APPLIED AND ENVIRONMENTAL MICROBIOLOGY,0099-2240/97/$04.0010

July 1997, p. 2716–2721 Vol. 63, No. 7

Copyright © 1997, American Society for Microbiology

Identification and Characterization of a Previously Undescribedcyt Gene in Bacillus thuringiensis subsp. israelensis

ALEJANDRA GUERCHICOFF, RODOLFO A. UGALDE, AND CLARA P. RUBINSTEIN*

Instituto de Investigaciones Bioquımicas F. Leloir, Fundacion Campomar,1405 Capital Federal, Argentina

Received 21 November 1996/Accepted 20 April 1997

Mosquitocidal Bacillus thuringiensis strains show as a common feature the presence of toxic proteins withcytolytic and hemolytic activities, Cyt1Aa1 being the characteristic cytolytic toxin of Bacillus thuringiensis subsp.israelensis. We have detected the presence of another cyt gene in this subspecies, highly homologous to cyt2Aa1,coding for the 29-kDa cytolytic toxin from B. thuringiensis subsp. kyushuensis. This gene, designated cyt2Ba1,maps upstream of cry4B coding for the 130-kDa crystal toxin, on the 72-MDa plasmid of strain 4Q2-72.Sequence analysis revealed, as a remarkable feature, a 5* mRNA stabilizing region similar to those describedfor some cry genes. PCR amplification and Southern analysis confirmed the presence of this gene in othermosquitocidal subspecies. Interestingly, anticoleopteran B. thuringiensis subsp. tenebrionis belonging to themorrisoni serovar also showed this gene. On the other hand, negative results were obtained with the anti-lepidopteran strains B. thuringiensis subsp. kurstaki HD-1 and subsp. aizawai HD-137. Western analysis failedto reveal Cyt2A-related polypeptides in B. thuringiensis subsp. israelensis 4Q2-72. However, B. thuringiensissubsp. israelensis 1884 and B. thuringiensis subsp. tenebrionis did show cross-reactive products, although in verysmall amounts.

Bacillus thuringiensis mosquitocidal strains produce paraspo-ral inclusions that are composed of several toxic polypeptideswhich fall into two classes: Cry and Cyt, that act together toeffect the larvicidal activity of the parasporal crystal (23). In B.thuringiensis subsp. israelensis, three major antidipteran toxinsranging from 68 to 135 kDa (Cry4A, Cry4B, and Cry11A in thenew nomenclature) contribute to the overall toxicity of intactcrystals in a synergistic manner (5, 9, 25). Cyt toxins are he-molytic and cytolytic in vitro and are specifically active againstdipteran larvae in vivo (20, 35); they are smaller than Crypolypeptides (25 to 28 kDa), and three types have been definedaccording to immunoreactivity. Cyt1 (former CytA) hemo-lysins are characteristic of B. thuringiensis subsp. israelensis andsubsp. morrisoni PG14 (16, 33). Cyt2 (former CytB) is found inthe inclusions of B. thuringiensis subsp. darmstadiensis 73-E10-2(20) and subsp. kyushuensis (21), and CytC is representative ofsubsp. fukuokaensis (35). A new type, CytD, has been recentlyproposed for B. thuringiensis subsp. jegathesan (18). They donot share homology with Cry toxins, but both types wouldshare a common cytolytic mechanism involving colloid-osmoticlysis (19); however, the actual mechanism of pore formationbetween the Cry and Cyt toxins might be different (9). BothCyt1A and Cyt2A have been shown to form cation-selectivechannels, and although they have a broad cytolytic activity invitro, it has been suggested that an insect-specific receptor maybe essential for these toxins to be active in vivo (22, 32). Thiscould explain the high specificity of Cyt toxins against dipteranlarvae.

Molecular homologies between different mosquitocidal B.thuringiensis strains have been established at the protein as wellas the DNA level (29). According to these studies, B. thurin-giensis subsp. israelensis and B. thuringiensis subsp. morrisoni

PG14 have the highest similarity between their toxin comple-ments. In fact, their Cyt1Aa hemolysins were found to differonly in one amino acid residue (14). Although lower homolo-gies were detected with other mosquitocidal subspecies, Cyt2Aa1from B. thuringiensis subsp. kyushuensis showed 39% identity(and 70% functional homology) with Cyt1Aa1 from B. thurin-giensis subsp. israelensis (22). A new variant (Cyt1Aab1) wasrecently described for B. thuringiensis subsp. medellin (serotypeH30) which is 86% identical to Cyt1Aa1 from B. thuringiensissubsp. israelensis (31).

We report the detection and characterization of a cyt2 vari-ant in B. thuringiensis subsp. israelensis that is highly homolo-gous to cyt2Aa1 from B. thuringiensis subsp. kyushuensis.

MATERIALS AND METHODS

Strains, plasmids, and media. B. thuringiensis strains and plasmids used in thiswork are listed in Table 1. Escherichia coli DH5a was used for plasmid construc-tion and propagation (15). B. thuringiensis strains were maintained in sporulationSchaeffer’s agar medium (28) and grown in Luria-Bertani medium (24) for DNAisolation. Liquid cultures were grown with aeration (shaking) at 37°C (E. coli) or30°C (B. thuringiensis). When appropriate, ampicillin was added to autoclavedmedia at 100 mg/ml.

DNA manipulations. Restriction enzymes and T4 DNA ligase (Gibco BRL)were used as recommended by the manufacturers. DNA restriction fragments orPCR-amplified fragments were purified from agarose gels with a Gene Clean kit(Bio 101). Plasmids from E. coli were prepared as described by Birnboim andDoly (6). Plasmid DNA was isolated from B. thuringiensis strains as described inreference 7 and further purified by Qiagen columns (DIAGEN GmbH, QIA-GEN Inc.).

DNA sequencing. DNA sequences were determined on double-stranded DNAby the chain termination method (27) after subcloning of the 1.4-kb HindIII-EcoRI insert from pRX80 into pUC19 and also directly from pRX80. TheSequenase version 2.0 DNA sequencing kit (Amersham, Cleveland, Ohio) wasused with the pUC commercial primers M13/pUC sequencing primer (240) andM13/pUC reverse sequencing primer (224) (New England Biolabs, Inc). Inter-nal primers were designed according to the cyt2Ba1 gene (Gibco BRL).

PCR conditions. Twenty to 50 ng of purified plasmid DNA was added to thePCR mixtures (0.2 mM deoxynucleoside triphosphates, 2 mM MgCl2, 0.5 U ofTaq polymerase [Promega], 100 ng of PCR primers) in a final volume of 50 ml.The oligonucleotide primers were as follows: upper, 59AATACATTTCAAGGAGCTA39; lower, 59TTTCATTTTAACTTCATATC39. Amplification was per-formed in a thermal cycler (M.J. Research Minicycler PTC100) by using a singledenaturation step (3 min at 94°C), followed by a 35-cycle program, with each

* Corresponding author. Mailing address: Instituto de Investigacio-nes Bioquımicas F. Leloir, Fundacıon Campomar, Av. Patricias Ar-gentinas 435, 1405 Capital Federal, Argentina. Phone: 54-1-8634015.Fax: 54-1-8652246.

2716

on June 1, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

cycle consisting of denaturation at 94°C for 45 s, annealing at 42°C for 45 s, andextension at 72°C for 1 min; a final extension step of 72°C for 5 min was alsoincluded. Twenty-microliter samples from each PCR mixture were electropho-resed on 1.5% agarose gels in 0.53 Tris-acetate buffer at 100 V for 30 to 35 minand stained with ethidium bromide.

Southern blotting. B. thuringiensis plasmid DNAs digested with EcoRI orHindIII were separated by electrophoresis in a 0.8% agarose gel and transferredby capillarity to nitrocellulose filters (24). Hybridization was performed over-night with a radiolabelled probe at 56°C in a solution containing 0.5% sodiumdodecyl sulfate (SDS), 53 Denhart’s solution, 100 mg of salmon sperm DNA perml, and 63 SSC (13 SSC is 150 mM NaCl plus 15 mM sodium citrate [pH 7.0]).Filters were washed at room temperature with two changes of 0.2% SDS and 33SSC and then once with 0.5% SDS–13 SSC, before exposure to Fuji XR film at270°C with an X-ray intensifier.

Protein analysis. B. thuringiensis strains were grown in Schaeffer’s liquid sporu-lation medium (28) until lysis. Spore-crystal mixtures from 10-ml culture sampleswere harvested by centrifugation at 12,000 3 g for 20 min and then washed oncein 1 M NaCl–2 mM phenylmethylsulfonyl fluoride–10 mM EDTA. Pellets wereresuspended in sample buffer (24) supplemented with phenylmethylsulfonyl flu-oride and EDTA as described before, boiled for 10 min, and subjected toSDS–15% polyacrylamide gel electrophoresis. Protein concentrations were de-termined by the Bradford assay (Bio-Rad) on solubilized samples (26). Proteinswere electrotransferred to nitrocellulose membranes and detected immunolog-ically according to the method of Koni and Ellar (22), with the following mod-ifications: incubation with the anti-Cyt2 antiserum (kindly provided by DavidEllar, University of Cambridge) was performed at room temperature for 1 h andthen overnight at 4°C. The antiserum was added at a 1:500 dilution. The GibcoBRL detection system (biotinylated second antibody, streptavidin-alkaline phos-phatase, nitroblue tetrazolium–5-bromo-4-chloro-3-indolylphosphate toluidinium)was used as recommended by the manufacturer.

RNA extraction and RT-PCR. B. thuringiensis strains were cultured in Schaef-fer’s medium at 30°C with shaking. Samples were taken at around t3 (t0 is definedas the onset of sporulation, and tn indicates the number of hours after t0). Cellswere harvested by centrifugation and then resuspended in 10 ml of protoplastingbuffer (15 mM Tris-HCl [pH 8], 8 mM EDTA, 0.45 mM sucrose) and 0.4 mg oflysozyme per ml. The homogenized samples were incubated for 15 min in ice,centrifuged for 5 min at 7,000 rpm at 4°C, and resuspended in 0.5 ml of lysisbuffer (10 mM Tris-HCl [pH 8.0], 10 mM NaCl, 1 mM sodium citrate, 1.5% SDS)in the presence of diethylpyrocarbonate. After 5 min in ice, 55 ml of 2 M sodiumacetate (pH 4.0) was added before the addition of 500 ml of water-equilibratedphenol-chloroform (1:1). Phases were separated by centrifugation, and the aque-ous phase was recovered. RNAs were precipitated from the aqueous phase bymixing with isopropyl alcohol, followed by incubation at 220°C for 30 min andcentrifugation at no more than 12,000 3 g for 20 min at 4°C. Single-strandedcDNA synthesis was performed as described in reference 13 with the lower PCRprimer for the reverse transcription (RT) step. Aliquots (1/10 of the single-stranded DNA-cDNA mixture) were used for PCRs without further purification.The amplification conditions were as described above.

Computer analysis. DNA sequences were analyzed by using the NationalCenter for Biotechnology Information’s BLAST WWW Server and with theMegAlign program (Macintosh 3.03; DNASTAR Inc).

Nucleotide sequence accession number. The nucleotide sequence data re-ported here have been submitted to GenBank and assigned accession no.U52043.

RESULTS

Sequence analysis. Sequencing of the upstream region of thecry4B gene from B. thuringiensis subsp. israelensis 4Q2-72 re-vealed a long open reading frame on the complementarystrand. This sequence was found at about 1 kb from cry4B, onthe same SstI fragment of the 72-MDa megaplasmid (11).When compared against the database sequence bank with theBLAST WWW Server (National Center for Biotechnology In-formation), the sequence showed a high degree of homologywith cyt2Aa, the gene coding for the cytolytic endotoxin fromB. thuringiensis subsp. kyushuensis.

This sequence, which appears to constitute a monocistronictranscript, showed consensus sequences for the 235 and 210midsporulation promoters previously reported for several B.thuringiensis toxins, suggesting a sE-dependent transcriptionfor this gene (3, 8). Some other interesting features were alsofound in this upstream region. (i) A typical Bacillus ribosomebinding site (RBS), GGAGG (34), was found at position 125,followed by two potential stem-loop structures that might format the inverted repeats between nucleotides 165 and 196 or 168and 193, respectively. These sequences resemble the 59 mRNAstabilizer region described for cry3 B. thuringiensis genes (1, 2).In fact, this RBS is included in a longer stretch of nucleotideswhich is identical to the stabilizing region from cry3A (GAAAGGAGGGA [enclosed in an open box in Fig. 1]). (ii) A sec-ond, nontypical RBS (GGGGG) was found at position 271; 11bases downstream lies the ATG start codon for the open read-ing frame corresponding to this gene (260 codons long). (iii) Atthe 39 end, this sequence revealed a possible terminator sec-ondary structure constituted by two partially overlapping hair-pin loops (from nucleotides 1065 to 1082) that include the stopcodon TAA. The presence of 39 terminator-stabilizing se-quences is highly conserved among B. thuringiensis toxin genes(1). The low G1C content of the entire sequence (27%) is infull agreement with the cloned cyt2Aa1 gene and is typical of B.thuringiensis endotoxin genes.

Sequence alignments. DNA sequence comparisons madewith the Blastn and the MegAlign programs revealed a highdegree of homology between this sequence and the cyt2Aa1gene from B. thuringiensis subsp. kyushuensis (22). The highestsimilarity (80%) was found from nucleotides 344 to 1054. Se-quence comparisons at the (predicted) protein level confirmedthat Cyt2 from B. thuringiensis subsp. israelensis was highlysimilar to Cyt proteins in general and, in particular (67.6%), to

TABLE 1. B. thuringiensis strains and plasmid used in this study

Strain or plasmid Serotype Relevant phenotype Source

StrainsB. thuringiensis subsp. kyushuensis 74F6-18 H11a, -11c Toxic for dipteran larvae BGSCa (4U1)B. thuringiensis subsp. fukuokaensis H3a, -3d, -3e Toxic for dipteran larvae BGSC (4AP1)B. thuringiensis subsp. israelensis 1884 H14 Toxic for dipteran larvae Pasteur Institute (France)B. thuringiensis subsp. darmstadiensis 73-E10-2 H10a, -10b Toxic for dipteran larvae BGSC (4M1)B. thuringiensis subsp. tenebrionis (morrisoni) H8a, -8b Toxic for coleopteran larvae BGSCB. thuringiensis subsp. kurstaki HD73 3a, 3b Toxic for lepidopteran larvae BGSC (4D4)B. thuringiensis subsp. aizawai HD137 7 Toxic for lepidopteran larvae BGSC (4J5)B. thuringiensis subsp. morrisoni PG14 H8a, -8b Toxic for dipteran larvae Pasteur Institute (France)B. thuringiensis subsp. israelensis 4Q2-72 H14 Toxic for dipteran larvae; bears only the

72-MDa plasmidBGSC (4Q5)

Plasmid; pRX80 Apr; SstI fragment carrying cry4B from B. thurin-giensis subsp. israelensis cloned into pUC18

A. Delecluse, Pasteur Institute,France

a BGSC, Bacillus Genetic Stock Center, The Ohio State University, Columbus.

VOL. 63, 1997 NEW cyt VARIANT IN B. THURINGIENSIS SUBSP. ISRAELENSIS 2717

on June 1, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Cyt2Aa. In fact, as shown in Fig. 2, predicted a helices and bstrand domains (22) are fairly well conserved throughout theentire sequence.

PCR and Southern analysis. A pair of oligonucleotide prim-ers was designed from two highly conserved regions betweenB. thuringiensis subsp. israelensis 4Q2-72 and B. thuringiensissubsp. kyushuensis cyt2 genes (Fig. 1). In fact, the upper andlower primers are 85 and 100% homologous, respectively. Thisprimer set was used in PCR amplification experiments in orderto search for the presence of this gene in other B. thuringiensisstrains. As shown in Fig. 3, amplification products of the ex-pected size (469 bp) were obtained with purified plasmidDNAs as templates in all of the mosquitocidal strains, whereasno product was observed for antilepidopteran strains. Interest-ingly, B. thuringiensis subsp. tenebrionis with anticoleopteranactivity showed the 469-bp fragment. It is noteworthy thatwhen the annealing temperature was raised from 42°C to 45°C,no amplification products were obtained for B. thuringiensissubsp. darmstadiensis or subsp. fukuokaensis, suggesting alower homology with the primers. Southern analysis of thesame DNAs digested with EcoRI or HindIII (for B. thuringien-sis subsp. kyushuensis) was also performed in order to confirmthe presence of cyt2-related sequences in the different strains(Fig. 4). The 469-bp amplification product from pRX80 wasused as a probe. At stringency conditions allowing around a30% mismatch, a single EcoRI hybridization band of 4.7 kbwas observed with B. thuringiensis subsp. israelensis 4Q2-72 and

1884 and subsp. morrisoni PG14 DNAs, although a weakersignal was observed in B. thuringiensis subsp. israelensis 1884.Even when similar amounts of these DNAs were loaded on theagarose gel, they were visually estimated, and therefore noquantitative conclusions can be drawn. In the case of B. thu-ringiensis subsp. tenebrionis, hybridization to a 4.2-kb EcoRIfragment was observed. A HindIII fragment of around 6 kb wasobserved in B. thuringiensis subsp. kyushuensis, whereas underthese conditions, no signal was found in B. thuringiensis subsp.darmstadiensis and subsp. fukuokaensis.

Expression of the cyt2-like genes. Western blot analysis ofspore-crystal extracts was performed with B. thuringiensissubsp. israelensis 4Q2-72 and 1884, as well as in B. thuringiensissubsp. tenebrionis, in order to determine whether these genes

FIG. 1. (A) Localization of cyt2Ba in B. thuringiensis subsp. israelensis 4Q2-72. An SstI fragment from pRX80 carrying cry4B and part of cry10A is shown.This fragment comes from the 72-MDa megaplasmid of B. thuringiensis subsp.israelensis 4Q2-72. Arrows indicate transcriptional direction. S, SstI; H1 and H2,HindIII; EI, EcoRI; EV, EcoRV. (B) Nucleotide sequence of the cyt2Ba1 genefrom B. thuringiensis subsp. israelensis. Promoter 235 and 210 consensus se-quences are boxed. RBSs are printed in outlined letters, and start (ATG) andstop (TAA) codons are underlined. Potential hairpin structures are indicated bysolid arrows. Primers used for PCR amplification are indicated by broken arrows.The predicted size of the PCR product is 469 bp.

FIG. 2. Amino acid sequence alignment between Cyt2Ba1 from B. thurin-giensis subsp. israelensis and the reported Cyt2Aa1 from B. thuringiensis subsp.kyushuensis. Solid and broken boxes, predicted conserved b strands and a heli-ces, respectively.

FIG. 3. PCR amplifications. Plasmid DNA preparations from different B.thuringiensis strains were subjected to PCR amplification as described in Mate-rials and Methods. Lanes: 1, B. thuringiensis subsp. aizawai; 2, B. thuringiensissubsp. kyushuensis; 3, B. thuringiensis subsp. morrisoni PG14; 4, B. thuringiensissubsp. fukuokaensis; 5, B. thuringiensis subsp. tenebrionis; m, 100-bp DNA ladder;6, B. thuringiensis subsp. israelensis 1884; 7, B. thuringiensis subsp. darmstadiensis;8, B. thuringiensis subsp. kurstaki; 9, B. thuringiensis subsp. israelensis 4Q2; 10,PCR control reaction without DNA template.

2718 GUERCHICOFF ET AL. APPL. ENVIRON. MICROBIOL.

on June 1, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

were expressed in these strains. As can be seen in Fig. 5, B.thuringiensis subsp. israelensis 4Q2-72 did not show any reactivepolypeptide of the expected size. However, B. thuringiensissubsp. israelensis 1884 revealed a band of the same size as thatof B. thuringiensis subsp. kyushuensis Cyt2Aa. A larger poly-peptide (around 28 to 29 kDa) cross-reacted with the anti-Cyt2Aa antiserum in B. thuringiensis subsp. tenebrionis.

DISCUSSIONB. thuringiensis subsp. israelensis is the mosquitocidal sub-

species most thoroughly studied. One of the major componentsof its toxin crystal is the cytolytic endotoxin Cyt1Aa1. We havefound in this subspecies another gene coding for a cytolytictoxin, highly homologous to the reported cyt2Aa1 from B.thuringiensis subsp. kyushuensis (22). The physical map of themegaplasmid carrying the B. thuringiensis subsp. israelensistoxin genes has very recently been reported (4). Our findingsadd a new component to this map, contributing to the knowl-edge of the coding information available for this megaplasmid(which amounts to less than 20% up to date). This variant,which has been designated cyt2Ba1 (10), enters a phylogram ofcry and cyt genes (not shown) at a node of about 67% identitywith the reported Cyt2Aa1, constituting a new member of theCyt2 family. B. thuringiensis subsp. darmstadiensis Cyt2 mightalso be a different variant. The lack of hybridization observedin this subspecies under our stringency conditions might reflectthis difference. In the case of B. thuringiensis subsp. fukuokaen-sis, the lack of signal in the Southern experiment but thepresence of the expected PCR amplification product could bethe result of homology with cytC (coding for the Cyt toxindescribed for this subspecies) and not with a cyt2 variant.Cloning and sequencing of all of the amplification products arecurrently being done to clarify these possibilities.

Western blotting experiments done so far have failed toreveal the presence of the expected polypeptide in B. thurin-giensis subsp. israelensis 4Q2-72, whereas a small amount of apolypeptide similar in size to B. thuringiensis subsp. kyushuensis

Cyt2Aa was present in B. thuringiensis subsp. israelensis 1884(both strains derive from the original B. thuringiensis subsp.israelensis isolate). Interestingly, B. thuringiensis subsp. tene-brionis also showed a polypeptide that cross-reacted with theantiserum, although it appears to be larger than Cyt2. B. thu-ringiensis subsp. tenebrionis does not show low-molecular-masspolypeptides as crystal components in addition to the 68- to73-kDa Cry3A toxin (30). However, isolate EG2158 has beendescribed to synthesize the major protein of 68 kDa and twominor components of approximately 29 and 30 kDa. The latter,is part of a diamond-shaped inclusion found in this isolate, notpresent in B. thuringiensis subsp. tenebrionis, and not essentialfor toxic activity (12). In fact, in both B. thuringiensis subsp.israelensis 1884 and subsp. tenebrionis, the immunoreactivepolypeptides are minor components, present in small amountswhen compared with the other components of the spore-crystalpreparations (not shown). This low level of expression couldexplain why the toxin might have not been detected in 4Q2-72at our resolution level. This could also imply that these genesmay be functionally “cryptic,” due to insufficient expression,although being transcriptionally active.

In fact, RT-PCR studies carried out with B. thuringiensissubsp. israelensis confirmed that cyt2Ba is normally transcribed.When total RNAs from B. thuringiensis subsp. israelensis 4Q2-72 and 1884 were reverse transcribed and then amplified withour PCR primer set, the expected 469-bp amplification productcould be observed (Fig. 6). This result shows that the promotersequences found upstream of the open reading frame are func-tional and suggests that a full-length message is produced inthese strains.

With the information at hand, we can conclude that a newcyt2 variant is present in B. thuringiensis subsp. israelensis 4Q2-72, of which we know the sequence and localization. Interest-ingly, two strains belonging to serotype H8a8b and to twodifferent pathotypes (PG14 and a strain of B. thuringiensissubsp. tenebrionis), also carry this type of gene. This is also truefor the two other members of this serotype, with antilepidopt-

FIG. 4. (A) Southern blotting analysis. DNA transfer and hybridization werecarried out as described in Materials and Methods. The 469-bp PCR amplifica-tion product from pRX80 was used as a probe. Lanes: 1, B. thuringiensis subsp.morrisoni PG14; 2, B. thuringiensis subsp. israelensis 1884; 3, B. thuringiensissubsp. israelensis 4Q2-72; 4, B. thuringiensis subsp. fukuokaensis; 5, B. thuringien-sis subsp. kyushuensis; 6, B. thuringiensis subsp. darmstadiensis; 7, B. thuringiensissubsp. tenebrionis.

FIG. 5. Western blotting analysis. B. thuringiensis spore-crystal preparationswere processed for immunodetection with an anti-Cyt2Aa1 specific antiserum asdescribed in Materials and Methods. Around 40 mg of total protein was originallyloaded in each lane. Lanes: 1, B. thuringiensis subsp. tenebrionis; 2, B. thuringiensissubsp. israelensis 4Q2-72; 3, B. thuringiensis subsp. israelensis 1884; 4, B. thurin-giensis subsp. kyushuensis. Molecular mass markers are indicated on the left inkilodaltons.

VOL. 63, 1997 NEW cyt VARIANT IN B. THURINGIENSIS SUBSP. ISRAELENSIS 2719

on June 1, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

eran specificity, strains HD517 and 518, as we have very re-cently found (data not shown). This may have evolutionaryimplications, suggesting an ancestral character for the morri-soni serovar, from which the others might have diverged. Ex-pression of the corresponding polypeptides is presently beinginvestigated for all of the subspecies found to bear cyt2-relatedsequences.

The presence of a 59 mRNA stabilizing sequence is anotherinteresting feature which, described for the first time in a cytgene, seems to reinforce the connection between cyt-bearingsubspecies and the anticoleopteran pathotypes. These se-quences appear to be consensus RBSs located in the upstreamuntranslated region and which can stabilize the transcriptthrough the interaction with the 39 end of the 16S rRNA. Theyare found in similar positions in the three types of cry3 genesdescribed so far (1). We have also found a potential stem-loopstructure downstream of the RBS, although the secondarystructures associated with the cry3 stabilizers are located up-stream of these sequences (3). The stabilizing region describedin the early messenger from B. subtilis bacteriophage SP82(also a polypurine sequence) is also preceded by a secondarystructure, although it does not seem to be essential for stabi-lization (17). The constant presence of Cyt polypeptides (26)among mosquitocidal B. thuringiensis strains suggests that aselective advantage might exist for their expression. In the caseof the Cyt2-related toxins here described, their role (if any) inthe toxicity of the different strains remains to be established. Inthe case of B. thuringiensis subsp. israelensis, the low level ofexpression and the similar larvicidal activities of strains 4Q2-72and 1884 toward mosquito larvae suggest that these cytolysins(which coexist with Cyt1Aa) are dispensable for full activity. Infact, Cyt1Aa has been shown to be more active than Cyt2 orCytC (26, 35). Nevertheless, the high degree of conservationfound among the different isolates is extremely significant.

Because of their apparently ubiquitous nature among themosquitocidal pathotype and the morrisoni serotype, these cytgenes might also constitute markers that could be exploited forscreening purposes once all versions are sequenced and goodsets of PCR primers are established from highly conservedregions.

ACKNOWLEDGMENTS

We thank Neil Crickmore and Daniel Zeigler of the Bacillus thu-ringiensis Toxin Gene Nomenclature Committee and the BGSC forhelpful discussion and phylogenetic protein comparisons and DavidEllar for the anti-Cyt2A1 antiserum. We are grateful to CarmenSanchez Rivas for helpful discussion and valuable material and A.Delecluse for providing us with pRX80. We also thank Guido Pollevickfor training A.G. in DNA sequencing.

A.G. is a predoctoral fellow of the National Council for Scientificand Technological Research (CONICET).

REFERENCES1. Agaisse, H., and D. Lereclus. 1994. Structural and functional analysis of the

promoter region involved in full expression of the cryIIIA toxin gene ofBacillus thuringiensis. Mol. Microbiol. 13:97–107.

2. Agaisse, H., and D. Lereclus. 1995. How does Bacillus thuringiensis produceso much insecticidal crystal protein? J. Bacteriol. 177:6027–6032.

3. Baum, J. A., and T. Malvar. 1995. Regulation of insecticidal crystal proteinproduction in Bacillus thuringiensis. Mol. Microbiol. 18:1–12.

4. Ben-Dov, E., M. Einav, N. Peleg, S. Boussiba, and A. Zaritsky. 1996. Re-striction map of the 125-kilobase plasmid of Bacillus thuringiensis subsp.israelensis carrying the genes that encode delta-endotoxins active againstmosquito larvae. Appl. Environ. Microbiol. 62:3140–3145.

5. Ben-Dov, E., S. Boussiba, and A. Zaritsky. 1995. Mosquito larvicidal activityof Escherichia coli with combinations of genes from Bacillus thuringiensissubsp. israelensis. J. Bacteriol. 177:2851–2857.

6. Birnboim, H., and J. Doly. 1979. A rapid alkaline extraction procedure forscreening recombinant plasmid DNA. Nucleic Acids Res. 7:1513–1523.

7. Bourgouin, C., A. Klier, and G. Rapoport. 1986. Characterization of thegenes encoding the haemolytic toxin and the mosquitocidal d-endotoxins ofBacillus thuringiensis var israelensis. Mol. Gen. Genet. 205:390–397.

8. Brown, K. L. 1993. Transcriptional regulation of the Bacillus thuringiensissubsp. thompsoni crystal protein gene operon. J. Bacteriol. 175:7951–7957.

9. Crickmore, N., E. J. Bone, J. A. Williams, and D. J. Ellar. 1995. Contributionof the individual components of the d-endotoxin crystal to the mosquitocidalactivity of Bacillus thuringiensis subsp. israelensis. FEMS Microbiol. Lett.131:249–254.

10. Crickmore, N., and D. Zeigler. 1996. Personal communication.11. Delecluse, A., S. Poncet, A. Klier, and G. Rapoport. 1993. Expression of

cryIVA and cryIVB genes, independently or in combination, in a crystal-negative strain of Bacillus thuringiensis subsp. israelensis. Appl. Environ.Microbiol. 59:3922–3927.

12. Donovan, W. P., J. M. Gonzalez, Jr., M. P. Gilbert, and C. Dankocsik. 1988.Isolation and characterization of EG2158, a new strain of Bacillus thurin-giensis toxic coleopteran larvae, and nucleotide sequence of the toxin gene.Mol. Gen. Genet. 214:365–372.

13. Dumas Milne Edwards, J. B., P. Ravassard, C. Icard-Liepkalns, and J.Mallet. 1995. cDNA cloning by RT-PCR, p. 96–98. In M. J. McPherson,B. D. Hames, and G. R. Taylor (ed.), PCR2, a practical approach. OxfordUniversity Press, Inc., New York, N.Y.

14. Earp, D. J., E. S. Ward, and D. J. Ellar. 1987. Investigation of possiblehomologies between crystal proteins of three mosquitocidal strains of Bacil-lus thuringiensis. FEMS Microbiol. Lett. 42:195–199.

15. Hanahan, D. 1983. Studies on the transformation of Escherichia coli withplasmids. J. Mol. Biol. 166:557–580.

16. Hofte, H., and H. R. Whiteley. 1989. Insecticidal crystal proteins of Bacillusthuringiensis. Microbiol. Rev. 53:242–255.

17. Hue, K. K., S. D. Cohen, and D. H. Bechhofer. 1995. A polypurine sequencethat acts as a 59 mRNA stabilizer in Bacillus subtilis. J. Bacteriol. 177:3465–3471.

18. Kawalek, M. D., S. Benjamin, H. L. Lee, and S. S. Gill. 1995. Isolation andidentification of novel toxins from a new mosquitocidal isolate from Malay-sia, Bacillus thuringiensis subsp. jegathesan. Appl. Environ. Microbiol. 61:2965–2969.

19. Knowles, B. H., and D. J. Ellar. 1987. Colloid-osmotic lysis is a generalfeature of the mechanism of action of Bacillus thuringiensis d-endotoxins withdifferent specificity. Biochim. Biophys. Acta 924:509–518.

20. Knowles, B. H., M. R. Blatt, M. Tester, J. M. Horsnell, J. Carroll, G.Menestrina, and D. J. Ellar. 1989. A cytolytic d-endotoxin from Bacillusthuringiensis var israelensis forms cation-selective channels in planar lipidbilayers. FEBS Lett. 244:259–262.

21. Knowles, B. H., P. J. White, C. N. Nicholls, and D. J. Ellar. 1992. A broadspectrum cytolytic toxin from Bacillus thuringiensis var kyushuensis. Proc.Roy. Soc. Lond. Ser. B 248:1–7.

22. Koni, P. A., and D. J. Ellar. 1993. Cloning and characterization of a novelBacillus thuringiensis cytolytic delta-endotoxin. J. Mol. Biol. 229:319–327.

23. Lereclus, D., A. Delecluse, and M.-M. Lecadet. 1993. Diversity of Bacillusthuringiensis toxins and genes, p. 37–69. In P. F. Entwistle, J. S. Cory, M. J.Bailey, and S. Higgs (ed.), Bacillus thuringiensis, an environmental biopesti-cide: theory and practice. John Wiley & Sons, Ltd., Chichester, UnitedKingdom.

FIG. 6. RT-PCR of total RNAs from B. thuringiensis subsp. israelensis 1884(lanes 1 and 2) and 4Q2-72 (lanes 3 and 4). Lane 5 contains a 100-bp DNAladder. Even lanes, control reactions (without reverse transcriptase).

2720 GUERCHICOFF ET AL. APPL. ENVIRON. MICROBIOL.

on June 1, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

24. Maniatis, T., E. Fritsch, and J. Sambrook. 1982. Molecular cloning: a lab-oratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

25. Park, H., H. Kim, D. Lee, Y. Yu, B. Jin, and S. Kang. 1995. Expression andsynergistic effect of three types of crystal protein genes in Bacillus thurin-giensis. Biochem. Biophys. Res. Commun. 214:602–607.

26. Ragni, A., I. Thiery, and A. Delecluse. 1996. Characterization of six highlymosquitocidal Bacillus thuringiensis strains that do not belong to H-14 sero-type. Curr. Microbiol. 32:48–54.

27. Sanger, F., S. Nicken, and A. R. Coulson. 1977. DNA sequencing withchain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463–5467.

28. Schaeffer, P., J. Millet, and J. Aubert. 1965. Catabolic repression of bacterialsporulation. Proc. Natl. Acad. Sci. USA 554:701–711.

29. Sekar, V. 1987. DNA homology between the crystal toxin genes of severalmosquito pathogenic Bacillus thuringiensis strains. Curr. Microbiol. 15:1–3.

30. Sekar, V., D. V. Thompson, M. J. Maroney, R. G. Bookland, and M. J.Adang. 1987. Molecular cloning and characterization of the insecticidal crys-tal protein of Bacillus thuringiensis var tenebrionis. Proc. Natl. Acad. Sci. USA84:7036–7040.

31. Thiery, I., A. Delecluse, M. C. Tamayo, and S. Orduz. 1996. Identification ofa gene for Cyt1A-like hemolysin from Bacillus thuringiensis subsp. medellinand expression in a crystal-negative B. thuringiensis strain. Appl. Environ.Microbiol. 63:468–473.

32. Thomas, W. E., and D. J. Ellar. 1983. Bacillus thuringiensis var israelensiscrystal d-endotoxins: effects on insect and mammalian cells in vitro and invivo. J. Cell Sci. 60:181–197.

33. Ward, E. S., D. J. Earp, B. H. Knowles, S. M. Pinnavaia, C. N. Nicholls, T. J.Sawyer, P. E. Granum, and D. J. Ellar. 1988. Diversity of structure andspecificity of mosquitocidal d-endotoxins. Zentralbl. Bakteriol. Suppl. 17:67–68.

34. Wong, H. C., H. E. Schnepf, and H. R. Whiteley. 1983. Transcriptional andtranslational start sites for the Bacillus thuringiensis crystal protein gene.J. Biol. Chem. 258:1960–1967.

35. Yu, Y.-M., M. Ohba, and S. S. Gill. 1991. Characterization of mosquitocidalactivity of Bacillus thuringiensis subsp. fukuokaensis crystal proteins. Appl.Environ. Microbiol. 57:1075–1081.

VOL. 63, 1997 NEW cyt VARIANT IN B. THURINGIENSIS SUBSP. ISRAELENSIS 2721

on June 1, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from