnip plant total RNA used as a

positive control. Lanes C and D both show bands at the expected size (750 bp),

indicating the presence of the transgene in the transgenic N. benthamiana

35

plants. As expected non transformed plants (used as a negative control) did

not show the presence of the 750 bp (Figure. 8, Lane E).

For the identification of the LTSV satellite RNA, another PCR was performed

using LTSVsat_F and LTSVsat_R as forward and reverse primers. A 200 bp DNA

fragment corresponding to LTSV sat RNA as well as a 522 bp product were

shown due to presence of the dimer (200 bp + 322 bp)(Figure 9). Both lanes B

and C showed specific bands of the correct size, while in lane D (DNA from

healthy untransformed plant used as a negative control) showed no specific

bands (only bands for unused primers), confirming that both transgenic N.

benthamiana plants have the transgenes.

To verify the presence of DNA corresponding to GFP gene, GFP_F and GFP_R

primers were used to detect the presence of the Green Florescent Protein

(GFP) gene. A 760 bp product was produced only from the transgenic N.

benthamiana plants (Figure 10). Both Lane B and C showed strong band at

the expected molecular weight, while the absence of a 760 bp band in wild

type plant (Lane D) confirmed the presence of GFP gene in both transgenic

plants.

36

Figure 8: PCR confirmation of capsid protein transgene in TROVCP_LTSVsat transgenic N.

benthamiana. Chromosomal DNA was extracted from TROVCP_LTSVsatF, TROVCP_LTSVsatR N.

benthamiana and wild type N. benthamiana. PCR was performed using primers for the capsid

protein (TROVCP_F, TROVCP_R) and PCR products were analyzed on a 2% agarose gel. Lane A:

100 bp DNA size markers. Lane B: TROVCP PCR product from RT-PCR on TRoV RNA (positive

control for primers) Lane C: TROVCP PCR product from TROVCP_LTSVsatF (+sense RNA) transgenic

N. benthamiana chromosomal DNA extraction. Lane D: TROVCP PCR product from

TROVCP_LTSVsatR (-sense complementary RNA) transgenic N. benthamiana chromosomal DNA

extraction. Lane E: TROVCP PCR product from wild type (non-transformed plant as a negative

control) N. benthamiana chromosomal DNA extraction. Bands which are less than 100 bp are

probably unused primers/nucleotides.

37

Figure 9: PCR confirmation of LTSV satRNA transgene in TROVCP_LTSVsat transgenic N.

benthamiana. Chromosomal DNA was extracted from TROVCP_LTSVsatF, TROVCP_LTSVsatR N.

benthamiana and wild type N. benthamiana. PCR was performed using internal primers for the

LTSV sat (LTSVsat_FLTSvsat_R) and PCR products were analyzed on a 2% agarose gel. Lane A:

100 bp DNA ladder. Lane B: LTSV sat PCR product from TROVCP_LTSVsatF transgenic N.

benthamiana chromosomal DNA extraction. Lane C: LTSV sat PCR product from TROVCP_LTSVsatR

transgenic N. benthamiana chromosomal DNA extraction. Lane D: LTSV sat PCR product from wild

type N. benthamiana chromosomal DNA extraction. Bands which are less than 100 bp are

probably unused primers.

38

Figure 10: PCR confirmation of Green fluorescent protein transgene in TROVCP_LTSVsat

transgenic N. benthamiana. Chromosomal DNA was extracted from TROVCP_LTSVsatF,

TROVCP_LTSVsatR N. benthamiana and wild type N.benthamiana. PCR was performed using

primers for the GFP (GFP_F and GFP_R) and PCR products were analyzed on a 2% agarose gel.

Lane A: 100 bp DNA ladder. Lane B: GFP PCR product from TROVCP_LTSVsatF transgenic N.

benthamiana chromosomal DNA extraction. Lane C: GFP PCR product from TROVCP_LTSVsatR

transgenic N. benthamiana chromosomal DNA extraction. Lane D: GFP PCR product from wild

type N. benthamiana chromosomal DNA extraction. Bands which are less than 100 bp are

probably unused primers.

39

4.2.2 ANALYSIS OF TRANSCRIPTION PRODUCTS IN TRANSGENIC PLANTS

To determine the proper transcription of the transgenes in transgenic plants,

total RNA was extracted from transgenic plants and used in the following

experiments:

a. Quality of total RNA was verified by gel electrophoresis as shown in

Figure 11. As seen in lanes A and B the quality of cellular ribosomal

RNA is quite good implying that mRNAs transcripts must also be

intact.

Figure 11: Quality check of total RNA from transgenic N. benthamiana. RNA was extracted from

TROVCP_LTSVsatF and TROVCP_LTSVsatR, and due to high susceptibility to degradation, was

40

verified RNA quality on 1% RNA gel. 25S rRNA, 23S rRNA, 18S rRNA, 16S rRNA and tRNA were

indicated. Lane A: Total RNA extraction from TROVCP_LTSVsatF transgenic plant. Lane B: Total

RNA from TROVCP_LTSVsatR transgenic plant.

b. To verify that RNA preparations were not contaminated by

chromosomal DNA, RNA samples were first treated with DNases, and

then extracted with phenol-chloroform and precipitation by ethanol.

RNA concentrations were measured using spectrophotometer (see

Table 3). Gel electrophoresis further indicated the quality of the of the

RNA sample (see Figure 12).

Table 3: Spectrophotometer reading of RNA

TROVCP_LTSVsatF RNA sample

after DNase treatment

TROVCP_LTSVsatR RNA sample

after DNase treatment

OD260/ OD280 1.923 1.889

Concentration (ng/μl) 272 255

41

Figure 12: Quality of RNA samples before and after DNase treatment. Both RNA samples of

transgenic plants were subjected to DNase treatment to ensure no genomic DNA was exist in the

RNA sample. Due to RNA susceptibility to degradation, the quality of the RNA was verified by gel

electrophoresis. Genomic DNA was indicated. Lane A and lane C: TROVCP_LTSVsatF and

TROVCP_LTSVsatR RNA samples before DNase treatment. Lane B and lane D: TROVCP_LTSVsatF

and TROVCP_LTSVsatR RNA samples post DNase treatment.

The result in Table 3 showed that the ratio of OD260/OD280 is approximately

1.9, indicating that the RNA sample is free from proteins. Gel electrophoresis

reveals that the RNA quality is good. Bands corresponding to ribosomal RNAs

seem to be intact indicating that the quality of RNA is good. Contaminating

chromosomal DNA bands (seen on top of the gel) were not visible after

DNase treatment and presumably the total RNA samples are free from

contaminating DNAs.

42

c) Analysis of RNA transcripts from transgenic plants:

DNA free RNA samples were used for RT-PCR experiments. Three different

experiments were conducted to determine the expression of each of the

three genes in the transgene construct: TRoVCP, LTSV satellite and GFP genes.

All different treatments were using the same amount RNA (1000ng). A

negative control to determine that the RNA was not contaminated with DNA

was used. For RT-PCR experiments, 1μl of DEPC water rather than reverse

transcriptase was added. As seen in Lane D, and Lane J (Figure 13) no bands

were visible confirming that both transgenic RNA samples from transgenic

plants (TROVCP_LTSVsatF and TROVCP_LTSVsatR) were DNA free (only bands

for unused primers were shown), and revealed that the product of RT-PCR

derived from the cDNA and was not a contamination from genomic DNA.

43

Figure 13: PCR and RT-PCR results of genomic and transcripts of TRoV capsid protein, LTSV sat

RNA and GFP construct in transgenic N. benthamiana plants. RNA samples were used after

DNase treatment were used for the cDNA synthesis, followed by the PCR, using LTSVsat_F and

LTSVsat_R, Actin_F and Actin_R, GFP_F and GFP_R, and TROVCP_iF and TROVCP_iR respectively.

PCR products were analyzed on 2% agarose gel to determine the transcription of transgene in

transgenic plants. Lanes A and H: 100 bp molecular weight DNA size markers. Lane B: 210 bp

product from genomic DNA of transgenic N. benthamiana, using Actin primers. Lane C and Lane I:

RT-PCR product from TROVCP_LTSVsatF and TROVCP_LTSVsatR transgenic plants, using Actin_F

and Actin_R primer (positive control for the cDNA synthesis for RT-PCR). Lane D and Lane J:

negative control for the RT-PCR, using TROVCP_LTSVsatF and TROVCP_LTSVsatR RNA samples

after DNase treatment without reverse transcriptase, to confirm there is no genomic DNA

remaining in the RNA samples. Lane E: PCR product of genomic DNA from transgenic plant using

LTSVsat_F and LTSVsat_R primers (positive control for the primers). Lane F: RT-PCR product from

TROVCP_LTSVsatF transgenic plant, using LTSVsat_F and LTSVsat_R primers. Lane G: RT-PCR

product from TROVCP_LTSVsatR transgenic plant, using LTSVsat_F and LTSVsat_R primers. Lane K:

PCR product of genomic DNA from transgenic plant using GFP_F and GFP_R primers (positive

control for the primers). Lane L and Lane M: RT-PCR product from TROVCP_LTSVsatF and

TROVCP_LTSVsatR transgenic plant respectively, using GFP _F and GFP_R primers. Lane N: RT-PCR

product from TRoV RNA using TROVCP_iF and TROVCP_iR internal primers (positive control for

primers). Lane O and Lane P: RT-PCR products from TROVCP_LTSVsatF and TROVCP_LTSVsatR

transgenic plant respectively, using TROVCP_iF and TROVCP_iR primers. Bands which are less

than 100 bp are probably unused primers.

44

As shown in Figure 13 lanes B is positive control using Actin to indicate that

Actin primers were functional with genomic DNA. Lanes C and I are RT-PCR

results using Actin primers which showed a 210 bp product, indicating that

cDNA synthesis conditions are optimal and the quality of both RNA samples is

suitable for cDNA synthesis. Lane E is a positive control for the LTSV satellite

primers (using genomic DNA). RT-PCR results of LTSV sat RNA for both

transgenic plants showed that they can successfully transcribe sat RNA

monomer, as only one single 200 bp band appeared (Figure 13 Lane F and

Lane G). While RT-PCR results of TRoV capsid protein and GFP showed only

bands less than 100 bp which probably come from unused primers. These

results indicated that the transcripts of the TRoV capsid protein and GFP were

not detectable (Figure 13 Lanes L, M, O and P). Lanes K and N are positive

controls for GFP and TRoV capsid protein primers using genomic DNA. The

results of RT-PCR indicated that either the capsid protein and GFP mRNAs

were not transcribed or the transcripts were not stable. Since the satellite

RNA was clearly transcribed, it is likely that the CP and GFP transcripts

originated from the same RNA transcript (driven by the 35S promoter) were

also transcribed. However, the absence of any RT-PCR bands related to these

2 genes clearly proves that both CP and GFP RNAs were not stable.

45

4.3 ANTIBODY GENERATION AND IMMUNOBLOTTING

4.3.1 PROTEIN PURIFICATION

To determine if TRoV capsid protein translation was occurring in transgenic

plants, polyclonal antibodies were raised against TRoV capsid protein. TRoV

capsid protein was first cloned in pET-29 Escherichia coli (E. coli) and total

protein was isolated and electrophoresed on the SDS-PAGE. Electroelution

was used to purify the specific protein. SDS-PAGE gel was run to confirm the

purified TRoV capsid protein (Figure 14).

Figure 14: SDS-PAGE of purified TRoV capsid protein. Total protein was extracted from E. coli

harboring TRoV capsid protein gene clone (pET29c plasmid). Lane A: Protein molecular weight

Ladder (molecular weights 30 KDa, 40 KDa, 50 KDa, 60 KDa, 80 KDa, 100 KDa and 150 KDa

from bottom to top respectively). Lane B: SDS-PAGE result of naive E. coli total protein extraction

(after IPTG induction). Lane C: SDS-PAE results of total E. coli expressing TRoV capsid protein

cloned in pET-29 plasmid (after IPTG induction). Lane D: Purified TRoV protein sample after

electroelution prior to injection into a rabbit.

46

In figure 14, the thick band of 30 KDa protein in the transgenic lane

corresponds to TRoV capsid protein. Electroelution mediated purification was

performed to prepare capsid protein sample to be injected in a rabbit for

generation of polyclonal antibody.

4.3.2 WESTERN BLOTTING

Following total protein extraction from the leaf samples, the crude protein

samples were prepared, mixed according to Table 4, and incubated for 5

minutes before measuring their OD595 using spectrophotometer. Results are

listed in Table 4.

Table 4: Bradford Assay to quantitate the amount of proteins used for western blotting.

Sample Volume

of Protein

sample

Volume of

ddH2o

Volume of

Bradford mix

OD595 Average OD595

from 2 replicates

Wild type N.

benthamiana

5μl 195μl 800μl 1.803 1.726

5μl 195μl 800μl 1.649

TROVCP_LTSV

satF N.benth

5μl 195μl 800μl 1.758 1.762

5μl 195μl 800μl 1.766

TROVCP_LTSV

satR N. benth

5μl 195μl 800μl 1.698 1.704

5μl 195μl 800μl 1.710

Healthy turnip

plant

5μl 195μl 800μl 1.690 1.687

5μl 195μl 800μl 1.684

Turnip plant

infected by TRoV

5μl 195μl 800μl 1.702 1.687

5μl 195μl 800μl 1.672

The Bradford Assay standard protein curve was made according to Table 2,

the concentration of protein crude extraction sample was then determined by

plotting the O.D. reading onto the standard curve (shown in Figure 15).

47

Figure 15: Bradford assay showing concentrations of protein samples (in μg/ml). Each sample

was incubated at room temperature for 5 minutes before subjected to spectrophotometric

measurement. BSA: Bradford Assay standard protein curve. Wild type N. Benthamiana: Protein

extraction of wild type N. benthamiana. F sense transgenic: Protein extraction of

TROVCP_LTSVsatF transgenic plant. R sense transgenic: Protein extraction of TROVCP_LTSVsatR

transgenic plant. Healthy turnip: protein extraction of healthy turnip plant. Infected turnip:

Protein extraction of turnip plant infected by TRoV.

From Figure 15, the concentration of 5 protein samples can be determined by

plotting the spectrophotometer reading on to the standard curve. Using the

standard curve we can then determine the concentration of the sample

subjected to the spectrophotometric measurement. The original sample’s

concentration is 200 times greater than the sample subjected to

spectrophotometric measurement, thus allowing calculation of the crude

48

protein extraction sample concentration (Table 5).

Table 5: Protein concentration for western blotting

Sample Concentration (μg/ml)

Wild type N. benthamiana 5045

TROVCP_LTSVsatF N.benth 5194

TROVCP_LTSVsatR N. benth 4955

Healthy turnip plant 4882

Turnip plant infected by TRoV 4882

Protein samples were then used for western blotting. The western result was

shown in Figure 16. Purified TRoV sample work as positive control, showed a

specific band at 30 KDa (Figure 16, Lane A), indicating the polyclonal antibody

of TRoV is effective. TRoV infected turnip plant protein sample also showed

specific band indicating that protein extraction method and western blotting

condition is optimal (Figure 16, Lane G). Both TROVCP_LTSVsatF and

TROVCP_LTSVsatR transgenic N. benthamiana protein extract didn’t show

specific band, indicating there was no expression of TRoV capsid protein in

transgenic plants (Figure 16, Lane C and Lane D). While wild type N.

benthamiana and healthy turnip protein samples were used as negative

control and showed no specific band (Figure 16, Lane E and Lane F).

The result of the western blotting further confirms there was no TRoV capsid

protein expressed in the transgenic plant.

49

Figure 16: Western blotting using anti-TRoV antisera across dilution of purified virus and total

protein extracts to detect the presence of the TRoV capsid protein. Lane A: Purified TRoV

sample. Lane B: Protein molecular weight Ladder (molecular weights 20 KDa, 25 KDa (green), 35

KDa, 48 KDa, 63 KDa, 75 KDa (red) and 100 KDa, 135 KDa and 180 KDa from bottom to top

respectively). LaneC: Total protein extarction of TROVCP_LTSVsatF transgenic plant. Lane D:

Total protein extarction of TROVCP_LTSVsatR transgenic plant. Lane E: Total protein extarction of

wild type N. benthamiana. Lane F: Total protein extraction of healthy turnip plant. Lane G: Total

protein extraction of turnip plant which infected by TRoV.

50

4.4 AGROBACTERIUM MEDIATED TRANSIENT INFECTIVITY

ASSAY

To test whether TRoV capsid protein gene is expressed in the N. benthamiana

plant, a clone was constructed with TRoV capsid protein(Figure 17). TRoV

capsid gene was cloned using a forward primer with an incorporated KpnI

sequence and a reverse primer containing an XbaI restriction site; the insert

incorporated the natural start and stop codons of the capsid protein gene.

Figure 17: Schematic representation of TROVCP constructs. The TRoV capsid protein gene

(TROVCP) is cloned between the KpnI and XbaI restriction sites of modified pCambia 1300. All

elements downstream of the cauliflower mosaic virus (CaMV) 35S promoter are destined for

transcription, ending at the nopaline synthase terminator (Tnos). TROVCP possesses

independent translational start and stop (TAG, indicated) codons. sGFP denotes synthetic green

fluorescent protein.

The confirmed construct was then transformed to Agrobacterium to infiltrate

the healthy N. benthamiana plants. After 72 hours, the total protein of the

infiltrated leaf was extracted and used for the western blotting. The result is

shown in Figure 18. TRoV infected turnip plant protein sample (Lane A, Figure

18)acting as positive control, showed a specific band at 30 KDa indicating

western condition is optimal. Both TROVCP_LTSVsatF and TROVCP_LTSVsatR

transgenic N. benthamiana protein extract didn’t show specific band,

51

indicating there was no expression of TRoV capsid protein in transgenic plants

(Figure 18, Lane D and Lane E), which is the same result as shown in Figure 16.

The experiment plant showed specific band at 30 KDa (Figure 18, Lane F),

while wild type N. benthamiana, functioning as negative control, showed no

specific band. These findings confirm that TRoV capsid protein gene can be

successfully transcribed and translated in N. benthamiana plant. Furthermore,

poly (A) tail (generated from the Tnos-terminator) can replace the function of

the 3’ UTR in TRoV (which is naturally devoid of poly (A) tail but has a 3’ UTR).

Figure 18: Confirmation of the expression of the TRoV capsid protein in N. benthamiana plant

using western blotting. Lane A: Total protein extraction of turnip plant which infected by TRoV.

Lane B: Protein molecular weight Ladde. Lane C: Total protein extarction of wild type N.

benthamiana. Lane D: Total protein extarction of TROVCP_LTSVsatF transgenic plant. Lane E: Total

protein extarction of TROVCP_LTSVsatR transgenic plant. Lane F: Total protein extraction of

experiment N. benthamiana using Agrobacterium-mediated transient expression assay.

4.5 INFECTIVITY ASSAY OF TRoV AND LTSV sat RNA

Infectivity assays were performed on turnip plants to determine if LTSV sat

RNA transcribed in the transgenic N. benthamiana is in its natural, circularized

form. Healthy turnip leaves were used for infectivity assay with either TRoV

virion, total RNA extraction of transgenic plants, or both. Newly-grown leaf

was collected for the RNA extraction.

52

Quality of total RNA was verified by gel electrophoresis as shown in Figure 19.

As seen in lanes A, B, C, D, and E the quality of cellular ribosomal RNA is good

indicating that mRNAs transcripts must also be intact.

Figure 19: Quality of total RNA extraction from turnip plant. RNA was extracted from turnip

plants doing different infectivity assay, due to high susceptibility to degradation, was viewed on 1%

RNA gel to verify quality before RT-PCR. 28S rRNA, 18S rRNA and tRNA are indicated. Lane A: RNA

extraction of healthy turnip plant. Lane B: RNA extraction of turnip plant inoculated with TRoV

only. Lane C: RNA extraction of turnip plant inoculated with both TRoV and total RNA extraction

of TROVCP_LTSVsatF transgenic plant. Lane D: RNA extraction of turnip plant inoculated with

both TRoV and total RNA extraction of TROVCP_LTSVsatR transgenic plant. Lane E: RNA extraction

of turnip plant inoculated with both TRoV and LTSV sat RNA.

RT-PCR was performed to analyze RNA transcripts from different treatments.

Results are shown in Figure 20 and Figure 21. As shown in Figure 20, lane B,

RT-PCR result of healthy turnip plant, worked as negative control showed no

53

specific band, indicating prior to treatment, turnip plant didn’t contain TRoV

capsid protein. Lane C, turnip plant infected by TRoV only, used as positive

control which showed a specific 250 bp RT-PCR product, meaning the

infectivity assay method worked well. While both lane D and E showed

specific band indicating turnip plants infected by both TRoV virion and RNA

extraction of transgenic plant are successfully infected by TRoV. As shown in

Figure 21, no band was visible for RT-PCR of healthy turnip RNA and turnip

plant only inoculated with TRoV (Lane B and lane C), indicating prior to

inoculation with LTSV sat RNA (either RNA extraction of transgenic plant or

LTSV sat RNA), there was no LTSV sat RNA in either naïve turnip plant or TRoV

virion infected turnip plant (negative control). A 200 bp band was visible in

the RT-PCR result of turnip plant infected with both TRoV and LTSV sat RNA

(positive control), revealing TRoV supported replication of LTSV satellite

(Figure 21 Lane D). Meanwhile, both turnip plants inoculated with TRoV and

total RNA of transgenic plants (TROVCP_LTSVsatF and TROVCP_LTSVsatR)

possessed a specific band at correct place, indicating that transgenic N.

benthamiana produce the circular, natural form of the satellite.

54

Figure 20: RT-PCR results of transcripts of TRoV capsid protein in turnip plants after infectivity

assay. Turnip plants were subjected to different treatment, and newly grown leaves were

collected for RNA extraction, followed by RT-PCR using TROVCP_iF and TROVCP_iR internal

primers to detect the presence of TRoV capsid protein transcription product. PCR products were

run on the 2% agarose gel. Lane A: 100 bp DNA ladder. Lane B: RT-PCR result of healthy turnip

plant RNA extraction. Lane C: RT-PCR product of turnip plant inoculated with TRoV only. Lane D:

RT-PCR product of turnip plant inoculated with both TRoV and total RNA of TROVCP_LTSVsatF

transgenic plant. Lane E: RT-PCR product of turnip plant inoculated with both TRoV and total RNA

of TROVCP_LTSVsatR transgenic plant. Bands which are less than 100 bp are probably unused

primers.

55

Figure 21: RT-PCR results of transcripts of LTSV satellite RNA in turnip plants after infectivity

assay. Turnip plants were subjected to different treatment, and newly grown leaves were

collected for RNA extraction, followed by RT-PCR using LTSVsat_F and LTSVsat_R internal primers

to detect LTSV sat RNA. PCR products were run on the 2% agarose gel. Lane A: 100 bp DNA ladder.

Lane B: RT-PCR result of healthy turnip plant RNA extraction. Lane C: RT-PCR result of turnip plant

inoculated with TRoV only. Lane D: RT-PCR product of turnip plant inoculated with TRoV and LTSV

sat RNA. Lane E: RT-PCR product of turnip plant inoculated with both TRoV and total RNA of

TROVCP_LTSVsatF transgenic plant. Lane F: RT-PCR product of turnip plant inoculated with both

TRoV and total RNA of TROVCP_LTSVsatR transgenic plant. Bands which are less than 100 bp are

probably unused primers.

56

5 Discussion

The main goal of this study was to investigate whether a functional (CCC RNA

which is identical to the native CCC RNA found in LTSV particles and capable

of replication with the helper TRoV) LTSV satellite RNA can be produced in

vivo without any other helper viral proteins. Furthermore whether LTSV

satellite RNA is capable of independent packaging, i.e., without the presence

of a helper virus, in TRoV capsid protein alone. The particles of LTSV, the

natural helper virus of the LTSV satellite, are always found to contain sat RNA

together with LTSV genomic RNA. Moreover, packaging is exclusive for these

RNA molecules (Forster & Jones, 1979). The TROVCP_LTSVsat transgenic lines

were developed to test whether TRoV particles can assemble and encapsidate

the LTSV satellite in the absence of TRoV.

From the results of the thesis, we confirm that TRoV capsid protein gene and

LTSV satellite dimer successfully inserted into chromosomal DNA of transgenic

plants (Figure 8, 9). However, the result of the RT-PCR showed that due to the

ribozyme activity of the LTSV satellite, the LTSV satellite dimer was

self-cleaved into a monomer, and conjunctively that the TRoV capsid protein

mRNA is not stable. From Figure 13, the RT-PCR result of the LTSV satellite for

the transgenic plants showed a single 200 bp product while the PCR result of

the transgenic chromosomal DNA showed 200 bp and 522 bp products (due

to the LTSV sat dimer) indicating that due to the hammerhead ribozyme

57

activity of the LTSV satellite generated in transgenic plants is circular

monomer. Additionally, there was no detectable transcription product for

TRoV capsid protein and GFP, which revealed that 3’ poly (A) (generated from

the polyadenylation signal in pCambia) and 5’ cap deficient mRNA of the TRoV

capsid protein and GFP are not stable in the transgenic plants. Western

blotting result showed no specific band at the correct place further confirmed

that TRoV capsid protein is not expressed in the transgenic plants (Figure 16).

Furthermore, Agrobacterium-mediated transient expression assay proved

TRoV capsid protein can be successfully expressed in the N. benthamiana

plant (Figure 18), indicating that the poly (A) tail (provided by Tnos terminator)

is a functional surrogate for the natural TRoV 3’ UTR. It is worth noting here

that the LTSV sat dimer is transcribed from the 35S promoter following the

transcription of the TRoV CP mRNA. Lack of the detection of any TRoV mRNA

in transgenic plants implies that the mRNA is rapidly degraded following the

self-splicing of the LTSV sat dimer into monomeric covalently closed circular

RNA (CCC RNA). This may be related to the instability of the transgene mRNA

for the capsid protein gene which is positioned in tandem with LTSV dimer.

Self-cleavage of the satellite following the transcription would leave the TRoV

capsid protein without the protection of the poly (A) tail and therefore prone

to degradation (Figure 22). This is despite the additional 168 nucleotides that

would remain from the LTSV satellite before the hammerhead ribozyme

following satellite self-cleavage. That the constitutive expression of the TRoV

58

capsid protein and LTSV by the 35S promoter did not result in a significant

amount of uncleaved transcripts further indicates that both the self-cleavage

of the satellite and degradation of the defective mRNA (TRoV capsid protein)

are at a very high efficiency. Since the self-splicing/ligation ribozyme is carried

out through a 2’-3’ cyclic phosphate diester bonding, leaving one 2’-3’ cyclic

phosphate end and a 5’ OH termini. The 5’ OH end which is a good substrate

for the exonucleases (see Figure 4). Consequently, the GFP gene located

downstream from the sat RNA was shown to be degraded (see Figure 14).

However the 2’-3’ cyclic phosphate which is found at the end of the CP gene

should in theory be more resistant to exonucleases. This is contradictory to

our results. Furthermore, the Sobemoviruses are known to be devoid of a

poly (A) tail. However, their mRNAs (particularly CP mRNA) must be stable in

vivo to generate the CP. The 5’ end in Sobemoviruses is also known to have a

covalently bound VPg protein which is certainly a good protection from

exonucleases. In our construct we do not have the VPg. However, the 35 S

promoter will generate a cap which is certainly a good protection from

exonuleases. The 3’ UTR of CP which naturally may contain a specific

structure (which is not a tRNA-like structure) may confer a stability of CP

mRNA. In our construct we relied on the 168 nucleotides (not the 3’ UTR) to

confer stability to CP mRNA. This proved not to be the case.

LTSV circular RNA was shown to be biologically active. According to the

inoculation of turnip plants with the total RNA extracted from transgenic

59

plants, transgenic plants produced infective monomeric LTSV satellite RNA

(Figure 21); further substantiating that the transgenic plants transcribed

functional and infectious LTSV satellite successfully without any other LTSV

genes. However, no mRNA of the TRoV capsid protein was detected through

RT-PCR, and no translation product of TRoV in western blotting, indicating

that the mRNA was degraded immediately after transcription. The most

notable feature of characterized eukaryotic RNA degradation pathways is

their striking efficiency. Therefore due to the lack of the poly (A) tail at the 3’

end, TRoV capsid protein RNA transcripts were degraded in no time. The

original construct was designed to produce both the TRoV capsid protein and

the LTSV satellite in the same transgenic plant. However, the unexpected

results obtained opened a new direction in the study of the stability of mRNA.

It would be interesting to determine whether a CP mRNA with an added poly

(A) tail at the 3’ end before the ribozyme would be able to protect the mRNA

from fast degradation by exonuleases. Or is it the 2’-3’ cyclic phosphate which

makes the mRNA an efficient target for degradation?

60

Figure 22: Diagram showing how the CP mRNA could be degraded. Scissors indicate the

ribozyme activity of the LTSV sat RNA. Pocket monsters represent exonucleases. Thick

arrows indicate the LTSV (+)-sense sequence. CaMV 35S = Cauliflower mosaic 35S

promoter. Tnos= NOS terminator. sGFP=synthetic green fluorescent protein. pCambia

1300. Binary plasmid used.

61

6 Conclusions

In this thesis we have shown that a dimer copy of the virusoid of LTSV

(satellite RNA) may be expressed in transgenic plants (from 35S promoter) to

produce a functional (infectious and circular) monomer identical to the

natural one. This implies that the hammerhead ribozyme is fully functional in

vivo in a non-host plant (LTSV does not replicate in tobacco plants). Satellite

RNA expressed in tobacco was fully infectious in the natural host plant with

TRoV as a helper virus. Furthermore this result indicated that the satellite

RNA does not require any viral genes to be functional in vivo.

Encapsidation experiments with the capsid protein of TRoV (helper virus) did

not produce positive results because the presence of hammerhead ribozyme

near the end of the TRoV-CP resulted in the instability of CP mRNA. This

unexpected result becomes a very useful tool to study the stability of viral

and non-viral mRNAs in vivo.

62

7 Future Directions

Due to the ribozyme activity of the LTSV satellite RNA, transgenic plants

failed to produce TRoV capsid protein. Therefore another vector (other than

pCambia) which has TRoV capsid protein will be used to transform transgenic

plants which were proven to generate monomeric LTSV satellite RNA. Once

the TRoV capsid protein is expressed in the transgenic plants, we may attain

our original aim to test whether LTSV satRNA can be packaged in viral

particles without the presence of a helper virus.

Additionally, using the same system as TROVCP_LTSVsat, a poly (A) tail

sequence can be added to the end of the TRoV capsid protein gene to test

whether poly (A) tail is enough for the stability of the mRNA. Furthermore,

the entire 3’ UTR of the CP gene will also be added to determine whether or

not this sequence will be resistant to exonucleases.

To determine whether sat RNA produced in the both transgenic plant are

circular or linear, the denature acrylamide gel can be used to verify the

circular sat RNA and linear sat RNA.

63

8 References

AbouHaidar, M.G., and Y.C. Paliwal. (1988). Comparison of the nucleotide sequences

of the viroid-like satellite RNA of the Canadian and Australasian strains of lucerne

transient streak virus. Journal of General Virology, 69: 2369–2373.

Babour, A., Dargemont, C., and Stutz, F. (2012). Ubiquitin and assembly of export

competent mRNP. Biochim. Biophys. Acta, 1819:521-530.

Blackstock, J.M. (1978). Lucerne transient streak and lucerne latent, two new viruses

of lucerne. Australian Journal of Agricultural Research, 29: 291-304.

Bousquet-Antonelli, C., Presutti, C., and Tollervey, D. (2000). Identification of a

regulated pathway for nuclear pre-mRNA turnover. Cell, 102: 765-775.

Chiu, W.W., Kinney, R.M., and Dreher T.W. (2005). Control of translation by the 5′- and

3′-terminal regions of the dengue virus genome. J Virol, 79:8303–8015.

Chowdhury, S.R., and Savithri, H.S. (2011). Interaction of Sesbania mosaic virus

movement protein with the coat protein—implications for viral spread. FEBS J, 278:

257–272.

Collmer, C.W., and Howell, S.H. (1992). Role of satellite RNA in the expression of

symptoms caused by plant viruses. Ann. Rev. Phytopathol, 30: 419-442.

Collins, R.F., Gellatly, D.L., Sehgal, O.P., and M.G. AbouHaidar. (1998). Self-cleaving

circular RNA associated with rice yellow mottle virus is the smallest viroid-like RNA.

Virology, 241: 269-275.

Côté, F., Lévesque, D., and Perreault, J.P. (2001). Natural 2’,5’-phosphodiester bonds

found at the ligation sites of peach latent mosaic viroid. J Virol, 75:19-25.

De la Sierra-Gallay, I.L., Zig, L., Jamalli, A., and Putzer, H. (2008). Structural insights

into the dual activity of RNase J. Nat. Struct. Mol. Biol. 15, 206–212.

Decker, C.J., and Parker, R. (1993). A turnover pathway for both stable and unstable

mRNAs in yeast: evidence for a requirement for deadenylation. Genes Dev, 7:

1632-1643.

Diener, T.O. (2001). The viroid: biological oddity or evolutionary fossil? Advances in

Virus Research, 57: 137–184.

64

Doherty, E.A., and Doudna L.A. (2001). Ribozyme structure and mechanisms. Annu.

Rev. Biophys. Biomol. Struct, 30: 457-475.

Englert, M., Latz, A., Becker, D., Gimple, O., Beier, H., and Akama, K. (2007). Plant

pre-tRNA splicing enzymes are targeted to multiple cellular compartments.

Biochimie , 89: 1351-1365.

Flores, R., Delgado, S., Gas, M.E., Carbonell, A., et al. (2004). Viroids: the minimal

noncoding RNAs with autonomous replication. FEBS Letters, 567: 42–48.

Flores, R., Grubb, D., Elleuch, A., Nohales, M.A., Delgado, S., and Gago, S.

(2011). Rolling-circle replication of viroids, viroid-like satellite RNAs and hepatitis

delta virus: variations on a theme. RNA Biol, 8: 200–206.

Flores, R., Hernández C., Martinez de Alba A.E., Daròs J.A., and F. Di Serio. (2005).

Viroids and viroid-host interactions. Annual Review of Phyopathology, 43: 117-139.

Forster, A.C. and Symons, R.H. (1987a). Self-cleavage of a virusoid RNA is performed

by the proposed 55-nucleotide active site. Cell, 50: 9-16.

Forster, A.C. and Symons, R.H. (1987b). Self-cleavage of plus and minus RNAs of a

virusoid and a structural model for the active sites. Cell, 49: 211-220.

Forester, R.L. S. and Jones, A.T. (1979). Properties of lucerne transient streak virus,

and evidence of its affinity to southern bean mosaic virus. Annals of

Applied Biology , 93: 181-189.

Francki, R.B., Randles, J.W., Hatta, T., Davies, C., et al. (1983). Subterranean clover

mottle virus: another virus from Australia with encapsidated viroid-like RNA. Plant

Pathogens, 32: 47-59.

Gallie, D.R., and Kobayashi, M. (1994). The role of the 3′-untranslated region of

non-polyadenylated plant viral mRNAs in regulating translational efficiency.

Gene,142:159–165.

Gallie, D.R., Lewis, N.J., and Marzluff, W.F. (1996). The histone 3′-terminal stem-loop

is necessary for translation in Chinese hamster ovary cells. Nucleic Acids Res,

24:1954–1962.

Gallie, D.R., and Walbot, V. (1990). RNA pseudoknot domain of tobacco mosaic virus

can functionally substitute for a poly(A) tail in plant and animal cells. Genes Dev,

4:1149–1157.

Gas, M.E., Hernández, C., Flores, R., and Daròs, J.A. (2007). Processing of nuclear

65

viroids in vivo: an interplay between RNA conformations. PLoS Pathog, 3: 1813-1826.

Gas, M.E., Molina-Serrano, D., Hernández, C., Flores, R., and Daròs, J.A. (2008).

Monomeric linear RNA of citrus exocortis viroid resulting from processing in vivo has

5’-phosphomonoester and 3’-hydroxyl termini: implications for the ribonuclease and

RNA ligase involved in replication. J Virol, 82:10321-10325.

Gorgoni, B., Andrews, S., Schaller, A., Schumperli, D., Gray, N.K., Muller, B. (2005).

The stem-loop binding protein stimulates histone translation at an early step in the

initiation pathway. RNA , 11:1030–1042.

Gould, A.R. (1981). Studies on encapsidated viroid-like RNA. II. Purification and

characterization of a viroid-like RNA associated with velvet tobacco mottle virus

(VTMoV). Virology, 108: 123-133.

Gould, A.R. and T. Hatta. (1981). Studies on encapsidated viroid-like RNA. III.

Comparative studies on RNAs isolated from velvet tobacco mottle

virus and solanum nodiflorum mottle virus. Virology, 109: 137-47.

Gutiérrez, R., MacIntosh, G., and Green, P. (1999). Current perspectives on mRNA

stability in plants: multiple levels and mechanisms of control. Trend in plant science,

4:No.11.

Hazeloff, J.P. and Gerlach, W.L. (1988). Simple RNA enzymes with new and highly

specific endoribonuclease activities. Nature, 334: 585-591.

Hilleren, P., McCarthy, T., Rosbash, M., Parker, R., and Jensen, T.H. (2001). Quality

control of mRNA 3′-end processing is linked to the nuclear exosome. Nature, 413:

538-542.

Holden, K.L., and Harris, E. (2004). Enhancement of dengue virus translation: role of

the 3′ untranslated region and the terminal 3′ stem-loop domain. Virology,

329:119–133.

Houseley, J., and Tollervey, D. (2009). The many pathways of RNA degradation. Cell,

136:763-776.

Hull, R. (1977). The grouping of small spherical plant viruses with single RNA

components. J. Gen. Virol, 36: 289–295.

Hull, R. (1988). The sobemovirus group. Polyhedral Virions with monopartite RNA

genomes. In The Plant Viruses, 3: 113-146.

Hull, R. (1995). Sobemovirus. Classification and Nomenclature of Viruses. Sixth

66

Report of the International Committee on Taxonomy of Viruses. Eds. Murphy F.A.,

Fauquet C.M., Bishop D.H.L., Ghabrial S.A., Jarvis A.W., Martelli G.P., Mayo M.A., and

M.D. Summers. Vienna: Springer Publishing, pp. 376-78.

Hutchins, C., Rathjen, P.D., Forster, A.C., and Symons, R.H. (1986). Self-cleavage of

plus and minus RNA transcripts of avocado sunblotch viroid. Nucleic Acids Res, 14:

3627-3640.

Jacobs Anderson, J.S., and Parker, R. (1998). The 3′ to 5′ degradation of yeast mRNAs

is a general mechanism for mRNA turnover that requires the SKI2 DEVH box protein

and 3′ to 5′exonucleases of the exosome complex. EMBO J, 17:1497-1506.

Jensen, T.H., Patricio, K., and Rosbash, M. (2001). A block to mRNA nuclear export

in S. cerevisiae leads to hyperadenylation of transcripts that accumulate at the site of

transcription. Mol. Cell, 7: 887-898.

Jones, A.T., and Mayo M.A. (1984). Satellite nature of the viroid-like RNA-2 of

Solanum nodiflorummottle virus and the ability of other plant viruses to support the

replication of viroid-like RNA molecules. J. Gen. Virol, 65:1713–1721.

Koonin E.V., Senkevich T.G., and Dolja V.V. (2006) The ancient Virus World and

evolution of cells. Biology Direct, 1: 29.

Kopek, B.G., Perkins, G., Miller, D.J., Ellisman, M.H., and Ahlquist, P. (2007).

Three-dimensional analysis of a viral RNA replication complex reveals a virus-induced

mini-organelle. PLoS Biol, 5: 2022-2034.

LaCava, J., Houseley, J., Saveanu, C., Petfalski, E., Thompson, E., Jacquier, A., and

Tollervey, D. (2005). RNA degradation by the exosome is promoted by a nuclear

polyadenylation complex. Cell, 121: 713-724.

LaGrandeur, T.E., and Parker, R. (1996). mRNA decapping activities and their

biological roles. Biochinie, 78:1049-1055.

Lacombe, S., Bangratz, M., Vignols, F., and Brugidou, C. (2010). The rice yellow mottle

virus P1 protein exhibits dual functions to suppress and activate gene silencing. Plant

J. 61: 371–382.

Larimer, F.W., and Stevens, A. (1990). Disruption of the gene XRN1, coding for a 5′–3′

exoribonuclease, restricts yeast cell growth. Gene, 95: 85-90.

Matsuda, D., and Dreher, T.W. (2004). The tRNA-like structure of Turnip yellow mosaic

virus RNA is a 3′-translational enhancer. Virology, 321:36–46.

67

Lilley, D.M. (2005). Structure, folding and mechanisms of ribozymes. Curr Opin Struct

Biol, 15: 313–323.

Ling, R., Pate, A.E., Carr, J.P., and Firth, A.E. (2013). An essential fifth coding ORF in

the sobemoviruses. Virology, 446: 397-408.

Mäkinen, K., Mäkeläinen, K., Arshava, N., Tamm, T., Merits, A., Truve, E., Zavriev, S.,

and Saarma, M. (2000). Characterization of VPg and the polyprotein processing of

cocksfoot mottle virus (genus Sobemovirus). J. Gen. Virol, 81:2783–2789.

Martínez, F., Marqués, J., Salvador, M.L., and Daròs, J.A. (2009). Mutational analysis

of eggplant latent viroid RNA processing in Chlamydomonas reinhardtii chloroplast. J

Gen Virol,90: 3057-3065.

Mathy, N., Benard, L., Pellegrini, O., Daou, R., Wen, T., and Condon, C. (2007). 5’-to-3’

exoribonuclease activity in bacteria: role of RNase J1 in rRNA maturation and 5’

stability of mRNA. Cell, 129: 681–692.

Meier, M., and Truve, E. (20070. Sobemoviruses possess a common CfMV-like

genomic organization. Arch Virol, 152: 635–640.

Muhlrad, D., and Parker R. (1994). Premature translational termination triggers

mRNA decapping. Nature, 370: 578-581.

Murant, A.F., and Mayo, M.A. (1982). Satellites of plant viruses. Annu Rev

Phytopathol, 20:49–70.

Nair, S., and Savithri, H.S. (2010). Processing of SeMV polyproteins revisited. Virology,

396: 106–117.

Navarro, J.A., Daròs, J.A., and Flores, R. (1999). Complexes containing both polarity

strands of avocado sunblotch viroid: Identification in chloroplasts and

characterization. Virology, 253: 77-85.

Neeleman, L., Olsthoorn, R.C., Linthorst, H.J., and Bol, J.F. (2001). Translation of a

nonpolyadenylated viral RNA is enhanced by binding of viral coat protein or

polyadenylation of the RNA. Proc Natl Acad Sci U S A, 98:14286–14291.

Oparka KJ and Alison GR,Plasmodesmata. (2001). A Not So Open-and-Shut Case.

Plant Physiology, Jan, 125: 123-126.

Paliwal, Y.C. (1983). Identification and distribution in eastern Canada of Lucerne

transient streak, a virus newly discovered in North America. Canadian Journal of

Plant Pathology, 5: 75-80.

68

Paliwal, Y.C. (1984). Interction of the viroid-like RNA-2 of lucerne transient streak

virus with southern bean mosaic virus. Canadian Journal of Plant Pathology, 6:

93-184.

Pérez-Ortín, J.Z., Alepuz, P., Chavez, S., and Choder, M. (2013). Eukaryotic mRNA

Decay: methodologies, pathways, and links to other stages of gene expression. J Mol.

Biol, 425: 3750-3775.

Presutti, C. et al. (1995). Identification of the cis-elements mediating the autogenous

control of ribosomal protein L2 mRNA stability in yeast. EMBO J, 14:4022-4030.

Prody, G.A., Bakos, J.T., Buzayan, J.M., Schneider, I.R., and Bruening, G. (1986).

Autolytic processing of dimeric plant virus satellite RNA. Science, 231: 1577-1580.

Qi, Y., and Ding, B. (2003). Differential subnuclear localization of RNA strands of

opposite polarity derived from an autonomously replicating viroid. Plant Cell, 15:

2566-2577.

Roossinck, M. J., Sleat, D. and Palukaitis, P. (1992). Satellite RNAs of plant viruses :

structures and biological effects.Microbiological Reviews, 56:265-279.

Sänger H.L., Klotz G., Riesner D., Gross H.J., and A. Kleinschmidt. (1976). Viroids are

single-stranded covalently closed circular RNA molecules existing as highly

basepaired rod-like structures. Proceedings of the National Academy of Sciences

United States of America, 73: 3852–3856.

Sehgal O.P., Sinha R.C., Gellatly D.L., Ivanov I., and M.G. AbouHaidar. (1993).

Replication and encapsidation of the viroid-like satellite RNA of lucerne transient

streak virus are supported in divergent hosts by cocksfoot mottle virus and turnip

rosette virus. Journal of General Virology, 74: 785-788.

Shen, R.Z and Miller, W.A. (2007). Structures required for poly(A) tail-independent

translation overlap with, but are distinct from, cap-independent translation and RNA

replication signals at the 3′end of Tobacco necrosis virusRNA. Virology, 358: 448-458.

Sivakumaran, K., Fowler, B.C., and Hacker, D.L., (1998). Identification of viral genes

required for cell-to-cell movement of southern bean mosaic virus. Virology, 252:

376–386.

Symons, R.H. (1991). The intriguing viroids and virusoids: what is their information

content and how did they evolve? Mol. Plant Microbe Interact, 4(2): 111-121.

Tamm, T., and Truve, E. (2000). Sobemoviruses. J. Virol, 74: 6231–6241.

69

Thomsen, R., Libri, D., Boulay, J., Rosbash, M., and Jensen, T.H. (2003). Localization of

nuclear retained mRNAs in Saccharomyces cerevisiae. RNA, 9:1049-1057.

Tien-Po., Davres, C., Hatta, T., and Francki, R.I.B. (1981). Viroid-like RNA

encapsidated in lucerne transient streak virus. FEBS Letters, 132: 353-356.

Voinnet, O., Pinto, Y.M., and Baulcombe, D.C. (1999). Suppression of gene silencing: a

general strategy used by diverse DNA and RNA viruses of plants. PNAS 96:

14147–14152.

Wei T., Zhang C., Hong J., Xiong R., et al. (2010) Formation of complexes at

plasmodesmata for potyvirus intercellular movement is mediated by viral protein 116

P3N-PIPO. Public Library of Science Pathogens, 6 (6): e1000962.

Willson, T.J., and Lilley, D.M. (2009). The evolution of ribozyme chemistry. Science,

323: 1436-1438.

Zaumeyer W.J. and L.L. Harter. (1943). Inheritance of symptom expression of bean

mosaic virus. Journal of Agricultural Research, 67: 295-300.

70

Appendix

Table 6: Nucleotide sequences of forward (F) and reverse (R) primers

used for confirmation of transgene presence

Primer

Name

Sequence 5’ to 3’ Tm( )℃ PCR Product

Size

TROVCP_F ATAGTCGGTACCATGGAGAAAGGAAACAAGAAGCT 68.2 750bp

TROVCP_R GGGAACTCTAGACCATTCTATACGTTTAAGGACGA 68.2

LTSVsat_F CCTACCATGGCCTCATCAGT 62.4 200bp

LTSVsat_R GCCGGTAGGATGATGGATTA 60.4

GFP_F GACCATTCTATACGTTAGG 62.4 760bp

GFP_R GAACTTCAGGGTCAGCTTGC 62.4

TROVCP_iF ACGAGTGTGTGGAAGGGAAG 62.4 250bp

TROVCP_iR GTGGATATCTCGCCGACAGT 62.4

Actin_F GCGTGGTCTAGATGTGGATTT 60.2 200bp

Actin_R GACTACTCTAGAATGAGTAGAG 60.2