IL-37 Inhibits Inflammasome Activation and Disease ... · IL-37 Inhibits Inflammasome Activation...

IL-37 Inhibits Inflammasome Activation and DiseaseSeverity in Murine AspergillosisSilvia Moretti1., Silvia Bozza1., Vasilis Oikonomou1, Giorgia Renga1, Andrea Casagrande1,2,

Rossana G. Iannitti1, Matteo Puccetti1, Cecilia Garlanda3, Soohyun Kim4, Suzhao Li4,

Frank L. van de Veerdonk5, Charles A. Dinarello4,5, Luigina Romani1*

1 Department of Experimental Medicine and Biochemical Sciences, University of Perugia, Perugia, Italy, 2 Istituto Superiore di Sanita, Roma, Italy, 3 Humanitas Clinical and

Research Center, Rozzano, Milan, Italy, 4 Department of Medicine, University of Colorado Denver, Aurora, Colorado, United States of America, 5 Department of Medicine,

Radboud University Medical Centre, Nijmegen, The Netherlands

Abstract

Since IL-37 transgenic mice possesses broad anti-inflammatory properties, we assessed whether recombinant IL-37 affectsinflammation in a murine model of invasive pulmonary aspergillosis. Recombinant human IL-37 was injectedintraperitoneally into mice prior to infection and the effects on lung inflammation and inflammasome activation wereevaluated. IL-37 markedly reduced NLRP3-dependent neutrophil recruitment and steady state mRNA levels of IL-1bproduction and mitigated lung inflammation and damage in a relevant clinical model, namely aspergillosis in mice withcystic fibrosis. The anti-inflammatory activity of IL-37 requires the IL-1 family decoy receptor TIR-8/SIGIRR. Thus, bypreventing activation of the NLRP3 inflammasome and reducing IL-1b secretion, IL-37 functions as a broad spectruminhibitor of the innate response to infection-mediated inflammation, and could be considered to be therapeutic in reducingthe pulmonary damage due to non-resolving Aspergillus infection and disease.

Citation: Moretti S, Bozza S, Oikonomou V, Renga G, Casagrande A, et al. (2014) IL-37 Inhibits Inflammasome Activation and Disease Severity in MurineAspergillosis. PLoS Pathog 10(11): e1004462. doi:10.1371/journal.ppat.1004462

Editor: Bruce S. Klein, University of Wisconsin-Madison, United States of America

Received January 3, 2014; Accepted September 10, 2014; Published November 6, 2014

Copyright: � 2014 Moretti et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permitsunrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This study was supported by the Specific Targeted Research Project FunMeta (ERC-2011-AdG-293714 to LR), the Italian Grant funded by the ItalianCystic Fibrosis Research Foundation (FFC#16/2012 to LR), and the Italian Projects PRIN (2009HL28E8_002 to SB). Supported also by United States NationalInstitutes of Health Grants AI-15614, CA-04-6934 and AR-45584 (to CAD). SL was supported by American Heart Association grant 12POST12030134. SK wassupported by National Research Foundation of Korea (MEST 2012R1A2A1A010017910) and Konkuk University National Research Foundation of Korea (MEST2012R1A2A1A010017910). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing Interests: The authors have declared that no competing interests exist.

* Email: [email protected]

. These authors contributed equally to this work.

Introduction

IL-37 is a member of the IL-1 family of ligands discovered by

computational cloning and previously termed IL-1 family member

7 [1]. Five different splice variants of IL-37 have been described

[2,3]. The major splice variant is IL-37b [4] and, similar to most

members of the IL-1 family, lacks a clear signal peptide. The

precursor form is a ,30-kDa molecular mass protein that shares

critical amino acid residues with IL-18 [5]. In fact, IL-37 binds to

the IL-18 receptor [6] as well as the IL-18 binding protein [7]. The

first indication that IL-37 possessed anti-inflammatory properties

was observed with the combination of IL-37 plus IL-18 binding

protein [7]. Staining for IL-37 of human PBMC shows a granular

pattern in close proximity to the Golgi and endoplasmic reticulum,

a pattern, which suggests translocation via secretory vesicles [6,7].

IL-37 translocates to the nucleus and reduces LPS-induced

cytokines. The nuclear translocation of IL-37 requires caspase-1

activity as assessed by caspase-1 inhibitors [8] or by mutation of

the caspase-1 recognition aspartic acid in the IL-37 precursor [9].

IL-37 exerts anti-inflammatory effects by suppressing innate

immune responses through attenuating the production of inflam-

matory cytokines induced by TLR agonists, IL-1 and tumor

necrosis factor (TNF) [8,10].

IL-37 specific mRNA has been detected in a variety of normal

tissues and tumors in humans, where it is up-regulated by

inflammatory stimuli and cytokines [10–12], a finding suggesting

that IL-37 mediates a negative feedback mechanism to curb

excessive inflammation. Although a mouse homologue has not yet

been identified, IL-37b has been reported to act as an inhibitor of

inflammation in mice, a function achieved by inhibition of

dendritic cell activation on the cellular level and by interaction

with Smad3 and modulation of kinase checkpoints on the

molecular level [10]. Transgenic mice expressing human IL-37

on haematopoietic cells were protected from chemically-induced

colitis [13] and from local and systemic inflammation in ConA-

induced hepatitis and LPS challenge [14]. These results place IL-

37 within the portfolio of classical anti-inflammatory cytokines,

such as IL-10 and TGF-b [15].

Cytokines of the IL-1 family have important roles for antifungal

host defense in the lung [16] and IL-1 gene cluster polymorphisms

has been associated with susceptibility to aspergillosis in hemato-

logically suppressed patients [17]. IL-1a, IL-1b and IL-18 are

induced in alveolar macrophages, blood monocytes and neutro-

phils in response to Aspergillus in mice and humans. In turn, these

cytokines activate the release of other pro-inflammatory cytokines

such as TNF-a and IL-6, and induce antifungal Th17 responses

PLOS Pathogens | www.plospathogens.org 1 November 2014 | Volume 10 | Issue 11 | e1004462

http://creativecommons.org/licenses/by/4.0/

http://crossmark.crossref.org/dialog/?doi=10.1371/journal.ppat.1004462&domain=pdf

[18–20]. In contrast to conidia, Aspergillus hyphae also induced

NLRP3 inflammasome assembly, caspase-1 activation and IL-1brelease from a human monocyte cell line [21]. However, given that

IL-1R1-deficient or caspase 1-deficient mice are resistant to lung

inflammation during aspergillosis [20,22] and that IL-1 signaling

could drive the differentiation of antifungal inflammatory Th17

cells [20,23], the proinflammatory properties of IL-1-induced

inflammation in aspergillosis is potentially dangerous for the host.

Therefore, in order to reduce inflammation in this model, we

assessed whether IL-37 would dampen inflammation in experi-

mental pulmonary inflammatory aspergillosis.

Results

IL-37 reduces inflammatory cell recruitment in mice withaspergillosis

We first assessed the impact of the recombinant IL-37 precursor

(hereafter referred to as IL-37) on lung inflammation. The IL-37

precursor was administered intraperitoneally once either 96, 48 or

1 hour before intranasal infection with live A. fumigatus conidia.

Mice were monitored 1 and 3 days after the infection for BAL

morphometry, inflammatory cell recruitment and expression of

myeloperoxidase (Mpo) and chemokines. Although not affecting

the fungal burden in the lung (Figure 1A), IL-37 administered 1 h

before the infection at the dosage of 1000 and 100 ng/mouse (50

and 5 mg/kg, respectively) reduced BAL neutrophilia (Figure 1B),

neutrophil influx in the lung (Figure 1C), lung damage (Figure 1C,

insets) and lung expression of Mpo and CxCl2, an essential

mediator of host defense against A. fumigatus in mice [24] and

humans [25]. CxCl1 expression was instead unaffected (Fig-

ure 1D). These reductions were observed as early as 1 day after

the infection and appears to be long-lasting, being still present at 3

days post-infection, a time at which BAL neutrophilia (Figure 1B),

lung neutrophilic infiltration (Figure 1C) and Mpo and CxCl2expression (Figure 1D) were drastically reduced. Accordingly, IL-

37 was effective when administered 96 or 48 hours before the

infection (Figure 1E and F). The effects was strictly dependent on

the route of administration, being lost upon local intranasal

injection (Figure 1E and F). Of interest, IL-37 was also effective in

dampening inflammation when administered after the infection

(Figure S1). Similar to Aspergillus, IL-37 also reduces neutrophil

infiltration in mice treated with LPS (Figure 1G), a finding

indicating that IL-37 inhibits TLR-dependent neutrophil recruit-

ment in lung infections as reported previously [10].

IL-37 impairs inflammasome activation in mice withaspergillosis

As uncontrolled IL-1b promotes detrimental neutrophil-depen-

dent inflammation during aspergillosis [20], we examined whether

IL-37 pretreatment affects the level of IL-1b production and

inflammasome activation. As shown in Figure 2 by immunohis-

tochemistry (Figure 2A) and RT-PCR (Figure 2B), lung NLRP3

expression increased after the infection in both epithelial and in

the recruited inflammatory cell compartment. IL-37, at 1000 and

100 ng/mouse, greatly reduced Nlrp3 steady state mRNA levels

in the lungs. IL-1b was also decreased by IL-37, as revealed by

RT-PCR (Figure 2B), ELISA (Figure 2C) and pro-IL-1b and

caspase-1 cleavage by immunoblotting (Figure 2D). IL-37 did not

inhibit the expression of Il1a (Figure 2B), did not change that of

Il1ra (Figure 2B), known to inhibit inflammasome activation [26],

and only partially reduced the expression Tnfa and Il6(Figure 2B). IL-37 also reduced the expression of Il17a and Ifng(Figure 2E) and greatly increased that of Il10 (Figure 2C and E).

However, the induction of IL-10 did not apparently account for

the anti-inflammatory activity of IL-37, as IL-37 still retained its

effects in IL-10-deficient mice (Figure S2). This finding is in line

with what described in experimental colitis in which an antibody

to the IL-10 receptor did not affect the anti-inflammatory

properties of transgenic mice expressing human IL-37 [13]. Thus,

these data indicate that IL-37 may limit the recruitment of

inflammatory neutrophils and damage in infected lungs by

dampening NLRP3 inflammasome activation. To directly prove

this, we assessed NLRP3-deficient mice for susceptibility to

aspergillosis and the effects of IL-37 administration. The results

showed that neutrophil recruitment in the BAL (Figure 3A) and

lungs (Figure 3B), Mpo and Cxcl2 expression (Figure 3C) and IL-

1b production (Figure 3D) were lower in NLRP3-deficient than

wild-type mice and were not modified by IL-37 treatment. These

data suggest that one mechanism by which IL-37 exerts its anti-

inflammatory effects in lung aspergillosis is by inhibition of

NLRP3 inflammasome activity.

IL-37 dampens inflammatory pathways in phagocyticcells

In order to identify which cell type is responsive to IL-37, we

assessed the ability of IL-37 to affect the expression of Il1b in

purified alveolar macrophages, lung epithelial cells and peripheral

neutrophils from naıve mice in response to Aspergillus conidia.

We did not observe that IL-37 decreased phagocytic capacity and

fungicidal activity of phagocytes in vitro (Figure 4A), nevertheless

recombinant IL-37 inhibited the expression of Il1b in response to

conidia, in both macrophages and neutrophils (Figure 4B).

Epithelial cells poorly responded to conidia stimulation, with

and without IL-37 (Figure 4B). Of interest, IL-37 induced the

expression of the inducible nitric oxide (Nos2), known to suppress

inflammasome activation [27] and Th17 development [28]. IL-37

inhibits MAP kinase p38a in the human monocytic THP1 cell line

[10]; therefore, we measured the phosphorylation of 19 kinases in

the murine leukemic monocyte macrophage cell line RAW 264.7

pretreated with IL-37 and exposed to Aspergillus conidia, known

Author Summary

IL-37, firstly identified by in silico research in the year 2000,is a member of the IL-1 family. The biological properties ofIL-37 are mainly those of down-regulating inflammation inmodels of septic shock, chemical colitis, cardiac ischemiaand contact dermatitis. Whether and how IL-37 down-regulates the inflammation of infection, and its conse-quences, is not known. We observed that IL-37 limitsinflammation and disease severity in murine invasiveaspergillosis, an infection model in which cytokines ofthe IL-1 family have important roles. However, given thatIL-1R1-deficient or caspase 1-deficient mice are resistant tolung inflammation during infection and that IL-1 signalingcould drive the differentiation of antifungal inflammatoryTh17 cells, the pro-inflammatory properties of IL 1-inducedinflammation in aspergillosis is potentially dangerous forthe host. IL-37 markedly reduced NLRP3-dependentneutrophil recruitment and steady state mRNA levels ofIL-1b production and mitigated lung inflammation anddamage in a relevant clinical model, namely aspergillosis inmice with cystic fibrosis. The anti-inflammatory activity ofIL-37 requires the IL-1 receptor family decoy TIR-8/SIGIRR.Thus, IL-37 functions as a broad spectrum inhibitor ofinfection-mediated inflammation, and could be consideredto be therapeutic in reducing the pulmonary damage dueto non-resolving Aspergillus infection and disease.

IL-37 Inhibits Inflammasome Activation


to trigger the phosphorylation of p38 [29]. IL-37 greatly reduced

p38a phosphorylation and, to a lesser extent, ERK1/2 phosphor-

ylation in response to conidia (Figure 4C). These results indicate

that IL-37 affects signal transduction pathways in response to

conidia, likely impacting Il1b and Nos2 gene expression.

IL-37 fails to inhibit inflammasome activation in TIR-8/SIGIRR-deficient mice

We reported that TIR-8/SIGIRR is required for host resistance

to fungal infections by reducing IL-1b–dependent activation of

inflammatory Th17 responses [20]. In the present study, we

assessed whether the inhibitory activity of recombinant IL-37

would require TIR-8/SIGIRR. To this purpose, we evaluated the

impact of IL-37 on inflammasome activation and inflammation in

Tir82/2 mice with aspergillosis. Consistent with previous findings

[20], increased BAL neutrophilia (Figure 5A) and lung inflamma-

tion (Figure 5B) were observed in Tir82/2 mice along with an

heightened expression of NLRP3 (Figure 5B inset). Consistently,

Mpo, CxCl2 (Figure 5C), Il1b and Il17a (Figure 5D) expression as

well as the cleavage of the IL-1b precursor (Figure 5E) were all up-

regulated in these mice. Treatment with 1000 ng/mouse of IL-37

one h before the infection neither limited inflammatory cell

recruitment nor inhibited the heightened NALP3 expression

activation in these mice (Figure 5B–E). IL-37 also failed to restore

Il10 expression in these mice (Figure 5D). These data support the

concept that TIR-8/SIGIRR signaling is required for the anti-

inflammatory effects of IL-37.

IL-37 limits inflammation in fungal allergy and mice withcystic fibrosis

To evaluate the potential for IL-37 to limit inflammation also in

Aspergillus allergy, we resorted to a murine model of allergic

bronchopulmonary aspergillosis (ABPA) in which both the Th2

and Th17 cell responses contribute to the inflammatory response

[30]. Mice were sensitized to Aspergillus antigens and concom-

itantly treated with 1000 ng/mouse of IL-37. We found that IL-37

reduced mucin production (Figure 6A) and peribronchial fibrosis

due to collagen deposition as shown by Masson’s trichrome

staining (Figure 6A) and hydroxyprolin content (Figure 6B). In

addition, IL-37 markedly reduced the expression of the mucin

Muc-5/5ac gene, a known marker of globlet cells metaplasia in

murine airways [9]. In addition, IL-37 greatly decreased

inflammatory cell recruitment and Th2/Th17cell activation

(Figure 6D), a finding indicating that IL-37 has the potential to

impact on the adaptive immune response. To evaluate the anti-

allergic activity of IL-37 in a clinically relevant model, we resorted

to Cftr tm1Unc (Cftr2/2) mice that are considered to mimic, to

some extent, the airway inflammation and infection of human

cystic fibrosis (CF) [31,32]. We have already shown that Cftr2/2

mice are highly susceptible to Aspergillus infection and allergy,

due to an heightened inflammatory Th17/Th2 response [33].

Cftr2/2 mice were pretreated with 1000 ng/mouse IL-37 one h

before the infection and parameters of infection and inflammation

were evaluated one day after the infection. We observed that IL-37

pretreatment, while not affecting the fungal burden (Figure 6E),

decreased the numbers of neutrophils in BAL (Figure 6F) and

lungs (Figure 6G) associated with lower expression of Mpo and

Cxcl2 (Figure 6H). IL-37 also decreased the expression Il1b,

Il17a, Il4 and increased that of Il10 and Ifng (Figure 6I). These

data point to IL-37 as a potent regulator of inflammation during

respiratory fungal infection and allergy.

Discussion

This study is the first to show the activation of the NLRP3

inflammasome in vivo during A. fumigatus infection and its

inhibition by recombinant IL-37 precursor. Members of the

inflammasome family are key players in host defense against

Candida albicans [34–36] and control fungal opportunism and

pathogenicity [37]. Activation of NLRP3 has also been shown in

response to A. fumigatus in vitro [21], but a functional role in

infection has not been demonstrated. Here, we observed that the

activation of the NLRP3 inflammasome is associated with

increased secretion of IL-1b and chemokines that mediate

neutrophil recruitment into the lung. Although neutrophils serve

potent antifungal effector function [38], in conditions of non-

resolving inflammatory responses, neutrophils drive detrimental

inflammation. Indeed, in such settings, mice deficient in IL-1R1

are protected [22,38] and mice with hyper-functioning of IL-1bsignaling have detrimental inflammatory responses [20]. There-

fore, inflammasome activation and IL-1b secretion can drive

pathological sequelae during Aspergillus infection. Although

overexpression of IL-37 reduces IL-1beta secretion [10], the

capacity of IL-37 to inhibit NLRP3 activation and IL-1b-mediated

chemokine production described here impacts directly on inflam-

matory cell recruitment in the lung and on the Th balance. IL-37

decreased tissue damage during infection, a finding suggesting that

regulation of inflammatory cell recruitment is essential to maintain

normal tissue function. The ability to limit inflammatory cell

recruitment was also observed in response to LPS, a finding

consistent with the ability of IL-37 to reduce LPS-induced pro-

inflammatory cytokine expression [10] and further pointing to a

protective effect for IL-37 in respiratory infections.

The immunomodulatory action of IL-37 appears to occur at the

level of myeloid cells, likely bone marrow-recruited macrophages

and neutrophils, whose transcriptional program in response to

conidia was indeed modified in the presence of recombinant IL-

37. IL-37 increased Nos2 gene expression, a finding that may

suggest an impairment of the fungicidal activity of effector

phagocytes by IL-37. However, we did not observe decreased

phagocytic capacity or impaired fungicidal activity of phagocytes

in vitro in the presence of IL-37. IL-37 increased the expression of

b-defensins and cathelicidin, which may play a role in antifungal

Figure 1. IL-37 reduces inflammatory cell recruitment in mice with inflammatory aspergillosis. C57BL/6 mice were infected intranasally(in) with A. fumigatus and pretreated one time with different doses IL-37 administered intraperitoneally (ip) at different times before the infection.Mice were assessed for: (A) fungal growth (Log10 CFU, mean6SD) in the lungs at 1 and 3 days post-infection (dpi); (B) BAL fluid morphometry[number of total (T) cells and polymorphonuclear neutrophils (P) upon May Grunwald Giemsa staining. Values represent the mean6SD of three miceper group and are representative of 3 independent experiments]; (C) lung histology (periodic acid-Schiff and, in the inset, TUNEL staining). Redarrows indicate PMN and white arrows indicate increased deposition of DNA on lung parenchyma (in TUNEL-stained sections). Scale bars, 25 mm; (D)myeloperoxidase (Mpo), Cxcl1 and Cxcl2 mRNA expression by RT-PCR on total lung cells; (E) lung histology (periodic acid-Schiff staining, scale bars,25 mm) and (F) Mpo, Cxcl1 and Cxcl2 mRNA expression (RT-PCR on total lung cells) in mice pretreated with IL-37 given ip or in, at different hoursbefore the infection. (G) Numbers of CD11b/Gr1–positive cells were assessed by flow cytometry of total lung cells from LPS-treated mice. Data arerepresentative (histology) or pooled from three experiments. *P,0.05,**P,0.01, treated vs untreated (None) mice. Naıve, uninfected and untreatedmice.doi:10.1371/journal.ppat.1004462.g001



host defense [39], but the contribution of these peptides to the

control of fungal growth by IL-37 is presently unknown.

Regardless of the specific downstream signaling pathways

mediating the effects of IL-37, TIR8/SIGIRR is required. The

Toll IL-1 Receptor (TIR) domain of SIGIRR has two mutations

which likely act as decoys for MyD88 activation for IL-1 as well as

TLR signaling. TIR-8 inhibits signaling receptor complexes of IL-

1 family members associated with Th1 (IL-18), Th2 (IL-33) and

Figure 2. IL-37 impairs inflammasome activation in mice with aspergillosis. C57BL/6 mice were infected intranasally with A. fumigatus andtreated intraperitoneally with recombinant IL-37 precursor, at the indicated doses, 96, 48 and 1 hour before the infection. (A) NLRP3 expression in thelung by immunofluorescence staining with anti-CIAS1/Nlrp3 antibody. In the insets, positive staining of epithelial cells. Nuclei were counterstainedwith DAPI. Scale bars, 100 mm. (B, E) Gene expression on total lung cells by RT-PCR. (C) Cytokine production (ELISA) on lung homogenates. (D)Immunoblot analysis on whole lung lysates of IL-1b and Caspase 1 using rabbit specific antibodies and rabbit anti-actin. Goat anti-rabbit IgG-HRPwere used as secondary antibody. Corresponding pixel density ratio was normalized against actin. Assays were done a day after the infection. Dataare representative (immunoblotting) or pooled from three experiments. *P,0.05, **P,0.01, treated vs untreated (None) mice. Naıve, uninfected anduntreated mice.doi:10.1371/journal.ppat.1004462.g002



Th17 (IL-1) and induces tolerogenic responses [40]. Thus, TIR-8/

SIGIRR emerges as a non-redundant receptor for dampening

inflammation and tissue damage in respiratory infections [20,40].

In fungal infections, signaling through TIR-8/SIGIRR was

required for the prevention of lethal inflammatory pathology

associated with disregulated IL-1-dependent Th17 responses

[20,41].

Little is known about the interaction between TIR-8/SIGIRR

and other members of the superfamily [42]. IL-37b may recruit

TIR8/SIGIRR to activate the anti-inflammatory pathway [11].

Our study clearly shows that TIR-8/SIGIRR is involved in the

anti-inflammatory activity of IL-37, but the molecular mechanisms

of this interaction remains to be fully elucidated.

In the era in which damage control more than pathogen control

has been suggested to provide new approaches for the treatment of

infections and other diseases [43], our study seems to qualify IL-37

as an endogenous mediator of tissue tolerance during acute

Aspergillus infection, likely including that occurring in the setting

of neutrophil recovery. Moreover, the ability of IL-37 to also affect

the development of adaptive immunity may suggest that recom-

binant IL-37 could be of benefit in conditions of non-resolving

detrimental inflammation during acute Aspergillus infection but

also fungal allergy.

Materials and Methods

Ethics statementMurine experiments were performed according to the Italian

Approved Animal Welfare Assurance A-3143-01 and Legislative

decree protocol number 245/2011-B regarding the animal license

obtained by the Italian Ministry of Health lasting for three years

(2011–2014). Infections were performed under avertin anesthesia

and all efforts were made to minimize suffering. The experimental

protocol was designed in conformity with the recommendations of

the European Economic Community (86/609/CEE) for the care

and the use of laboratory animals, was in agreement with the

Good Laboratory Practices and was approved by the animal care

Committee of the University of Perugia (Perugia, Italy).

MiceSix to eight-week C57BL/6 (wild-type) female mice were

purchased from Charles River (Calco, Italy). Genetically engi-

neered homozygous Cftr2/2 mice [44] were bred at the Cystic

Fibrosis core animal facility at San Raffaele Hospital, Milan, Italy.

Tir82/2 mice were raised on a 129/Sv and C57BL/6J mixed

genetic background. Il102/2 mice were bred at the Animal

Facility of the University of Perugia, Perugia, Italy. Nlrp32/2 mice

were obtained from Francis Derouet, Universite de Lausanne,

Switzerland.

Recombinant human IL-37Full-length human IL-37 precursor with amino acids 1–218 (IL-

37B isoform), was inserted in pCACTUS with a chicken beta actin

promoter and N-terminal 6-histidines. After expression in E. coli,the recombinant molecule was purified on Talon followed by

FPLC size exclusion. The peak isolated from the FPLC was

applied to a C6 HPLC column and the IL-37 peak eluted in

acetonitrile, isolated and lyophilized. The lyophilized IL-37 was

reconstituted in PBS. On silver PAGE, recombinant IL-37 appears

as a single band with a MW of 34 kDa.

Fungal infection, allergy and treatmentViable conidia from the A. fumigatus Af293 strain were

obtained as described [30]. Mice were anesthetized in a plastic

cage by inhalation of 3% isoflurane (Forane Abbot) in oxygen

before intranasal instillation of 26107 resting conidia/20 ml saline.

Recombinant human IL-37 was given intraperitoneally at different

times (96, 48 and 1 hour) and at different concentrations (1000,

100, 10 and 1 ng/mouse) before the infection. Controls received

the diluent alone. Mice were monitored for cell recruitment in the

bronchoalveolar lavage fluid (BAL), histopathological analysis and

Figure 3. NLRP3-deficient mice exhibit reduced neutrophilrecruitment and IL-1b production in pulmonary aspergillosis.C57BL/6 and Nlrp32/2 mice were infected intranasally with A. fumigatusand treated with 1000 ng/mouse recombinant IL-37 precursor admin-istered intraperitoneally 1 hour before the infection. (A) BAL fluidmorphometry [number of total (T) cells and polymorphonuclearneutrophils (P). Values represent the mean6SD of three mice pergroup and are representative of 3 independent experiments]. (B) Lunghistology (periodic acid-Schiff staining) and cell recruitment (insets).Scale bars, 100 mm and 25 mm, respectively. Arrows indicate neutro-phils. (C) Mpo and Cxcl2 mRNA expression by RT-PCR on total lung cells.(D) IL-1b production (ELISA on lung homogenates). Assays were done 3days after the infection. Data are representative (histology) or pooledfrom three experiments. *P,0.05, Nlrp32/2 vs C57BL/6 mice andtreated vs untreated (None) mice. Naıve, uninfected and untreatedmice.doi:10.1371/journal.ppat.1004462.g003



Figure 4. IL-37 dampens inflammasome activation in phagocytic cells. Alveolar macrophages and epithelial cells from naive mice andperipheral neutrophils were pre-exposed to recombinant IL-37 precursor for 8 hours before stimulation with live Aspergillus conidia for 2 hours. (A)Percent of phagocytosis and conidiocidal activity. (B) Il1b and Nos2 mRNA expression by RT-PCR on total lung cells. Ct, control cells. None, Aspergillus-pulsed, untreated cells. (C) Activation of distinct intracellular kinases in RAW cells, using Proteome Profiler Array, pre-exposed to 100 ng/ml IL-37 for8 hours before stimulation with live Aspergillus conidia for 30 min. Data are representative (Proteome Profiler Array) or pooled from two experiments.*P,0.05,**P,0.01, ***P,0.001, IL-37-stimulated vs unstimulated cells.doi:10.1371/journal.ppat.1004462.g004



chemokine or cytokine expression and production. For allergy,

mice received an i.p. and s.c. injection of 100 mg of A. fumigatusculture filtrate extract (CCFA) dissolved in incomplete Freund’s

adjuvant (Sigma-Aldrich) followed by two consecutive intranasal

injections (a week apart) of 20 mg CCFA. A week after the last

intranasal challenge, mice received 107 Aspergillus resting conidia

and evaluated a week later [30]. IL-37 (1000 ng) was administered

in concomitance with CCFA sensitization and Aspergillusinoculation. Ultrapure LPS from Salmonella minnesota Re 595

(Sigma-Aldrich) was given intranasally at the concentration of

10 mg/mouse. For histology, paraffin-embedded tissues were

stained with Periodic acid-Schiff (PAS) and with Masson’s

trichrome staining to investigate the collagen deposition. Photo-

graphs were taken using a high- resolution Olympus DP71

microscope.

Collection of BALLungs were filled thoroughly with 1.0 ml aliquots of pyrogen-

free saline through a 22-gauge bead-tipped feeding needle

introduced into the trachea. BAL fluid was collected in a plastic

tube on ice and centrifuged at 4006 g at 4uC for 5 min. For

differential BAL fluid cell counts, cytospin preparations were

stained with May-Grunwald Giemsa reagents (Sigma-Aldrich). At

least 10 fields (200 cells/field) were counted, and the percent of

polymorphonuclear (PMN) and mononuclear (MNC) cells was

calculated [45]. Photographs were made using a high-resolution

Olympus DP71 microscope.

Terminal deoxynucleotidyl transferase-mediateddeoxyuridine triphosphate nick-end labeling (TUNEL) oflung sections

The lungs were fixed in 4% buffered paraformaldehyde,

pH 7.3, for 36 h and embedded in paraffin. Sections were de-

paraffinized, re-hydrated and treated with 0.1 M citrate buffer,

pH 6.0, for 20 min in a water bath, washed and blocked in 0.1 M

Tris/HCl buffer, pH 7.5, supplemented with 3% bovine serum

albumin and 20% FCS. The slides were then incubated with

fluorescein-coupled dUTP and TUNEL enzyme (Roche Diagnos-

tics) in the presence of terminal deoxynucleotidyl transferase. The

samples were then washed with PBS, incubated for 10 min at

70uC to remove unspecific binding. The sections were mounted

and analyzed by fluorescent microscopy using a 406 objective.

ImmunofluorescenceThe lung was removed and fixed in 10% phosphate-buffered

formalin, embedded in paraffin and sectioned at 5 mm. Sections

were then rehydrated and after antigen retrieval in citrate buffer

(10 mM, pH 6), sections were blocked with 5% BSA in PBS and

stained with goat-anti-CIAS1/Nlrp3 antibody overnight at 4uC

Figure 5. IL-37 fails to inhibit inflammasome activation in Tir82/2 mice. Tir82/2 mice were infected intranasally with A. fumigatus and treatedintraperitoneally with recombinant IL-37 precursor, at the dose of 1000 ng/mouse, 1 hour before the infection. (A) BAL fluid morphometry [numberof total (T) cells and polymorphonuclear neutrophils (P). Values represent the mean6SD of three mice per group and are representative of 3independent experiments]. (B) Lung histology (PAS-stained sections). Scale bars, 25 mm. In the insets, NLRP3 expression by immunofluorescencestaining of epithelial cells. Images were acquired using a fluorescence microscope with a 406objective. Nuclei were counterstained with DAPI. (C)Mpo and Cxcl2 mRNA expression and (D) cytokine gene expression (RT-PCR) on total lung cells. (E) Immunoblot with rabbit polyclonal IL-1b-specificantibody on whole lung lysates. Assays were done 3 days post-infection. Data are representative (histology) or pooled from two experiments. None,untreated mice. Naıve, uninfected and untreated mice.doi:10.1371/journal.ppat.1004462.g005



followed by donkey anti-goat IgG H&L (DyLight 488) secondary

antibody (both from Abcam). Images were acquired using a

fluorescence microscope (BX51 Olympus) with a 206 objective

and the analySIS image processing software (Olympus). 49-6-

Diamino-2-phenylindole (DAPI, Molecular Probes, Invitrogen)

was used to counterstain tissues and to detect nuclei.

Cell preparation, phagocytosis, conidiocidal activity andculture

Alveolar macrophages were isolated from total lung cells after 2-

hour plastic adherence at 37uC. Murine CD11b+ Gr-1+ neutro-

phils were positively selected with magnetic beads (Miltenyi

Biotech) [46] from the peritoneal cavity of uninfected wild-type

mice 8 h after the intraperitoneal injection of 1 ml endotoxin-free

10% thioglycollate solution. Endotoxin was depleted from all

solutions with Detoxi-gel (Pierce). On fluorescence-activated cell

sorting (FACS) analysis, Gr-1+ neutrophils were .98% pure and

stained positive for the CD11b myeloid marker. Lung epithelial

cells were isolated as described [39]. Cells were pre-exposed to IL-

37 for 8 hours before stimulation with live Aspergillus conidia for

2 hours for the assessment of phagocytosis, conidiocidal activity

and cytokine gene expression.

Whole proteomic RAW analysisRAW 264.7 cells (ATCC) were exposed to 100 ng/ml IL-37

precursor for 8 hours before stimulation with live Aspergillus

Figure 6. IL-37 restrains inflammation in fungal allergy and Cftr2/2 mice. (A) Lung histology (PAS- and Masson’s trichrome-stained sections,scale bars 100 and 25 (insets) mm); (B) hydroxyproline content (mg/lung); (C) expression of mucins (RT-PCR on total lung cells); (D) expression ofcytokines and Th transcription factors in total lung cells from mice with ABPA and treated with IL-37. None, untreated mice. Naıve, uninfected anduntreated mice. (E) Fungal growth (Log10 CFU, mean6SD) in the lungs of Cftr2/2 mice infected intranasally with A. fumigatus and treatedintraperitoneally with IL-37, at the dose of 1000 ng/mouse, 1 hour before the infection. (F) BAL fluid morphometry [number of total (T) cells andpolymorphonuclear neutrophils (P) upon May Grunwald Giemsa staining]. (G) Lung histology (periodic acid-Schiff staining) and cell recruitment(insets). Scale bars, 100 mm and 25 mm in the insets; (H) Mpo and Cxcl2 mRNA expression and (I) cytokine gene expression on total lung cells by RT-PCR, 3 days after the infection. Data are pooled from two experiments. *P,0.05, **P,0.01, treated vs untreated (None) mice. Naıve, uninfected anduntreated mice.doi:10.1371/journal.ppat.1004462.g006



conidia at a cell/fungi ratio of 1:1, for 30 minutes. The relative

phosphorylation of 26 Phospho-Mitogen-activated Protein Kinase

(MAPK) was performed using the Proteome ProfilerArray (R&D

Systems). Kinases were captured by 26 different antibodies spotted

in duplicate on a nitrocellulose membrane. Levels of phosphor-

ylated protein were then assessed using phospho-specific antibod-

ies and chemiluminescent detection.

Western blot analysisAn equal amount of whole lung tissue were lysed in 26Laemli

buffer and separated in 14% Tris/glicine SDS gel, transferred to a

nitrocellulose membrane, probed with rabbit anti-mouse IL-1b(Biolegend) or rabbit anti-caspase-1-p10 (Santa Cruz). Goat anti-

rabbit IgG-HRP (Sigma-Aldrich) was used as secondary antibod-

ies. Normalization was performed on rabbit anti-actin antibody

(Santa Cruz) and quantification was obtained by densitometric

image analysis using Image Lab 3.1.1 software (Bio-Rad) as

previously described [47].

Flow cytometry analysisAll staining reactions were performed at 4uC on cells first

exposed to Fc receptor mAb (2.4G2) in order to reduce nonspecific

binding. Anti CD11b (M1/70) and anti-CD11c (N418) were

purchased from BD Biosciences-Pharmingen. Cells were analyzed

with a BD LSRFortessa flow cytometer (BD) equipped with BD

FACSDiva 7.0 software.

ELISA and real-time PCRThe levels of cytokines in lung homogenates were determined

by mouse ELISAs (R&D Systems). The detection limits of the

ELISAs were less than 3 pg/ml for IL-10 and 5 pg/ml for IL-1b,

respectively. Real-time RT-PCR was performed using the

Stratagene Mx3000P QPCR System and SYBR Green chemistry

(Stratagene). Cells were lysed and total RNA was reverse

transcribed with cDNA Synthesis Kit (BioRad), according to the

manufacturer’s instructions. The PCR primers were as listed in

Table 1. Amplification efficiencies were validated and normalized

against GAPDH. The thermal profile for SYBR Green real-time

PCR was at 95uC for 3 min, followed by 40 cycles of denaturation

for 30 s at 95uC and an annealing/extension step of 30 sec at

60uC. Each data point was examined for integrity by analysis of

the amplification plot. The mRNA-normalized data were

expressed as relative gene mRNA in treated compared to

untreated experimental groups or cells.

Hydroxyproline assayThe total collagen content of the lung tissue was measured

spectrophotometrically by absorbance at 560 nm to quantify the

lung hydroxyproline content 7 days after infection. Briefly, the

minced lung lobes were homogenized in dH2O, using 100 ml H2O

for every 10 mg of tissue. To a 100 ml of sample homogenates, add

100 ml concentrated 12 N HCl in a pressure-tight, teflon capped

vial and hydrolyze at 120uC for 3 hours. After reaction with

Chloramine T reagent (incubate at room temperature for 5 min)

and DMAB reagent (incubate for 90 min at 60uC), the absorbance

was measured at 560 nm. The results were expressed as mg

hydroxyproline per mg of wet lung weight using a standard curve

(0,1 mg/ml) (BioVision).

Statistical analysisData are expressed as mean 6 SD. Horizontal bars indicate the

means. For multiple comparisons, p values were calculated by a

one-way ANOVA (Bonferroni’s post hoc test). For single

comparison, p values were calculated by a twotailed Student’s t

test. The data reported are either from one representative

experiment (histology, TUNEL and western blotting) or pooled

otherwise. The in vivo groups consisted of 4–6 mice/group. Data

Table 1. Real-time murine PCR primers used in this study.

Gene name Primer sequence

Mpo Forward, 59-TTACACCCCAGGCATAAAAA-39

Reverse, 59-TTCCATACAGCTCAGCACAA-39

Cxcl1 Forward, 59-CCGCTCGCTTCTCTGTGC-39

Reverse, 59-CTCTGGATGTTCTTGAGGTGAATC-39

Cxcl2 Forward, 59-CCAACCACCAGGCTACAG-39

Reverse, 59-CTTCAGGGTCAAGGCAAAC-39

Gata3 Forward, 59-TCTGGAGGAGGAACGCTAATG-39

Reverse, 59-GGCTGGAGTGGCTGAAGG-39

Rorc Forward, 59-ACAACAGCAGCAAGTGATGG-39

Reverse, 59-CCTGGATTTATCCCTGCTGA-39

Tnfa Forward, 59-CGAGTGACAAGCCTGTAGCC-39

Reverse, 59-AAGAGAACCTGGGAGTAGACAAG-39

IL6 Forward, 59-CCGGAGAGGAGACTTCACAG-39

Reverse, 59-TCCACGATTTCCCAGAGAAC-39

Ifng Forward, 59-ACTGGCAAAAGGATGGTGAC-39

Reverse, 59-TGAGCTCATTGAATGCTTGG-39

Il17a Forward, 59-GACTACCTCAACCGTTCCAC-39

Reverse, 59-CCTCCGCATTGACACAGC-39

Il4 Forward, 59-CGGCATTTTGAACGAGGTCACAGG-39

Reverse, 59-AGCACCTTGGAAGCCCTACAGACG-39

Il10 Forward, 59-CCCTTTGCTATGGTGTCCTT-39

Reverse, 59-TGGTTTCTCTTCCCAAGACC-39

Nalp3 Forward, 59-ATGCTGCTTCGACATCTCCT-39

Reverse, 59-GTTTCTGGAGGTTGCAGAGC-39

Il1b Forward, 59-TGACGGACCCCAAAAGATGAAGG-39

Reverse, 59-CCACGGGAAAGACACAGGTAGC-39

Il1a Forward, 59-CTGCAGTCCATAACCCAT-39

Reverse, 59-TGACAAACTTCTGCCTGACG-39

Il1ra Forward, 59-TTGTGCCAAGTCTGGAGATG-39

Reverse, 59-CAGCTGACTCAAAGCTGGTG-39

p47 Forward, 59- TAGAGACTCCTCCCATGCCT -39

Reverse, 59- CACTGCCTCCTCTCATGCTA -39

p67 Forward, 59- CTATCTGGGCAAGGCTACGGTT -39

Reverse, 59- CACAAAGCCAAACAATACGCG -39

gp91 Forward, 59-AAAGGAGTGCCCAGTACCAAAGT-39

Reverse, 59-TACAGGAACATGGGACCCACTAT-39

Nos2 Forward, 59-GGACACTGCCGCCAACATCTAC-39

Reverse, 59-CACCCAAAGTGCTTCAGTCA-39

Muc1 Forward, 59-TGAGCCAGGACTTCTGGTAG-39

Reverse, 59-CCTTCTGAGAGCCACCACTA-39

Muc5ac Forward, 59-CTGGACCTGGAGGTTGTATG-39

Reverse, 59-CAGTAGTGAGGGTTGGATGG-39

Muc13 Forward, 59-ACATGGTGAAGGGTCAAGAA-39

Reverse, 59-AGATGAACTACCCACGGTCA-39

doi:10.1371/journal.ppat.1004462.t001



were analyzed by GraphPad Prism 4.03 program (GraphPad

Software).

Supporting Information

Figure S1 IL-37 reduces inflammation when adminis-tered after the infection. C57BL/6 mice were infected

intranasally with A. fumigatus and treated with 1000 ng/mouse

IL-37 administered intraperitoneally for 3 consecutive days

starting the day of the infection. Mice were assessed for: (A)

number of total (T) cells and polymorphonuclear neutrophils (P) in

the BAL. Values represent the mean6SD of three mice per group

and are representative of 2 independent experiments; (B) lung

histology (periodic acid-Schiff staining) and cell recruitment

(insets). Scale bars, 100 mm and 25 mm in the insets; (C)

myeloperoxidase (Mpo) and Cxcl2 mRNA expression by RT-

PCR on total lung cells. Assays were done a day after the last

treatment. *P,0.05,**P,0.01, treated vs untreated (None) mice.

Naıve, uninfected and untreated mice.

(TIF)

Figure S2 The anti-inflammatory activity of IL-37 in notdependent on IL-10. Il102/2 mice were infected intranasally

with A. fumigatus and treated with 1000 ng/mouse IL-37

administered intraperitoneally 1 h before the infection. Mice were

assessed for: (A) number of total (T) cells and polymorphonuclear

neutrophils (P) in the BAL. Values represent the mean6SD of

three mice per group and are representative of 3 independent

experiments; (B) lung histology (periodic acid-Schiff staining) and

cell recruitment (insets). Scale bars, 100 mm and 25 mm in the

insets. Assays were done a day after the infection. *P,0.05, treated

vs untreated (None) mice. Naıve, uninfected and untreated mice.

(TIF)

Author Contributions

Conceived and designed the experiments: FLvdV CAD LR. Performed the

experiments: SB SM GR MP AC VO RGI. Analyzed the data: FLvdV

CAD LR. Contributed reagents/materials/analysis tools: CG SK SL.

Wrote the paper: FLvdV CAD LR. Provided mice and gave conceptual

advice: CG. Provided the recombinant IL-37 as well as analyzing data: SK

SL.

References

1. Dinarello C, Arend W, Sims J, Smith D, Blumberg H, et al. (2010) IL-1 family

nomenclature. Nat Immunol 11: 973.

2. Busfield SJ, Comrack CA, Yu G, Chickering TW, Smutko JS, et al. (2000)

Identification and gene organization of three novel members of the IL-1 familyon human chromosome 2. Genomics 66: 213–216.

3. Taylor SL, Renshaw BR, Garka KE, Smith DE, Sims JE (2002) Genomic

organization of the interleukin-1 locus. Genomics 79: 726–733.

4. Bufler P, Gamboni-Robertson F, Azam T, Kim SH, Dinarello CA (2004)

Interleukin-1 homologues IL-1F7b and IL-18 contain functional mRNA

instability elements within the coding region responsive to lipopolysaccharide.

Biochem J 381: 503–510.

5. Dinarello CA, Bufler P (2013) Interleukin-37. Semin Immunol 25: 466–468.

6. Kumar S, Hanning CR, Brigham-Burke MR, Rieman DJ, Lehr R, et al. (2002)

Interleukin-1F7B (IL-1H4/IL-1F7) is processed by caspase-1 and mature IL-

1F7B binds to the IL-18 receptor but does not induce IFN-gamma production.

Cytokine 18: 61–71.

7. Bufler P, Azam T, Gamboni-Robertson F, Reznikov LL, Kumar S, et al. (2002)

A complex of the IL-1 homologue IL-1F7b and IL-18-binding protein reduces

IL-18 activity. Proc Natl Acad Sci U S A 99: 13723–13728.

8. Sharma S, Kulk N, Nold MF, Graf R, Kim SH, et al. (2008) The IL-1 familymember 7b translocates to the nucleus and down-regulates proinflammatory

cytokines. J Immunol 180: 5477–5482.

9. Zuhdi Alimam M, Piazza FM, Selby DM, Letwin N, Huang L, et al. (2000)

Muc-5/5ac mucin messenger RNA and protein expression is a marker of goblet

cell metaplasia in murine airways. Am J Respir Cell Mol Biol 22: 253–260.

10. Bulau AM, Nold MF, Li S, Petry-Nold CA, Fink M, et al. (2014) The role of

caspase 1 in the processing of IL 37 for nuclear translocation, release of the

cytokine and the ability of IL 37 to inhibit innate immune responses. Proc Natl

Acad Sci U S A 111: 2650–2655.

11. Nold MF, Nold-Petry CA, Zepp JA, Palmer BE, Bufler P, et al. (2010) IL-37 is a

fundamental inhibitor of innate immunity. Nat Immunol 11: 1014–1022.

12. Boraschi D, Lucchesi D, Hainzl S, Leitner M, Maier E, et al. (2011) IL-37: a new

anti-inflammatory cytokine of the IL-1 family. Eur Cytokine Netw 22: 127–147.

13. Imaeda H, Takahashi K, Fujimoto T, Kasumi E, Ban H, et al. (2013) Epithelial

expression of interleukin-37b in inflammatory bowel disease. Clin Exp Immunol

172: 410–416.

14. McNamee EN, Masterson JC, Jedlicka P, McManus M, Grenz A, et al. (2011)Interleukin 37 expression protects mice from colitis. Proc Natl Acad Sci U S A

108: 16711–16716.

15. Bulau AM, Fink M, Maucksch C, Kappler R, Mayr D, et al. (2011) In vivo

expression of interleukin-37 reduces local and systemic inflammation in

concanavalin A-induced hepatitis. ScientificWorldJournal 11: 2480–2490.

16. Banchereau J, Pascual V, O’Garra A (2012) From IL-2 to IL-37: the expanding

spectrum of anti-inflammatory cytokines. Nat Immunol 13: 925–931.

17. Romani L (2011) Immunity to fungal infections. Nat Rev Immunol 11: 275–288.

18. Sainz J, Perez E, Gomez-Lopera S, Jurado M (2008) IL1 gene cluster

polymorphisms and its haplotypes may predict the risk to develop invasive

pulmonary aspergillosis and modulate C-reactive protein level. J Clin Immunol

28: 473–485.

19. Brieland JK, Jackson C, Menzel F, Loebenberg D, Cacciapuoti A, et al. (2001)

Cytokine networking in lungs of immunocompetent mice in response to inhaled

Aspergillus fumigatus. Infect Immun 69: 1554–1560.

20. Warris A, Netea MG, Verweij PE, Gaustad P, Kullberg BJ, et al. (2005)

Cytokine responses and regulation of interferon-gamma release by human

mononuclear cells to Aspergillus fumigatus and other filamentous fungi. MedMycol 43: 613–621.

21. Bozza S, Zelante T, Moretti S, Bonifazi P, DeLuca A, et al. (2008) Lack of Toll

IL-1R8 exacerbates Th17 cell responses in fungal infection. J Immunol 180:

4022–4031.22. Said-Sadier N, Padilla E, Langsley G, Ojcius DM (2010) Aspergillus fumigatus

stimulates the NLRP3 inflammasome through a pathway requiring ROS

production and the Syk tyrosine kinase. PLoS One 5: e10008.23. de Luca A, Bozza S, Zelante T, Zagarella S, D’Angelo C, et al. (2010) Non-

hematopoietic cells contribute to protective tolerance to Aspergillus fumigatusvia a TRIF pathway converging on IDO. Cell Mol Immunol 7: 459–470.

24. Zielinski CE, Mele F, Aschenbrenner D, Jarrossay D, Ronchi F, et al. (2012)

Pathogen-induced human TH17 cells produce IFN-gamma or IL-10 and are

regulated by IL-1beta. Nature 484: 514–518.25. Mehrad B, Strieter RM, Moore TA, Tsai WC, Lira SA, et al. (1999) CXC

chemokine receptor-2 ligands are necessary components of neutrophil-mediated

host defense in invasive pulmonary aspergillosis. J Immunol 163: 6086–6094.

26. Loeffler J, Ok M, Morton OC, Mezger M, Einsele H (2010) Geneticpolymorphisms in the cytokine and chemokine system: their possible importance

in allogeneic stem cell transplantation. Curr Top Microbiol Immunol 341: 83–96.

27. Petrasek J, Bala S, Csak T, Lippai D, Kodys K, et al. (2012) IL-1 receptor

antagonist ameliorates inflammasome-dependent alcoholic steatohepatitis inmice. J Clin Invest 122: 3476–3489.

28. Mao K, Chen S, Chen M, Ma Y, Wang Y, et al. (2013) Nitric oxide suppresses

NLRP3 inflammasome activation and protects against LPS-induced septicshock. Cell Res 23: 201–212.

29. Jianjun Y, Zhang R, Lu G, Shen Y, Peng L, et al. (2013) T cell-derived inducible

nitric oxide synthase switches off Th17 cell differentiation. J Exp Med 210:1447–1462.

30. Bonifazi P, D’Angelo C, Zagarella S, Zelante T, Bozza S, et al. (2010)

Intranasally delivered siRNA targeting PI3K/Akt/mTOR inflammatorypathways protects from aspergillosis. Mucosal Immunol 3: 193–205.

31. Dinarello CA, Bufler P (2013) Interleukin-37. Semin Immunol 25: 466–468.

32. Bragonzi A (2010) Murine models of acute and chronic lung infection with cystic

fibrosis pathogens. Int J Med Microbiol 300: 584–593.

33. Cohen TS, Prince A (2012) Cystic fibrosis: a mucosal immunodeficiencysyndrome. Nat Med 18: 509–519.

34. Iannitti RG, Carvalho A, Cunha C, De Luca A, Giovannini G, et al. (2013)

Th17/Treg imbalance in murine cystic fibrosis is linked to indoleamine 2,3-dioxygenase deficiency but corrected by kynurenines. Am J Respir Crit Care

Med 187: 609–620.

35. Gross O, Poeck H, Bscheider M, Dostert C, Hannesschlager N, et al. (2009) Sykkinase signalling couples to the Nlrp3 inflammasome for anti-fungal host

defence. Nature 459: 433–436.

36. Joly S, Ma N, Sadler JJ, Soll DR, Cassel SL, et al. (2009) Cutting edge: Candidaalbicans hyphae formation triggers activation of the Nlrp3 inflammasome.

J Immunol 183: 3578–3581.

37. Tomalka J, Ganesan S, Azodi E, Patel K, Majmudar P, et al. (2011) A novel rolefor the NLRC4 inflammasome in mucosal defenses against the fungal pathogen

Candida albicans. PLoS Pathog 7: e1002379.

38. Cheng SC, van de Veerdonk FL, Lenardon M, Stoffels M, Plantinga T, et al.(2011) The dectin-1/inflammasome pathway is responsible for the induction of

protective T-helper 17 responses that discriminate between yeasts and hyphae of

Candida albicans. J Leukoc Biol 90: 357–366.



39. Bellocchio S, Montagnoli C, Bozza S, Gaziano R, Rossi G, et al. (2004) The

contribution of the Toll-like/IL-1 receptor superfamily to innate and adaptiveimmunity to fungal pathogens in vivo. J Immunol 172: 3059–3069.

40. D’Angelo C, De Luca A, Zelante T, Bonifazi P, Moretti S, et al. (2009)

Exogenous pentraxin 3 restores antifungal resistance and restrains inflammationin murine chronic granulomatous disease. J Immunol 183: 4609–4618.

41. Villena J, Suzuki R, Fujie H, Chiba E, Takahashi T, et al. (2012) ImmunobioticLactobacillus jensenii modulates the Toll-like receptor 4-induced inflammatory

response via negative regulation in porcine antigen-presenting cells. Clin

Vaccine Immunol 19: 1038–1053.42. Zelante T, De Luca A, Bonifazi P, Montagnoli C, Bozza S, et al. (2007) IL-23

and the Th17 pathway promote inflammation and impair antifungal immuneresistance. Eur J Immunol 37: 2695–2706.

43. Riva F, Bonavita E, Barbati E, Muzio M, Mantovani A, et al. (2012) TIR8/

SIGIRR is an Interleukin-1 Receptor/Toll Like Receptor Family Member withRegulatory Functions in Inflammation and Immunity. Front Immunol 3: 322.

44. Ayres JS, Schneider DS (2012) Tolerance of infections. Annu Rev Immunol 30:

271–294.45. Zhou L, Dey CR, Wert SE, DuVall MD, Frizzell RA, et al. (1994) Correction of

lethal intestinal defect in a mouse model of cystic fibrosis by human CFTR.Science 266: 1705–1708.

46. Sorci G, Giovannini G, Riuzzi F, Bonifazi P, Zelante T, et al. (2011) The danger

signal S100B integrates pathogen- and danger-sensing pathways to restraininflammation. PLoS Pathog 7: e1001315.

47. Bellocchio S, Moretti S, Perruccio K, Fallarino F, Bozza S, et al. (2004) TLRsgovern neutrophil activity in aspergillosis. J Immunol 173: 7406–7415.



IL-37 Inhibits Inflammasome Activation and Disease ... · IL-37 Inhibits Inflammasome Activation...

Documents

Transcript of IL-37 Inhibits Inflammasome Activation and Disease ... · IL-37 Inhibits Inflammasome Activation...