IN VITRO SELECTION AND DEVELOPMENT OF...
137
1 IN VITRO SELECTION AND DEVELOPMENT OF APTAMERS FOR BIOMARKER DISCOVERY AND TARGETED THERAPY By PRABODHIKA MALLIKARATCHY A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008
Transcript of IN VITRO SELECTION AND DEVELOPMENT OF...
1
IN VITRO SELECTION AND DEVELOPMENT OF APTAMERS FOR BIOMARKER DISCOVERY AND TARGETED THERAPY
By
PRABODHIKA MALLIKARATCHY
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2008
2
© 2008 Prabodhika Mallikaratchy
3
To my family
4
ACKNOWLEDGMENTS
I wish to express my sincere appreciation and gratitude to my major research advisor, Dr.
Weihong Tan, for his guidance through out my graduate school and his understanding. I am
indebted to him forever for his valued assistance during the period of my research work.
My profound gratitude and appreciation is also extended to Dr. Jorg Bungert, Dr. Kirk
Schanze, Dr. Nigel Richards and Dr. Thomas Lyons for serving on my committee and for their
helpful suggestions and advice during my research projects.
I thank the support staff at the Department of Chemistry, University of Florida, for their
silent contribution during my research work. My special thanks go to Ms. Julie McGrath, Ms.
Tina Williams, Ms. Lori Clark and Ms. Jeanne Karably for each of their continuing help with
numerous tasks.
My special thanks go to Ms. Hui Lin and Dr. Arup Sen for their assistance with DNA
synthesis for each of the projects.
It has been a great joy over the years I spent at Tan group. I thank Dr. Lin Wang, Dr.
Steven Suljak, Dr. James Yang, Dr. Colin Medley, Dr. Dihua Shangguan, Dr. Marie Carmen
Estevez, Karen Martinez, Hui Lin, Dr. Zehui Cao, Dr. Marie C. Vicėns, Huaizhi Kang, Dr. Josh
E. Smith, Dr. Alina Munteanu, Yanrong Wu, Youngmi Sohn, Dosung Sohn, Kwame Sefah, Zhi
Zhu, Hui Chen, Yan Chen, Ling Meng, Dr. Jilin Yan, Jennifer Martin, Pinpin Sheng and Zeyu
Xiao for their kindness and help.
Last but not least my deepest love and appreciation is extended to my dear family for their
constant support and love through out my research work. I can not achieve anything in my life
with out the constant encouragement I got from every one of them.
5
TABLE OF CONTENTS page
ACKNOWLEDGMENTS .............................................................................................................. 4
LIST OF TABLES.......................................................................................................................... 8
LIST OF FIGURES ........................................................................................................................ 9
ABSTRACT.................................................................................................................................. 12
CHAPTER
1 INTRODUCTION ................................................................................................................. 14
Role of Proteins in Cancer ..................................................................................................... 14 Molecular Probing of Cancer for Biomarker Discovery........................................................ 16
Transcription Profiling Based Molecular Marker identification .................................... 16 Protein Profiling Based Molecular Marker Identification .............................................. 17
Aptamers................................................................................................................................ 18 Aptamer-Protein Interactions.......................................................................................... 18 Systematic Evolution of Ligands by EXponential enrichment (SELEX)....................... 19
Separation Methods in SELEX.............................................................................................. 21 Conventional SELEX Separation Techniques................................................................ 21 Novel SELEX Separation Strategies .............................................................................. 22
Aptamer Signaling as Molecular Probes in Cancer Protein Analysis.................................... 22 Multiple Aptamer Probes Targeting Whole Living Cells...................................................... 24 Whole Cell-SELEX Strategy ................................................................................................. 26 Applications of Aptamers in Cancer...................................................................................... 29 Aptamers and Antibodies....................................................................................................... 31 Photodynamic Therapy .......................................................................................................... 31
Mechanisms of Photosensitizing Action ........................................................................ 32 Biological Damage of Singlet Oxygen ........................................................................... 32 Current Delivery Systems in Photodynamic Treatment. ................................................ 32
Overview of Dissertation Research ....................................................................................... 35
2 SELECTION OF HIGH AFFINITY DNA LIGANDS FOR PROTEIN KINASE C-δ ........ 36
Introduction............................................................................................................................ 36 Protein Kinase C Family of Proteins ..................................................................................... 36 Materials and Methods........................................................................................................... 38
Instrumentation............................................................................................................... 38 Initial Library Design ..................................................................................................... 38 PKCδ Expression and Purification ................................................................................. 39 PCR Optimization........................................................................................................... 39 Combinatorial Selection of Aptamer .............................................................................. 40 Aptamer Labeling with AT32P........................................................................................ 40
6
Electrophoretic Mobility Shift Assay (EMSA) .............................................................. 41 Cloning and DNA Sequencing ....................................................................................... 42 Fluorescence Anisotropy Measurements........................................................................ 42
Results and Discussions......................................................................................................... 43 The SELEX Process ....................................................................................................... 43 Analysis of Consensus Secondary Structure of High-Affinity DNA Ligands ............... 49 Analysis of Binding Sequences for PKCδ...................................................................... 49 Specificity of Aptamer PB 9........................................................................................... 54 Conclusion ...................................................................................................................... 55
3 APTAMER DIRECTLY EVOLVED FROM LIVE CELLS RECOGNIZES MEMBRANE BOUND IMMUNOGLOBIN HEAVY MU CHAIN IN BURKITT’S LYMPHOMA CELLS........................................................................................................... 56
Burkitt’s Lymphoma.............................................................................................................. 57 Principle of Photocrosslinking of DNA with Proteins........................................................... 58 Aptamer TD05 Recognize Proteins on the Membrane .......................................................... 60 Methods and Materials........................................................................................................... 61
Competition Assays with the Modified Aptamer Probes ............................................... 62 Aptamer Labeling with AT32P........................................................................................ 63 Protein-Nucleic Acid Photo-Crosslinking ...................................................................... 63 Cell Lysis and Protein-Aptamer Extraction.................................................................... 64 Release of Captured Complex and Protein Gel Electrophoresis .................................... 65 Partial Digestion of Membrane Proteins Using Trypsin................................................. 65 Characterization of Aptamer Binding Protein on Ramos Cells...................................... 66 Fluorescence Imaging..................................................................................................... 66
Results and Discussion .......................................................................................................... 66 Probe Modification and the Effect of Modification on Aptamer Affinity and
Specificity ................................................................................................................... 66 Separation of Captured Complex From the Crude Cell Lysate and MS Analysis of
Captured Protein ......................................................................................................... 67 Confirmation of the Protein IGHM as the Binding Target for Aptamer TD05.............. 72 Discussion....................................................................................................................... 77
4 APTAMERS EVOLVED FROM WHOLE CELL SELECTION AS SELECTIVE ANTI-TUMOR PHOTODYNAMIC AGENTS.................................................................... 81
Introduction to Photosensitizers............................................................................................. 81 Methods and Materials........................................................................................................... 83
Synthesis of the Conjugate ............................................................................................. 83 Cell Lines and Binding Buffer........................................................................................ 84 Characterization of the Conjugates................................................................................. 84 Fluorescence Imaging..................................................................................................... 85 Flow Cytometry.............................................................................................................. 85 In Vitro Photolysis .......................................................................................................... 85
Results and Discussion .......................................................................................................... 86 Conjugation of Ce6 with Amine Modified Aptamer TD05............................................ 87
7
Characterization of Aptamer TD05-Ce6 Conjugates ..................................................... 88 Investigation of Toxicity of Aptamer TD05-Ce6 Conjugates ........................................ 90
5 APTAMER EVOLVED FROM CELL-SELEX AS AN EFFECTIVE PLATFORM FOR DRUG RELEASE......................................................................................................... 95
DNA Directed Functional Group Transfer Reactions ........................................................... 96 Methods and Materials........................................................................................................... 98
DNA Synthesis and Purification..................................................................................... 98 Fluorescence Measurements........................................................................................... 99 Cell line and Reaction Conditions .................................................................................. 99
Results and Discussion ........................................................................................................ 100 Probe Design and Mechanism of Activation ................................................................ 100 Investigation of Quencher Release Using Aptamer Sgc8tem-C3-DTT on the CEM
Cells .......................................................................................................................... 102
6 SUMMARY AND FUTURE WORK ................................................................................. 110
Summary of In vitro Selection of Aptamer Targeting PKCδ .............................................. 110 Biomarker Discovery........................................................................................................... 110 Summary of Targeted Therapy Study.................................................................................. 111 Future Work......................................................................................................................... 112
Aptamers with Increased Nuclease Stability ................................................................ 112 Aptamers as Targeting Moiety in Gene Therapy ......................................................... 113 Additional Structural Studies of Aptamer Site Recognition......................................... 114
APPENDIX FLOW CYTROMETRIC ANALYSIS OF BINDING OF FLUOROPHORE LABELED APTAMER WITH CELLS .............................................................................. 118
Instrumentation .................................................................................................................... 118 Data Interpretation ............................................................................................................... 119
REFERENCES ........................................................................................................................... 122
BIOGRAPHICAL SKETCH ...................................................................................................... 137
8
LIST OF TABLES
Table page 1-1 Screening of aptamers selected using Cell-SELEX. ......................................................... 28
2-1. Evolved family of sequences with percentage of population............................................ 51
3-1. Recognition patterns of aptamers TD05 and TE13 with different leukemia cell lines. .... 58
3-2. Identified proteins and their IPI values based on European Protein Data Bank using MASCOT database search. ............................................................................................... 71
3-3. Binding patterns of aptamer TD05 and anti-IGHM with different cell lines.................... 74
5-1. Sequences of DTS reactions ........................................................................................... 100
6-1. Different types of chemical modifications, for stabilization of aptamers and for enhancing pharmacokinetics, immobilization and labeling ............................................ 113
9
LIST OF FIGURES
Figure page 1-1 Thrombin aptamer and thrombin protein interaction. ....................................................... 19
1-2 The SELEX process.. ........................................................................................................ 20
1-3 The CE-SELEX process.................................................................................................... 23
1-4 The cell-SELEX aptamer selection process developed by the Tan group. ....................... 27
1-5 Enrichment of the pool with the desired sequences for target cells. ................................. 27
1-6 Extended Jabonski diagram.. ............................................................................................ 33
1-7 Reactions of singlet oxygen with biomolecules................................................................ 34
2-1 Home made CE set-up used in SELEX experiments.. ...................................................... 41
2-2 PCR Optimization.. ........................................................................................................... 44
2-3 Electropherogram of 2mM DNA library........................................................................... 45
2-4 Electropherograms of the unbound DNA observed during SELEX rounds 2, 4, 6, and 8......................................................................................................................................... 47
2-5 Affinity of enriched DNA pool from 8th round................................................................. 48
2-6 Affinity of starting DNA pool........................................................................................... 48
2-7 Sequences obtained from high throughput sequencing of pool of round 9....................... 50
2-8 Affinity of 32P labeled aptamer PB 9 to PKCδ.................................................................. 52
2-9 Affinity of TMR labeled PB-9 to PKCδ.. ......................................................................... 53
2-10 Specificity of aptamer PB9 towards PKCδ. ...................................................................... 54
3-1 Protocol for the identification of IGHM protein on Ramos cells...................................... 59
3-2 Partial digestion of exracellular membrane proteins using trypsin and proteinase K (indicated by scissors). ...................................................................................................... 60
3-3 Binding of aptamer TD05 with Ramos cells after treatment with proteinase K at different time intervals. ..................................................................................................... 61
3-4 Modified aptamer with photoactive 5-dUI, linked to biotin via a disulfide bond............. 68
10
3-5 Binding of modified aptamer with 5-dUI and biotin linker with Ramos cells.................. 69
3-6 Phospho images for 10% tris-bis PAGE analysis of the captured complex.. ................... 70
3-7 Phospho images for control TE02 Sequence .................................................................... 71
3-8 Aptamer TD05-FITC and Alexa Flour 488 -anti-IGHM binding analysis with Ramos, CCRF-CEM and Toledo cells .............................................................................. 72
3-9 Aptamer TD05-FITC and anti-IGHM antibody binding with surface IgM positive CA46 ................................................................................................................................. 73
3-10 Competition of aptamer TD05-FITC and anti-IGHM antibody for the target protein...... 75
3-11 Binding of Alexa fluor 488 labeled anti-IGHM antibody and TMR labeled TD05 aptamer with Ramos cells ................................................................................................. 75
3-12 Flow cytometric results for the anti-IGHM binding with Ramos cells after Trypsin digestion. ........................................................................................................................... 76
4-1 Chemical structures of photosensitizers............................................................................ 82
4-2 Aptamer TD05-FITC binding to different leukemia cells.. .............................................. 86
4-3 Reaction of chlorin e6 with an amine modified TD05 aptamer probe.............................. 87
4-4 UV-Vis absorption of Ce6 conjugated with DNA. ........................................................... 88
4-5 Singlet oxygen generation ability of free Ce6 dye and Ce6 conjugated to aptamer TD05. ................................................................................................................................ 89
4-6 Binding of aptamer TD05-Ce6 conjugate.. ....................................................................... 90
4-7 Fluorescence confocal images.. ........................................................................................ 91
4-8 Cell toxicity of aptamer TD05-Ce6 treated cells.. ............................................................ 92
4-9 Cell viability observed for CEM and Ramos cells with no irradiation of light. ............... 93
4-10 Observed cell viability for HL-60, NB-4, K562, CEM and Ramos cells with Ce6 attached to a random DNA sequence. ............................................................................... 94
5-1 DNA Template based Functional Group Transfer Reactions.. ......................................... 96
5-2 Aptamer-based DTGTR as a tool for drug release............................................................ 98
5-3 Mechanism of fluorescence restoration of the hypothetical pro-drug upon reduction of disulfide linker.. .......................................................................................................... 101
11
5-4 Verification of de-quenching effect upon reduction of disulfide link............................. 102
5-5 Restored fluorescence upon addition of PB-C3-DTT to PBFSSD.. ............................... 103
5-6 Aptamer –platform and hypothetical prodrug................................................................. 104
5-7 Binding of Sgc8tem with CEM cells.. ............................................................................ 106
5-8 Flow cytometric results for DTT treated PBFSSD on CCRF-CEM cells....................... 106
5-9 Reduction abilities of free DTT and DTT attached to DNA aptamer template.. ............ 107
5-10 Disulfide bond reduction of PBFSSD using DTT bound to aptamer platform and free DTT................................................................................................................................. 108
5-11 Specificity of disulfide bond reduction by DTT attached to Sgc8-tem-c3DTT.............. 108
6-1 Structure of 5-iodo deoxy uridine. (*) position refers to the 13C on the base. ................ 116
6-2 The proposed method for determination of aptamer binding site on IGHM. ................. 117
A-1 Typical flow cytometer setup.......................................................................................... 118
A-2 Histogram obtained from the flow cytometer.. ............................................................... 120
A-3 Histogram obtained to find out the binding of fluorescence tagged aptamer probe.. ..... 120
A-4 Fluorescence tagged aptamer binding with different cells. …........................................ 121
12
Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy
IN VITRO SELECTION AND DEVELOPMENT OF APTAMERS FOR BIOMARKER DISCOVERY AND TARGETED THERAPY
By
Prabodhika R. Mallikaratchy
May 2008
Chair: Weihong Tan Major: Chemistry
Increasing emphasis on molecular level understanding of cellular processes has allowed
certain diseases to be redefined in terms of underlying molecular level abnormalities rather than
pathological differences. In an attempt to understand some of these molecular level
characteristics, this research was undertaken to utilize aptamers as molecular probes in cancer
studies. Aptamers are short DNA/RNA strands that show a preferential binding with variety of
molecules, and are generated by a process called Systematic Evolution of Ligands by
Exponential enrichment (SELEX).
First, in an attempt to develop sensitive probes for intracellular proteins, DNA aptamers
were selected utilizing Capillary Electrophoresis based SELEX (CE-SELEX) targeting Protein
Kinase C delta (PKCδ). PKCδ is an important signal transduction protein that plays a significant
role in tumor initiation. The selected aptamer was later labeled with a fluorophore and
developed into a fluorescent probe for protein detection studies.
Second, a novel strategy to identify over-expressed proteins on the cell membranes
utilizing aptamers has been implemented. Here, an aptamer selected using Cell based SELEX
(Cell-SELEX) has been utilized as a tool for biomarker identification. The aptamer TD05
selected against a Burkitt’s lymphoma (BL) cell line was chemically modified to covalently
13
crosslink with its target and to capture and to enrich the target receptors using streptavidin coated
magnetic beads. The separated target protein was identified using mass spectrometry. Using this
method, we were able to identify membrane bound Immunoglobin Heavy mu chain (IGHM)
which is an established marker protein as the target for aptamer TD05. This study demonstrates
aptamers selected against whole cells can be effectively utilized to identify cancer related marker
proteins.
Third, since the identified biomarker is expressed only on the target BL cells, this
selectivity was exploited to demonstrate that the aptamer can be used as a drug carrier. Aptamer-
photosensitizer conjugates were engineered to effectively target cancer cells that express
identified biomarker. Introduction of the aptamer-photosensitizer conjugates followed by
irradiation with light has selectively destroyed target cancer cells utilizing induced singlet
oxygen.
Finally, to avoid undesirable side effects associated with photosensitizers, as a proof-of-
concept a FRET principle based “prodrug” and an aptamer based drug delivery platform were
engineered. The engineered hypothetical “prodrug” was effectively activated upon reaching
aptamer platform aided by DNA Template based functional Group Transfer Reactions (DTGTR).
The developed strategy further demonstrates that aptamers can be used as drug delivery
platforms.
.
14
CHAPTER 1 INTRODUCTION
Fundamental understanding of biological processes has been greatly influenced by the
completion of the human genome project. Today, the National Center for Biotechnology
database consists of completed genome data for more than 800 different organisms.1 This vast
pool of information has resulted in a revolution in the biological sciences. Increasing emphasis
on molecular level understanding of bio-organisms has allowed certain diseases to be re-defined
in terms of underlying molecular level abnormalities rather than pathological differences.
In an attempt to understand some of these molecular level characteristics, this research
was undertaken to utilize aptamers as probes to target tumor-promoting proteins and to
investigate the feasibility of developing aptamers into fluorescent probes. We have focused on
the identification of biomarker proteins utilizing aptamers evolved from cell-SELEX
methodology and have been able to demonstrate that the identified biomarker protein can be
applied in therapeutic applications.
In order to set the foundation for these objectives, this chapter explores the role of proteins
in diseases, with particular emphasis on cancer, and how understanding these roles can lead the
development of diagnostic and therapeutic approaches and can stimulate further basic research.
Role of Proteins in Cancer
Cancer ranks as the second major cause of death in the United States. 2 The origin of
cancer cannot be correlated to a single genetic or proteomic alteration. Since all living cells rely
on proteins for their survival and growth, slight modifications of proteins can result in different
cellular mechanisms. The alteration of proteins can be in their levels of expression,3 or in
changes to post-translational modifications (glycosylation, phenylation, formylation, acetylation)
4 or by mutations at the genetic level.5 Such changes can induce uncontrolled cell growth
15
leading to cancer, particularly, when receptor proteins are involved. Therefore, detection of
alterations of cell receptor protein expression levels and evaluation of their involvement in
cancer initiation is important. Furthermore, these discoveries can lead to the invention of novel
diagnostic approaches and targeted therapy strategies.
Most of the key proteins discovered so far are associated with membrane receptors. For
example, overexpression of the number of a serum marker proteins, such as α-fetoprotein, 6
carcino-embryonic antigen (CEA) for colon cancer7 and prostate specific antigen (PSA) for
prostate cancer8 are well established markers strongly related to tumor initiation and growth.
Also, several growth factor proteins, such as epidermal growth factor receptor 2 (EGFR2),9
vascular enhanced growth factors (VEGF),10 platelet-derived growth factor (PDGF)11 and
insulin-like growth factors (IGF)12 are classic tumor related proteins that play key roles in tumor
initiation. Overexpression of these proteins is most likely due to activation and/or mutations of
the encoding gene.13 For example, the EGFR2 gene encoding the EGFR2 receptor protein is
activated in various cancers.14 These receptors are responsible for cell-cell or cell-stromal
communication through signal transduction with intracellular growth factors or ligands. This
signaling activates the transcription of various genes through phosphorylation or
dephosphorylation, and ultimately the induced signaling cascade triggers enhanced cell growth.
According to a reported clinical study, it has been shown that approximately 85% of breast
cancer patients have significantly elevated levels of EGFR2 protein and this elevation is strongly
correlated with disease recurrence, metastasis or shortened survival.15-34 These studies have all
shown that the identification of molecular basis of diseases can lead to a more in-depth
understanding of cancer. Molecular profiling in diseased cells using various probes is important
16
in this process, and should eventually lead to the identification of new biomarkers that can help
in early diagnosis.
Molecular Probing of Cancer for Biomarker Discovery
Transcription Profiling Based Molecular Marker identification
The approach termed “molecular profiling” is the investigation of abnormalities of many
genes or proteins on a common platform.35 The identified unique molecular signatures are
correlated with tumors to identify subsets of patients and to tailor treatment regimes to achieve
more personalized medical therapies. Detection of these molecular signatures can also lead to
methodologies for early detection of cancer.
Currently, molecular profiling studies rely largely on the analysis of genetic mutations
using DNA micro-arrays.36 For example, a recent genetic analysis of diffuse B- cell large
lymphoma (DBCL) using DNA micro-array techniques enabled the re-classification of two
molecularly distinct forms of DBCL with different proliferation rates, host responses, and tumor
differentiation rates.37 The results showed that the two subsets have significantly different
survival rates, demonstrating that, even within a common category of lymphoma, there are
subsets that can be further divided into subcategories. There are also many studies currently
being reported using DNA micro-arrays to identify different disease subcategories based on
genetic level differences. 35
Although DNA/RNA arrays are effective in analyzing millions of genes in a common
platform, a disadvantage of DNA/RNA array analysis is sample preparation, because RNA is
extremely labile and easily degradable. 38 The lack of stability of mRNA can also be responsible
for false negative results, especially if unknown subpopulations of cells do not express high
levels of mRNA. This low expression level can be lost by contamination from higher abundance
mRNAs .39 In addition, mRNA expression may not necessarily correlate with protein expression
17
patterns in a given cell. The information generated from array-based methods may not reflect the
related protein expression levels in cancer, because proteins can also be mutated and /or altered
in post-translational processing stages that can initiate the cancer formation.40 In addition to
micro-array based methods, genetic analysis using a polymerase chain reaction (PCR) based
method is considered to be more sensitive. However, amplification of gene products has been
reported to have variable sensitivities, which can lead to false positive or false negative results.41
Protein Profiling Based Molecular Marker Identification
Instead of detecting the mRNA corresponding to a given protein, the protein itself can be
identified by various methods. Currently, the major method of disease related protein
identification utilizes mass spectrometry (MS), including both electrospray ionization (ESI)42
and matrix-assisted laser desorption ionization (MALDI).43 In addition, a number of novel
techniques have been developed. For example, surface-enhanced laser desorption time of flight
MS (SELDI-MS),44 proximity ligation,45 cell-based bioactivity analysis, and immunological
assays such as enzyme linked immunoabsorbant assays (ELISA)46 have been used to identify
biological molecules. However, due to the poor limits of detection, and sensitivities as well as
sample loss during the tedious sample preparation, the identification of biologically important
molecules in disease origination has been hindered. Therefore, currently the focus is on more
systematic approaches to identify biomarker proteins related to disease origination.
One way of addressing this issue is the generation of molecular probes that specifically
recognize different expression patterns of proteins on the cancer cell membrane. In this regard,
aptamers show potential in identifying such molecular differences. Since aptamers can be
selected without having to introduce a specific epitope, use of these molecules can help the
identification of the molecular targets that are overexpressed in specific cells. The new
18
information generated by aptamer-based molecular analysis has led to re-exploration of diseases
based on underlying molecular abnormalities.
Aptamers
Aptamers are small oligonucleotides that specifically bind to a wide range of target
molecules, such as drugs, proteins, or other inorganic or organic molecules, with high affinity
and specificity.47-50 The concept of aptamers is based on the ability of small oligonucleotides
(typically 80-100mers) to fold into unique three-dimensional structures that can interact with a
specific target with high specificity and affinity. Aptamers are made of RNA,51 modified
RNA,52 DNA, 53 or modified DNA54 and some peptide aptamers have also been reported.55
Aptamers have been selected for a variety of targets, including ions,56 small molecules,57
peptides,58 single proteins,59 organelles,60 viruses,61 entire cells62 and tissue samples.63 In the
case of more complex samples, such as tissues or cells, the aptamers primarily recognize the
most abundant proteins.
Aptamer-Protein Interactions
Naturally, some proteins are known to interact specifically with DNA and/or RNA. For
example, most of the transcription factors and nuclear proteins are known to interact with
DNA/RNA through non-covalent binding to mediate various cellular events. Binding of these
“nucleic acids of prey” for their associated “protein baits” is relatively weak. Despite the low
affinities, these interactions are specific, selective, and functional.
The interaction of a DNA/RNA aptamer with its target molecules does not necessarily
involve a DNA or RNA recognition capability. In fact, most of the DNA or RNA aptamers have
been selected for common plasma or membrane proteins that do not possess a nucleic acid
recognition capability.64 Interaction of an aptamer with its target molecule is a combination of
non-covalent and electrostatic interactions, and it also depends on the ability of nucleic acids to
19
fold into a unique three-dimensional secondary structure which can fit into a binding pocket in
the protein. This compact folding of nucleic acids is the key to enhanced “trapping” of the
aptamer in the protein pocket, especially for RNA aptamers, which have an extra hydroxyl group
at the 2’ position of the sugar ring. Figure 1-1, shows the anti-thrombin DNA aptamer binding
via electrostatic interactions with thrombin protein. The affinities of these types of interactions
are in the picomolar to sub-nanomolar range.
Figure 1-1. Thrombin aptamer and thrombin protein interaction. Ribbon diagram of thrombin protein interacting with thrombin aptamer predicted by x-ray Crystallography. Aptamer binds with thrombin via a strong electrostatic interaction. Reprinted by permission from Journal of Molecular Biology.65
Systematic Evolution of Ligands by EXponential enrichment (SELEX)
The process by which aptamers are selected is called Systematic Evolution of Ligands by
EXponential enrichment (SELEX), which was introduced by two independent laboratories in
1990.66, 67 Typically, the SELEX process is a combination of in vitro evolution and
combinatorial chemistry.
20
Figure 1-2. The SELEX process. The library containing DNA or RNA molecules is incubated with the protein target of interest. The DNA/RNA bound to the target is separated from the unbound sequences. Separated high affinity sequences are amplified by Polymerase Chain Reaction (PCR), and this process is repeated until the library is enriched with the potential aptamer sequences.
The first step involves the chemical synthesis of a DNA library with completely random base
sequences flanked by pre-defined primer binding sites. The initial library of the SELEX process
is incredibly complex with at least 1015 different DNA molecules. The immense complexity of
the generated pool justifies the hypothesis that the library will contain a few molecules with
unique three-dimensional structural characteristics to facilitate specific interactions with the
target molecule. As exemplified in Figure 1-2, a typical selection process involves successive
incubation and separation of high affinity binders, followed by PCR amplification. Finally, the
evolved DNA library is cloned and sequenced to obtain the potential aptamers. However, the
high complexity of the library leads to difficulties in the separation of the few desired sequences
21
from the rest of the library. Thus, a well controlled and effective partitioning process is the key
step in increasing the efficiency of aptamer selection.
Separation Methods in SELEX
Conventional SELEX Separation Techniques
Nitrocellulose filters and affinity chromatography are established methods for separating
protein bound sequences 68, 69 In nitrocellulose filtration, the DNA or RNA library is incubated
with the protein target and filtered through a nitrocellulose film. Since nitrocellulose is sticky
only to the protein molecules, the protein-nucleic acid complex is retained on the film, while the
free nucleic acids are removed. Denaturing reagent is introduced to dissociate the bound nucleic
acid sequences from the complex prior to the PCR amplification step. While the nitrocellulose
filter binding method is most common, several studies have demonstrated that the unbound
DNA/RNA sequences interact nonspecifically with the nitrocellulose membrane and interfere
with the separation efficiency of the selection process.70 This non-specific interaction of DNA
with the membrane often results in the enrichment of sequences that have a high affinity towards
the membrane instead of the proteins, resulting in a high background with false positive
sequences. The problem can be partially counteracted by introducing a high-salt washing to
remove the non-specifically bound sequences.
In using affinity columns, the target protein is immobilized on a solid support. The
SELEX library is passed through the column, and the sequences with high affinity towards the
target protein are retained. The bound sequences are subsequently removed and used for PCR
amplification. A major limitation of affinity columns is the need to immobilize the protein
target, thereby hindering access its potential binding pocket. Thus, use of both nitrocellulose
filters and affinity columns can limit the selection of aptamers. For this reason, there has
22
recently been increased effort to introduce cost-effective, simple, and efficient techniques for the
separation of aptamer sequences from the library.
Novel SELEX Separation Strategies
Target-immobilized magnetic beads71 and capillary electrophoresis (CE)72-75, are newer
methods for SELEX separations. The magnetic bead method is rapid and easy, and it requires a
relatively low sample volume, but it suffers from the same flaws as affinity columns; i.e.
potential loss of the binding site due to immobilization of the target on to the magnetic beads.
Non-specific interactions of magnetic beads with the DNA library can also hinder the selection
efficiency.
Capillary electrophoresis offers several advantages for SELEX separations. This method
provides high separation efficiency, and the selection occurs in free solution so there is little non-
specific binding observed. A schematic of the method is shown in the Figure 1-3. DNA library
containing protein-bound and unbound sequences is injected into the capillary and a high electric
filed is applied. Because of their relatively small sizes the unbound sequences migrate rapidly
and leave the capillary first. The bound sequences migrate more slowly and are collected as they
elute. Subsequently, the high affinity sequences are further amplified using PCR. The process is
repeated until the library is enriched with aptamer candidates.
Aptamer Signaling as Molecular Probes in Cancer Protein Analysis
Specific signaling aptamers, which combine binding specificity and signal transduction
capability, are promising probes for real-time detection of nucleic acids and proteins both in vivo
and in vitro. Recent studies from our group have shown that signaling aptamers can recognize
Platelet-Derived Growth Factor (PDGF) and thrombin in a complex biological mixture.76-78
However, one of the major limitations in using aptamers in vivo is their susceptibility towards
nuclease degradation.
23
With the advancement of fluorescent based techniques, many research groups have focused
on developing signaling aptamers (aptamer beacons) that may have potential as in vitro
diagnostic tools.79
Figure 1-3. The CE-SELEX process. After incubation with the protein target the library is injected into the capillary. Upon application of the electric field, free DNA sequences migrate faster (peak highlighted in blue) than the DNA sequences bound to the protein target (peak highlighted in red). The separated bound DNA sequences are amplified and proceed to subsequent rounds of selection.
Signaling aptamers are types of molecular beacons, in which an aptamer is incorporated into
fluorescence based signaling mechanisms. As a result, selection methods that incorporate
Fluorescence Resonance Energy Transfer (FRET) based mechanisms80 have been introduced
usually as a FRET pair, into the starting library. However, one of the challenges in using
fluorescence based signaling aptamers as a diagnostic tool is the high background signal of the
biological fluids. One report addressed this problem by engineering a structure switching
excimer aptamer probe targeting Platelet Derived Growth Factor.81 This excimer aptamer probe
24
represents the first study demonstrating the potential uses of aptamers as in vitro diagnostic
probes for cancer markers.
Despite the demonstrated success in selecting aptamers against single proteins, the
application in real systems is still a challenge, because the aptamers are selected in artificial
buffer systems where only the target protein is present. Non-specific interactions with nuclear
proteins commonly present in real biological samples are known to interfere with the specific
recognition. 82, 83 Another limitation is the rapid nuclease degradation. In order to prevent
nuclease degradation, several reports have successfully used modified aptamers, with -OCH3, -
NH2, -F substituents at the 2’ position of the sugar ring. 82, 83 Also, use of locked nucleic acids
have shown an increase in nuclease resistance82, 83.
Multiple Aptamer Probes Targeting Whole Living Cells
For cancer diagnosis and study, there has been increasing interest in identifying aptamers
for more complex targets such as cells. Use of living cells as the targets for aptamer selection
will enable the generation of a panel of aptamers capable of binding to native cell membrane
proteins. The use of whole cells as targets to select aptamers offers several advantages:84, 85
• A panel of aptamers can be selected to target multiple proteins for the cancer study. This can be achieved without prior knowledge of up/down regulated genes related to the proteins.
• Aptamers selected against whole cells can lead to the discovery of novel biomarkers even when the expression of distinct protein candidates is not known in advance.
• By chemical modification of aptamers, the aptamers can be converted into specific transporters of drugs in therapeutic approaches.
• Aptamers selected against whole cells can be used as in vivo imaging agents.
• Use of subtractive SELEX strategy can reveal protein expression profiles, which can effectively distinguish the transformed cells from healthy cells at a molecular level.
• Finally, the aptamers are selected against the native state of the proteins in the cellular environment.
25
For the above mentioned reasons, cell-based aptamer selection is a promising scheme for the
creation of molecular probes for profiling and imaging of cancer.
The first example of cell-based aptamer selection was a whole cell selection for anti-
Prostate Specific Membrane Antigen aptamer (PSMA).86 PSMA is a tumor marker for prostate
cancer, and its expression is primarily prostate specific. In this study, Lupold et al.86 selected
RNA aptamers for targeting the extra-cellular domain of the PSMA fusion protein. To increase
the nuclease stability of the aptamers in the serum, 2’-fluoropyrimidines were incorporated. The
resulting aptamer was able to recognize PSMA expressed by prostate cancer cells, and
demonstrated the feasibility of specifically selecting aptamers for known protein targets on a
cellular membrane.
Following this approach, the selection of an aptamer targeting U251 glioblastoma cells was
reported.87 Glioblastoma is one of the most common brain malignancies. The aggressive nature
of the glioblastoma cells is considered to originate from hyper-vascularity, focal necrosis, and
rapid cellular proliferation. Out of the aptamers selected, authors reported that the target of the
aptamer GBI-10 was tenascin-C, an integral membrane protein considered to be a stromal marker
for epithelial malignancy.
Two other studies reported the selection of aptamers with functional capability towards cell
targets. Guo et al. demonstrated the feasibility of the selection of aptamers that promote cell
adhesion using osteoblasts from human osteosarcoma cells.88 The author selected aptamers to
act as osteoblast capturing probes in order to create artificial tissue engineering platforms.
Another intriguing study showed aptamer selection against mutated human Receptor Tyrosine
Kinase–REarranged during Transfection (RTK-RET) using RET-expressing cells as targets.89
This work led to the selection of an aptamer that can recognize the extra-cellular domain of the
26
RET receptor. One of the identified aptamers was shown to inhibit the dimerization of the RET
receptor and blocked the downstream RET-dependent intracellular signaling pathways,
demonstrating that the selected aptamers could be used as potential therapeutic agents for the
RET receptor.
Whole Cell-SELEX Strategy
The selection strategies described above have all been designed to target a protein
previously known to be present in the cell membrane. However, a recent study from our group
demonstrated a universal strategy to select a panel of aptamers for whole cellular targets.84, 85
The newly developed cell-based aptamer selection method, called cell-SELEX, is illustrated in
Figure 1-4.
Using this approach, several aptamers were selected targeting a cultured leukemia cell line:
a CCRF-CEM, which is a cultured precursor T cell acute lymphoblastic leukemia (ALL) cell
line, and a B-cell line from the human Burkitt’s lymphoma Ramos cell line as the control.
Introduction a counter selection strategy excluded the selection of the most popular receptors on
all cell membrane surfaces, and minimized non-specific membrane interactions. The cell-
SELEX method generates highly specific molecular probes able to recognize one type of cancer
cell line.
In cell-SELEX, the initial library is incubated with the target cell line. Following
incubation, the cells are washed to remove unbound DNA, and the bound sequences are
dissociated by heating. The resulting sequences are incubated with a counter cell line to ensure
the subtraction of common binders. Introduction of the counter selection step eliminates the
possibility of selecting aptamers for common membrane proteins and enhances the probability of
recognizing protein candidates exclusively expressed in the cell line. The supernatant now
enriched with sequences that do not bind to the control cells, is collected and PCR amplified.
27
Figure 1-4. The cell-SELEX aptamer selection process developed by the Tan group. A ssDNA
pool is incubated with target cells. After washing, the bound DNAs are eluted by heating to 95°C. The eluted DNAs are then incubated with negative cells for counter-selection. After centrifugation, the supernatant is collected and the selected DNA is amplified by PCR. The PCR products are separated into ssDNA for the next round of selection. Finally the enriched library with aptamer sequences is cloned and sequenced to obtain aptamer candidates. 85
Figure 1-5. Enrichment of the pool with the desired sequences for target cells. (a) The green curve represents the background binding of the starting DNA library. An increase in fluorescence intensity with the number of cycles is indicative of enrichment of the affinity towards the target cells. (b) Little change is observed for the control cells.85 (For information on flow cytometry, see Appendix A)
a b
28
The progress of the selection is monitored by flow cytometry using fluorescence-labeled DNA
libraries and aptamer probes, as shown Figure 1-5. This process is continued for about 20
rounds, and the resulting enriched library is cloned and sequenced. The sequences are collected
and aptamers are identified.
Table 1-1. Screening of aptamers selected using Cell-SELEX. Each aptamer was screened with different types of leukemia cells to identify common receptor profiles. 85,90
Cell line Aptamer Sgc8a
Aptamer Sgc3b
Aptamer Sgc4c
Aptamer Sgd2d
Aptamer Sgd3e
Cultured cell lines
Molt-4 (T cell-ALL) ++++ +++ ++++ ++++ ++++
Sup-T1 (T cell-ALL) ++++ + ++++ ++++ ++ Jurkat (T cell-ALL) ++++ +++ ++++ ++++ ++++ SUP-B15 (B cell-ALL) + 0 ++ + 0 U266 (B-cell myeloma) 0 0 0 0 0 Toledo (B-cell
lymphoma) 0 0 ++++ ++++ +
Mo2058 (B-cell lymphoma)
0 ++ ++ 0 +
NB-4 (AML, APL) 0 0 +++ ++++ 0 Cells from patients
TALL Large B-cell lymphoma
++ 0
+++ 0
+++ 0
+++ 0
+++ 0
See appendix A for an explanation of used for binding tendency (i.e. ++++, +++, etc…) AML: acute myeloid leukemia; ALL: acute lymphoblastic leukemia, APL: acute promyelocytic leukemia. a-e: Aptamers Sgc8, Sgc3, Sgc4, Sgd2, sgd3 selected against T-cell acute lymphoma cell line: CCRF-CEM respectively (see reference 85 and 90). For more information on flow cytometer analysis see Appendix A.
The aptamers selected in the previous study84, 85 were also tested to determine their
feasibility as molecular probes for recognition and targeting. Since one aptamer interacts with
protein targets on the cell membrane, the probes were tested with different leukemia cell lines to
investigate common protein profiles as shown in Table 1-1.90 Several of the aptamers selected
against the T-cell leukemia cell line also showed binding with other categories of leukemia cells.
For example, aptamer Sgc3 primarily recognizes T cell acute lymphoblastic leukemia cells,
while aptamer Sgc8 recognizes both B-cells and T cell acute lymphoblastic leukemia cells. The
29
results summarized in Table 1-1 indicate that a panel of aptamers specific for each cell type is
useful in revealing over- or under-expressed specific protein signatures, thus eliminating the
need for detailed knowledge of distinct expression patterns of membrane proteins prior to
selection.
Applications of Aptamers in Cancer
Biomarker identification has enabled the development of therapeutic applications that can
precisely target elevated levels of proteins or genes. Such approaches anticipate that targeted
imaging of elevated levels of cellular molecules may be used as a tool in diagnosis and or
therapy.
Currently, a number of techniques have been used to image tumors. For example, one
study exploited the increased glycolysis in cancer by observing the increased uptake of 18F-
labeled fluorodeoxyglucose by positron emission tomography (PET).91 In addition to PET, there
are many other imaging techniques available, such as magnetic resonance imaging (MRI),92
computed tomography (CT),93 ultrasound methods and optical technologies.94 These methods
for whole-body imaging provide primarily anatomical information or functional information at a
macroscopic level. Recent research has focused on cellular-level recognition using specific binding
by molecular probes, which can produce or alter signals that are detected by imaging devices such as
PET. However, a major limitation is inadequate availability of tumor specific imaging probes.
This lack results in low sensitivity and reduced specificity, as well as poor spatial localization in
clinical applications of molecular imaging. In this regard, aptamers can be effective candidates for
new probes for both biomarker identification and therapeutic targeting of tumor cells.90, 95-99 For
example, labeling oligonucleotides with gamma or β−positron emitters for in vivo imaging has
been already demonstrated. 100, 101 In particular, the labeling of a phosphodiester oligonucleotide
with 18F showed potential for in vivo imaging in a primate PET study.100, 101
30
Use of aptamers as molecular imaging probes in combination with PET will greatly
increase the specificity of current imaging techniques. A recent study demonstrated that an
aptamer specifically selected against tenascin-C (aptamer TTA1) and modified with 99mTc could
be used as an imaging probe to specifically recognize tenascin abundant cell surfaces.102
Aptamer TTA1 was chemically modified with 2'-F-pyrimidines and 2'-OMe-purines to increase
the nuclease resistance in vivo. It has been modified with a 3’-3’ linkage to increase the stability,
and the 5’ end was modified with diethylenetriaminepentaacetic acid (DTPA) via a polyethylene
glycol (PEG) linker. The DTPA chealates with 99mTc for imaging aptamer localization. This
study demonstrated the potential applicability of aptamers in xenografted human tumor imaging.
Results from our laboratory have also demonstrated the wide-range of feasibility of aptamer-
based cell profiling and imaging using a cocktail of labeled aptamer probes to target specific cell
types.84,85
Aptamers can also be chemically modified for drug delivery. Recently, two studies were
published describing aptamer conjugated to a chemotherapeutic drug doxyrubicin95 and a toxin.96
Because most of the chemotherapeutic agents are DNA intercalating reagents, DNA/RNA
aptamers themselves can carry packed chemotherapeutic agents, but toxins must be conjugated
to the aptamer. For example, anti PSMA (Prostate Specific Membrane Antigen) aptamers were
conjugated to recombinant gelonin an N-glycosidase protein. Gelonin causes cell death by
cleaving a specific glycosidic bond in rRNA, thus disrupting protein synthesis. The aptamer-
toxin conjugates showed IC50 (Inhibition Concentration) of 27nM for cells which express
PSMA compared to non-PSMA expressing cells.
Also, two independent studies have demonstrated the feasibility of using aptamers for gene
therapy using SiRNA.97,103 Since the aptamers can readily be chemically modified to conjugate
31
biomolecules with different functionalities, aptamer-SiRNA complexes were designed for release
after internalization into the endosome.
Aptamers and Antibodies
The interaction of an antibody with its epitope is analogous to binding of an aptamer with
its target. Even though antibodies have been known for more than three decades, aptamers show
inherent advantages that merit their application in biomedical and analytical sciences, as well as
in basic molecular biology.104 Unlike antibodies, which need tedious procedures involving
animals for production, generations of aptamers can be prepared by a simple automated chemical
reaction. Since aptamers are short DNA/RNA strands, they have much longer shelf lives than
antibodies. Aptamers are stable and chemically robust, and are able to regain activity after
exposure to heat and denaturants. Also, the selection process can be manipulated to obtain
aptamers with desired properties for binding to specific regions of the target proteins. In
biomedical applications, use of antibodies is limited by their large size and their inability to
penetrate large solid tumors.105 However, aptamers are smaller in size, and they show higher
penetration and higher clearance rates compared to antibodies. Affinities of aptamers are
comparable with antibodies, with KD ranging typically from 0.3 to 500nM. 53, 106-110
Photodynamic Therapy
While use of SiRNA and other chemotherapeutic agents are successful in treating cancer,
these drugs must be co-localized in a specific cellular compartment in order to produce their
therapeutic effects.111 Photodynamic therapy (PDT) is an alternative method which cleverly
exploits the ability of a photosensitizer (PS) to be excited into the excited state by UV, visible, or
near infra-red light (λ = 200nm-700nm). The excited PS reacts with dioxygen in the surrounding
tissue to produce singlet oxygen which subsequently reacts with unsaturated double bonds to
disrupt cell membranes and protein structure. The lifetimes of singlet oxygen in biological
32
systems is typically around 0.04 microseconds, and, as a consequence, the radius of action of
photo damage is considered to be 0.02 micrometers.112 Thus, PDTs with predetermined
localizations are considered to be among the most effective treatment modalities for cancer. This
technique was introduced in the 1890’s by Finsen who treated the skin condition lupus vulgaris
using a heat –filtered light from a carbon arc lamp.113 The Nobel Prize was awarded to Finsen in
1903 for his investigations of the use of light to cure diseased cells.
Mechanisms of Photosensitizing Action
The PDT process is summarized in the extended Jablonski diagram shown in Figure 1-6.
When the porphyrin moiety of PS absorbs light of the correct wavelength, it is excited to the first
excited singlet state, S1. The S1 state can return to the ground state by fluorescence or
radiationless decay, or it can undergo intersystem crossing to a triplet state, T1, which is longer
lived and chemically more reactive than S1. For this reason, most of the biological reactions are
mediated by PS in the triplet state, which can interact with the triplet ground state of O2 to
generate the excited singlet state of oxygen and return PS to its ground state. This excited
oxygen can induce photo-oxidative reactions with various biomolecules.
Biological Damage of Singlet Oxygen
The generated singlet oxygen can react with unsaturated lipids and amino acid residues
(Figure 1-7).114 Since unsaturated lipids and proteins are commonly present in biological
membranes, the major cause of cell death is damage to the cell membrane. This leads to vascular
shutdown and necrosis. Photo damage to the membrane activates the immune system, which is
triggered to recognize, track down and destroy the remaining tumor cells.
Current Delivery Systems in Photodynamic Treatment.
Efficiency of PDT is determined by successful localization of the PS in diseased tissue.
Unlike other chemotherapeutic or toxin agents, the PS does not need to be released from the
33
delivery agent. As long as the delivery agent shows preferential selectivity for the target tissue,
the improved photo-destruction will take place.
Figure 1-6. Extended Jabonski diagram. The generation of excited porphyrin states and reactive dioxygen species is illustrated. State energies: blue porphyrin sensitizer, green dioxygen. Upon irradiation of light the porphyrin is excited into excited states which then react with ground state triplet oxygen in the surrounding tissues.
For this reason, an improved delivery system for PSs will preferentially increase the
concentration of the PS at the diseased cells and increase PDT effectiveness. A number of PS
delivery systems have been introduced. Photoimmuno conjugates comprise the most common
approach.115 The idea is that new antigens specific for diseased cells are present in the tumor
cells, and it is possible to exploit the specific recognition of a monoclonal antibody (MAb) for its
antigen. However, a limitation of this procedure is the need to conjugate the PSs to the antibody.
After the conjugation of molecules to MAbs, the antibodies can lose their affinities toward
their antigens. Besides, due to their large sizes, the tissue penetration efficiency of PS/Mab
conjugates is poor. For this reason, alternative approaches have been introduced. For example,
34
PSs have been conjugated to serum proteins such as bovine serum albumin (BSA), 116 low
density lipoproteins (LDL)117, annexins118, steroids119 and transferrin.120
Figure 1-7. Reactions of singlet oxygen with biomolecules. Singlet oxygen react with molecules containing unsaturated bonds and α−amino acid residues, resulting in damage to membranes and proteins
However, these delivery systems have shown non-specific localization into different sites,
difficulties in conjugation chemistries, and the loss of specificity, and affinity after conjugation,
thus decreasing their targeting ability and effectiveness as delivery agents. Alternatively,
conjugation of a PS with an aptamer may provide a more effective way to deliver the PS to the
target site.
35
Overview of Dissertation Research
The scope of the research work presented here is to investigate the applicability of
aptamers as probes in cancer studies. First, CE-SELEX methodology was used to select an
aptamer targeting a tumor promoting protein. In a second project, aptamer selected using cell-
SELEX method was used to identify a cancer-cell specific biomarker. The aptamer binds to
biomarker was subsequently used for therapeutic targeting of tumor cells. Finally, a fourth
project demonstrates proof-of-concept of aptamer-based pro-drug design.
36
CHAPTER 2 SELECTION OF HIGH AFFINITY DNA LIGANDS FOR PROTEIN KINASE C-δ
Introduction
Development of fluorescent proteins, such as green fluorescent protein (GFP), that co-
express with a protein of interest has been widely applied and can be considered as the most
successful way to monitor molecular events in real time121 However, co-expression, in particular
for protein kinase C-delta (PKCδ), has been shown to affect its biological function. One way to
address this problem is the development of PKCδ specific probes that can track the translocation
of the protein in vivo. Recent studies from our group demonstrated that fluorescently labeled
aptamers can be used as tools to study protein-protein interactions.122 The focus of this chapter
is, therefore, to select DNA aptamers and to develop DNA based fluorescent probes targeting
PKCδ .
Protein Kinase C Family of Proteins
Protein Kinase C is a family of serine and threonine kinases that mediate a wide variety of
cellular signaling processes such as cell growth, differentiation, apoptosis and tumor
development.123-125 Also, PKC is known as the major receptor for tumor-promoting phorbal
esters in the cell. To date, eleven isoforms of PKCs have been identified. Based on the structural
composition of the regulatory moiety, three major sub families are known: 1) conventional PKCs
with four homologous domains, whose activation depends on calcium and responds to diacyl
glycerol (DAG) or 12-O-tetradeconoylphorbal-13-actate (TPA), 2) novel PKCs activated by
DAG, or TPA, which are calcium independent, and 3) atypical PKCs, whose activation
mechanism does not depend on DAG, TPA, or calcium.126
We are interested in PKC isoform δ (PKCδ), which is ubiquitously distributed in a variety
of cells and belongs to the novel PKC (group 2) sub family. Changes of the cellular processes
37
observed with/without treatment of cells with TPA are assumed to be mediated by PKCδ.
Extensive biochemical studies have established that PKCδ is mainly implicated in regulation and
programmed cell death in non-cardiac cell types.127 Furthermore, unlike closely related isoforms
PKCβ and PKCε, PKCδ slows proliferation, induces cell cycle arrest, and enhances the
differentiation of the various undifferentiated cell lines.128 Also, PKCδ activates NFκ B (nuclear
factor κ B), which is a ubiquitous transcription factor that plays a key role in regulating the
immune and inflammatory responses.129, 130
The interaction of binding and anchoring proteins specific for PKC plays a significant role
in co-localization and interaction with specific substrates.131 The mechanism of PKCδ signaling
is frequently studied by producing stable cell clones that over-express PKCδ with a fluorescent
reporter using corresponding expression vectors and/or by using fluorescently labeled protein
specific antibodies.132 Apart from using antibodies, recent work has shown that fluorescence
resonance energy transfer (FRET) based reporters for kinase activities are viable probes for
phosphorylation in live cells. 133 However, several studies indicate that the over-expression is
not always physiologically relevant. For example, several groups reported that over-expressed
PKC iso-enzyme overwhelmed the endogenous enzyme, causing non-specific localization and
substrate phosphorylation in CHO cells,134 smooth muscle cells,135 NIH 3T3 fibroblast cells,136
human gliloma cells,137 and capillary endothelial cells.138 For these reasons, development of a
new methodology for specific fluorescence labeling of endogenous proteins including PKCs
would be very useful.
In this regard, use of aptamers as reporter molecules to track PKC translocation can be
promising. One way to obtain protein-specific DNA aptamers is by capillary electrophoresis
based systematic evolution of ligands by exponential enrichment (CE-SELEX).72, 73, 75 This
38
method has shown significant advantages over conventional SELEX techniques. For example,
the first study on CE-SELEX was reported to obtain aptamers with low-nanomolar dissociation
constants in only four rounds of CE-SELEX. 73, 75 In this work, we have used CE-SELEX to
identify DNA sequences which specifically bind to PKCδ, with the objective of producing
fluorescent probes for in vitro studies.
Materials and Methods
Instrumentation
PCR was performed using a Bio-Rad thermocycler. The CE instrument that was used is a
home-made CE system (see Figure 2-1). Radiation quantification was done using a Bio-Rad
personal phospho-imager. Fluorescence measurements were made on a JOBIN YVON-SPEX
Industries Fluorolog-3 Model FL3-22 spectrofluorometer.
Initial Library Design
The aim of the SELEX experiment was to identify DNA sequences that specifically bind to
PKCδ and to develop fluorescent probes targeting PKCδ. The SELEX process was initiated by
preparation of an initial library, consisting of a pool of oligonucleotides with a continuous stretch
of 30 randomized nucleotides. The random sequences were flanked on both sides by fixed
sequences used for the hybridization of PCR primers during subsequent rounds of amplification.
SELEX library: 5’-GCCAGGGGTTCCACTACGTAGA (N)30 ACCAGGGGGCAGAGAGAAG GGC-3’ Reverse Primer: 3’-CGGTCCCCAAGGTTGAGCATCA-5’
All oligonucleotides, including PCR primers, were synthesized using standard phosphoramidite
chemistry and purified by denaturing Poly Acrylamide Gel Electrophoresis (PAGE) to remove
truncated DNA fragments produced in the chemical synthesis.
39
PKCδ Expression and Purification
Human recombinant PKCδ was a gift from the laboratory of Dr W. Cho, University of
Illinois at Chicago, and was over-expressed from E. Coli stain BL21 (DE3) and purified using Ni
beads .
PCR Optimization
Once the library was synthesized, the next step was PCR optimization of the DNA library.
PCR is one of the major steps in the SELEX process, and it is necessary to optimize the
conditions (melting temperature, number of cycles) for PCR to obtain the highest yield without
any nonspecific amplifications. The final optimized conditions for the PCR reaction were: 23 ng
of forward primer, 23 ng of biotin-reverse primer, 0.4 mM each of DNTP and 10 mM Tris-HCl
(pH = 9.2) with 3.5 mM MgCl2, and 75 mM KCl buffer in 50uL reaction volumes. A total of 15
cycles of denaturation (30 s, 95ºC), annealing (30 s, 57.5ºC), and extension (20 s, 72ºC) were
performed followed by final extension for 5 minutes at 72ºC.
The PCR products were verified by analyzing aliquots on 2.5% agarose gel stained with
ethidium bromide. In order to obtain a single stranded DNA library of the PCR amplified
product, a second PCR amplification was carried out using 3’-biotin-attached reversed primer.
Amplified DNA was made single stranded using streptavidin sepharose (Amersham Biosciences,
Upsala, Sweden). Double stranded DNA from the PCR reaction was added to the equilibrated
streptavidin column, which was washed with PBS buffer. The dsDNA, which was retained in
the column, was eluted with 200 mM NaOH. The eluted DNA fraction was de-salted using
SephadexTM G-25 DNA grade NAP columns (Amersham Biosciences, Upsala, Sweden).
Recovered DNA was quantified by measuring the absorbance at 254 nm and was used in the
following/subsequent round of selections.
40
Combinatorial Selection of Aptamer
A 2mM solution of the library was prepared in the binding buffer (10 mM HEPES, 0.1M
NaCl, 1mM DTT, 8.1mM Na2HPO4, 1.1mM KH2PO4, 1mM MgCl2) at a pH of 8.05. Before
selection, the 2mM DNA library was denatured at 95ºC for 5 minutes and then cooled at 4ºC.
Human recombinant PKCδ was diluted in the binding buffer and added to the DNA library to
give a final PKCδ concentration of 50nM. The mixture was kept at room temperature for 15
minutes to allow complete binding. The CE selections were performed on a home-made CE
system, shown in Figure 2-1. A high-voltage power supply (Gamma High Voltage Research
Inc., Ormond Beach, FL) provided the electric field. DNA was detected using a UV/Vis detector
(CE-Thermo Capillary Electrophoresis, CRYSTAL 110). A 50μm × 36cm- long (26 cm to
detector), poly(vinyl alcohol)-coated capillary (Agilent Technologies, Palo Alto, CA) was used
for separations. Each day, capillaries were initially flushed with CE separation buffer (8.1mM
Na2HPO4, 1.1mM KH2PO2, 1mM MgCl2, 2.7mM KCl, 40mM NaCl, pH 8.08) for 30 minutes.
An initial potential of 12.5kV was applied during separations. However, after the 4th round, the
applied voltage was reduced to 7.5kV to prevent base line interferences due to Joule heating. For
CE-SELEX selections, samples were injected onto the capillary hydrodynamically (Δh= 5cm,
10s), and absorbance at 254nm was monitored. After non-binding sequences migrated through
the capillary, CE fractions containing high affinity DNA sequences were collected into a sample
vial by applying pressure.
Aptamer Labeling with AT32P
Samples containing oligonucleotide (3.74nmole) and [γ-32P] ATP (8.3pmole) were
incubated overnight at room temperature with 50 units of polynucleotide kinase (Promega).
Unincorporated ATP was removed using a G-25 column (Amersham Biosciences).
41
Figure 2-1. Home made CE set-up used in SELEX experiments. Samples were introduced
hydrodynamically. Protein-DNA complexes were collected by applying pressure to push the samples out of the capillary.
Electrophoretic Mobility Shift Assay (EMSA)
Binding of aptamers to the human recombinant PKCδ was investigated by EMSA. Native
4% polyacrylamide (16cm × 20cm × 1.5mm) gels were prepared using stock solutions of 40%
acrylamide, 2.6% bisacrylamide, 10X TB, pH 8.5 95% glycerol, and 10% ammonium persulfate.
The gels were equilibrated at 4ºC and 20mA for 30 minutes prior to sample loading. The
proteins and the DNA were serially diluted in 30% glycerol and binding buffer, respectively.
Aptamers (8nM final concentration) were incubated for 30 minutes with increasing amounts of
PKCδ (0-2uM) in 2X binding buffer with 200μg/uL BSA in a final volume of 25μL. At the end
of the incubation, samples were loaded while the current was running. Electrophoresis was
continued at 30mA constant current for three hours. A quantitative analysis of the relative
amounts of the radioactivity present in the different bands was obtained from direct counting of
the gel on a Bio-Rad instant phosphor imager system. Despite the enrichment achieved in the 8th
42
round, we introduced an additional gel retardation step to eliminate the low affinity sequences
from the pool. A separate preparative EMSA assay was performed after the 8th CE-SELEX
round using 8nM of PKCδ and 100nM of DNA library from the 8th pool. In order to avoid to the
non-specific interactions, the DNA concentration was increased by a factor of 10 by adding
sheared salmon-sperm DNA to the binding buffer. DNA sequences bound to protein were
extracted using the crush and soak method in which the band corresponded to the DNA-Protein
complexs was excised from the gel and crushed followed by soaking in the elution buffer to elute
bound DNA. 139 The DNA bound to the protein was recovered by phenol extraction followed by
ethanol precipitation.
Cloning and DNA Sequencing
The resulting pool from the 9th round was PCR amplified, cloned using the TOPO-TA
cloning kit (InVitrogen, Carlsbad, CA), ligated into the TA cloning vector and transformed into
Escherichia coli. White colonies were isolated and sequenced using a 96-well format
MegaBACE 1000 capillary sequencer (GE Healthcare) at the ICBR sequencing facility. The
resulted sequences were analyzed with the program Sequencing Analysis Clustlaw 6.0 software.
Fluorescence Anisotropy Measurements
Fluorescence measurements were performed on a Fluorolog-Tau-3 spectrofluorometer
(Jobin Yvon, Inc., Edison, NJ). All experiments were carried out at room temperature using a
100μL cuvette.
The fluorescence intensity of the aptamer was monitored by exciting the sample (TAMRA
label) at 555nm and measuring the emission at 585nm. Bandwidths for both the excitation and
the emission monochromators were set at 10nm. Corrections were also made for potential
dilution factors in the titration experiments.
43
Results and Discussions
The SELEX Process
The need for effective separation methods in SELEX experiments is described in Chapter
1. The SELEX process is a versatile method for identifying nucleic acids that bind to proteins
with affinities and specificities comparable to antibodies. The aim of the SELEX experiment
described in this chapter is to identify DNA sequences that specifically bind to PKCδ, with the
objective of developing fluorescent probes. One of the advantages of CE-SELEX is its high
separation efficiency, which reduces the number of selection rounds required to achieve an
enrichment of the library. For example, the first study by Bowser group on CE-SELEX was
reported to obtain aptamers in the sub-nanomolar affinity with only four rounds of selection. 72
After the synthesis of the DNA library, PCR conditions were optimized. As shown in
Figure 2-2, after 15 PCR cycles the amplification was sufficient to proceed with the selection.
The positive control sequence with identical primer sites was also amplified correctly, while the
negative control with no template sequences was not amplified indicating that no primer-dimer
formed or non-specific amplification of contaminant had taken place.
One difference of CE-SELEX compared to conventional SELEX techniques, is the smaller
sample volumes. Usually, the conventional SELEX experiments are performed using a larger
volume of very diverse DNA library, because having a large number of independent sequences
increases the probability of finding high affinity sequences. So, scaling the volume of a DNA
library down to dimensions typical for CE can hinder the selection of the best aptamers. For
example, synthesis of DNA strands composed of 30 random bases produce 1014 to 1015
independent nucleic acid sequences. During the first round of selection, it is necessary to
introduce all independent sequences to capture the best aptamer. In CE-SELEX, the introduction
of large number of DNA sequences can be done in two ways:
44
Figure 2-2. PCR Optimization. Lane 1: 25bp ladder, Lane 2: negative control (without template sequence), Lane 3: positive control ( DNA template with identical primer sites) Lane 4: amplified DNA library. The positive control and the DNA library were amplified in 15 PCR cycles. The negative control does not show any bands, indicating that no primer-dimer formation or non-specific amplification had taken place. The final optimized conditions for the PCR reaction were: 23 ng of forward primer, 23 ng of biotin/-reverse primer, 0.4mM each of DNTP and 10 mM Tris-HCl buffer (pH = 9.2) with 3.5 mM MgCl2 and 75 mM KCl in 50uL volumes. A total of 15 cycles of denaturation (30 s, 95ºC), annealing (30 s, 57.5 ºC), and extension (20 s, 72ºC) were performed followed by final extension for 5 minutes at 72ºC. The PCR products were verified by analyzing aliquots on 2.5% agarose gel stained with ethidium bromide.
(1) Use of large injection volumes (still much smaller than conventional SELEX volumes) to
increase the number of molecules used in CE-SELEX, and (2) use of high concentration of DNA
library, thereby increasing the number of potential binders in the starting pool. Since the
injection volumes can not be significantly manipulated, we initiated the SELEX process by
employing a high concentration of DNA library (2mM), which provides 1013 DNA molecules
with an injection volume in the nano-liter range.
The disadvantage of using a high concentration of DNA is that the peaks observed in the
CE are relatively broad and can interfere with the separation efficiency (see Figure 2-3). Also,
these large peaks can be mis-shaped due to the high ionic concentrations employed in the
experiments. Both high concentration of ions and analytes can lead to de-stacking of the flow of
45
ions giving broad peaks. This is the major drawback in using CE as the separation method in
SELEX experiments.
Figure 2-3. Electropherogram of 2mM DNA library. Observed electropherogram of 2mM DNA library with retention time of 129 seconds. The peak width observed for the DNA library is 30 seconds, which is much larger than typical CE peak widths. CE conditions: Binding buffer with 10mM HEPES,1mM MgCl2, 16mM KCl pH 8.05, 12.5kV at room temperature, UV detection at 254nm
Therefore prior to the actual selection, we estimated the migration time of the free library
by observing the absorbance of DNA at 254nm (see Figure 2-3). This allowed us to estimate the
collection time of the protein-DNA complexes which migrate more slowly than the free DNA.
Prior to the SELEX experiments, the initial DNA library was denatured and then slowly
cooled to room temperature to allow the formation of stable secondary structures. During the
first 2 rounds of selection, PKCδ was kept at 100nM concentration and incubated with the 2mM
DNA library at room temperature for 15 minutes to allow complete binding. Typically, in
SELEX experiments, the selection process starts with a low ratio of DNA to protein to allow all
the binding species to be captured and amplified. However, as the selection progresses, the ratio
46
of DNA to protein is increased to make the selection more stringent. This way, only the best
binders will be retained, and the poor binders will be removed. Therefore, in our SELEX
experiments, after the 2nd round of the SELEX process, the DNA-to-protein ratio was increased.
Also, the pH of the buffer was adjusted to 8.05 to match the pI of the protein. When the free
protein is at its pI, it carries no charge and does not migrate with the electrophoretic flow.
Protein bound to DNA carries the negative charge of the DNA molecule and migrates ahead,
with the electrophoretic flow, but because of the greater size of the protein-DNA complex, it
migrates much more slowly than the free DNA. After the free DNA eluted to the waste
reservoir, the voltage was applied for another five minutes. The outlet of the capillary was then
placed into a collection vial and pressure was applied to push the DNA-PKCδ complex out of the
capillary. Captured fractions were PCR amplified using 50μL reaction volumes. A second PCR
step was employed with a biotinylated reverse primer and dsDNA was converted in to ssDNA
using a streptavidin column.
Even though CE shows high separation efficiencies, we did not achieve enrichment with
a low number of SELEX rounds (fewer than 4 rounds). The initial paper 73 introducing the CE-
SELEX method, used human recombinant IgE as the target. The molecular weight of IgE is
115kDa. In comparison, the molecular weight of PKCδ is 70kDa, significantly less than IgE.
Since the mobility shift depends on the differences of the molecular weights of the protein-DNA
complexes and the free DNA, the mobility shift of PKC−DΝΑ is considerably less. Due to this
smaller difference, the free and bound DNAs are not separated well, increasing the probability of
collecting non-specifically interacting sequences. This effect of size difference on the separation
using CE-SELEX can limit the versatility of CE-SELEX method.
47
The peak shape is also a potential limitation of the CE-SELEX technique, because low
affinity sequences migrate in different rates, resulting in broad peaks. Figure 2-4 exemplifies the
observed absorbance at 254nm of the libraries corresponding to pools from 2, 4 5 and 8. As
shown in Figure 2-4, even with 100uM DNA, the peaks observed in rounds 2, 4, 6 and 8 are
significantly broad. Since only a few DNA sequences binding with PKCδ, the peak
corresponding to bound DNA sequences cannot be seen in Figure 2-4 because it is below the
limit of detection.
Figure 2-4. Electropherograms of the unbound DNA observed during SELEX rounds 2, 4, 6, and 8. DNA samples from the previous round were incubated with PKCδ and separated using CE. CE conditions are identical except for the voltage. Due to interferences from joule heating, the voltage was reduced to 7.5kV after round 2. Despite the number of the round, the peak corresponding to free DNA is broad which can decrease the separation efficiency.
Despite these challenges, we achieved a significant enrichment of the library at the 8th
round. The progress of the selection was monitored using Electro Mobility Shift Assay (EMSA)
as described in the methods and materials. The results for the 8th pool and the initial library are
shown in Figures 2-5 and 2-6, respectively. By comparing the binding curves corresponding to
the initial library (Figure 2-6) and enriched pool from round 8 (Figure 2-5), we observed a 60%
enrichment of high affinity sequences. However, since the enrichment was relatively poor, we
introduced an additional gel extraction step to capture the sequences with the highest affinity.
48
Figure 2-5. Affinity of enriched DNA pool from 8th round. A 3nM of 32P labeled DNA pool was
incubated with 4, 8, 16, 32, 64, 128, 250, 500, 1000, 2000nM PKCδ and analyzed by EMSA image (4% PAGE). Fraction bound was plotted as a function of protein concentration. As the concentration of PKCδ increases, there is an increase in the bound fraction, indicating that the DNA pool has been enriched with specific binders.
Figure 2-6. Affinity of starting DNA pool. 32P labeled starting library (3nM) was incubated with
4, 8, 16, 32, 64, 128, 250, 500, 1000, 2000nM of PKCδ and analyzed by EMSA. Fraction of bound DNA plotted was as a function of PKCδ concentration. Despite the increase in protein concentration, the fraction of bound DNA remains less than 20%, suggesting the starting librarycontained a low concentration of specific binders.
49
Analysis of Consensus Secondary Structure of High-Affinity DNA Ligands
The sequencing data for clones were analyzed using Sequencing Analysis Clustal W 6.0
software. As shown in the Figure 2-7, these were 53 sequences, of which 11 unique ligands can
be grouped into 11 sub-families based on their sequence similarities.
Typically, the classification of sequences is based on the fragments of sequences conserved
during the selection due to evolution (color coded in Figure 2-7). Inspection of the evolved
sequences for the group of ligands shown in Figure 2-7 shows short segments of conserved
primary sequences, disrupted by less conserved sequence regions of different lengths. By
observing the patterns of these conserved fragments, the individual sequences can be pooled into
a single subfamily. The number on the right hand side of the Figure 2-7 corresponds to the
random region of the starting library retained during the selection.
Analysis of Binding Sequences for PKCδ
According to CE-SELEX experiment, highly repeated sequences should be the best
aptamer candidates. As shown in Table 2-1 sequence PB 9 represents a higher population in the
library, while the population for sequence PB 12 smaller. This indicates that sequence PB 9 is a
higher affinity sequence, while sequence PB 12 is a non-specifically enriched sequence.
Therefore, sequence PB 9 was chosen for further investigation with PB 12 as the control
sequence.
The binding analysis of aptamer sequence PB 9 and sequence PB 12 was performed using
EMSA. Each sequence was labeled with 32P and the resulting sequences were analyzed for
fraction of binding with PKCδ using EMSA with a fixed protein concentration at 400nM. As
expected, aptamer sequence PB 9 from the major class showed higher affinity towards the
protein, i.e. higher fraction of bound sequence for a given concentration of PKCδ.
50
Aptamer_PB4-A06 ---------GATCCGGACGCACGGTGGGATGGACAAC-----------------28
Aptamer_PB4-G09 (PB 1) -------------CCGACCAACCGCGGGGGGCACACCTC---------------26
Aptamer_PB4-F12 --------------ACGCAAACCGTGAGTGGTGGAAGGATCATG----------30
Aptamer_PB4-H03 ------CGAACAGCATCCGGAGGACGAATCGGGTTA------------------30
Aptamer_PB4-H05 -------GACCACAGCCGAGGCC--GGACATGAGCGTACA--------------31
Aptamer_PB4-F09 --------GGAGATCAGCAACGTTAGGAAACACAGCTA----------------30
Aptamer_PB4-C07 (PB3) --------CGTGAGGCTGAGACCATGGATATTAGGGCC----------------30
Aptamer_PB4-H12 -----CGCAACACACACGGGACCATCAACAGTACA-------------------30
Aptamer_PB4-E11 ---------------TCGCGACCTAAGGGAGCACGTTCTGTCTCCA--------31
Aptamer_PB4-H08 ---------GGTAGCAGGAA-TAGAGACGTGAGGCGTAAA---------------30
Aptamer_PB4-B03 (PB4) ---------CGAAGGAAGGG-TAGCGGATCGAGAGGGGGA--------------30
Aptamer_PB4-G01 ----------GCAGCAAGGC-TAGAAAGAGAGGACAGCGGT-------------30
Aptamer_PB4-F01 ------------GGCAAGGGATAGGGAAAAGGGCGGGTAAAG------------30
Aptamer_PB4-H07 (PB5) ---TACAAACAGACCAGGTGGCAGAGAGAAGGGC--------------------31
Aptamer_PB4-F07 -------------CCAGCGGGCAGAGAGAAGGGCACGGTGTG------------29
Aptamer_PB4-D11 ----------GAGGCAGTAAACGGGAGGGGACAAAGGGCT--------------30
Aptamer_PB4-D06 (PB 6) ----------CAGCTGAACGGCAGGCGTGGACAA--GGAGAT------------30
Aptamer_PB4-B10 ------------GACAGGTGGAGGAGCGAACAAGCGGAT--------------27
Aptamer_PB4-C08 ---------GAGAAAGAGAAGGAGTGAGACGCAGACAAA---------------30
Aptamer_PB4-F04 ----------AGAGATGGTGACAGAGGATTGTGATCTCAC--------------30
Aptamer_PB4-A10 -------TTGGGAGCCTTGGGTCCGGGAACACAAGGGC----------------31
Aptamer_PB4-B12 (PB7) --------GGAGGAGCCGAGGGTCCCAGAAGAAGGGA-----------------29
Aptamer_PB4-D02 ---------GTG--ACCAGAAGGTCCA-GACTGGAGGCCGCC------------30
Aptamer_PB4-B11 --------TGTATAGCTCCCATTCATGGCGCTGGTAC-----------------29
Aptamer_PB4-E08 -----------GCACACCCCACTGAAGGCTCCGGTGCGGTA-------------30
Aptamer_PB4-G06 -----------GAGGGGGACGA-GGTGAATGCACACGGGATT------------30
Aptamer_PB4-F11 (PB 8) ----------GGGTGGTGACGA-ATGGGTTGCATACCCGAT-------------30
Aptamer_PB4-H06 ----------GGTCTATGTCGATATCGGTTGTATCCGGGG--------------30
Aptamer_PB4-C10 ---------GTGGAAAGGAAGTCCTCGAGGGTATGCGGT---------------30
Aptamer_PB4-A09 ------------CAGCCCTGAGCATGCGTACTCCCCCCTGACCCC---------33
Aptamer_PB4-G08 (PB 9)------------ACACGACGGGAATACTGACTCCCCCCCATGT-----------31
Aptamer_PB4-E12 -------------TGCCCCGGCCATTTGTCCTACACCCCCCTC-----------30
Aptamer_PB4-F06 -------------TGCCACCCCCACAGACCTTTCCCCCCCTAG-----------30
Aptamer_PB4-G10 -----------CAGGCAGCTCCGAAAGACGGGACCCCCCC--------------29
Aptamer_PB4-G12 ----------TGA-GTCCCCGCACCAGCGACCCTCCCCCCT-------------30
Aptamer_PB4-G11 ----------------GAGCGGCGAAGCTCACAGCCCCCCCACACA--------30
Aptamer_PB4-B06.b ----------CGGGGCGGTAGTAATTCCCTCCAGATCGGT--------------30
Aptamer_PB4-E07 (PB 10)-------------CCCTAGTGTTACTCTACCACATAATGCATC-----------30
Aptamer_PB4-A07 -------------GACCACCGCTGTTCACCCCGGTACTACTTC-----------30
Figure 2-7. Sequences obtained from high throughput sequencing of pool of round 9. The same color indicates the conserved similar sequence fragments captured during the evolution. The dash lines correspond to the fixed primer regions. Short fragment of sequences of the same color correspond to sequences evolved during the selection process. According to sequence homology, 11 subfamilies were identified.
51
Aptamer_PB4-C11 (PB 11)-----CATGC--TGCCAGGGGTTCCACTACGTAGAGGCAAT-------------34
Aptamer_PB4-E06 -------TGCC-TGCCAGGG--TTCACTACGTAGAGGTA---------------29
Aptamer_PB4-G04 ---------CCGTGCCAGGGGTTCCACTACGTAG--------------------25
Aptamer_PB4-D12(PB 12)-TGGGGAACGGAATGCCAGGGGTTCCACTACGTAGA-------------------35
Aptamer_PB4-D08 TTCGCAGTGCCAGGGGTTCCACTACGTAGAGTTGCTTCATCCGCTCATATGCACG 55
Aptamer_PB4-F02 CAGCGTGCCAGGGGTTCCACTACGTAGAGCGATGTGGCTTGGGGAGGGTGCGT 53
Aptamer_PB4E1 TGCCAC--TGCCAGGTGTTCCACTACGTAGAT--GGGACGGCAAGGTGGACAGCAG 52
Aptamer_PB4-H10 ----GACAAGGTGCCAGG-GTTCCACTACGTAGACCCGCAACGGGGACACGCGCACCAC 54
Aptamer_PB4-B02 (PB 13)----CACGGGTCTCGTTGTCGAATGCGTGCAAGG--------------------30
Aptamer_PB4-C03 ------TCTTCTCCTCTCCTTCTTTACTAGTTGCGATACGTAGTGGAACCTGGC48
Aptamer_PB4-E03 ---------GCTGCCTGTCCATGTGACTGGATGTGCTA----------------29
Aptamer_PB4-D01 ------------GCGATTTCGTGTCAACTGTTGTGTCGCCTC------------30
Aptamer_PB4-H04 ------GAGCGAGAGTTAAGT-CTTTGGTTCGTGCAA-----------------30
Aptamer_PB4-D10 ---TCACAGAAAGGGACTCCATCTCCACGGGCA---------------------30
Figure 2-7. Continued
Table 2-1. Evolved family of sequences with percentage of population. Higher percentages are indicative of sequences with preferential binding with PKCδ with high affinity.
Family Sequence Percentage of Population PB9 PB12 PB11 PB2 PB3 PB1 PB4 PB6 PB5 PB7 PB8
ACACGACGGGAATACTGACTCTCCCCCATGT TGGTGAACGGAATGCCGGGGCTTCCACTACGCAGA CATGCTGCCAGGGGTTCCACTACGTAGAGGCAA CCAGGGGGCAGAGAGAAGGGCATGGTGTG GTAAAGGGCCAAAGACTGTATGAATACCAT AGCCGAGTGCTCGCAACGGTTTAGCCCCAT CAACGAGAGTAGAACGAGGGGATGTCTGCA GGACGGGCAAAGAAAGAGGGAAGAGAACAG GCCAAGAGCAACGAGGAAGCAGGATAGGGC CATACGTGGTCATGCATACCCGTAACCGTT ACAAAAGAAGGAGAGGGAGAAGGGATAGGT
32% 4% 24% 11 % 9% 4% 4% 4% 3% 2% 2%
As exemplified in Figure 2-8, compared with sequence PB 12, aptamer sequence PB 9 shows
approximately five times higher binding with the given concentration of PKCδ. After the
demonstrating the affinity for PKCδ, the feasibility of modifying the aptamer probe with a
fluorescent label was investigated. Since the final goal of this study was to use the aptamer for
fluorescent based assays, the binding constant of the labeled aptamer was determined by
observing the change of fluorescent anisotropy of aptamer PB 9 labeled TMR
(Tetramethylrhodamine) at the 5’ end.
52
Figure 2-8. Affinity of 32P labeled aptamer PB 9 to PKCδ. 32P labeled aptamer PB 9 (14nM) was
incubated with 400nM PKCδ in the binding buffer and analyzed by EMSA. Similarly, 14nM of 32P labeled PB12 incubated with PKC-δ (400nM) was analyzed. Fraction of bound PB9 with PKCδ was normalized to 1. Binding of aptamer was PB 9 with is approximately 5 times higher than binding with PB 12, demonstrating the higher affinity of aptamer PB 9 towards PKCδ.
Fluorescence anisotropy is the measurement of the change in the rotational motion of a
small molecule interacting with large molecule. Since aptamers are small molecules, binding to a
large protein molecule significantly increase their molecular weights and decrease the rotational
motion. This results in a detectable variation of the initial anisotropy. The fluorescence
anisotropy r, is calculated by the equation:
r = (IVV – G·IVH) / (IVV + 2G· IVH) (2-1)
Subscripts V and H refer to the orientation (vertical or horizontal) of the polarizers for the
intensity measurements, with the first subscript to corresponding to the position of the excitation
polarizer and the second subscript to the emission polarizer. The term G refers to the G-factor,
which is the ratio of sensitivities of the detection system for vertically and horizontally polarized
light.
53
Figure 2-9 shows the binding curve generated by monitoring the change in fluorescence
anisotropy of aptamer PB 9 upon addition of PKCδ. The increase fluorescence anisotropy upon
addition of aliquots of PKCδ indicates a change in the rotational motion of TMR labeled aptamer
PB 9 when it binds with PKCδ. Since TMR-labeled aptamer PB 9 is small, when it is free in
solution, the rotational motion of TMR is high, resulting in low anisotropy. On the other hand,
when aptamer PB 9 is bound to PKCδ, the size increases significantly, thus, decreasing the
rotational motion and increasing the anisotropy.
Figure 2-9. Affinity of TMR labeled PB-9 to PKCδ. Change of anisotropy of 5’-TMR labeled aptamer PB 9 observed upon addition of PKCδ. Αs aliquots of PKCδ are added the fluorescence anisotropy increases, because of the much larger size of the TMR labeled aptamer PB 9 bound to PKCδ. On the other hand, control random sequence does not change its anisotropy with increase in concentration of PKCδ, indicating that the random sequence does not bind to PKCδ.
The dissociation constant of the PB9-PKCδ was calculated from the fluorescence
anisotropy data to be 122 nM. A control experiment with a TMR labeled random DNA sequence
54
showed no significant change of fluorescence anisotropy when PKCδ was added, thus
demonstrating that the fluorescently labeled aptamer probe PB 9 can bind with
PKCδ specifically.
Specificity of Aptamer PB 9
Since aptamer PB 9 showed high affinity towards the target PKCδ, we wanted to assess the
specificity of binding. Therefore, the specificity of binding of the aptamer PB 9 with human
PKCδ was investigated by EMSA, using a similar protocol that was used for the binding assays
indicated above. It has been reported in the literature that, high affinity of an aptamers towards
one particular target does not necessarily mean that the binding is preferential for one target
protein. For example, an aptamer selected against coenzyme A recognizes AMP, and an aptamer
selected for xanthine also recognizes guanine.140, 141 Since the target protein PKCδ belongs to a
closely related family of isoforms, the specificity of this aptamer towards PKCδ was assessed by
measuring its affinities for PKCδ and closely for related PKCα and PKCφ.
Figure 2-10. Specificity of aptamer PB9 towards PKCδ. A 32P labeled PB9 (14nM) was added
to a fixed concentrations (400nM) of PKCδ, PKCα, and PKCφ and analyzed by EMSA. Fraction of bound aptamer PB9 with PKCδ was normalized and compared with other isoforms. The affinity of aptamer PB9 for PKCδ is approximately 5-times the affinity for PKCα and 2.5 times the affinity for PKCφ
55
Specificity was measured using 32P labeled aptamer PB 9 and observing the fraction of bound
DNA at a fixed concentration of each protein. As shown in Figure 2-10, the affinity of aptamer
PB 9 towards PKCδ is approximately 5 times the affinity for PKCα and approximately 2.5 times
the affinity for PKCφ, thus demonstrating the specificity of aptamer PB 9 towards PKCδ.
Conclusion
We have selected DNA aptamers capable of in vitro PKCδ monitoring using CE-SELEX.
This aptamer will enable us to apply fluorescently labeled aptamers to study protein-protein
interactions in signal transduction leading to tumor promotion. In this work we have
demonstrated that fluorescently tagged aptamer PB9 can specifically recognize PKCδ with a ΚD
of 122 nM under in vitro conditions. This work shows that, by using CE-SELEX, molecular
probes can be generated for studying intracellular proteins and their functions.
56
CHAPTER 3 APTAMER DIRECTLY EVOLVED FROM LIVE CELLS RECOGNIZES MEMBRANE
BOUND IMMUNOGLOBIN HEAVY MU CHAIN IN BURKITT’S LYMPHOMA CELLS
Previous chapter demonstrated the importance of generating molecular probes that allow
the detection of important signal transduction proteins. Aptamers for PKCδ were selected, and
subsequently one of the aptamer probes was tagged with fluorophore for the detection of
PKCδ in vitro.142 While intracellular proteins are important in a variety of biological
mechanisms, membrane proteins are equally or more important in detection of cancer.
Detection of cancer when the cells are in a pre-malignant state can provide a higher
probability of increasing the cure rate with current treatment strategies. One way of approaching
the issue of early cancer diagnosis is finding new biomarkers. By definition, biomarkers involve
quantitative measurements of biological species which are “abnormal” in their levels compared
to reference “normal” levels. In cancer they often act as key molecules in transforming healthy
cells into malignant cells. Because of their importance, recently much interest has been focused
on the identification of membrane marker proteins.143 In particular, proteomic approaches, in
particular, have emerged as established tools. 144, 145 These include the analysis of complex
protein samples using two-dimensional gel electrophoresis,146 as well as shotgun methods that
employ different membrane solubilization strategies, such as isotope-coded affinity tagging,147
multidimensional protein identification technology148 and surface-enhanced-laser-desorption-
ionization combined with time-of-flight mass analysis of complex biological mixtures.149
Although these approaches are effective in identifying a large number of proteins in their
expression patterns, identifying specific protein markers that strongly correlate with cancer
remains a big challenge.
57
In this regard, there is growing interest in using monoclonal antibodies to target cell
surface proteins that are significantly expressed on diseased cells or tissues. In particular,
magnetic beads conjugated to monoclonal antibodies have been used to isolate membrane
proteins and plasma proteins using whole cellular lysates.150, 151 However, the major problem
with antibodies is the difficulty in generating cell specific antibodies for the detection of the
expression levels in a single type of cell for unknown epitopes.
In order to address this issue, we have developed an effective method to generate aptamer-
based molecular probes for the specific recognition of cancer cells. 84,85 Using the Cell-SELEX
method described in the Chapter 1, we have generated aptamer TD05 which only recognizes
Ramos cells, from a Burkitt’s Lymphoma (BL) cell line (described below).84, 85 For example, as
shown in Table 3-1, aptamer TE13, which was selected against this cell line, shows different
levels of binding with different leukemia/lymphoma cell lines. On the other hand, aptamer TD05
shows preferential binding to the target Ramos cell line. Based on the observed selectivity of
aptamer TD05, we hypothesized that this aptamer might be recognizing a protein related
primarily to BL cells but not to other cells.
Burkitt’s Lymphoma
Burkitt’s non-Hodgkin’s lymphoma (BL) is a heterogeneous collection of highly
aggressive malignant B-Cells. BL was first reported as an endemic in equatorial Africa and in
New Guinea, and it also is commonly found in HIV-infected patients.152 At the molecular level,
BL is associated with deregulation of the expression of c-myc, a gene that encodes a basic helix-
loop-helix transcription factor that specifically binds to DNA sequence. The gene c-myc plays
an important role in the transcriptional regulation of downstream genes that control a number of
cellular processes, such as cell cycle progression and programmed cell death.153, 154 These tumor
58
cells usually express B-cell-specific tumor markers such as CD19, CD20 immunoglobin and Ig κ
and λ light chains. 155-157
Table 3-1. Recognition patterns of aptamers TD05 and TE13 with different leukemia cell lines, Aptamer TD05 exclusively recognizes Ramos cells, indicating that TD05 might be interacting with BL specific protein, while aptamer TE13 interacting with a wide range of cells (for information aptamer TD05, see reference 84)
Cell Line Aptamer TD05 AptamerTE13
Ramos (Burkitts’ Lymphoma) ++++ ++++ CCRF CEM (T cell line, human Acute Lymphoblastic Leukemia)
-0- ++++
MO2058 (Mantle lymphoma cell line ) -0- + Jurkat, (human acute T cell leukemia) -0- +++ Toledo (Human Diffuse large cell Lymphoma) -0- +++ HL69 (small cell lung cancer) -0- -0- NB-4 (acute promyelocytic leukemia) -0- +++ HL-60 (acute promyelocytic leukemia) -0- +++
This data were obtained from partly unpublished work. The experiments were performed by Dr Zhiwen Tang. An explanation of the symbols used to evaluate cell binding (i.e. +++, ++++…) is given in appendix A
Principle of Photocrosslinking of DNA with Proteins
Interaction site of proteins and nucleic acids, in particular the crosslinking of proteins with
nucleic acids, have been studied for decades. For example, UV-crosslinking combined with
immunoprecipitation (UV-X-ChIP) assays has been used in mapping protein DNA
interactions.158 Similarly, there have been several attempts made to map interactions between
aptamers and proteins using photo-aptamers containing photo-active bases that can induce
formation of highly reactive radicals upon irradiation with light. 159 For example, the interaction
of single-stranded DNA aptamers with basic fibroblast growth factor has been studied by
photochemically crosslinking the protein with the aptamer. 159, 160
59
Figure 3-1. Protocol for the identification of IGHM protein on Ramos cells. (1) Incubation of biotinylated photoactive aptamer TD05 with the cells. (2) Irradiation of photoactive aptamer TD05 to initiate crosslinks to the membrane protein (3) Cell lysis and extraction with steptavidin-labeled magnetic beads (4) Release of protein-aptamer complexes from the beads (5) Gel electrophoresis (6) MS analysis
A multi-step process was used to identify the target protein of aptamer TD05 on the
Ramos membrane, as shown schematically in Figure 3-1. First, the aptamer probe was
chemically modified with a photoactive uracil derivative at selected sites and linked to biotin via
S-S-bomd. After incubation with Ramos cells, the target protein was separated by lysing and
extraction with streptavidin linked to magnetic beads. The beads were removed by reduction of
the –S-S- link. The crosslinked proteins were separated by gel electrophoresis and analyzed by
60
mass spectroscopy (MS) and by a database search. Last, the identity of the target protein was
confirmed using an existing antibody and the selected aptamer. Detailed description about each
step is discussed in the later sections.
Aptamer TD05 Recognize Proteins on the Membrane
Since aptamers are known to interact with different molecules such as sugars, peptides, and
small organic molecules, it was necessary to confirm that selected probes interact selectively
with membrane proteins. In order to determine this, we adapted a previously described
procedure, based on the ability of certain proteases to selectively cleave amide bonds on
membrane proteins. 144 By employing the protease of choice, one can selectively “shave” off the
extracellular domain of the proteins (Figure 3-2). Since the ”shaved”cells no longer contain most
of the extracellular portion of a membrane proteins, the resulting decrease in the binding of
aptamer TD05 gives an idea of the identity of the binding site.
Figure 3-2. Partial digestion of exracellular membrane proteins using trypsin and proteinase K (indicated by scissors). 144 Trypsin cleaves carboxy terminal Lys and Arg residues of the proteins, and is thus more selective than protenase K, which cleaves peptide bonds adjacent to carboxylic groups of aromatic and aliphatic amino acids.144
Therefore, using this method, we carried out experiments by partially digesting cell surface
proteins with proteinase K to confirm that aptamer TD05 binds with cell surface proteins.
Protienase K acts on the cell membrane and cleaves peptide bonds adjacent to carboxylic groups
of aromatic and aliphatic amino acids. After treatment with proteinase K, flow cytometric
61
analysis of binding of FITC labeled aptamer TD05 showed no binding with Ramos cells,
suggesting that its target protein has been cleaved from the membrane (Figure 3-3).
Figure 3-3. Binding of aptamer TD05 with Ramos cells after treatment with proteinase K at different time intervals.84 The fluorescence signal resulting from binding of FITC labeled aptamer TD05 with Ramos cells shifts to a lower value with increase in time of protease digestion, indicating that membrane proteins are being digested and binding of aptamer TD05 is lost. (For information on flow cytometric analysis see appendix A.)
Methods and Materials
A panel of aptamers targeting Burkitt’s lymphoma cells was selected by using cell-based
SELEX. As shown in Table 3-1, aptamer TD05 showed significant and specific binding with
Ramos cells. The aptamer sequence TD05 was modified with photo-active 5-iodo deoxyuridine
(5-dUI) nucleotides.
The original FITC labeled aptamer TD05 is 5’ FITC- 5’-ACCGGGAGGATAGTTCGGTGGCTGTTCAGGGTCTCCTCCCGGTG-3’ The modified aptamer TD05 with 5dUI disulfide link and biotin 5’-ACCGGGAGGAUAGTUCGGTGGCTGTTCAGGGUCTCCUCCCGGTG-S-S-T-PEG-(3) –Biotin Control TE02 sequence with 5-dUI disulfide link and biotin
62
5’fluorescene-ATCUAACTGCUGCGCCGCCGGGAAAATACTGTACGGTTAGA-S-S-PEG-(3)-biotin
All DNA synthesis reagents were obtained from Glen Research. Biotin controlled pore
glass beads (Biotin-CPG) were used for all the biotin labeled aptamer synthesis. All
oligonucleotide sequences were synthesized using standard phosophoamidite chemistry using an
ABI3400 DNA synthesizer. Three poly ethylene glycol (PEG) units were introduced between
the aptamer and the biotin to avoid the interference of biotin with the spatial folding of the
aptamer. Mild deprotection conditions were used to avoid reduction of the disulfide bond.
Following precipitation with ethanol, the precipitated DNA was purified using high-pressure
liquid chromatography (HPLC), on a ProStar HPLC station (Varian, CA) equipped with a
photodiode array detector, using a C-18 reversed phase column (Alltech, C18, 5uM, 250 ×
4.6mm).
The conditions of disulfide bond reduction using Tris(2-carboxyethyl)phosphine (TCEP)
were optimized by passing a 500nM biotinylated aptamer probe was passed through a mini
column packed with streptavidin sepharose labeled magnetic beads (Amersham Biosciences,
Upsala, Sweden) three times. After washing with PBS, the beads were placed into a micro-
centrifuge tube, treated with 50-100mM TCEP, and heated for 10, 20, or 30 min at 75ºC to
cleave the disulfide bond linking the aptamer and the biotin. The supernatant and the beads were
analyzed by 2.5% agarose gel electrophoresis stained with ethidium bromide.
Competition Assays with the Modified Aptamer Probes
Following cell lines were obtained from American Type Culture Collection CCRF-CEM
(CCL-119, T cell line, human Acute Lymphoblastic Leukemia), Ramos (CRL-1596, B-cell line,
human Burkitt’s lymphoma), CA46 (CRL 1648, B-Cell line, Human Burkitt’s lymphoma),
Jurkat (TIB-152, human acute T cell leukemia), Toledo (CRL-2631, B-cell line, human diffuse
63
large-cell lymphoma), K562 (CCL-243, chronic myelogenous leukemia, CML), NB-4 and HL-
60 (CCL-240, acute promyelocytic leukemia).
All of the cells were cultured in RPMI medium 1640 (American Type Culture Collection)
supplemented with 10% FBS (heat-inactivated; GIBCO) and 100 units/mL penicillin–
streptomycin (Cellgro). Cells were washed before and after incubation with wash buffer (4.5g/L
glucose and 5mM MgCl2 in Dulbecco’s PBS with calcium chloride and magnesium chloride;
Sigma). Binding buffer used for selection was prepared by adding yeast tRNA (0.1mg/mL;
Sigma) and 1mg/mL sheared salmon sperm DNA to the wash buffer to reduce non-specific
binding.
The effect of replacement of thymine (T) with 5-dUI was investigated by conducting
competition assays. Briefly, 1µM aptamer TD05 was mixed with 10µM in 500 μL of the
modified aptamer probe were incubated with 1 × 106 cells for 30 min at 4º C in the binding
buffer. After washing with the wash buffer, the cells were analyzed by observing the decrease in
the fluorescence of FITC-labeled aptamer TD05 using a FACScan cytometer (BD
Immunocytometry Systems) by counting 30,000 events. A FITC-labeled unselected ssDNA
library was used as a negative control.
Aptamer Labeling with AT32P
Samples containing oligonucleotide (3.74 nmole) and [γ-32P] ATP (8.3pmole) were
incubated overnight at room temperature with 50units of polynucleotide kinase (Promega).
Unincorporated ATP was removed using a G-25 column (Amersham Biosciences).
Protein-Nucleic Acid Photo-Crosslinking
A 0.023μCi aliquot of (Counts Per Minutes of 5× 104) of 5’-32P labeled aptamers was
added to 400 × 106 cells in the binding buffer. The cells and the aptamers were incubated at 4ºC
64
for 30 minutes to allow for complete binding. A control with the TE02 aptamer sequence was
performed in parallel. The unbound aptamers were washed until no radioactivity was detected in
the wash buffer. Cells and bound aptamer were re-suspended in the wash buffer in a cuvette
with a 10cm path length. To initiate crosslinkage, the sample was irradiated with 55pulses of
308nm light from a Lambda Physik, model LPX240 XeCl excimer laser operating at 16.065mJ
per pulse for 20 seconds. During the irradiation, the cell suspension was constantly stirred to
allow the maximum crosslinking.
Cell Lysis and Protein-Aptamer Extraction.
The cells were suspended in lysis buffer containing a protease inhibitor cocktail (Sigma),
1mg/mL salmon sperm DNA (Eppendroff), 1mg/mL tRNA (Fisher), 50mM HEPES, and 1mM
EGTA, and the suspension was homogenized using a Dounce homogenizer at 75 strokes per
minute. The crude mixture was centrifuged at 4000 rpm for 30 min at 4ºC. Water-soluble
protein extracts were separated from the crude membrane by centrifugation at 4000 rpm for 30
min. The pelleted crude membrane was solubilized in buffer containing PBS (Fisher), 0.5% NP-
40 (Sigma), 1.25% Cholesteryl-hemisuccinate (CHS; Tris-HCl salt, Sigma), and 2.5% n-
dodecyl-β-D-maltoside (DDM, Sigma) with gentle agitation at 4ºC. The solubilized membrane
proteins were separated from cell debris by centrifuging at 3000 rpm for 30 minutes at 4ºC.
Crude cell lysate was stirred with 2mg/mL of streptavidine labeled magnetic beads (Invitrogen)
at 4ºC for 2.5 hours. Captured probes were magnetically separated and washed with 3 different
solutions (15 minutes each): with PBS containing 1% NP-40; 10mM EDTA containing 1%NP-
40; and 0.05% SDS solutions by stirring for 15 minutes at 4ºC. Harsh washing steps were
employed to ensure that only crosslinked proteins remained and to minimize the non-specific
binding.
65
Release of Captured Complex and Protein Gel Electrophoresis
Complexes captured on magnetic beads were heated at 75ºC for 30 minutes with 10mM
TCEP and a sample loading buffer. The solution was loaded on to 10%-bis-Tris PAGE and
200V was applied for 55 minutes. Protein bands were visualized using Bio-Rad gel-code blue
staining reagents according to the manufacture’s instructions. The gel was subsequently exposed
to Bio-Rad personal phosphor imager screens overnight and visualized by Bio-Rad phosphor
personal phosphoimager. The single band appeared in the gel was excised, digested, and
analyzed by a QSTAR LC-MS/MS, equipped with a MASCOT® database at the Protein
Chemistry Core Facility, University of Florida. The conditions used in the MS analysis were as
follows: Capillary rpHPLC separation of protein digests was performed on a 15cm x 75um i.d.
PepMap C18 column (LC Packings, San Francisco, CA) in combination with an Ultimate
Capillary HPLC System (LC Packings, San Francisco, CA) operated at a flow rate of
200nL/min. Online tandem mass spectrometric analysis was accomplished by a hybrid
quadrupole time-of-flight instrument (QSTAR, Applied Biosystems, Foster City, CA) equipped
with a nanoelectrospray source.
Tandem mass spectrometric data were searched against the IPI human protein database
using the Mascot search algorithm. In general, probability-based MOWSE scores that exceeded
the value corresponding to p<0.05 were considered for protein identification.
Partial Digestion of Membrane Proteins Using Trypsin
A sample containing 5×106 CCRF-CEM cells was washed with 2ml PBS, and incubated at
37ºC with 1mL of 0.05% Trypsin/0.53mM EDTA in HBSS or 0.1mg/ml trypsin in PBS either
for 2 min or 10 min. Fetal Bovine Serum was then added to quench the proteinase action. After
washing with 2 ml binding buffer, the treated cells were used for aptamer binding assay using
flow cytometry.
66
Characterization of Aptamer Binding Protein on Ramos Cells
Alexa Fluor 488 labeled Anti-IgM heavy chain (2mg/mL Molecular probes, Invitrogen)
was used to further confirm the protein target. Competition experiments were carried out by first
incubating with 0.5uM TD05-FITC with 1 × 106 Ramos, Toledo, and CEM cells at 4ºC for 15
min. After wash off the excess TD05-FITC, labeled anti-IgM heavy chain (2µg/mL) was
incubated with the samples at 4ºC for 15 minutes and washed off the excess probe and decrease
of the binding of FITC-TD05 was analyzed by flow cytometry.
Trypsin digestion experiments were conducted as described above using 2µg/mL of Alexa
Fluor 488 labeled anti-IGHM antibody. Briefly, cells were partially digested with trypsin at
37ºC for 2 min and 10 min. Cells were then washed and incubated either with Alexa Fluor 488
labeled antibody or FITC labeled aptamerTD05. After washing to remove unbound sequences,
binding was analyzed using flow cytometry.
Fluorescence Imaging.
All cellular fluorescent images were collected using a confocal microscope consisting of an
Olympus IX-81 automated fluorescence microscope with a Fluoview 500 confocal scanning unit.
The dye conjugates were excited at 488 and 543nm. Images were acquired after five to ten
second delays, during which the instrument was focused to yield the highest intensity from the
fluorescence channels. The images were assigned color representations which were not
indicative of the actual emission wavelengths. Bright spots in the images are corresponding to
dead cells.
Results and Discussion
Probe Modification and the Effect of Modification on Aptamer Affinity and Specificity
Modification of aptamer TD05 with photoactive 5-dUI facilitates its covalent crosslinking
with the target protein on the cell membrane, so that only the crosslinked target protein is
67
extracted. First, in order to achieve high crosslinking efficiency, the position of the photoactive
nucleotide 5-dUI in the aptamer TD05 was optimized. Since 5-dUI and deoxythymidine have
similar covalent radius, we initially hypothesized that the modification would not affect the
aptamer binding with Ramos cells. However, when all of the deoxythymidine were replaced
with dUI, the aptamer no longer recognized Ramos cells. To avoid problems with aptamer
folding, 5-dUI was introduced only in alternating positions at the first two and final two
deoxythymidine bases (Figure 3-4). Next, biotin was linked through a disulfide bridge at the 3’
end of the aptamer. The purpose of the biotin was to complex with streptavidin-coated magnetic
beads to help efficient release of the aptamer-protein target from the beads.
Binding of modified aptamer TD05 with the target cells was analyzed through a
competition assay with unmodified FITC-labeled aptamer using flow cytometry. In the presence
of modified aptamerTD05 (no FITC label), the fluorescence corresponding to unmodified
aptamer TD05 with FITC label shifts to a lower value, indicating that modified aptamer binds
with Ramos cells and displaces the FITC labeled unmodified aptamer. (Figure 3-5).
Finally, the conditions pertaining to concentration, temperature and time were optimized to
achieve effective release of captured aptamer probe from the magnetic beads using Tris(2-
carboxyethyl)phosphine (TCEP).
Separation of Captured Complex From the Crude Cell Lysate and MS Analysis of Captured Protein
In order to trace the aptamer-protein complex during the isolation process, we labeled the
aptamer TD05 with 32P at the 5’ end. The resulting 32P labeled photoactive aptamer TD05 bound
to Ramos cells were irradiated with nanosecond pulses of a XeCl excimer laser to initiate the
crosslinking of the aptamer with the cell surface protein. Chemical crosslinking of aptamer
TD05 with its target protein was introduced to maximize the specificity of the extraction and to
68
minimize contamination caused by nuclear proteins. In addition to covalent crosslinking, the
non-specific interactions were further minimized by using a cocktail of sheared salmon-sperm
DNA and RNA in the cell lysis buffer.
Figure 3-4. Modified aptamer with photoactive 5-dUI, linked to biotin via a disulfide bond. 5-
dUI facilitated covalent crosslinking and the disulfide bridge allowed efficient release of the captured complex from the magnetic beads. The photoactive bases are shown by the squares. The structure is predicted by the m-fold program.
69
Figure 3-5. Binding of modified aptamer with 5-dUI and biotin linker with Ramos cells. In the
presence of modified aptamer TD05, the fluorescence of the FITC labeled unmodified aptamer TD05 was shifted to a lower fluorescence value, indicating that the modified aptamer TD05 competes with the unmodified aptamer TD05.
To avoid contamination caused by plasma proteins, water soluble proteins were removed by
lysing the cells in a high salt aqueous buffer (without any detergents added). Since cell-
membrane and membrane proteins contain hydrophobic regions, these proteins are not soluble in
high salt aqueous buffer. Once the soluble proteins were removed, the crude membrane was
solubilized in membrane solubilization buffer containing a number of cationic and neutral
detergents to aid in removing membrane proteins from the cell membrane.
The mixture of membrane proteins was incubated with streptavidin-coated magnetic beads
to extract aptamer sequences that bear biotin at the 3’ end, along with the covalently bound target
protein. The extraction was repeated 3 times until approximately 90% of the complex was
extracted onto the beads. Since the aptamer TD05 was labeled with 32P, we detected the
efficiency of the extraction was determined by measuring the radioactivity on the beads
compared to cell extract using a Geiger counter.
70
One of the challenges in isolating protein from cell lysates is the interference of nuclear
and other non-specific proteins with the aptamer. Insufficient washings of the complex led to
contamination with nuclear proteins resulting in a smeared band after gel electrophoresis.
Therefore, harsh washing conditions varying from PBS to 0.05% SDS were introduced to ensure
the efficient removal of non-specific nuclear proteins absorbed onto the magnetic beads.
Crosslinking of the protein target to the aptamer made it possible to use harsh washing
conditions without losing the target protein.
The aptamer TD05-protein complexes were subsequently removed from the beads by
reduction of the S-S bridge between the aptamer and biotin. Following the release of the aptamer
TD05-protein complex, the high sensitivity of 32P enabled us to recognize the protein-aptamer
complex using gel electrophoresis and a standard phosphor imager. As shown in Figure 3-6, the
band corresponding to the cross-linked aptamer TD05 with protein was retarded compared to the
free aptamer TD05, which is smaller in size. Figure 3-7, shows the image for the TE02 control
sequence, which was not retarded, indicating that aptamer TD05 is selective for the target
protein.
Figure 3-6. Phospho images for 10% tris-bis PAGE analysis of the captured complex. The shifted band in lane 2 corresponds to the cross-linked aptamer-TD05-Protein complex. Lane 1. cell lysate Lane 2. aptamer TD05-protein complex.
Despite the harsh washing conditions employed during the sample preparation process, the
results still indicated a significant amount of nuclear proteins. However, four candidates were
71
isolated based on their molecular weights and the nature of membrane proteins, and these are
marked * in the Table 3-2, which shows the candidates identified by the MASCOT library
search.
Figure 3-7. Phospho images for control TE02 Sequence: Lane 1 Cell lysate; Lane 2. With
modified TE02 extraction. TE02 is a control sequence. No shifted band is seen in either lane.
Table 3-2. Identified proteins and their IPI values based on European Protein Data Bank using MASCOT database search. These candidates could potentially be the target for aptamer TD05
Protein Candidate IPI Value
Nucleolar protein Nop56 IPI00411937 Heterogeneous nuclear ribonucleoprotein L isoform a IPI00027834 NONO protein IPI00304596 Splice Isoform 1 of Myelin expression factor 2 IPI00555833 Heterogeneous nuclear ribonucleoprotein M isoform a IPI00171903 Lamin B1 IPI00217975 Paraspeckle protein 1 alpha isoform IPI00103525,IPI00395775 Keratin, type II cytoskeletal 2 epidermal IPI00021304 L-plastin IPI00010471 Splice Isoform Short of RNA-binding protein FUS IPI00221354,IPI00260715 IGHM protein* IPI00477090 60 kDa heat shock protein, mitochondrial precursor IPI00472102 SYT interacting protein SIP IPI00013174,IPI00550920 HNRPR protein IPI00012074 Keratin 9 IPI00019359 Keratin, type I cytoskeletal 10 IPI00009865,IPI00295684 Splice Isoform 1 of Heterogeneous nuclear ribonucleoprotein K IPI00216049,IPI00216746,
IPI00514561 Keratin 1 IPI00556624 Probable RNA-dependent helicase p68 IPI00017617 Large neutral amino acids transporter small subunit 1* IPI00008986 Splice Isoform 1 of Development and differentiation-enhancing factor 2*
IPI00022058
Splice Isoform 4 of Potassium voltage-gated channel subfamily KQT member 2*
IPI00328286
72
Of the four candidates we determined the protein candidate IGHM to be the most probable match
because (1) IGHM protein was known to be expressed in B-cells; (2) its molecular weight
corresponded to the molecular weight of the protein excluding the molecular weight of the
aptamer; (3) it is a membrane protein; (4) the other three protein candidates are commonly
expressed in all types of cells. Following the MS analysis, further experiments were performed
to confirm the identification, as described in the next section.
Confirmation of the Protein IGHM as the Binding Target for Aptamer TD05
Figure 3-8. Aptamer TD05-FITC and Alexa Flour 488 -anti-IGHM binding analysis with
Ramos, CCRF-CEM and Toledo cells (A) Aptamer TD05-FITC binding with Ramos cells. Higher fluorescence intensity observed for Ramos cells indicates that FITC- TD05 recognizes Ramos cells but not CEM or Toledo cells. (B) Binding patterns of Alexa Fluor 488 labeled anti-IGHM antibody with Ramos cells, CEM and Toledo cells correlated with binding pattern on FITC-TD05 i.e. higher fluorescence signal for Ramos cells while background fluorescence signal for other cell lines. (For information on flow cytometric analyses see Appendix A)
73
With the MS results suggesting that IGHM is the target for aptamer TD05, we first
investigated the binding of Alexa Fluor 488 labeled anti-IGHM antibody with Ramos, CCRF
CEM, and Toledo cells. As shown previously in Table 3-1, the aptamer TD05 exclusively
recognizes Ramos cells but not control cell lines. Figure 3-8 shows the flow cytometric data for
Ramos, CCRF-CEM and Toledo cells after incubation with (A) FITC-TD05 and (B) Alexa Fluor
488 labeled anti-IGHM antibody. The much greater fluorescence intensities for the Ramos cells,
as well as the very similar patterns of the peaks, indicates that IGHM is very likely the target
protein.
Aptamer TD05 and anti-IGHM antibody were further assayed with another Burkitt’s
lymphoma cell line that is known to express surface IGHM (CA-46 cell line, see Figure 3-9). As
expected, aptamer TD05 and anti-IGHM antibody showed binding with the CA-46 cell line,
further indicating that IGHM could be the target protein.
Figure 3-9. Aptamer TD05-FITC and anti-IGHM antibody binding with surface IgM positive
CA46, a B-lymphocyte Burkitt’s lymphoma cell line. Shifted fluorescence intensity of both aptamer TD05-FITC and Alexa Fluor 488 labeled antibody is indicative of binding with CA-46 cells. (For information on flow cytometric analysis see Appendix A)
74
Several leukemia cell lines that are not related to B-cells were also tested to further analyze the
binding of FITC-TD05 and anti-IGHM antibody. As shown in Table 3-3, neither the aptamer nor
the antibody showed any binding towards cell lines other than cell lines originated from B cell
non-Hodgkin’s lymphoma.
Table 3-3. Binding patterns of aptamer TD05 and anti-IGHM with different cell lines. Aptamer TD05 does not show binding with tested cell lines except for Ramos and CA-46. Similarly, anti-IGHM anti body does not bind to other tested cell lines
Type of Leukemia Cell line Aptamer TD05 IGHM antibody B-cell non-Hodgkin’s
lymphoma
Ramos Toledo CA-46
++++ -0- +++
++++ -0- +++
T-Cell lymphoblast leukemia
Promyelocytic leukemia
CEM-CCRF Jurkat HL-60 NB-4 K562
-0- -0- -0- -0- -0-
-0- -0- -0- -0- -0-
Explanation of the symbols used to evaluate cell binding is given in the Appendix A.
If both aptamer TD05 and anti-IGHM antibody bind to similar epitopes or epitopes close
to each other on the IGHM protein, we should observe a competition between the two in binding
should be observed. We investigated the effect of aptamer TD05 binding with Ramos cells upon
addition of anti-IGHM antibody. Interestingly, aptamer TD05 did not affect the anti-IGHM
binding with Ramos cells. However, anti-IGHM antibody reduced the interaction between
aptamer TD05 with Ramos cells, as shown in Figure 3-10. These results suggest that aptamer
TD05 and anti-IGHM both bind to the same site, but the affinity for anti-IGHM binding is much
greater than that for aptamer TD05.
In addition, the co-localization of the Alexa Fluor 488 labeled anti-IGHM antibody and
tetramethylrhodamine-labeled TD05 aptamer was monitored using confocal microscopy. As
shown in Figure 3-11, both probes heavily stain the cell periphery of the corresponding target
Ramos cells.
75
Figure 3-10. Competition of aptamer TD05-FITC and anti-IGHM antibody for the target
protein. After addition of the antibody, the fluorescence corresponding to FITC labeled TD05 decreases, compared to FITC- TD05 binding in the absence of anti-IGHM antibody. (For more information on flow cytometric analysis see Appendix A).
Figure 3-11. Binding of Alexa fluor 488 labeled anti-IGHM antibody and TMR labeled TD05
aptamer with Ramos cells. Both aptamer and antibody stains the cell membrane periphery. (A) Ramos cells and Anti-IGHM, (B) Ramos Cells and TMR labeled aptamer TD05, (C) optical Image of the cells
76
A
B C
Figure 3-12. Flow cytometric results for the anti-IGHM binding with Ramos cells after Trypsin
digestion. (A ) Control experiments with FITC labeled TD05, and Alexa Fluor 488 labeled anti-IGHM antibody. Higher fluorescence intensity observed for both aptamer and antibody indicates that both probes bind with Ramos cells before the trypsin digestion. Analysis of Binding of (B) TD05-FITC (C) Alexa Fluor 488 labeled anti-IGHM with Trypsin digested cells. Both show that there is no effect on binding (either with the aptamer or the antibody) after trypsin treatment
77
The study of the effect of the treatment of the cells with trypsin also provides support for
the assignment of IGHM as the target protein. Figure 3-12 shows flow cytometric results prior to
and after trypsin digestion. Interestingly, we observed neither aptamer TD05 binding nor anti-
IGHM binding was lost by partial digestion with trypsin. These results contrasts with the results
from experiments using proteinase K (see Figure 3-3). In that study, binding of aptamer TD05 to
Ramos cells was lost after proteinase K digestion. This may be explained by the lower
specificity of proteinase K compared to trypsin. Evidently, the binding site for aptamer TD05
and anti-IGHM is cleaved by proteinase K but not by trypsin.
Discussion
Here, we have presented a simple strategy for identifying differentially expressed proteins
by employing aptamer probes selected against target tumor cells. This method integrates the
selection of molecular probes targeting specific cells and the use of cell specific aptamers for
effective identification of target proteins. Our group’s previous work with aptamer selection and
screening against cancer cells has established that aptamer binding signatures pertaining to each
cell type can indicate expression patterns of protein candidates and that each aptamer candidate
has its own identity when recognizing target proteins in complex biological specimens.84, 85, 90
Furthermore, we have shown that it is feasible to recognize up-regulated proteins that may have a
role in transforming unhealthy cells into diseased cells.161
We also have exploited the remarkable versatility for chemical modification of DNA
aptamers by incorporating different functionalities to improve their performance as molecular
probes. These modifications improved two important features: probe stability and collection
efficiency. Enhanced stability of the aptamer-protein complex through incorporation of 5-dUI
allowed the complex to sustain harsh washing conditions in extraction, which was important in
purification and enrichment of the targeted proteins from a cell lysate sample. Enhanced
78
efficiency of the biotin aptamer removal from the streptavidin support occurred through
introduction of a readily cleavable disulfide bond.
The typical approach for solubilizing membrane proteins from the cell membrane is to use
carefully optimized ratios of the detergents that mimic the membrane in an artificial
environment. However, poor optimization of detergent compositions can result in misfolding of
the receptor and/or irreversible denaturation of the receptor molecule, because the native
conformation of the receptor molecule depends on the hydrophobic lipid bilayer of the cell
membrane. Poor optimization of the detergents may also lead to possible disruption of the
aptamer-protein when the target protein mis-folds or denatures. This protein alteration, caused
by changes in the lipid composition of buffers, is one of the major concerns in identification of
membrane proteins using protein specific aptamers and can possibly be one of the limitations
when using these probes in identifying molecular markers. We have addressed this issue by
modifying the aptamer with photoactive 5-dUI to facilitate covalent crosslinking of the probe
with the target protein, which increases the stability of the complex.
Conjugations using biotin-strepavidin have been exploited for many applications in
immunology, affinity chromatography and other separation applications.162-164 However, one of
the major disadvantages of such interactions is that such affinity requires harsh conditions to
elute the biotin bearing-ligand from of the streptavidin-coated solid support, resulting in either
damage to the protein-ligand complex or the need for larger sample volumes to allow pre-
concentration prior to SDS-PAGE analysis.146 In this study, the aptamer was modified with a
disulfide functional group prior to the biotin at the 3’ end. Typically, disulfide linkage can be
easily hydrolyzed by treatment with commonly used reducing agents prior to gel electrophoresis.
This modification allows the biotin bearing aptamer along with its protein to dissociate from the
79
beads more efficiently with sample volumes compatible for gel electrophoresis. Also, this
approach can dramatically reduce potential sample loss during the sample preparation process.
The discovery of IGHM on the Ramos cells supports the initial expectations of this study,
because binding of aptamer TD05 with Ramos cells correlated with reported IGHM expression
patterns of these cells compared to other cell lines and in real bone marrow samples. IGHM
protein is one of the major components of the B-cell receptor complex expressed in mature
Burkitt’s lymphoma cells, 165 and it is known that IGHM expression on premature B-lymphocytes
is closely related to Burkitt’s lymphoma development166 and is a marker for this form of cancer.
Also, several literature references emphasize the active role of IGHM in Burkitt’s lymphoma cell
proliferation and survival.166-168 Accordingly, these findings demonstrate the adaptability of this
approach in identifying cell membrane receptors that have altered expression levels in tumor
cells.
In conclusion, we have shown that cancer-cell-specific aptamers provide an effective tool
in identifying target proteins that show increased expression levels in a chosen pool of diseased
cells. The ease in chemical modification of the DNA aptamer probe has lent needed binding
stability and strength for the effective capture, enrichment, and identification of corresponding
target receptors on the cell membrane surface. In addition, findings of this approach show that
the generation of aptamers using Cell-SELEX followed by identification of the binding entity for
each aptamer can be useful in discovering disease-specific marker proteins in a given cell type.
In contrast to conventional methods, such as phage display antibody production targeting a
previously known specific protein, the novelty of cell-SELEX based protein discovery is rooted
in its focus on finding cell surface membrane markers with no prior knowledge of the molecular
contents of the cell surface. Also, owing to the easy chemical manipulation and reproducible
80
generation of DNA aptamers by automated synthesis, this method is more universal and
technically feasible. Finally, apart from the ability to identify disease markers that may play key
roles in cancer progression, this method can also be useful in early diagnosis, targeted therapy, as
well as a molecular tool for the recognition and mechanistic studies of diseased cells.
81
CHAPTER 4 APTAMERS EVOLVED FROM WHOLE CELL SELECTION AS SELECTIVE ANTI-
TUMOR PHOTODYNAMIC AGENTS
In the previous chapter, we described a systematic approach to identify a protein marker
specific for Burkitt’s lymphoma (BL) cells.161 In doing so, aptamer TD05 selected using cell-
SELEX method was used to capture membrane bound IGHM protein from BL cells. Membrane
bound IgM is known to express uniquely in BL cells and is known as a marker protein for BL.
Since aptamer TD05 exclusively binds to this BL marker, we hypothesized that aptamer TD05
can be used for drug delivery. Therefore, the focus of this chapter is to demonstrate that aptamer
TD05 can be used as a drug delivery agent to selectively kill BL cells. In order to demonstrate
the targeting ability of aptamer TD05, a photosensitizer (PS) was used as the drug candidate.
Pages 31 to 34 in the introduction described photodynamic therapy, in which a localized PS
creates a toxic environment when it is irradiated.
Introduction to Photosensitizers
The mechanism of PSs and their biological applications in treating cancer cells are
described in Chapter 1. In this section, the chemical structures of PSs and their structural
properties are described.
The majority of photosensitizers commonly known as phorphyrins, contain a tetrapyrrole
aromatic nucleus similar to that in many naturally occurring ring structures, such as heme,
chlorophyll, and bacteriochlorophyll. The PS used in this study belongs to a category of PSs
called “second generation photosensitizers”, which were developed to increase the hydrophilic
nature by introducing polar substituents on the ring structures. 169 Figure 4-1 shows two
examples of the first and second generation PSs.
One of the most commonly used photosensitizers is Chlorin e6, with a main absorption
band at 643nm attributed to the extended pi system.
82
Figure 4-1. Chemical structures of photosensitizers. First generation photosensitizers(left) and
Chlorin e6 (right), a second generation photosensitizer. Chlorin e6 contains additional carboxyl groups to increase the water solubility.
The visible to IR-wavelength absorption makes Ce6 molecules desirable candidates for
photodynamic therapy, because use of wavelengths shorter than 600nm would result in
substantial light losses due to absorption by chromophores present in the tissues. 170
The biggest challenge in using PS in photo-therapeutic treatment of cancer is the
nonspecific targeting of healthy cells that leads to severe side effects.170 To address this issue, a
number of strategies were introduced, as described on pages 31-33. While these approaches are
effective in therapeutic targeting of tumor cells, there still is a need for improvement in
selectivity. For example, even if immunoconjugates are successful in targeting the cancer cells,
they have been shown to induce immune responses and to cross react with shared antigens in the
normal tissue. In addition, conjugation of drugs is tedious especially with proteins.171
Owing to their many significant advantages, including small size, easy chemical synthesis
with high reproducibility, easy chemical manipulation, low immunogenity and high blood
clearance rates, aptamers can be readily applicable in cancer therapy.172 Therefore, we have
combined the high selectivity of the aptamer TD05 with easy chemical manipulation of DNA to
83
develop a highly selective aptamer-photosensitizer (PS) conjugate to destroy aptamer specific
cancer cells.
Methods and Materials
Synthesis of the Conjugate
Amine modified aptamer TD05 and non-specific control DNA were synthesized in house
using an ABI3400 DNA/RNA synthesizer (Applied Biosystems, Foster City, CA and the probes
were purified using reversed phase HPLC (Varian, Walnut Creek, CA) with a C18 column
(Econosil, 5u, 250 × 4.6 mm) from Alltech (Deerfield, IL). A Cary Bio-300 UV spectrometer
(Varian, Walnut Creek, CA) was used to measure absorbances to quantify the manufactured
sequences. All oligonucleotides were synthesized by solid-state phosphoramidite chemistry at a
1 μmol scale. The completed sequences were then deprotected in concentrated ammonium
hydroxide at 40 ºC overnight and further purified twice with reversed phase high-pressure liquid
chromatography (HPLC) on a C-18 column.
TD05-NH2 5’-NH2-ACCGGGAGGATAGTTCGGTGGCTGTTCAGGGTCTCCTCCCGGTG-3’ Control Sequence: 5’NH2- CACCTGGGGGAGTATTGCGGAGGAAGGTAGTCTGATTGGC
Photodynamic ligand Chlorin e6 (Ce6) (Frontier Scientific, Logan, UT) was conjugated to
amine modified DNA using N-hydroxysuccinimide ester (NHS) of Ce6 and dicyclohexyl
carbodiimide (DCC) as a coupling agent. Equimolar amounts of NHS and Ce6 and DCC were
dissolved in anhydrous DMF in the dark for 30 min. The activated Ce6 was then added to excess
amine-modified TD05 in NaHCO3 at pH=7 by vigorously stirring overnight in the dark. The un-
conjugated Ce6 in the supernatant was removed by ethanol precipitation of DNA 5 times. The
resulting crude mixture was separated by reversed phase HPLC. The conjugated DNA and Ce6
were quantified by measuring the absorbance at 260nm, where DNA absorbs, and at the two
84
absorption maxima for Ce6, 404 nm and 643nm, using a Varian UV/Vis spectrometer. The
calculated εDNA/εCe6 was approximately 1.
Cell Lines and Binding Buffer
The following cell lines were obtained from American Type Culture Collection CCRF-
CEM (CCL-119, T cell line, human ALL), Ramos (CRL-1596, B-cell line, human Burkitt’s
lymphoma), K562 (CCL-243, chronic myelogenous leukemia, CML), HL-60 (CCL-240, acute
promyelocytic leukemia), and Jurkat (TIB-152, human acute T cell leukemia). NB-4 (acute
promyelocytic leukemia) was a gift from the Department of Pathology, University of Florida.
All of the cells were cultured in RPMI medium 1640 (American Type Culture Collection)
supplemented with 10% Fetal Bovine Serum (FBS, heat-inactivated; GIBCO) and 100 units/mL
penicillin–streptomycin (Cellgro). Cells were washed before and after incubation with wash
buffer (4.5g/L glucose and 5mM MgCl2 in Dulbecco’s PBS with calcium chloride and
magnesium chloride; Sigma). Binding buffer used for selection was prepared by adding yeast
tRNA (0.1mg/mL; Sigma) and 1mg/mL sheared salmon sperm DNA into wash buffer to reduce
non-specific binding.
Characterization of the Conjugates
After observing the UV/Vis absorbance, the conjugates were further assayed for binding to
target Ramos cells using competition assays. All cell lines were washed with binding buffer
prior to competition assays, and were then incubated with 250nM of FITC-labeled TD05 at 4ºC
for 20 minutes. After incubation, the cells were washed to remove the unbound probe. Binding of
FITC-TD05 was analyzed by flow cytometry to obtain the maximum binding. For competition
assay, cells were incubated with equimolor mixtures of FITC-TD05 and Ce6-TD05 for 20
minutes at 4ºC. After equilibration, cells were washed to remove the unbound probe and
analyzed for the binding with flow cytometry counting 10000 events.
85
Detection of singlet oxygen generation was done by using a commercially available singlet
oxygen sensor green reagent (Invtirogen). Fluorescent measurements were made using
excitation/emission 488/525 nm. A solution of 1μM of sensor green reagent was irradiated for 20
sec, and a 10 μM of either free Ce6 or TD05-Ce6 was added and increase in the fluorescence
intensity was monitored as a function of time.
Fluorescence Imaging.
All cellular fluorescent images were collected using a confocal microscope setup
consisting of an Olympus IX-81 automated fluorescence microscope with a Fluoview 500
confocal scanning unit. The Ce6 dye conjugates were excited at 633nm and the emission was
collected at 660nm. Images were taken after a five to ten second period during which the
instrument was focused to yield the highest intensity from the fluorescence channel. Bright spots
observed in the images of the control and the target cells are corresponding to the dead cells.
Images were taken using the same gain however; image processing software was adjusted to
obtain the maximum fluorescent intensity for the control cells.
Flow Cytometry
Fluorescence measurements were also made using a FACScan cytometer (Becton
Dickinson Immunocytometry Systems, San Jose, CA) counting 10000 events. Cell experiments
were performed using a final volume of 300 μL.
In Vitro Photolysis
Ramos cells (50,000) and equal number of control cell lines were washed with the cold
binding buffer in 500μL and subsequently incubated with 250nM of TD05-Ce6 probe at 4ºC for
20 min, cells were then washed with 1 mL of wash buffer by centrifuging at 950rpm, exposed to
white fluorescent light (fluence rate = 2.8Jmin-1 ) for 4 hours, and then re-cultured in RPMI-
86
1640 for 36 hours. The cell viability was determined by propidium iodide incorporation
(Invitrogen). Experiments were repeated three times, each time in triplicate.
Results and Discussion
Results presented in previous chapters show that the aptamer TD05 binds selectively to
Ramos cells. Subsequently, we found that aptamer TD05 binds with membrane bound IGHM, a
known marker for Burkitt’s lymphoma cells. As shown in Figure 4-2, FITC-labeled TD05
aptamer selectively binds to Ramos cells, but not with other leukemia cells.
Figure 4-2. Aptamer TD05-FITC binding to different leukemia cells. Higher fluorescence
intensity observed for Ramos cells is an indication that aptamer FITC-TD05 selectively binds to Ramos cells.
Therefore, we hypothesized that aptamer TD05 could be used for selective destruction of
Ramos cells by conjugating to a photosensitizer followed by illumination of light. Use of
aptamers in selective targeting of one specific tumor will effectively localize the PS on the cell
membrane prior to illumination of light, thus increasing the therapeutic efficacy and selectivity
of the PS.
87
Conjugation of DNA with the photosensitizer Ce6 solves several problems associated with PSs.
• Conjugation of negatively charged DNA with Ce6 increases the aqueous solubility of Ce6, and makes it more useful for in vivo applications.
• The DNA aptamer has the targeting ability to localize the photosensitizer on the tumor membrane.
• Since PS absorbs near in the IR, these probes can also be used as imaging agents.
Conjugation of Ce6 with Amine Modified Aptamer TD05
First, amine-modified TD05 aptamer was chemically conjugated to Ce6 by reaction with the
N-hydroxysuccinamide ester (NHS) of Ce6, using dicyclohexyl carbodiimide (DCC) as a
coupling agent as shown is Figure 4-3.
Figure 4-3. Reaction of conjugation of chlorin e6 with an amine modified TD05 aptamer probe.
88
Characterization of Aptamer TD05-Ce6 Conjugates
Since Ce6 molecules show characteristic absorption bands at 404nm and 643nm,
Ce6/DNA conjugates should show an absorbance maximum corresponding to Ce6 as well as
DNA. Therefore, to confirm the conjugation of TD05 with Ce6, the purified aptamer TD05-Ce6
conjugate was characterized by observing the absorbance at 260 nm for DNA, and at 404nm, and
643nm for Ce6. As shown in Figure 4-4, the conjugates indeed show absorbance at the expected
wavelengths, suggesting that the Ce6 has been conjugated with amine modified DNA. After
verifying the conjugation of Ce6 with DNA, we next investigated whether Ce6 can still act as an
efficient reactive singlet oxygen generator. This was necessary because interactions between the
electronic states of the dye chromophores and nucleic acids bases can lead to fluorescence
quenching.
Figure 4-4. UV-Vis absorption of Ce6 conjugated with DNA. The observed absorbance at
260nm is characteristic for DNA and absorbance at 404 nm and 643 nm are characteristic of Ce6 molecules.
Since Ce6 is a near-IR dye, it could possibly be Ce6 could be quenched by DNA bases
making the Ce6 less efficient as a photosensitizer. Therefore, the effectiveness of Ce6 was
89
evaluated using a commercially available singlet oxygen detection kit, which contains a reduced
version of FITC dye. The dye shows no fluorescence until it is oxidized by singlet oxygen.
Therefore, in the presence of reduced sensor dye, the increase in the fluorescence signal with
irradiation of Ce6 dye is proportional to the amount of singlet oxygen generated in solution.
Figure 4-5 compares the results for free Ce6 with TD05-Ce6 conjugates. Conjugation with
aptamer TD05 did not result in significant decrease in the sensor fluorescence, indicating that the
photosensitizing properties of Ce6 were not lost. The observed slight decrease in the
fluorescence signal with dye could be explained in terms photo bleaching effect with prolong
irradiation. Next, it was necessary to evaluate whether conjugation has affected the specific
binding of TD05 aptamer to Ramos cells. Since Ce6 is extremely hydrophobic, it can non-
specifically accumulate on the membrane, thus decreasing the specificity.
Figure 4-5. Singlet oxygen generation ability of free Ce6 dye and Ce6 conjugated to aptamer
TD05.The singlet oxygen generation was measured using fluorescence enhancement of sensor green, which is a reduced form of the FITC dye.
Figure 4-6 shows the flow cytometric results for an in vitro binding study using FITC
labeled TD05 by itself and an equimolar mixture of FITC-TD05 and Ce6-TD05. When Ce6-
TD05 is present the fluorescence due to FITC-TD05 decreases to about 50% of its original value,
showing that TD05-Ce6 recognizes Ramos cells with selectivities similar to that of FITC-TD05.
90
Binding of TD05-Ce6 to Ramos cells was also visualized using confocal microscopy. As
shown in Figure 4-7 fluorescence from Ce6 was significantly higher in the presence of Ramos
cells as compared to control CEM-CCRF cells, indicating that the TD05-Ce6 conjugates retain
the selectivity for Ramos cells.
Investigation of Toxicity of Aptamer TD05-Ce6 Conjugates
We next evaluated whether TD05-Ce6 can selectively kill Ramos cells upon illumination
of light. Ramos cells were used as the target cells, with CEM, K562, HL-60, and NB-4, which
do not express IGHM, as the control cells. All the experiments were conducted in the dark to
minimize the photo-bleaching of the PSs. Cells were incubated with 250nM of TD05-Ce6
conjugate in the dark at 4ºC for 30 min. Since the KD for TD05 is 75nM,84 slightly more than
75nM TD05-Ce6 was used to ensure the cells with IGHM were properly stained. A washing
step prior to illumination ensured the removal of unbound probe to decrease the non-specific
killing and to mimic higher clearance of unbound molecules from the body in the background
tissues.
Figure 4-6. Binding of aptamer TD05-Ce6 conjugate. Competitive binding of aptamer TD05
with Ramos cells before and after Ce 6 conjugation.
91
Figure 4-7. Fluorescence confocal images. (A) TD05-Ce6 bound to the cell membranes of target Ramos cells. (B) Control CEM cells which do not show binding. Higher fluorescence signal observed on the membrane periphery is an indication of aptamer TD05-Ce6 conjugates binding to Ramos cells. On the other hand, CEM cells showed only a background fluorescence intensity suggesting that TD05-Ce6 conjugates do not bind.
Since Ce6 molecules absorb long-wavelength of radiation, a commercially available
fluorescence bulb was used (fluence rate = 2.8 mJ/min, and for 4 hours). Because the toxicity
induced by PSs leads to slow killing of the cells, the exposed cells were re-cultured in the fresh
media.
Cell viability was determined 36 hours after illumination by propidium iodide
incorporation using flow cytometry counting 10,000 events. Propidium iodide (PI) is a DNA-
intercalating dye, which cannot pass through the healthy cell membrane. When the cell
membrane is damaged by reactive oxygen species, the dye is able to diffuse into the nucleus and
intercalate into the genomic DNA, resulting in increased fluorescence. Therefore, by monitoring
the fluorescence of the PI treated cells, the toxicity can be assayed.
The results of the toxicity study are shown in Figure 4-8. The heights of the bars gave the
percent cell viability with 100% corresponding to cells without any added aptamer or free Ce6.
A
B
92
Thus, the efficacy of the treatment is indicated by a decrease in bar height. Clearly, the TD05-
Ce6 conjugates markedly decreased cell viability (71.3% ± 6.9% decrease) as shown in Figure 4-
8. The toxicities observed in control CEM (35.8% ± 7.4), K562 (30% ± 3. 37), NB4 (36.4 ±
7.09), and HL60 (<1%) cells are over 50% less than toxicity for the targeted cell lines. This
suggests that the specific interaction of TD05-Ce6 on the cell membrane can induce selective cell
death. The slight toxicity of aptamer photosenstizer conjugate toward the CCRF-CEM, K-562,
and NB-4 could be due to non-specific interactions with the cell membrane. While unconjugated
Ce6 is insoluble in aqueous media, the conjugation of the DNA aptamer with Ce6 dramatically
increases its aqueous solubility, resulting in an increased interaction of the hydrophobic portion
of Ce6 with the cell membrane.
Figure 4-8. Cell toxicity of aptamer TD05-Ce6 treated cells. Ramos cells after 30 min
incubation at 4ºC. After removing the unbound probes, each sample was irradiated with light for 4 hours, and subsequently grown in fresh media for 36 hours. After 36 hours, cells were analyzed by monitoring the fluorescence enhancement resulted from PI incorporation into the genomic DNA of the dead cells.
Referring to Figure 4-8, the free aptamer without Ce6 and the free Ce6 samples did not
show significant toxicities. The toxicity clearly demonstrates the feasibility of aptamer-PS
93
conjugates in effectively destroying cells that interact selectively with TD05-Ce6. Removal of
the unbound TD05-Ce6 after incubation prevents the aptamer conjugates or free drug conjugates
from entering into the cells, and it removes any nonspecific binding. Taken together it is
suggestive that the interaction of TD05-Ce6 on the cell membrane is specific and can induce
selective cell death.
We next investigated the possibility of toxic effects could be due to the interaction of
aptamer TD05-Ce6 conjugates with its target protein , but not due to toxicity generated by
irradiation of the PS. Figure 4-9 shows percentage cells viability without irradiation. As
anticipated, the un-irradiated samples did not show any significant decrease in viability,
indicating aptamer TD05-Ce6 conjugate is not toxic in the absence of light. To further
demonstrate the specificity of the method, separate control experiments using a random DNA
sequence attached to the Ce6 dye were performed. Because a random sequence does not bind to
Ramos cells, the irradiated random DNA sequence attached to Ce6 dye should not lead to any
toxicity towards Ramos cells.
Figure 4-9. Cell viability observed for CEM and Ramos cells with no irradiation of light. Cells
were incubated with APS conjugate and free Ce6 in the dark. Following the washing step, cells were grown for 36 hours prior to toxicity analysis using PI incorporation.
94
As shown in Figure 4-10, the random DNA labeled with Ce6 did not show any toxicity
towards Ramos cells, however, 26% ± 2.15% decrease in cell viability was observed for CEM
cells. This could be due to non-specific interaction of DNA attached to Ce6 with the CEM cell
membrane.
Figure 4-10. Observed cell viability for HL-60, NB-4, K562, CEM and Ramos cells with Ce6
attached to a random DNA sequence.
Photoactive therapy has great potential in cancer treatment, but administration of
photoactive drugs for extended periods is usually not feasible. For this reason, conjugation of a
photosensitizer with a probe that can be localized at the tumor site will enhance the therapeutic
effectiveness. Here, we have exploited the specific recognition capability of DNA aptamers
evolved using live cells along with ability of chemical manipulation of DNA to effectively target
one type of cells. Covalent attachment of PS to aptamer provides stability in the cellular
environment. The small size of the aptamer –PS conjugate facilitates tissue penetration for
treatment of solid tumors. Problems with the stability of aptamers could be addressed by
incorporating unnatural nucleic acids at the pre-defined sites in the aptamer to increase resistance
to nuclease degradation.
95
CHAPTER 5 APTAMER EVOLVED FROM CELL-SELEX AS AN EFFECTIVE PLATFORM FOR DRUG
RELEASE
The previous chapter showed that aptamers can be used as carriers to deliver type II PSs to
the tumor surface.173 However, a further increase in selectivity is still necessary to prevent the
damage to the surrounding tissues caused by singlet oxygen. Patients who go through PDT
treatments are often required to avoid sunlight for several weeks to months following the
treatments due to the accumulation of the photosensitizer (PS) in the surrounding tissues.171, 174
One way to address this issue is by exploiting the photochemical and photophysical
properties of PSs themselves. For example, it has been shown that the photosensitizing ability
and the fluorescence emission of a PS can be successfully quenched by utilizing FRET
(Fluorescence Energy Resonance Transfer) with fluorescence quenchers.175 Zheng et.al. and
others demonstrated this principle by engineering a photodynamic molecular beacon, in which a
quencher carefully positioned close to a PS using a polypeptide linker to effectively quenches
ROS generation and fluorescence.175, 176 The FRET quenching mechanism depends strongly on
the proximity of the PS and the quencher. When the PS-peptide-quencher conjugate reaches the
tumor environment, tumor specific proteases cleave the peptide and release the quencher from
close proximity to the PS. The PS remains in contact with the tumor and upon irradiation at the
appropriate wavelength the PS produces fluorescence and cytotoxic singlet oxygen. Choi et al.
177 later demonstrated the feasibility of quenching of the photosensitizing ability of the PSs in
xenografted tumor models using polylysine conjugates, followed by protease cleavage to restore
toxicity. While the idea of specific peptides targeted by proteases secreted at the tumor
environment is attractive, this method suffers from lack specificity of the peptide. In addition,
peptide and small molecule conjugation chemistry is not straight forward and the structural
rigidity required for efficient quenching of PS and quenchers is limited in peptides.
96
In the following sections, we introduce an aptamer-based prodrug therapy which takes
advantage of the ability of aptamers to selectively target tumor cells. The pro-drug utilizes a
FRET-based PS quenching mechanism, and a DNA template-assisted disulfide bond reduction
has been introduced to activate the pro-drug.
DNA Directed Functional Group Transfer Reactions
Liu et al. 178 introduced DNA Template based functional Group Transfer Reactions
(DTGTR) in 2000. These reactions have proven to be effective in generating precise, well
controlled reaction products.
Figure 5-1. DNA Template based Functional Group Transfer Reactions. (a). Oligonucleotide is
linked to a reactive group through a linker. (b). Hybridization of complementary oligonucleotides brings A and B closer together with their most favorable orientations and for higher rates of reaction.
Figure 5-1 shows one type of DTGTR scheme. The reactants are linked to two
complementary DNA strands. Hybridization of the two complementary DNA templates brings
the reactants close together and orients them properly for reaction, resulting in higher reaction
rates at low concentrations. These orientations also increase the probability of generating the
desired product with minimal side product formation. Therefore, we hypothesized that the
targeting ability of aptamers and the kinetic advantages of DTGTR could be combined to create
a platform that triggers drug release.
97
Utilization of DTGTR as a drug delivery method has already been demonstrated. For
example, Ma and Taylor’s “nucleic acids-triggered catalytic drug release” took advantage of
positioning two reactants in close proximity.179 This study focused mainly on targeting mRNA
expression to trigger drug release. The authors linked an imidazole to a DNA nucleotide and a p-
nitrophenol group to a complementary DNA strand via an ester bond. Hybridization of the DNA
strands brought the ester group close to the imidazole, facilitating base hydrolysis of the ester to
generate free p-nitrophenol. 180
Alternatively, DNA aptamers can be attractive agents in applying drug delivery platforms
via DTGTR. Apart from clinical advantages of DNA aptamers, one of the inherent properties of
DNA is its structural rigidity, which can be manipulated to engineer PS/quencher pairs with
increased quenching efficiency, as well as higher rates in release of the quencher by DTGTR.
By combining suppression of the photosensitizing effect by the quencher, selective bond
breakage by DTGTR and tumor recognition ability by the aptamer, we have designed a DTGTR
based-aptamer complex to trigger the release of drug candidates at the tumor surface. Since
aptamer Sgc8 evolved from cell-SELEX shows preferential binding to T cell lymphoma CEM
cells,85,90 we hypothesized that the aptamers can be used as a platform to deliver drug candidates
to the CEM cells.
As shown in Figure 5-2, the newly designed aptamer template has three characteristics:
1. Tumor recognition ability from the aptamer
2. DNA platform for prodrug hybridization
3. Activator to release the drug by DTGTR.
The “prodrug” is composed of a DNA sequence complementary to an aptamer platform having
closely positioned fluorophore and quencher. Until the prodrug reaches the tumor environment
and hybridizes with the platform, fluorescence is quenched. Hybridization of the pro-drug with
98
platform allows the activator to react with the pro-drug to release the quencher and restore
fluorescence.
Figure 5-2. Aptamer-based DTGTR as a tool for drug release. The prodrug contains a fluorophore, which is quenched due to FRET. Upon hybridization with the platform, activator (DTT molecule) cleaves the disulfide linker between the quencher and the fluorophore, and the fluorescence is restored.
Methods and Materials
DNA Synthesis and Purification
Aptamer Sgc8 modified with reaction template and non-specific control DNA was
synthesized at the 1umole scale using standard phosphoimidite chemistry and was purified using
reversed phase HPLC. An ABI3400 DNA/RNA synthesizer (Applied Biosystems, Foster City,
CA) was used for the synthesis of all DNA sequences. Table 5-1 shows all the sequences used in
this study. For internal labeling either FITC-dT or 5-NH2-dT was used. For 3’ end labeling
either dabsyl-Controlled Pore Glass (CPG) or black-hole quencher 2 CPG (BHQ2-CPG) was
99
used. Dithiol phosphoamidite (DTPA) was used at the 5’ end as the activator. A ProStar HPLC
(Varian, Walnut Creek, CA) with a C18 column (Econosil, 5u, 250 × 4.6 mm) from Alltech
(Deerfield, IL) was used to purify all fabricated DNA. A Cary Bio-300 UV spectrometer
(Varian, Walnut Creek, CA) was used to measure the absorbance to quantify the manufactured
sequences. The completed sequences were then deprotected in concentrated ammonium
hydroxide at 65º C overnight and further purified with reverse phase high-pressure liquid
chromatography (HPLC) on a C-18 column.
Fluorescence Measurements
Fluorescence measurements were performed on a Fluorolog-Tau-3 spectrofluorometer
(Jobin Yvon, Inc., Edison, NJ) (37 ± 0.1) ºC using a 100- L cuvette. After adding the cDNA-
DTT probe, the resulting fluorescence intensity of the PBFSSD was monitored by exciting the
sample (FAM label) at 488 nm and measuring the emission at 505 nm. Bandwidth for both the
excitation and the emission were set at 10 nm. Corrections were also made for potential dilution
factors in the titration experiments.
Cell line and Reaction Conditions
CRF-CEM (CCL-119, T cell line, human ALL) cells were obtained from American Type
Culture Collection. The optimum reaction buffer was 0.1M Na3PO4 at pH=8.01. All reactions
were performed at 37ºC for 2 hours. Briefly, probe and the prodrug in appropriate ratios was
incubated with 50,000 cells for 2 hours. Upon completion of the reactions, the mixture was
immediately cooled to 4ºC and 350μL of cell binding buffer (4.5 g/L glucose and 5 mM MgCl2
in Dulbecco’s PBS with calcium chloride and magnesium chloride; Sigma), yeast tRNA 0.1
mg/ml; (Sigma) and 1mg/mL sheared salmon sperm DNA was added prior to flow cytometric
analysis. The data were analyzed by obtaining the mean fluorescence signal of the histogram for
each sample.
100
Table 5-1. Sequence of DTS reactions. DTT refers to DTPA , D refers to DabsyldT, F refers to FITCdT, 6 refers disulfide phosphoamidite, C3 refers to carbon-3 spacer phosphoamidite, N refers to Dabsyl-CPG.
Name Sequence PBC3DTT PBFSSD Sgc8Tem-C3DTT
DTT-C3-GA TGG TGC GGA GCC GGC TCC GCA CCA F C6 TN DTT-C3-GAT GGT GCG GAG CCA TCT AAC TGC TGC GCC GCC GGG AAA ATA CTG TAC GGT TAG A
Sgc8RTem-C3DTT DTT-C3-NNN NNN NNN NNN NNA TCT AAC TGC TGC GCC GCC GGG AAA ATA CTG TAC GGT TAG A
Sgc8Random NNN NNN NNN NNN NNA TCT AAC TGC TGC GCC GCC GGG AAA ATA CTG TAC GGT TAG A
Sgc8Tem GAT GGT GCG GAG CCA TCT AAC TGC TGC GCC GCC GGG AAA ATA CTG TAC GGT TAG A
Results and Discussion
Probe Design and Mechanism of Activation
Aptamer Sgc8 was chosen for this study because of its high affinity for CEM-CCRF
cells.85 A platform sequence consisting of 14 DNA bases was linked to dithiol phosphoamidite
at the 5’end. Reduction of dithiol phosphoamidite generates dithiothreitol (Cleavlan’s reagents,
DTT) to act as the DTGTR activator. For the DNA based prodrug a quencher and either a
fluorophore or a photosensitizer were linked via a S-S linkage to the DNA that is complementary
to the platform sequence. The basic hypothesis is that, upon hybridization of the prodrug with
the cDNA platform, the DTT group aligns with the disulfide group and cleaves the disulfide
linker to the quencher, thus restoring fluorescence. The mechanism of DTT mediated disulfide
cleavage is outlined in Figure 5-3. The FRET probe was aided in proving the concept of
DTGTR. A 14 mer sequence was aligned incorporating a FRET pair to monitor the reduction of
the disulfide linker between a Dabsyl quencher and an FITC fluorophore as shown in Figure 5-3.
Initially, the fluorescence restoration was investigated using large excess of free DTT, and
fluorescence signal was monitored.
101
Figure 5-3. Mechanism of fluorescence restoration of the hypothetical pro-drug upon reduction of disulfide linker. The prodrug contains a 14 mer DNA sequence modified with a FITC fluorophore and linked to a Dabsyl quencher through a disulfide bridge. The activator platform contains a 14 mer complementary sequence attached to a DTT molecule. Upon hybridization of prodrug with the platform, the DTT group comes into the close proximity of the disulfide linker. DTT molecule cleaves the disulfide linker, releasing the quencher and restoring fluorescence.
102
As shown is Figure 5-4, upon addition of free DTT, the fluorescence signal increased
within 1 hour reaction time, confirming the positioning of the FITC and Dabsyl. Following the
confirmation of the synthetic product of PBFSSD, we investigated whether DTT bonded to the
platform can also rapidly reduce the disulfide bond. The fluorescence signal enhancement was
monitored by adding equal amounts of PB-C3DTT and free DTT respectively, to two prodrug
samples. As shown in Figure 5-5, when PB-C3DTT was used, the increased local concentration
of DTT due to DNA hybridization enhanced the rates of fluorescence restoration compared to
free DTT.
Figure 5-4. Verification of de-quenching effect upon reduction of disulfide link. Increase in fluorescence signal with free DTT indicates that fluorescence can be restored by cleaving disulfide link to remove the quencher.
Investigation of Quencher Release Using Aptamer Sgc8tem-C3-DTT on the CEM Cells
Following the preliminary work with a short DNA sequence, the feasibility of applying the
same prodrug on a cell membrane was investigated. In doing so, Sgc8 aptamer targeted to CEM-
CCRF cells was modified with DTT via the platform and a 3-carbon spacer as shown in Figure
5-6. Introduction of the 3-carbon spacer increased the flexibility and free rotation, thus,
minimized steric effects caused by the large fluorophore and quencher pairs.
103
Figure 5-5. Restored fluorescence upon addition of PB-C3-DTT to PBFSSD. When PB-tem-c3DTT was added at 1200s, the fluorescence signal increased, confirming the reduction of the disulfide bond due increased local concentration. When an equal total concentration of free DTT was added, the fluorescence did not increase.
Since the aptamer and target cell interaction depends on the unique three dimensional
folding of the aptamer, it is possible that the aptamer binding would be affected by introducing
additional bases at the 3’ or 5’ end. The secondary structure predicted by m-fold for Sgc8
aptamer is a hair pin, as shown in Figure 5-6-A. Theoretically, addition of 14 additional bases at
the 5’ end and subsequent hybridization to the pro-drug should further stabilize the hair-pin
structure. However, it is also arguable that the DNA aptamer can refold when the extra bases are
added.
104
Figure 5-6. Aptamer –platform and hypothetical prodrug. Aptamer consists of three key elements: (A) Tumor recognition element, (B) Reaction platform, (C) Activator molecule (DTT). (D) The hypothetical prodrug consists of cDNA to hybridize with the platform. The mechanism of cleavage of the disulfide linker is shown in Figure 5-3.
105
Therefore, in order to investigate specific binding of the aptamer when modified, a competition
assay was performed by introducing excess modified aptamer to cells bound to the unmodified
aptamer Sgc8 labeled with FITC. As shown in Figure 5-7, the fluorescence intensity of FITC-
Sgc8 decreased, indicating that FITC-Sgc8 was displaced from the cell membranes by the
modified Sgc8 and verifying that the modified-Sgc8 retains its binding ability. We next
investigated whether the restored fluorescence on the cell membrane upon disulfide reduction
can be detected using flow cytometry. A 250nM sample of PBFSSD along with aptamer
Sgc8tem was incubated with 3000 fold excess of free DTT to allow complete reduction of the
disulfide bond. Upon completion of the reaction, the reduced probe was incubated with CEM
cells and the restored fluorescence on CEM cells was analyzed using the flow cytometry. As
shown Figure 5-8, the fluorescence intensity for the cells with DTT treated probe was increased
compared to the cells with untreated probe, indicating that fluorescence restoration can be
detected on the cell membrane.
Next, we investigated whether Sgc8tem-C3-DTT probe can also reduce the disulfide bond
on the cell membrane. The CEM cells were incubated with (1) 30-fold excess of Sgc8tem-C3-
DTT and PBFSSD, (2) the positive control (3000-fold excess of free DTT), and (3) the negative
control (nothing but the PBFSSD, Sgc8temC3) to investigate the reaction. After 2 hours of
reaction at 37ºC, the restored FITC fluorescence on the cell membrane was monitored using flow
cytometry. The heights of the bars give the mean fluorescence intensity observed in the
histogram for each reaction. All reactions were done in triplicate. As shown in Figure 5-9, a 30-
fold excess of aptamer Sgc8tem-C3-DTT reduces the disulfide linker, whereas a 3000-fold
excess of free DTT is needed to achieve the same fluorescence enhancement, demonstrating the
effective cleavage by increased local concentration.
106
Figure 5-7. Binding of Sgc8tem with CEM cells. The fluorescence intensity of aptamer Sgc8-
FITC decreases in the presence of a 10-fold excess of Sgc8tem and Sgc8-Random indicating that Sgc8 binding is retained after attachment of additional bases at the 5’ end.
Figure 5-8. Flow cytometric results for DTT treated PBFSSD on CCRF-CEM cells. The cells
were treated with equal concentrations of PBFSSD and Sgc8tem with and without excess DTT at 37ºC. The increase in the fluorescence indicates that PBFSSD was cleaved by excess DTT.
107
Figure 5-9. Reduction abilities of free DTT and DTT attached to DNA aptamer template. Each
probe was incubated in the reaction buffer with CEM-CCRF cells. After 2 hours, the restored fluorescence was analyzed using flow cytometry.
Next, ratios of Sgc8Tem-C3DTT to PBFSSD (250nM) were varied 5, 10 and 30 to
determine the minimum ratio of Sgc8Tem-C3DTT needed to achieve the highest fluorescence
restoration. Addition of excess template shifts the equilibrium to the bound state allowing the
entire PBFSSD to be hybridized with Sgc8Tem-C3DTT template. According to the Figure 5-10,
free DTT fails to reduce the disulfide linker at any of these ratios, but as the concentration of
Sgc8Tem-C3DTT increases the amount of sulfide reduction increases by the same factor.
Then the specificity of disulfide cleavage was investigated using a random template
bound to DTT via a 3-carbon linker. As shown in Figure 5-11, the Sgc8-Random-tem-C3DTT,
does not increase the fluorescence intensity, indicating that the disulfide linkage is not cleaved
without DNA hybridization and that the template mediated disulfide reduction using DTT
attached to the aptamer platform is specific.
108
Figure 5-10. Disulfide bond reduction of PBFSSD using DTT bound to aptamer platform and
free DTT. Respective ratios of Sgc8c3tem/DTT incubated with 250nM PBFSSD in binding buffer and with CEM-CCRF cells for 2 hours at 37ºC. Following 2 hours incubations, restored fluorescence was detected using flow cytometry.
Figure 5-11. Specificity of disulfide bond reduction by DTT attached to Sgc8-tem-c3DTT.
Sgc8-sequence with random DNA template linked to DTT (Sgc8-R-Tem-C3DTT) failed to reduce the disulfide bond.
109
In conclusion, a new model of drug delivery utilizing DTGTR has been demonstrated.
Based on the observed results using FITC-Dabsyl pair, we have shown a proof-of-concept for
PS/quencher based pro-drugs. The ability of aptamer to specifically recognize a target cell line,
followed by the drug activation mechanism could be utilized in precise control and delivery of
PS based prodrugs in exact tumor locations.
110
CHAPTER 6 SUMMARY AND FUTURE WORK
Summary of In vitro Selection of Aptamer Targeting PKCδ
This dissertation demonstrated the versatility of aptamers for variety applications: selective
binding to a predetermined protein, recognition of a biomarker on tumor cell membranes,
localization of a photosensitizer for photodynamic therapy, and localization of a prodrug for
controlled PDT.
The initial phase of the research (Chapter two) focused on the selection of an aptamer for a
single protein using CE-SELEX. The selected aptamer was modified with a fluorophore to
detect PKCδ. The aptamer showed reasonable specificity for PKCδ compared to PKCα and
PKCϕ. While CE-SELEX showed high separation efficiencies when a larger protein (IgE,
115kDa) was used73, the separation efficiency was low for the much smaller PKCδ (90 kDa).
This is mainly because of the overlap of the broad free-DNA peaks and the small difference in
electrophoretic mobility when the aptamer binds to a single protein. Therefore, the major
drawback of CE-SELEX for small target proteins leads to the selection of aptamers with poor
affinities. To address this problem, the combination of gel electrophoresis or other conventional
SELEX procedure along with CE may be useful.
Biomarker Discovery
The work described in Chapter 3 involved the identification of a biomarker using
aptamers generated against Ramos cells. This was accomplished by taking advantage of the
ability of easy chemical modification of DNA. Discovery of the biomarker demonstrated the
capability of aptamers selected using cell-SELEX to recognize Ramos cell specific protein
(IGHM) and to systematic identification of proteins that are significantly expressed in a cancer
cell.
111
Recent advances including the results of this work in aptamer selection and the ability to
target whole cells have led to investigation of applicability of aptamers as molecular probes in
disease recognition and therapy. Based on these examples, the feasibility and the promise in
cancer therapy using aptamers are becoming much more realistic and significant. As described
in this research, an important advantage of this approach is that, aptamer selection is done with
no prior knowledge of the protein expression patterns of a given cell. Subsequent identification
of interacting proteins on these cell membranes can lead to the discovery of new biomarkers,
thus forming a solid molecular foundation for molecular medicine. However, the current
approach of aptamer selection needs to be more refined in terms of selection efficiency as well as
methods of protein identification. With the advances in the fields of molecular probe
engineering, nanotechnology, imaging instrumentation aptamers can be highly efficient
molecular probes for cancer and other significant diseases. In summary, using aptamers as
molecular probes can enable highly effective molecular imaging and profiling of diseases.
Summary of Targeted Therapy Study
Chapter 4, we demonstrated that aptamers selected for specific recognition of a marker
protein can be used as a drug carrier, in particular a photosensitizer for the destruction of Ramos
cells. This demonstrated ability of aptamers to target tumors with high selectivity makes
targeted therapy possible in a number of “pretargeting” strategies. Moreover, aptamers do not
induce immunogenic reactions, and are effective in penetrating the solid tumors. Due to the easy
chemical manipulation, aptamers can readily be modified with functional groups making them
attractive in bio-conjugations. For example, we have demonstrated the feasibility of conjugation
of an aptamer for Ramos cells with photosensitizers. Despite the many advantages of aptamer,
their broader use in animal models needs to be investigated and potential problems in in vivo
applications needs to be addressed.181
112
The investigation of aptamers-based drug carriers was extended in Chapter 5. To avoid
undesirable effects associated with photosensitizers, as a proof-of-concept we demonstrated PS
can be delivered to CCRF-CEM cells in an inactive form using the FRET principle to a nearby
quencher. After localization on the cell membrane, the PS was activated by a template-based
bond cleavage reaction to remove the quencher and restore fluorescence. This pro-drug design
clearly demonstrated that targeted therapies can be controlled for optimum drug release.
Future Work
Aptamers with Increased Nuclease Stability
This work has demonstrated some of the advantages of aptamers as therapeutic carriers,
but challenges of applying aptamers in vivo studies are their instability in the serum. Since they
consist of nucleic acids, aptamers can readily be digested by nucleases and cleared from the
body. For example, unmodified antisense oligonucleotide has a half life in serum of less than a
minute; 182 and, an unmodified aptamer against thrombin has shown significantly low half-
lives.182 For this reason, the future of aptamers as therapeutic carriers relies mainly on the
introduction chemical functionalities that can resist the nuclease degradation. Modification of
the DNA backbone, as well as introduction of non-natural bases into the DNA sequence, have
been demonstrated to be effective in this regard.183 For example, substitution of 2’-hydroxy
group of the ribose moiety of an RNA aptamer by a fluorine or amino group increased the
stability of the aptamer by several orders of magnitude184. Another strategy exploited
phosphorothioate-modified aptamers for targeting at an immune receptor on T cells in vitro and
in vivo.183 Floege, J. et al. substituted the 2’ position of the sugar ring of a PDGF aptamer with
O-methyl- or fluoro- groups and replaced the non-binding portions of the aptamer sequence with
hexaethylene glycol spacers. They observed a much longer half-life in serum and the binding
affinity of the aptamer for PDGF was not significantly altered.185 External labels have also been
113
evaluated for increased nuclease-resistance of aptamers.186 It was found that aptamers linked to a
biotin label at the 3’-end showed increased stability in vitro, while a biotin-streptavidin group at
the 3’-end protected the aptamer from nucleases even in vivo. Besides the efforts in post-SELEX
modifications for enhanced aptamer stability, some studies have turned direct use of modified
DNA or RNA bases in the SELEX process.187 Aptamers isolated in this way can have the built-
in ability to resist nuclease digestion.
The first aptamer based FDA approved drug against VEGF-A is currently on market. 181
In this aptamer the pyrimidines were modifies at the 2’NH2 position with long poly ethylene
glycol chains to prevent nuclease degradations, and to increase the blood residence-time. 181
Table 6-1 summarizes the modifications of unconventional nucleic acid bases that have shown to
demonstrate prolonged lifetimes in real biological samples.
Table 6-1. Different types of chemical modifications, for stabilization of aptamers and for enhancing pharmacokinetics, immobilization and labeling. 188
Functional Group Position Purpose 2’-F or 2’-NH2 nucleotides
2’-OMe-nucleotides
dT-Cap
Polyethyleneglycol (PEG)
Diacyl glycerol
Biotin
Primary Amines (-NH2)
Pyrimidines
Pyrimidines and purines
3’-end
5’-end
5’-end
5’-end, 3’-end, other
defined positions
5’-end and 3’-end
Protection against endonucleases Protection against minor endonucleases Protection against exonucleases Reduced plasma clearance Reduced plasma clearance For Immobilization solid supports or attachment to other SA-conjugates NHS-EDC chemistry, introduction of drug conjugates
Aptamers as Targeting Moiety in Gene Therapy
Apart from PDT, aptamers have a potential as a targeting agents in gene therapy, which
was introduced as a treatment modality for genetic diseases. However, with the developments of
in bio-technology and increased variability of viral vectors, this modality is increasingly popular
114
in cancer therapy.189 One of the most used vectors in gene therapy is Adeno Associate Virus
vectors (AAV), which is a single stranded DNA parvovirus with a genome of 4700 nucleotides.
189 In the case of cancer treatment AAV was shown to be effective in delivering suicide genes
into the cancer cells. So far, the incorporation of saporin into the virus vectors has been
demonstrated to be effective in inducing cell death in B16 melanoma cells.190 A possible
extension of the present work would involve linkage of aptamer Sgc8 to AAV for delivery into
CEM cells. Infection can be monitored using a GFP fused gene along with the suicide gene and
by monitoring the expression of the tag.
Additional Structural Studies of Aptamer Site Recognition
In Chapter 3 we demonstrated a method to identify the protein that in interacting with
aptamer TD05 by covalent crosslinking of the probe, thereby generating a “frozen” aptamer
protein complex. By introducing 13C isotope at the C5 position of the 5-dUI additional
information could be obtained. By observing the location of the isotope covalently crosslinked
with the protein epitope, the interaction site of the protein can be determined. Stable isotope
labeling with deuterium, 18O, or 13C, having known ratios with their non-labeled counter parts
allows MS detection of products from the enzymatic digestion based solely on their distinctive
patterns of the isotope peaks. The identification of the epitope of the protein interacting with the
aptamer help scientists to understand the nature of the binding of the aptamer with its protein,
and to modify the aptamer for use as a drug carrier. Figure 6-1 exemplifies the structure of the 5-
iodo deoxy uracil with 13C incorporated at the C5 position. When cross-linked with a 13C-
labeled base, each amino acid in the corresponding to the peptide fragment will have a higher
m/z based on the degree of crosslinking.
The proposed scheme for the characterization of the binding site of the epitope of the IgM
protein using 13C labeled aptamer is shown below (Figure 6-2). Aptamers containing 13C-labeled
115
5-iodouridine will be incubated with target cell line. After washing off the unbound aptamers,
aptamer-cell complex can be irradiated with a 308nm excimer laser to induce covalent
crosslinking. After crosslinking, the extra-cellular membrane will be removed using trypsin and
protienase K and subsequently analyzed by LC-MS/MS. By detecting the presence of 5-dUI*
with 13C, the epitope of the protein can be determined.
116
O
HOH
HH
HH
HO
N
NH
O
O
I*
Figure 6-1. Structure of 5-iodo deoxy uridine. (*) position refers to the 13C on the base.
117
Figure 6-2. The proposed method for determination of aptamer binding site on IGHM. The modified aptamer with isotope encoded aptamer probe is cross-linked with the protein. The extracted tryptic digested peptides will be characterized by LC/MS/MS. By observing the presence of an isotope on the peptide fragment, the amino acids of the protein that are bound to the aptamer can be characterized.
118
APPENDIX FLOW CYTROMETRIC ANALYSIS OF BINDING OF FLUOROPHORE LABELED
APTAMER WITH CELLS
Chapter 3 - 5 described the utilization of flow cytometry to evaluate the binding of
fluorophore labeled aptamer with the corresponding cell line. Modern flow cytometers are
capable of analyzing thousands of cells per second by simultaneously obtaining multiple
parameters including front and side scattering as well as signals from one or more fluorophores.
A flow cytometer is similar to a microscope, instead of producing an image of the cell; flow
cytometer offers binding events in a form of a histogram.
Instrumentation
Figure A-1. Typical flow cytometer setup. Cells are hydrodynamically injected and with the aid of the sheath flow one cell at a time pushed into the optical path. As the cells intercept the laser, scattered light is collected. If the cells are stained with a fluorescence tags, the emitted fluorescence is collected and converted into a digital data set.
119
Flow cytometers use the principle of hydrodynamic focusing of cells by a laser (or any
other light excitation source). Figure A-1 illustrates the schematic representation of a flow
cytometer. A suspension of cells is injected into a flow cytometer hydrodynamically. The
combined sheath flow is reduced in diameter, forcing each the cell into the center of the stream.
Therefore, flow cytometer detects one cell at a time. As the cells intercept the light source, they
scatter light based on the sizes and shapes. If the cells are stained with a probe tagged with a
fluorophore, the fluoresced light will indicate which cells contain the probe. The scattered or
emitted light from each cell is converted into electric pulses through the photo-multiplier tube
(PMT) detectors.
Data Interpretation
A histogram displays the cell count plotted on the Y-axis (Events) as function of relative
fluorescence intensity of cells on the X axis in log scale. Figure A-2 illustrates a typical
histogram obtained for Ramos cells with no fluorescent tag (average intensity = 7.33) with a
FITC molecule. Binding of FITC-tagged aptamer TD05 shifts the average intensity to 54.4, but
incubation with a labeled random DNA sequence does not cause a signal increase (see Figure A-
3). Using the data for fluorescence tagged aptamer binding and the non-specific DNA sequence;
a threshold value can be introduced. Based on the threshold value and the fluorescence intensity
observed for each binding, a percentage of the cells with fluorescence above the set threshold can
be estimated: 0: <10% +: 10-35%, ++: 35-60%, +++: 60-85%, ++++ : >85%. For example as
illustrated in Figure A-4, point A corresponds to no binding of the probe i.e. fluorescence
detected on the cells are in the background level hence, cells detected below the threshold A are
considered unbound, and equals to <10% of the fluorescence of the aptamer bound cells. The
binding observed for each cell lines above the point A is calculated by the equation A-1.
120
Figure A-2. Histogram obtained from the flow cytometer. Y axis indicates number of cells detected in the given experiment, and the X axis indicates the relative fluorescence intensity detected in each cell. The mean fluorescence intensity for this histogram is 7.33.
Figure A-3. Histogram obtained to find out the binding of fluorescence tagged aptamer probe. Red curve shows higher fluorescence intensity with a mean fluorescence value of 54.37. The blue curve obtained for the same cell line with a fluorescence tagged random DNA indicates that the sequence does not bind with the cell line.
121
Figure A-4. Fluorescence tagged aptamer binding with different cells. The highest value of fluorescence indicated by B correlates to maximum binding, i.e. positive control (++++). Point A and below correspond to <10%, hence this correlates to background signal. The histograms in between point A and B correlates to ++, +++, etc…
Binding percentage = Mean fluorescence of the background signalMean fluorescence of the signal -Mean fluorescence of the positive control Mean fluorescence of the background signal-
× 100 (A-1)
122
REFERENCES
1. www.ncbi.nlm.nih.gov/. Lat accessed January 2, 2008
2. http://www.cancer.org/docroot/home/index.asp. Last accessed January 2, 2008
3. Jensen, O.N. Modification-specific proteomics: characterization of post-translational modifications by mass spectrometry. Curr Opin Chem Biol 8, 33-41 (2004).
4. Mann, M. & Jensen, O.N. Proteomic analysis of post-translational modifications. Nat Biotechnol 21, 255-261 (2003).
5. Hancock, W., Apffel, A., Chakel, J., Hahnenberger, K., Choudhary, G., Traina, J.A. & Pungor, E. Integrated genomic/proteomic analysis. Anal Chem 71, 742A-748A (1999).
6. Hardcastle, J., Kurozumi, K., Chiocca, E.A. & Kaur, B. Oncolytic viruses driven by tumor-specific promoters. Curr Cancer Drug Targets 7, 181-189 (2007).
7. Hammarstrom, S. The carcinoembryonic antigen (CEA) family: structures, suggested functions and expression in normal and malignant tissues. Semin Cancer Biol 9, 67-81 (1999).
8. Tasch, J., Gong, M., Sadelain, M. & Heston, W.D. A unique folate hydrolase, prostate-specific membrane antigen (PSMA): a target for immunotherapy? Crit Rev Immunol 21, 249-261 (2001).
9. Osborne, C.K., Hamilton, B., Titus, G. & Livingston, R.B. Epidermal growth factor stimulation of human breast cancer cells in culture. Cancer Res 40, 2361-2366 (1980).
10. Olsson, A.K., Dimberg, A., Kreuger, J. & Claesson-Welsh, L. VEGF receptor signalling - in control of vascular function. Nat Rev Mol Cell Biol 7, 359-371 (2006).
11. Ariad, S., Seymour, L. & Bezwoda, W.R. Platelet-derived growth factor (PDGF) in plasma of breast cancer patients: correlation with stage and rate of progression. Breast Cancer Res Treat 20, 11-17 (1991).
12. Chan, J.M., Stampfer, M.J., Giovannucci, E., Gann, P.H., Ma, J., Wilkinson, P., Hennekens, C.H. & Pollak, M. Plasma insulin-like growth factor-I and prostate cancer risk: a prospective study. Science 279, 563-566 (1998).
13. Hursting, S.D., Lashinger, L.M., Colbert, L.H., Rogers, C.J., Wheatley, K.W., Nunez, N.P., Mahabir, S., Barrett, J.C., Forman, M.R. & Perkin, S.N. Energy balance and carcinogenesis: underlying pathways and targets for intervention. Curr Cancer Drug Targets 7, 484-491 (2007 ).
14. Nahta, R. & Esteva, F.J. HER-2-targeted therapy: lessons learned and future directions. Clin Cancer Res 9, 5078-5084 (2003).
123
15. Halatsch, M.E., Schmidt, U., Behnke-Mursch, J., Unterberg, A. & Wirtz, C.R. Epidermal growth factor receptor inhibition for the treatment of glioblastoma multiforme and other malignant brain tumours. Cancer Treat Rev 32, 74-89 (2006).
16. Isola, J.J., Holli, K., Oksa, H., Teramoto, Y. & Kallioniemi, O.P. Elevated erbB-2 oncoprotein levels in preoperative and follow-up serum samples define an aggressive disease course in patients with breast cancer. Cancer 73, 652-658 (1994).
17. Andersen, T.I., Paus, E., Nesland, J.M., McKenzie, S.J. & Borresen, A.L. Detection of c-erbB-2 related protein in sera from breast cancer patients. Relationship to ERBB2 gene amplification and c-erbB-2 protein overexpression in tumour. Acta Oncol 34, 499-504 (1995).
18. Willsher, P.C., Beaver, J., Pinder, S., Bell, J.A., Ellis, I.O., Blamey, R.W. & Robertson, J.F. Prognostic significance of serum c-erbB-2 protein in breast cancer patients. Breast Cancer Res Treat 40, 251-255 (1996).
19. Fehm, T., Maimonis, P., Weitz, S., Teramoto, Y., Katalinic, A. & Jager, W. Influence of circulating c-erbB-2 serum protein on response to adjuvant chemotherapy in node-positive breast cancer patients. Breast Cancer Res Treat 43, 87-95 (1997).
20. Mansour, O.A., Zekri, A.R., Harvey, J., Teramoto, Y. & el-Ahmady, O. Tissue and serum c-erbB-2 and tissue EGFR in breast carcinoma: three years follow-up. Anticancer Res 17, 3101-3106 (1997).
21. Disis, M.L., Pupa, S.M., Gralow, J.R., Dittadi, R., Menard, S. & Cheever, M.A. High-titer HER-2/neu protein-specific antibody can be detected in patients with early-stage breast cancer. J Clin Oncol 15, 3363-3367 (1997).
22. Krainer, M., Brodowicz, T., Zeillinger, R., Wiltschke, C., Scholten, C., Seifert, M., Kubista, E. & Zielinski, C.C. Tissue expression and serum levels of HER-2/neu in patients with breast cancer. Oncology 54, 475-481 (1997).
23. Burke, H.B., Hoang, A., Iglehart, J.D. & Marks, J.R. Predicting response to adjuvant and radiation therapy in patients with early stage breast carcinoma. Cancer 82, 874-877 (1998).
24. Fehm, T., Maimonis, P., Katalinic, A. & Jager, W.H. The prognostic significance of c-erbB-2 serum protein in metastatic breast cancer. Oncology 55, 33-38 (1998).
25. Mehta, R.R., McDermott, J.H., Hieken, T.J., Marler, K.C., Patel, M.K., Wild, L.D. & Das Gupta, T.K. Plasma c-erbB-2 levels in breast cancer patients: prognostic significance in predicting response to chemotherapy. J Clin Oncol 16, 2409-2416 (1998).
26. Colomer, R., Montero, S., Lluch, A., Ojeda, B., Barnadas, A., Casado, A., Massuti, B., Cortes-Funes, H. & Lloveras, B. Circulating HER2 extracellular domain and resistance to chemotherapy in advanced breast cancer. Clin Cancer Res 6, 2356-2362 (2000).
124
27. Bewick, M., Conlon, M., Gerard, S., Lee, H., Parissenti, A.M., Zhang, L., Gluck, S. & Lafrenie, R.M. HER-2 expression is a prognostic factor in patients with metastatic breast cancer treated with a combination of high-dose cyclophosphamide, mitoxantrone, paclitaxel and autologous blood stem cell support. Bone Marrow Transplant 27, 847-853 (2001).
28. Harris, L.N., Liotcheva, V., Broadwater, G., Ramirez, M.J., Maimonis, P., Anderson, S., Everett, T., Harpole, D., Moore, M.B., Berry, D.A., Rizzeri, D., Vredenburgh, J.J. & Bentley, R.C. Comparison of methods of measuring HER-2 in metastatic breast cancer patients treated with high-dose chemotherapy. J Clin Oncol 19, 1698-1706 (2001).
29. Ali, S.M., Leitzel, K., Chinchilli, V.M., Engle, L., Demers, L., Harvey, H.A., Carney, W., Allard, J.W. & Lipton, A. Relationship of serum HER-2/neu and serum CA 15-3 in patients with metastatic breast cancer. Clin Chem 48, 1314-1320 (2002).
30. Classen, S., Kopp, R., Possinger, K., Weidenhagen, R., Eiermann, W. & Wilmanns, W. Clinical relevance of soluble c-erbB-2 for patients with metastatic breast cancer predicting the response to second-line hormone or chemotherapy. Tumour Biol 23, 70-75 (2002).
31. Lipton, A., Ali, S.M., Leitzel, K., Demers, L., Chinchilli, V., Engle, L., Harvey, H.A., Brady, C., Nalin, C.M., Dugan, M., Carney, W. & Allard, J. Elevated serum Her-2/neu level predicts decreased response to hormone therapy in metastatic breast cancer. J Clin Oncol 20, 1467-1472 (2002).
32. Kandl, H., Seymour, L. & Bezwoda, W.R. Soluble c-erbB-2 fragment in serum correlates with disease stage and predicts for shortened survival in patients with early-stage and advanced breast cancer. Br J Cancer 70, 739-742 (1994).
33. Volas, G.H., Leitzel, K., Teramoto, Y., Grossberg, H., Demers, L. & Lipton, A. Serial serum c-erbB-2 levels in patients with breast carcinoma. Cancer 78, 267-272 (1996).
34. Carney, W.P., Neumann, R., Lipton, A., Leitzel, K., Ali, S. & Price, C.P. Potential clinical utility of serum HER-2/neu oncoprotein concentrations in patients with breast cancer. Clin Chem 49, 1579-1598 (2003).
35. Liotta, L. & Petricoin, E. Molecular profiling of human cancer. Nat Rev Genet 1, 48-56 (2000).
36. Lipshutz, R.J., Fodor, S.P., Gingeras, T.R. & Lockhart, D.J. High density synthetic oligonucleotide arrays. Nat Genet 21, 20-24 (1999).
37. Alizadeh, A.A., Eisen, M.B., Davis, R.E., Ma, C., Lossos, I.S., Rosenwald, A., Boldrick, J.C., Sabet, H., Tran, T., Yu, X., Powell, J.I., Yang, L., Marti, G.E., Moore, T., Hudson, J., Jr., Lu, L., Lewis, D.B., Tibshirani, R., Sherlock, G., Chan, W.C., Greiner, T.C., Weisenburger, D.D., Armitage, J.O., Warnke, R., Levy, R., Wilson, W., Grever, M.R., Byrd, J.C., Botstein, D., Brown, P.O. & Staudt, L.M. Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling. Nature 403, 503-511 (2000).
125
38. Humphery-Smith, I., Cordwell, S.J. & Blackstock, W.P. Proteome research: complementarity and limitations with respect to the RNA and DNA worlds. Electrophoresis 18, 1217-1242 (1997).
39. Goldsworthy, S.M., Stockton, P.S., Trempus, C.S., Foley, J.F. & Maronpot, R.R. Effects of fixation on RNA extraction and amplification from laser capture microdissected tissue. Mol Carcinog 25, 86-91 (1999).
40. Golub, T.R., Slonim, D.K., Tamayo, P., Huard, C., Gaasenbeek, M., Mesirov, J.P., Coller, H., Loh, M.L., Downing, J.R., Caligiuri, M.A., Bloomfield, C.D. & Lander, E.S. Molecular classification of cancer: class discovery and class prediction by gene expression monitoring. Science 286, 531-537 (1999).
41. Sgroi, D.C., Teng, S., Robinson, G., LeVangie, R., Hudson, J.R., Jr. & Elkahloun, A.G. In vivo gene expression profile analysis of human breast cancer progression. Cancer Res 59, 5656-5661 (1999).
42. Barber, M., Bordoli, R.S., Sedgwick, R.D., Tyler, A.N. & Bycroft, B.W. Fast atom bombardment mass spectrometry of bleomycin A2 and B2 and their metal complexes. Biochem Biophys Res Commun 101, 632-638 (1981).
43. Morris, H.R., Panico, M., Barber, M., Bordoli, R.S., Sedgwick, R.D. & Tyler, A. Fast atom bombardment: a new mass spectrometric method for peptide sequence analysis. Biochem Biophys Res Commun 101, 623-631 (1981).
44. Tang, N. & Tornatore, P.W., S. R. Current developments in SELDI affinity technology. Mass Spectrometry Reviews 23, 34-44 (2003).
45. Gullberg, M., Fredriksson, S., Taussig, M., Jarvius, J., Gustafsdottir, S. & Landegren, U. A sense of closeness: protein detection by proximity ligation. Curr Opin Biotechnol 14, 82-86 (2003).
46. Engvall, E. & Perlman, P. Enzyme-linked immunosorbent assay (ELISA). Quantitative assay of immunoglobulin G. Immunochemistry 8, 871-874 (1971).
47. Famulok, M., Mayer, G. & Blind, M. Nucleic acid aptamers-from selection in vitro to applications in vivo. Acc Chem Res 33, 591-599 (2000).
48. Jayasena, S.D. Aptamers: an emerging class of molecules that rival antibodies in diagnostics. Clin Chem 45, 1628-1650 (1999).
49. Rajendran, M. & Ellington, A.D. In vitro selection of molecular beacons. Nucleic Acids Res 31, 5700-5713 (2003).
50. Nutiu, R. & Li, Y. In vitro selection of structure-switching signaling aptamers. Angew Chem Int Ed Engl 44, 1061-1065 (2005).
126
51. Hermann, T. & Patel, D.J. Adaptive recognition by nucleic acid aptamers. Science 287, 820-825 (2000).
52. Di Primo, C., Rudloff, I., Reigadas, S., Arzumanov, A.A., Gait, M.J. & Toulme, J.J. Systematic screening of LNA/2'-O-methyl chimeric derivatives of a TAR RNA aptamer. FEBS Lett 581, 771-774 (2007).
53. Green, L.S., Jellinek, D., Jenison, R., Ostman, A., Heldin, C.H. & Janjic, N. Inhibitory DNA ligands to platelet-derived growth factor B-chain. Biochemistry 35, 14413-14424 (1996).
54. Schmidt, K.S., Borkowski, S., Kurreck, J., Stephens, A.W., Bald, R., Hecht, M., Friebe, M., Dinkelborg, L. & Erdmann, V.A. Application of locked nucleic acids to improve aptamer in vivo stability and targeting function. Nucleic Acids Res 32, 5757-5765 (2004).
55. Crawford, M., Woodman, R. & Ko Ferrigno, P. Peptide aptamers: tools for biology and drug discovery. Brief Funct Genomic Proteomic 2, 72-79 (2003).
56. Ciesiolka, J. & Yarus, M. Small RNA-divalent domains. RNA 2, 785-793 (1996).
57. Sullenger, B.A. & Gilboa, E. Emerging clinical applications of RNA. Nature 418, 252-258 (2002).
58. Nieuwlandt, D., Wecker, M. & Gold, L. In vitro selection of RNA ligands to substance P. Biochemistry 34, 5651-5659 (1995).
59. Malina, A., Khan, S., Carlson, C.B., Svitkin, Y., Harvey, I., Sonenberg, N., Beal, P.A. & Pelletier, J. Inhibitory properties of nucleic acid-binding ligands on protein synthesis. FEBS Lett 579, 79-89 (2005).
60. Ringquist, S., Jones, T., Snyder, E.E., Gibson, T., Boni, I. & Gold, L. High-affinity RNA ligands to Escherichia coli ribosomes and ribosomal protein S1: comparison of natural and unnatural binding sites. Biochemistry 34, 3640-3648 (1995).
61. Pan, W., Craven, R.C., Qiu, Q., Wilson, C.B., Wills, J.W., Golovine, S. & Wang, J.F. Isolation of virus-neutralizing RNAs from a large pool of random sequences. Proc Natl Acad Sci U S A 92, 11509-11513 (1995).
62. Morris, K.N., Jensen, K.B., Julin, C.M., Weil, M. & Gold, L. High affinity ligands from in vitro selection: complex targets. Proc Natl Acad Sci U S A 95, 2902-2907 (1998).
63. Noma, T., Ikebukuro, K., Sode, K., Ohkubo, T., Sakasegawa, Y., Hachiya, N. & Kaneko, K. Screening of DNA aptamers against multiple proteins in tissue. Nucleic Acids Symp Ser (Oxf), 357-358 (2005).
64. Wilson, D.S. & Szostak, J.W. In vitro selection of functional nucleic acids. Annu Rev Biochem 68, 611-647 (1999).
127
65. Tasset, D.M., Kubik, M.F. & Steiner, W. Oligonucleotide inhibitors of human thrombin that bind distinct epitopes. J Mol Biol 272, 688-698 (1997).
66. Tuerk, C. & Gold, L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249, 505-510 (1990).
67. Ellington, A.D. & Szostak, J.W. In vitro selection of RNA molecules that bind specific ligands. Nature 346, 818-822 (1990).
68. Fitzwater, T. & Polisky, B. A SELEX primer. Methods Enzymol 267, 275-301 (1996).
69. Sassanfar, M. & Szostak, J.W. An RNA motif that binds ATP. Nature 364, 550-553 (1993).
70. Pileur, F., Andreola, M.L., Dausse, E., Michel, J., Moreau, S., Yamada, H., Gaidamakov, S.A., Crouch, R.J., Toulme, J.J. & Cazenave, C. Selective inhibitory DNA aptamers of the human RNase H1. Nucleic Acids Res 31, 5776-5788 (2003).
71. Bruno, J.G. & Kiel, J.L. Use of magnetic beads in selection and detection of biotoxin aptamers by electrochemiluminescence and enzymatic methods. Biotechniques 32, 178-180, 182-173 (2002).
72. Mendonsa, S.D. & Bowser, M.T. In vitro evolution of functional DNA using capillary electrophoresis. J Am Chem Soc 126, 20-21 (2004).
73. Mendonsa, S.D. & Bowser, M.T. In vitro selection of high-affinity DNA ligands for human IgE using capillary electrophoresis. Anal Chem 76, 5387-5392 (2004).
74. Berezovski, M., Drabovich, A., Krylova, S.M., Musheev, M., Okhonin, V., Petrov, A. & Krylov, S.N. Nonequilibrium capillary electrophoresis of equilibrium mixtures: a universal tool for development of aptamers. J Am Chem Soc 127, 3165-3171 (2005).
75. Mendonsa, S.D. & Bowser, M.T. In vitro selection of aptamers with affinity for neuropeptide Y using capillary electrophoresis. J Am Chem Soc 127, 9382-9383 (2005).
76. Fang, X., Cao, Z., Beck, T. & Tan, W. Molecular aptamer for real-time oncoprotein platelet-derived growth factor monitoring by fluorescence anisotropy. Anal Chem 73, 5752-5757 (2001).
77. Suljak, S.W., Cao, Z. & Tan, W. Recent Research Developments in Chemistry. Research Signpost 1, 59-77 (2003).
78. Vicens, M.C., Sen, A., Vanderlaan, A., Drake, T.J. & Tan, W. Investigation of molecular beacon aptamer-based bioassay for platelet-derived growth factor detection. Chembiochem 6, 900-907 (2005).
128
79. Li, J.J., Fang, X. & Tan, W. Molecular aptamer beacons for real-time protein recognition. Biochem Biophys Res Commun 292, 31-40 (2002), Li, J. & Tan, W. A single DNA nano motor, Nano Letters 2, 315 (2002).
80. Jhaveri S, Rajendran M, Ellington A D., In vitro selection of signaling aptamers, Nat. Biotechnology, 18, 1293 - 1297 (2000)
81. Yang, C.J., Jockusch, S., Vicens, M., Turro, N.J. & Tan, W. Light-switching excimer probes for rapid protein monitoring in complex biological fluids. Proc Natl Acad Sci U S A 102, 17278-17283 (2005).
82. Petersen, M. & Wengel, J. LNA: a versatile tool for therapeutics and genomics. Trends Biotechnol 21, 74-81 (2003).
83. Eaton, B. E., Gold, L., Hicke, B.J., Janjic, N., Jucker, F. M., Sebesta, D. P., Tarasow, T.M., Willis, M.C., and Zichi, D. A. Post-SELEX Combinatorial optimization of aptamers, Biorganic & Med. Chem. 5 1087-1096 (1997)
84. Tang, Z., Shangguan, D., Wang, K., Shi, H., Sefah, K., Mallikratchy, P., Chen, H.W., Li, Y. & Tan, W. Selection of aptamers for molecular recognition and characterization of cancer cells. Anal Chem 79, 4900-4907 (2007).
85. Shangguan, D., Li, Y., Tang, Z., Cao, Z.C., Chen, H.W., Mallikaratchy, P., Sefah, K., Yang, C.J. & Tan, W. Aptamers evolved from live cells as effective molecular probes for cancer study. Proc Natl Acad Sci U S A 103, 11838-11843 (2006).
86. Lupold, S.E., Hicke, B.J., Lin, Y. & Coffey, D.S. Identification and characterization of nuclease-stabilized RNA molecules that bind human prostate cancer cells via the prostate-specific membrane antigen. Cancer Res 62, 4029-4033 (2002).
87. Daniels, D.A., Chen, H., Hicke, B.J., Swiderek, K.M. & Gold, L. A tenascin-C aptamer identified by tumor cell SELEX: systematic evolution of ligands by exponential enrichment. Proc Natl Acad Sci U S A 100, 15416-15421 (2003).
88. Guo, K., Wendel, H.P., Scheideler, L., Ziemer, G. & Scheule, A.M. Aptamer-based capture molecules as a novel coating strategy to promote cell adhesion. J Cell Mol Med 9, 731-736 (2005).
89. Cerchia, L., Duconge, F., Pestourie, C., Boulay, J., Aissouni, Y., Gombert, K., Tavitian, B., de Franciscis, V. & Libri, D. Neutralizing aptamers from whole-cell SELEX inhibit the RET receptor tyrosine kinase. PLoS Biol 3, e123 (2005).
90. Shangguan, D., Cao, Z.C., Li, Y. & Tan, W. Aptamers evolved from cultured cancer cells reveal molecular differences of cancer cells in patient samples. Clin Chem 53, 1153-1155 (2007).
91. Quon, A. & Gambhir, S.S. FDG-PET and beyond: molecular breast cancer imaging. J Clin Oncol 23, 1664-1673 (2005).
129
92. Sullivan, D.C. & Kelloff, G. Seeing into cells. The promise of in vivo molecular imaging in oncology. EMBO Rep 6, 292-296 (2005).
93. Weissleder, R. Molecular imaging in cancer. Science 312, 1168-1171 (2006).
94. Halpern, E.J. Contrast-enhanced ultrasound imaging of prostate cancer. Rev Urol 8 Suppl 1, S29-37 (2006).
95. Bagalkot, V., Farokhzad, O.C., Langer, R. & Jon, S. An aptamer-doxorubicin physical conjugate as a novel targeted drug-delivery platform. Angew Chem Int Ed Engl 45, 8149-8152 (2006).
96. Chu, T.C., Marks, J.W., 3rd, Lavery, L.A., Faulkner, S., Rosenblum, M.G., Ellington, A.D. & Levy, M. Aptamer:toxin conjugates that specifically target prostate tumor cells. Cancer Res 66, 5989-5992 (2006).
97. Chu, T.C., Twu, K.Y., Ellington, A.D. & Levy, M. Aptamer mediated siRNA delivery. Nucleic Acids Res 34, e73 (2006).
98. Dolle, F., Hinnen,F., Vaufrey,F., Tavitian, B., Crouzel, C. A general method for labeling oligodeoxynucleotides with 18F for in vivo PET imaging J. of. Labelled compounds and radiopharmaceuticals, 39, 319-326 (1997)
99. Farokhzad, O.C., Jon, S., Khademhosseini, A., Tran, T.N., Lavan, D.A. & Langer, R. Nanoparticle-aptamer bioconjugates: a new approach for targeting prostate cancer cells. Cancer Res 64, 7668-7672 (2004).
100. Tavitian, B., Terrazzino, S., Kuhnast, B., Marzabal, S., Stettler, O., Dolle, F., Deverre, J.R., Jobert, A., Hinnen, F., Bendriem, B., Crouzel, C. & Di Giamberardino, L. In vivo imaging of oligonucleotides with positron emission tomography. Nat Med 4, 467-471 (1998).
101. Jerusalem, G., Hustinx, R., Beguin, Y. & Fillet, G. PET scan imaging in oncology. Eur J Cancer 39, 1525-1534 (2003).
102. Hicke, B.J., Stephens, A.W., Gould, T., Chang, Y.F., Lynott, C.K., Heil, J., Borkowski, S., Hilger, C.S., Cook, G., Warren, S. & Schmidt, P.G. Tumor targeting by an aptamer. J Nucl Med 47, 668-678 (2006).
103. McNamara, J.O., 2nd, Andrechek, E.R., Wang, Y., Viles, K.D., Rempel, R.E., Gilboa, E., Sullenger, B.A. & Giangrande, P.H. Cell type-specific delivery of siRNAs with aptamer-siRNA chimeras. Nat Biotechnol 24, 1005-1015 (2006).
104. James, W. Encyclopedia of Analytical Chemistry. (John Wiley & Sons Ltd, Chichester; 2000).
105. Boyle, F.T. & Costello, G.F. Cancer Therapy: move to the molecular level, Chem Soc. Rev 27, 251-261 (1998).
130
106. Ulrich, H., Ippolito, J.E., Pagan, O.R., Eterovic, V.A., Hann, R.M., Shi, H., Lis, J.T., Eldefrawi, M.E. & Hess, G.P. In vitro selection of RNA molecules that displace cocaine from the membrane-bound nicotinic acetylcholine receptor. Proc Natl Acad Sci U S A 95, 14051-14056 (1998).
107. Green, L.S., Jellinek, D., Bell, C., Beebe, L.A., Feistner, B.D., Gill, S.C., Jucker, F.M. & Janjic, N. Nuclease-resistant nucleic acid ligands to vascular permeability factor/vascular endothelial growth factor. Chem Biol 2, 683-695 (1995).
108. Kimoto, M., Shirouzu, M., Mizutani, S., Koide, H., Kaziro, Y., Hirao, I. & Yokoyama, S. Anti-(Raf-1) RNA aptamers that inhibit Ras-induced Raf-1 activation. Eur J Biochem 269, 697-704 (2002).
109. O'Connell, D., Koenig, A., Jennings, S., Hicke, B., Han, H.L., Fitzwater, T., Chang, Y.F., Varki, N., Parma, D. & Varki, A. Calcium-dependent oligonucleotide antagonists specific for L-selectin. Proc Natl Acad Sci U S A 93, 5883-5887 (1996).
110. Pagratis, N.C., Bell, C., Chang, Y.F., Jennings, S., Fitzwater, T., Jellinek, D. & Dang, C. Potent 2'-amino-, and 2'-fluoro-2'-deoxyribonucleotide RNA inhibitors of keratinocyte growth factor. Nat Biotechnol 15, 68-73 (1997).
111. Dolmans, D.E., Fukumura, D. & Jain, R.K. Photodynamic therapy for cancer. Nat Rev Cancer 3, 380-387 (2003).
112. Castano, A.P., Mroz, P. & Hamblin, M.R. Photodynamic therapy and anti-tumour immunity. Nat Rev Cancer 6, 535-545 (2006).
113. Bonnett, R., Photosensitizers of the porphyrin and phthalocyanine series for photodynamic therapy, Chem. Soc. Rev. 24, 19-31 (1995).
114. Dougherty, T.J., Gomer, C.J., Henderson, B.W., Jori, G., Kessel, D., Korbelik, M., Moan, J. & Peng, Q. Photodynamic therapy. J Natl Cancer Inst 90, 889-905 (1998).
115. Strong, L., Yarmush, D.M. & Yarmush, M.L. Antibody-targeted photolysis. Photophysical, biochemical, and pharmacokinetic properties of antibacterial conjugates. Ann N Y Acad Sci 745, 297-320 (1994).
116. Kragh-Hansen, U. Structure and ligand binding properties of human serum albumin. Dan Med Bull 37, 57-84 (1990).
117. de Smidt, P.C., Versluis, A.J. & van Berkel, T.J. Properties of incorporation, redistribution, and integrity of porphyrin-low-density lipoprotein complexes. Biochemistry 32, 2916-2922 (1993).
118. Seaton, B.A. & Dedman, J.R. Annexins. Biometals 11, 399-404 (1998).
119. Ali, H. & van Lier, J.E. Metal complexes as photo- and radiosensitizers. Chem Rev 99, 2379-2450 (1999).
131
120. Conrad, M.E. & Umbreit, J.N. Iron absorption and transport-an update. Am J Hematol 64, 287-298 (2000).
121. Tsein, R. Imaging imaging’s future Nature Reviews Molecular Cell Biology 4, 16-21 (2003).
122. Cao, Z. & Tan, W. Molecular aptamers for real-time protein-protein interaction study. Chemistry 11, 4502-4508 (2005).
123. Newton, A.C. Protein kinase C: structural and spatial regulation by phosphorylation, cofactors, and macromolecular interactions. Chem Rev 101, 2353-2364 (2001).
124. Newton, A.C. The ins and outs of protein kinase C. Methods Mol Biol 233, 3-7 (2003).
125. Gschwendt, M. Protein kinase C delta. Eur J Biochem 259, 555-564 (1999).
126. Miyamoto, A., Nakayama, K., Imaki, H., Hirose, S., Jiang, Y., Abe, M., Tsukiyama, T., Nagahama, H., Ohno, S., Hatakeyama, S. & Nakayama, K.I. Increased proliferation of B cells and auto-immunity in mice lacking protein kinase Cdelta. Nature 416, 865-869 (2002).
127. Ashton, A.W., Watanabe, G., Albanese, C., Harrington, E.O., Ware, J.A. & Pestell, R.G. Protein kinase Cdelta inhibition of S-phase transition in capillary endothelial cells involves the cyclin-dependent kinase inhibitor p27(Kip1). J Biol Chem 274, 20805-20811 (1999).
128. Wang, Q., Wang, X. & Evers, B.M. Induction of cIAP-2 in human colon cancer cells through PKC delta/NF-kappa B. J Biol Chem 278, 51091-51099 (2003).
129. Steinberg, S.F. Distinctive activation mechanisms and functions for protein kinase Cdelta. Biochem J 384, 449-459 (2004).
130. Yoshida, K., Miki, Y. & Kufe, D. Activation of SAPK/JNK signaling by protein kinase Cdelta in response to DNA damage. J Biol Chem 277, 48372-48378 (2002).
131. Yang, C. & Kazanietz, M.G. Divergence and complexities in DAG signaling: looking beyond PKC. Trends Pharmacol Sci 24, 602-608 (2003).
132. Poole, A.W., Pula, G., Hers, I., Crosby, D. & Jones, M.L. PKC-interacting proteins: from function to pharmacology. Trends Pharmacol Sci 25, 528-535 (2004).
133. Violin, J.D., Zhang, J., Tsien, R.Y. & Newton, A.C. A genetically encoded fluorescent reporter reveals oscillatory phosphorylation by protein kinase C. J Cell Biol 161, 899-909 (2003).
132
134. Watanabe, T., Ono, Y., Taniyama, Y., Hazama, K., Igarashi, K., Ogita, K., Kikkawa, U. & Nishizuka, Y. Cell division arrest induced by phorbol ester in CHO cells overexpressing protein kinase C-delta subspecies. Proc Natl Acad Sci U S A 89, 10159-10163 (1992).
135. Fukumoto, S., Nishizawa, Y., Hosoi, M., Koyama, H., Yamakawa, K., Ohno, S. & Morii, H. Protein kinase C delta inhibits the proliferation of vascular smooth muscle cells by suppressing G1 cyclin expression. J Biol Chem 272, 13816-13822 (1997).
136. Mischak, H., Goodnight, J.A., Kolch, W., Martiny-Baron, G., Schaechtle, C., Kazanietz, M.G., Blumberg, P.M., Pierce, J.H. & Mushinski, J.F. Overexpression of protein kinase C-delta and -epsilon in NIH 3T3 cells induces opposite effects on growth, morphology, anchorage dependence, and tumorigenicity. J Biol Chem 268, 6090-6096 (1993).
137. Mishima, K., Ohno, S., Shitara, N., Yamaoka, K. & Suzuki, K. Opposite effects of the overexpression of protein kinase C gamma and delta on the growth properties of human glioma cell line U251 MG. Biochem Biophys Res Commun 201, 363-372 (1994).
138. Harrington, E.O., Loffler, J., Nelson, P.R., Kent, K.C., Simons, M. & Ware, J.A. Enhancement of migration by protein kinase Calpha and inhibition of proliferation and cell cycle progression by protein kinase Cdelta in capillary endothelial cells. J Biol Chem 272, 7390-7397 (1997).
139. Sambrook, J. & Russell, W. Molecular Biology, Vol. 1 7.9-7.10 (CSHL Press, 2001).
140. Kiga, D., Futamura, Y., Sakamoto, K. & Yokoyama, S. An RNA aptamer to the xanthine/guanine base with a distinctive mode of purine recognition. Nucleic Acids Res 26, 1755-1760 (1998).
141. Saran, D., Frank, J. & Burke, D.H. The tyranny of adenosine recognition among RNA aptamers to coenzyme A. BMC Evol Biol 3, 26 (2003).
142. Mallikaratchy, P., Stahelin, R.V., Cao, Z., Cho, W. & Tan, W. Selection of DNA ligands for protein kinase C-delta. Chem Commun (Camb), 3229-3231 (2006).
143. Dalton, W.S. & Friend, S.H. Cancer biomarkers--an invitation to the table. Science 312, 1165-1168 (2006).
144. Bledi, Y., Inberg, A. & Linial, M. PROCEED: A proteomic method for analysing plasma membrane proteins in living mammalian cells. Brief Funct Genomic Proteomic 2, 254-265 (2003).
145. Oh, P., Li, Y., Yu, J., Durr, E., Krasinska, K.M., Carver, L.A., Testa, J.E. & Schnitzer, J.E. Subtractive proteomic mapping of the endothelial surface in lung and solid tumours for tissue-specific therapy. Nature 429, 629-635 (2004).
133
146. Shin, B.K., Wang, H., Yim, A.M., Le Naour, F., Brichory, F., Jang, J.H., Zhao, R., Puravs, E., Tra, J., Michael, C.W., Misek, D.E. & Hanash, S.M. Global profiling of the cell surface proteome of cancer cells uncovers an abundance of proteins with chaperone function. J Biol Chem 278, 7607-7616 (2003).
147. Gygi, S.P., Rist, B., Gerber, S.A., Turecek, F., Gelb, M.H. & Aebersold, R. Quantitative analysis of complex protein mixtures using isotope-coded affinity tags. Nat Biotechnol 17, 994-999 (1999).
148. Washburn, M.P., Wolters, D. & Yates, J.R., 3rd Large-scale analysis of the yeast proteome by multidimensional protein identification technology. Nat Biotechnol 19, 242-247 (2001).
149. Roboz, J. Mass spectrometry in diagnostic oncoproteomics. Cancer Invest 23, 465-478 (2005).
150. Lawson, E.L., Clifton, J.G., Huang, F., Li, X., Hixson, D.C. & Josic, D. Use of magnetic beads with immobilized monoclonal antibodies for isolation of highly pure plasma membranes. Electrophoresis 27, 2747-2758 (2006).
151. Chang, P.S., Absood, A., Linderman, J.J. & Omann, G.M. Magnetic bead isolation of neutrophil plasma membranes and quantification of membrane-associated guanine nucleotide binding proteins. Anal Biochem 325, 175-184 (2004).
152. Thomas, M.D., Srivastava, B. & Allman, D. Regulation of peripheral B cell maturation. Cell Immunol 239, 92-102 (2006).
153. Cambier, J.C. & Campbell, K.S. Membrane immunoglobulin and its accomplices: new lessons from an old receptor. FASEB J 6, 3207-3217 (1992).
154. Trujillo, M.A., Jiang, S.W., Tarara, J.E. & Eberhardt, N.L. Clustering of the B cell receptor is not required for the apoptotic response. DNA Cell Biol 22, 513-523 (2003).
155. Joseph, L.F., Ezhevsky, S. & Scott, D.W. Lymphoma models for B-cell activation and tolerance: anti-immunoglobulin M treatment induces growth arrest by preventing the formation of an active kinase complex which phosphorylates retinoblastoma gene product in G1. Cell Growth Differ 6, 51-57 (1995).
156. Carey, G.B., Donjerkovic, D., Mueller, C.M., Liu, S., Hinshaw, J.A., Tonnetti, L., Davidson, W. & Scott, D.W. B-cell receptor and Fas-mediated signals for life and death. Immunol Rev 176, 105-115 (2000).
157. Cragg, M.S., Zhang, L., French, R.R. & Glennie, M.J. Analysis of the interaction of monoclonal antibodies with surface IgM on neoplastic B-cells. Br J Cancer 79, 850-857 (1999).
134
158. Kang, S.H., Vieira, K. & Bungert, J. Combining chromatin immunoprecipitation and DNA footprinting: a novel method to analyze protein-DNA interactions in vivo. Nucleic Acids Res 30, e44 (2002).
159. Smith, D., Collins, B.D., Heil, J. & Koch, T.H. Sensitivity and specificity of photoaptamer probes. Mol Cell Proteomics 2, 11-18 (2003).
160. Golden, M.C., Resing, K.A., Collins, B.D., Willis, M.C. & Koch, T.H. Mass spectral characterization of a protein-nucleic acid photocrosslink. Protein Sci 8, 2806-2812 (1999).
161. Mallikaratchy, P., Tang, Z., Meng, L., Shangguan, D., Kwame, S. & Tan, W. Aptamer directly evolved from live cells recognizes membrane bound immunoglobin heavy mu chain in Burkitt's lymphoma cells. Mol Cell Proteomics 6, 2230-2238 (2007).
162. Wilbur, D.S., Pathare, P.M., Hamlin, D.K., Stayton, P.S., To, R., Klumb, L.A., Buhler, K.R. & Vessella, R.L. Development of new biotin/streptavidin reagents for pretargeting. Biomol Eng 16, 113-118 (1999).
163. Wilchek, M. & Bayer, E.A. Foreword and introduction to the book (strept)avidin-biotin system. Biomol Eng 16, 1-4 (1999).
164. Diamandis, E.P. & Christopoulos, T.K. The biotin-(strept)avidin system: principles and applications in biotechnology. Clin Chem 37, 625-636 (1991).
165. Sieverts, H., Alabaster, O., Goldschmidts, W. & Magrath, I. Expression of surface antigens during the cell cycle in different growth phases of American and African Burkitt's lymphoma cell lines. Cancer Res 46, 1182-1188 (1986).
166. Kaptein, J.S., Lin, C.K., Wang, C.L., Nguyen, T.T., Kalunta, C.I., Park, E., Chen, F.S. & Lad, P.M. Anti-IgM-mediated regulation of c-myc and its possible relationship to apoptosis. J Biol Chem 271, 18875-18884 (1996).
167. Cutrona, G., Carpaneto, E.M., Ponzanelli, A., Ulivi, M., Millo, E., Scarfi, S., Roncella, S., Benatti, U., Boffa, L.C. & Ferrarini, M. Inhibition of the translocated c-myc in Burkitt's lymphoma by a PNA complementary to the E mu enhancer. Cancer Res 63, 6144-6148 (2003).
168. Mongini, P.K., Liu, Q., Vilensky, M.A., Highet, P.F. & Inman, J.K. Evidence for an upper affinity threshold for anti-IgM-induced apoptosis in a human B-cell lymphoma. Blood 92, 3756-3771 (1998).
169. Gurinovich, G.P., Zorina, T.E., Melnov, S.B., Melnova, N.I., Gurinovich, I.F., Grubina, L.A., Sarzhevskaya, M.V. & Cherenkevich, S.N. Photodynamic activity of chlorin e6 and chlorin e6 ethylenediamide in vitro and in vivo. J Photochem Photobiol B 13, 51-57 (1992).
135
170. Dalla Via, L. & Marciani Magno, S. Photochemotherapy in the treatment of cancer. Curr Med Chem 8, 1405-1418 (2001).
171. Sharman, W.M., van Lier, J.E. & Allen, C.M. Targeted photodynamic therapy via receptor mediated delivery systems. Adv Drug Deliv Rev 56, 53-76 (2004).
172. Klussmann, S. The Aptamer Handbook:Functional Oligonucleotides and Their Applications. (Wiley-VCH, Weinheim, Germany; 2006).
173. Mallikaratchy, P., Tang, Z. & Tan, W. Cell Specific Aptamer Photosensitizer Conjugates as a Molecular Tool in Photodynamic Therapy. ChemMedChem, accepted (2007).
174. Choi, Y., Weissleder, R. & Tung, C.H. Protease-mediated phototoxicity of a polylysine-chlorin(E6) conjugate. ChemMedChem 1, 698-701 (2006).
175. Chen, J., Stefflova, K., Niedre, M.J., Wilson, B.C., Chance, B., Glickson, J.D. & Zheng, G. Protease-triggered photosensitizing beacon based on singlet oxygen quenching and activation. J Am Chem Soc 126, 11450-11451 (2004).
176. Zheng, G., Chen, J., Stefflova, K., Jarvi, M., Li, H. & Wilson, B.C. Photodynamic molecular beacon as an activatable photosensitizer based on protease-controlled singlet oxygen quenching and activation. Proc Natl Acad Sci U S A 104, 8989-8994 (2007).
177. Choi, Y., Weissleder, R. & Tung, C.H. Selective antitumor effect of novel protease-mediated photodynamic agent. Cancer Res 66, 7225-7229 (2006).
178. Li, X. & Liu, D.R. DNA-templated organic synthesis: nature's strategy for controlling chemical reactivity applied to synthetic molecules. Angew Chem Int Ed Engl 43, 4848-4870 (2004).
179. Ma, Z. & Taylor, J.S. Nucleic acid-triggered catalytic drug release. Proc Natl Acad Sci U S A 97, 11159-11163 (2000).
180. Silverman, A.P. & Kool, E.T. Detecting RNA and DNA with templated chemical reactions. Chem Rev 106, 3775-3789 (2006).
181. Ng, E.W., Shima, D.T., Calias, P., Cunningham, E.T., Jr., Guyer, D.R. & Adamis, A.P. Pegaptanib, a targeted anti-VEGF aptamer for ocular vascular disease. Nat Rev Drug Discov 5, 123-132 (2006).
182. Griffin, L.C., Tidmarsh, G.F., Bock, L.C., Toole, J.J. & Leung, L.L. In vivo anticoagulant properties of a novel nucleotide-based thrombin inhibitor and demonstration of regional anticoagulation in extracorporeal circuits. Blood 81, 3271-3276 (1993).
183. Tam, R.C., Wu-Pong, S., Pai, B., Lim, C., Chan, A., Thomas, D.F., Milovanovic, T., Bard, J. & Middleton, P.J. Increased potency of an aptameric G-rich oligonucleotide is associated with novel functional properties of phosphorothioate linkages. Antisense Nucleic Acid Drug Dev 9, 289-300 (1999).
136
184. Pieken, W.A., Olsen, D.B., Benseler, F., Aurup, H. & Eckstein, F. Kinetic characterization of ribonuclease-resistant 2'-modified hammerhead ribozymes. Science 253, 314-317 (1991).
185. Floege, J., Ostendorf, T., Janssen, U., Burg, M., Radeke, H.H., Vargeese, C., Gill, S.C., Green, L.S. & Janjic, N. Novel approach to specific growth factor inhibition in vivo: antagonism of platelet-derived growth factor in glomerulonephritis by aptamers. Am J Pathol 154, 169-179 (1999).
186. Dougan, H., Lyster, D.M., Vo, C.V., Stafford, A., Weitz, J.I. & Hobbs, J.B. Extending the lifetime of anticoagulant oligodeoxynucleotide aptamers in blood. Nucl Med Biol 27, 289-297 (2000).
187. Ruckman, J., Green, L.S., Beeson, J., Waugh, S., Gillette, W.L., Henninger, D.D., Claesson-Welsh, L. & Janjic, N. 2'-Fluoropyrimidine RNA-based aptamers to the 165-amino acid form of vascular endothelial growth factor (VEGF165). Inhibition of receptor binding and VEGF-induced vascular permeability through interactions requiring the exon 7-encoded domain. J Biol Chem 273, 20556-20567 (1998).
188. Blank, M. & Blind, M. Aptamers as tools for target validation. Curr Opin Chem Biol 9, 336-342 (2005).
189. Buning, H., Ried, M.U., Perabo, L., Gerner, F.M., Huttner, N.A., Enssle, J. & Hallek, M. Receptor targeting of adeno-associated virus vectors. Gene Ther 10, 1142-1151 (2003).
190. Li, C., Bowles, D.E., van Dyke, T. & Samulski, R.J. Adeno-associated virus vectors: potential applications for cancer gene therapy. Cancer Gene Ther 12, 913-925 (2005).
137
BIOGRAPHICAL SKETCH
Prabodhika Mallikaratchy is from Gampola, Sri Lanka. In 1996, after finishing her
General Certificate Examination Advanced Level, she enrolled in Institute of Chemistry Ceylon,
to major in Physical Chemistry. As an undergraduate student, she studied the effect of dye
sensitization of CdS semiconductors to implement efficient solar cells under Dr. O.A. Illeperuma
at his Inorganic Research Laboratory. After completing her undergraduate studies with honors,
in August 2001 she traveled to University of Louisiana at Monroe to pursue a Master of Science
in organo-metallic chemistry under the supervision of Dr Thomas Junk. At ULM she studied
and characterized three novel organo- metallic compounds. After successfully completing her
M.Sc. degree in 2003 June, she joined Dr. Weihong Tan’s lab to pursue a PhD in Chemistry.
![Molecular Selection, Modification and Development of ...€¦ · 1990 [3,4,6]. Compared to monoclonal antibodies, aptamers possess similar affinity and specificity, but have minimal](https://static.fdocuments.in/doc/165x107/5f89c78334544f44117e5b45/molecular-selection-modification-and-development-of-1990-346-compared.jpg)
![Cell-SELEX Identifies a Sticky RNA Aptamer Sequencebe propagated for selection, whereas unbound aptamers, or aptamers that only bind to the cell surface but are not internalized,willbecleavedbytheactionofRS[11].](https://static.fdocuments.in/doc/165x107/60f9ddad548d0e7de0148f4d/cell-selex-identifies-a-sticky-rna-aptamer-sequence-be-propagated-for-selection.jpg)
