Identification of the Site-Specific DNA Invertase ... · invertase for this inverlon (designated...

JOURNAL OF BACTERIOLOGY, Oct. 2009, p. 6003–6011 Vol. 191, No. 190021-9193/09/$08.00�0 doi:10.1128/JB.00687-09Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Identification of the Site-Specific DNA Invertase Responsible for thePhase Variation of SusC/SusD Family Outer Membrane

Proteins in Bacteroides fragilis�†Haruyuki Nakayama-Imaohji,1 Hideki Hirakawa,2 Minoru Ichimura,1 Shin Wakimoto,1

Satoru Kuhara,3 Tetsuya Hayashi,4 and Tomomi Kuwahara1*Department of Molecular Bacteriology, Institute of Health Biosciences, The University of Tokushima Graduate School,

3-18-15 Kuramoto-cho, Tokushima, 770-8503, Japan1; Laboratory of Plant Genome Informatics, Department ofPlant Genome Research, Kazusa DNA Research Institute, 2-6-7 Kazusakamatari, Kisarazu, Chiba, 292-0818,

Japan2; Department of Genetic Resources Technology, Faculty of Agriculture, Kyushu University,Hakozaki, Higashi-ku, Fukuoka 812-8581, Japan3; and Frontier Science Research Center,

University of Miyazaki, 5200 Kiyotake, Miyazaki 889-1692, Japan4

Received 26 May 2009/Accepted 22 July 2009

The human gut microbe Bacteroides fragilis can alter the expression of its surface molecules, such as capsularpolysaccharides and SusC/SusD family outer membrane proteins, through reversible DNA inversions. Wedemonstrate here that DNA inversions at 12 invertible regions, including three gene clusters for SusC/SusDfamily proteins, were controlled by a single tyrosine site-specific recombinase (Tsr0667) encoded by BF0667 inB. fragilis strain YCH46. Genetic disruption of BF0667 diminished or attenuated shufflon-type DNA inversionsat all three susC/susD genes clusters, as well as simple DNA inversions at nine other loci, most of whichcolocalized with susC/susD family genes. The inverted repeat sequences found within the Tsr0667-regulatedinvertible regions shared the consensus motif sequence AGTYYYN4GDACT. Tsr0667 specifically mediated theDNA inversions of 10 of the 12 regions, even under an Escherichia coli background when the invertible regionswere exposed to BF0667 in E. coli cells. Thus, Tsr0667 is an additional globally acting DNA invertase in B.fragilis, which probably involves the selective expression of SusC/SusD family outer membrane proteins.

The human gut harbors an abundant and diverse microbiota.Bacteroides is one of the most abundant genera of human gutmicroflora (10, 17, 20), and the biological activities of Bacte-roides species are deeply integrated into human physiologythrough nutrient degradation, the production of short-chainfatty acids, or immunomodulatory molecules (11–14, 24). Re-cent genomic analyses of Bacteroides have revealed that thebacteria possess redundant abilities not only to bind and de-grade otherwise indigestible dietary polysaccharides but also toproduce vast arrays of capsular polysaccharide (5, 19, 38, 39).These functional redundancies have been established by theextensive duplication of various genes that encode moleculessuch as glycosylhydrolases, glycosyltransferases, and outermembrane proteins of the SusC/SusD family (starch utilizationsystem) known to be involved in polysaccharide recognitionand transport (7, 27, 28, 30). It has been assumed that thesefunctional redundancies of Bacteroides contribute to the sta-bility of the gut ecosystem (3, 21, 23, 32, 39).

Another characteristic feature common in Bacteroides spe-cies is that the expression of some of the genes is altered in anon-off manner by reversible DNA inversions at gene promotersor within the protein-coding regions (5, 9, 19, 38, 39). These

phase-variable phenotypes are associated with surface archi-tectures such as capsular polysaccharides and SusC/SusD fam-ily proteins (5, 6, 16, 19). Our previous genomic analyses ofBacteroides fragilis strain YCH46 revealed that it contained asmany as 31 invertible regions in its chromosome (19). Theseinvertible regions can be grouped into six classes according tothe internal motif sequences within inverted repeat sequences(IRs) (Table 1). The DNA inversions within these regions arethought to be controlled by site-specific DNA invertases spe-cific to each class. B. fragilis strain YCH46 contains 33 tyrosinesite-specific recombinases (Tsr) genes and four serine site-specific recombinases (Ssr) genes. Generally, DNA invertasesmediate DNA inversions at adjacent regions, such as FimB andFimE, that flip their immediate downstream promoters to gen-erate a phase-variable phenotype of type I pili in Escherichiacoli (15). B. fragilis is unique in that this anaerobe possesses notonly locally acting DNA invertases but also globally actingDNA invertases that mediate DNA inversions at distant loci(8, 29). It has been reported that B. fragilis possesses at leasttwo types of master DNA invertase that regulate DNA inver-sions at multiple loci simultaneously (8, 29). One is Mpi, an Ssrthat mediates the on-off switching of 13 promoter regions (cor-responding to class I regions in B. fragilis strain YCH46), in-cluding seven promoter regions for capsular polysaccharidebiosynthesis in B. fragilis strain NCTC9343 (8). The other mas-ter DNA invertase is Tsr19, a Tsr that regulates DNA inver-sions at two distantly located promoter regions (correspondingto class IV regions in B. fragilis strain YCH46) associated withthe large encapsulation phenotype (6, 26, 29). The invertibleregions contain specific consensus motifs within the IRs cor-

* Corresponding author. Mailing address: Department of MolecularBacteriology, Institute of Health Biosciences, The University of To-kushima Graduate School, 3-18-15 Kuramoto-cho, Tokushima 770-8503, Japan. Phone and fax: 81-88-633-9229. E-mail: [email protected].

† Supplemental material for this article may be found at http://jb.asm.org/.

� Published ahead of print on 31 July 2009.

6003

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

https://crossmark.crossref.org/dialog/?doi=10.1128/JB.00687-09&domain=pdf&date_stamp=2009-10-01http://jb.asm.org/

responding to each DNA invertase and constitute a regulatoryunit. We designated this type of regulatory unit as an “inver-lon,” which consists of at least two invertible regions controlledby a single master DNA invertase.

Our previous studies indicated that an additional inverlonother than the Mpi- and Tsr19-regulated inverlons is present inB. fragilis, based on the finding that at least 10 invertible re-gions (corresponding to class II regions in B. fragilis strainYCH46) contain a particular consensus motif sequence (AAGTTCN5GAACTT) within their IRs (19) but do not appear tocolocalize with a DNA invertase gene. The majority of the classII regions were associated with the selective switching of aparticular set of susC/susD family genes. Since the SusC/SusDfamily of outer membrane proteins play an important role inpolysaccharide utilization by Bacteroides (3, 23, 32), the inver-lon associated with the phase variation of SusC/SusD familyproteins would likely be involved in the survival of this anaer-obe in the distal gut.

In the present study, we sought to identify the DNA inver-tase regulating the additional inverlon in B. fragilis. Our resultsindicated that the Tsr encoded by BF0667 is a master DNAinvertase for this inverlon (designated the Tsr0667-inverlon) inB. fragilis.

MATERIALS AND METHODS

Bacterial strains, plasmids, and culture conditions. The bacterial strains andplasmids used in the present study are listed in Table S1 in the supplementalmaterial. B. fragilis strains were grown anaerobically at 37°C in Gifu anaerobicmedium (GAM; Nissui Pharmaceutical Co., Tokyo, Japan) or on GAM agarplates using the AnaeroPack system (Mitsubishi Gas Chemical Co., Inc., Tokyo,Japan). B. fragilis strain YCH46 (18) was used as a parental strain for all geneticdisruption experiments. E. coli strains were grown aerobically at 37°C in Luria-Bertani (LB) broth or on LB agar plates. If necessary, antibiotics were added tothe media at the following concentrations: ampicillin, 50 �g/ml; erythromycin(Em), 10 �g/ml; and tetracycline (Tc), 10 �g/ml.

Clustering of Tsr proteins. We identified all Tsr genes from B. fragilis strainsYCH46 and NCTC9343 and B. thetaiotaomicron strain VPI-5482 by screeningthe proteomes with the pfam00589 motif. Total of 33, 25, and 55 Tsr-encodinggenes were identified in the genomes of B. fragilis strains YCH46 and NCTC9343and B. thetaiotaomicron strain VPI-5482, respectively. These Tsr protein se-quences were aligned, and distance matrices were calculated based on aminoacid sequence similarities by the CLUSTAL W program (34). A phylogenetictree was drawn by using MEGA-4 software (33). Similarly, Ssr genes wereidentified by screening with the pfam00239 motif.

Plasmid and strain construction. Deletion mutants for 19 Tsr- and two Ssr-encoding genes were constructed in the B. fragilis strain YCH46 by removing theinternal segment of each target gene. Briefly, DNA fragments upstream anddownstream of the region being deleted were separately PCR amplified andfused by a second PCR amplification via an overlapping regions incorporatedinto the primer sequences. The resultant PCR products were digested withrestriction endonucleases that corresponded to restriction sites added to the

primer ends, ligated into pKK100, and introduced into E. coli strain JM109. Theplasmid pKK100 is a suicide vector for Bacteroides, which was constructed bysubcloning the 3.8-kb Em/Tc resistance element from pE5-2 (31) into the XmnIsite of the pBluescript II KS vector (Stratagene). The purified knockout vectorswere then electroporated into B. fragilis strain YCH46 as described below.Em-resistant transformants, in which the knockout vector had integrated into thechromosome through a single crossover, were selected. The single-crossovermutants were then grown in GAM broth, spread onto nonselective GAM agarplates, and replica plated onto GAM agar plates containing Em to screen formutants that had lost the vector sequence through a second crossover event.Em-sensitive colonies were selected, and the genetic disruption was confirmed byPCR amplification using primers that flanked the deletion sites (see Table S2 inthe supplemental material). BF0667 complementation studies were performedby cloning BF0667 into the modified E. coli-Bacteroides shuttle plasmid pVAL-Exp, derived from plasmid pVAL-1 (35). Synthetic oligonucleotide primers werepurchased from Sigma-Aldrich Japan Co., Ltd. (Tokyo, Japan). DNA sequencingwas performed on an ABI Prism 3100 genetic analyzer (Applied Biosystems) byusing a ABI Prism BigDye terminator cycle sequencing ready reaction kit (ver-sion 1.1; Applied Biosystems).

Electrotransformation. B. fragilis strain YCH46 was grown anaerobically in 10ml of GAM broth at 37°C overnight, and then 0.1 ml of the overnight culture wasinoculated into 10 ml of freshly prepared GAM broth, followed by incubationanaerobically at 37°C until mid-exponential phase. Then, 1 ml of the freshbacterial culture was inoculated into 100 ml of GAM broth, followed by incu-bation anaerobically at 37°C, and grown to early exponential phase (i.e., anoptical density at 660 nm of 0.4 to 0.5). After harvesting by centrifugation at 4°C,the bacterial cells were washed twice with 100 ml of ice-cold 10% glycerol andresuspended in 1.0 ml of ice-cold 10% glycerol. For electroporation, 0.1 ml of thecell suspension was mixed with 10 �g of the plasmid DNA in a 0.2-cm cuvette.The sample was immediately subjected to an electric pulse (12.5 kV/cm, 200 �,25 �F) by using a GenePulser II (Bio-Rad). Prewarmed GAM broth (0.9 ml) wasimmediately added to the sample, and the cells were incubated anaerobically at37°C for 12 h before being spread on a GAM agar plate containing Em. Theplates were incubated at 37°C for 48 h under anaerobic conditions.

PCR assay to detect DNA inversions. To assess the DNA inversions at eachregion, we examined genomic DNA from each site-specific recombinase genedeletion mutant by PCR using a set of orientation-specific primers (see Table S2in the supplemental material). PCR amplification was performed on 100 ng ofgenomic DNA using GoTaq polymerase (Promega) under the following condi-tions: preheating at 95°C for 1 min; 25, 30, or 35 cycles of 30 s at 95°C; 30 s at55°C; and 1 min at 72°C, with a final extension step of 5 min of 72°C. DNAfragments over 5 kb were amplified by using TaKaRa LA Taq DNA polymerase(Takara Shuzo Co., Ltd., Otsu, Japan) with amplification conditions of 1 min at94°C; followed by 25, 30, or 35 cycles of 30 s at 94°C; and 10 min at 68°C, witha final extension step of 10 min of 68°C.

Reconstruction of the Tsr0667-inverlon in E. coli. To test the specificity ofTsr0667, each invertible region of the Tsr0667-inverlon was exposed to BF0667in an E. coli background. BF0667 was PCR amplified using the primers BF0667-PCR2 and BF0667-PCR3 and cloned into the SmaI site of the pBluescript II KSvector in both orientations. In the plasmid construct pKS0667(�), BF0667 wascloned in same orientation as the lac promoter, while in pKS0667(�), BF0667was in the opposite orientation to the lac promoter. All of the Tsr0667-inverloninvertible regions except for class V were amplified from the genomic DNA ofwild-type strain. The PCR amplification of the class V invertible region wasperformed by using the BF0667 deletion mutant (TSRM0667) genomic DNA.The resultant PCR products were cloned individually into the EcoRV site of

TABLE 1. Classification of the invertible regions in B. fragilis strain YCH46 based on internal motif sequences within IRs

Classa No. Consensus motif sequencesb Master DNA invertase genec Regulated genes Source orreference(s)

I 14 ARACGTWCGT BF2765 (mpi) Capsular polysaccharide biosynthesis genes 8II 10 AGTTC{N5}GAACT BF0667 susC/susD paralogs This studyIII 3 GTTAC{N7}GTAAC BF3038, BF4033, BF4283 Putative outer membrane protein genes 36IV 2 TACTTANTAGGTAANAGAA BF2766 Extracellular polysacharide biosynthesis genes 6, 26, 29V 1 TCTGCAAAGNCTTTGCAGA BF0667 susC/susD paralogs This studyVI 1 ACTAAGTTCTATCGG BF0667 susC/susD paralogs This study

a Our previous classification of the invertible regions identified in B. fragilis strain YCH46 genome (19).b Consensus motif sequences found within IRs are shown. R � A or G, W � A or T, and N � A, G, C, or T.c The gene identifications in B. fragilis strain YCH46 genome are shown.

6004 NAKAYAMA-IMAOHJI ET AL. J. BACTERIOL.


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

pACYC184 (Nippon Gene Co., Ltd., Tokyo, Japan), producing the reporterplasmids pRep1 to pRep12. The gene for Mpi was also PCR amplified by usingthe primers int4 and mpi-PCR5 and cloned into the SmaI site of pBluescript IIKS vector in both orientations, producing the plasmids pKSmpi(�) andpKSmpi(�). The reporter plasmid for Mpi-mediated inversion, pRep13, thatharbored the invertible promoter from capsular polysaccharide biosynthesis lo-cus PS-3 (corresponding to PS A locus in B. fragilis strain NCTC9343) was alsoconstructed. E. coli DH5� cells harboring each of the reporter plasmids werethen transformed with pKS0667(�), pKS0667(�), pKSmpi(�), or pKSmpi(�),and the extent of DNA inversion on each reporter plasmid was assessed by PCRwith orientation-specific primer sets.

RESULTS

Invertible regions and site-specific recombinase genes in B.fragilis strain YCH46. The B. fragilis strain YCH46 chromo-some contains at least 31 invertible regions (19). As shown inFig. 1, 10 of these invertible regions (class II regions) appearedto constitute an inverlon controlled by a DNA invertase otherthan Mpi and Tsr19. This was based on the observation thatthese 10 regions contained IRs with a distinct type of consen-sus motif sequence (AAGTTCN5GAACTT) and that none ofthe regions colocalized with DNA invertase genes. Eight ofthese regions contain promoter-like sequences (1) that mayaffect the on-off expression of the corresponding SusC/SusDregions, which indicated that the inverlon may be involved inthe utilization of various dietary- or host-derived polysaccha-

rides. The mode of DNA inversion in these regions was notmerely simple promoter switching (class II-4, -7, -8, -9, and -10)but may also involve the formation of hybrid proteins (classII-1, -2, and -6) or shufflon-type multiple DNA inversions(class II-3).

The B. fragilis strain YCH46 possesses 33 Tsr-encodinggenes (Fig. 2), as well as four Ssr-encoding genes (BF0513,BF2906, BF2765, and BF3012). Of the 37 site-specific recom-binase-encoding genes, 19 Tsr- and 2 Ssr-encoding genes(BF0513 and BF2765) are conserved between B. fragilis strainsYCH46 and NCTC9343, and six Tsr genes are conserved be-tween the B. fragilis strains and the B. thetaiotaomicron strainVPI-5482. Amino acid sequence comparisons showed that theTsr proteins from B. fragilis strains YCH46 and NCTC9343,and B. thetaiotaomicron strain VPI-5482 fell into three clusters.The Tsr-encoding genes that have been demonstrated experi-mentally to mediate DNA inversions to date (BF2766, BF3038,BF4033, and BF4283 corresponding to Tsr19, -25, -15, and -26in strain NCTC9343, respectively) belong to the same cluster(cluster 3b). These Tsr proteins control local promoter inver-sions immediately downstream (29, 36). We found putativeinvertible regions at loci immediately downstream for othermembers of the 3b cluster in B. fragilis strain YCH46 (BF1781,BF3522, and BF4438), each containing a unique IR (data not

FIG. 1. Genetic structures of invertible regions previously classified as class II regions in B. fragilis strain YCH46 (19). The open reading framespresent in each locus are indicated by arrows that are differentiated according to function. IRs are indicated by arrowheads. Bent arrows show thepositions and orientations of Bacteroides consensus promoter sequences (1) basing on the final genome sequence data of B. fragilis strain YCH46(GenBank accession no. AP006841). Dotted circles represent the DNA inversions via for each IR pair. In the cases of class II-1, -2, and -6 regions,the outcomes of DNA inversions are shown on the right side of horizontal line with arrowheads. DNA inversions in class II-1 region mediate theformation of two types of hybrid proteins with different C-terminal sequences. A small open reading frame encoded in the invertible segments inclass II-2 and -6 regions fuses to the downstream or upstream gene by DNA inversion resulting in an N-terminal extension.

VOL. 191, 2009 Tsr0667-INVERLON IN BACTEROIDES FRAGILIS 6005


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

shown). Likewise, in the B. thetaiotaomicron strain VPI-5482all of the 3b cluster Tsr-encoding genes were associated withputative invertible regions located immediately downstream(data not shown). The members of cluster 3b are thought tohave expanded from a locally acting DNA invertase in Bacte-roides.

Identification of the DNA invertase regulating the addi-tional inverlon. Of the 37 site-specific recombinase-encodinggenes in B. fragilis strain YCH46, we selected six genes(BF0667, BF1168, BF1340, BF3036, BF4201, and BF4484) thatwere conserved between B. fragilis strain NCTC9343 and B.thetaiotaomicron strain VPI-5482 (Fig. 2) as candidate genesfor a master DNA invertase of the additional inverlon. This

selection was based on the observation that the class II invert-ible regions contain IRs with consensus motif sequence AAGTTCN5GAACTT which was also conserved between thestrains. We constructed deletion mutants for each of thesecandidate genes and performed PCR screening using orienta-tion-specific primer sets (Fig. 3A) to identify mutants in whichthe DNA inversions in the class II invertible regions werediminished. Of the mutants screened, the DNA inversionswere affected only when BF0667 was disrupted (Fig. 3B andD). Although amplicons were still produced from both orien-tation-specific primer sets from the class II-5 region of thismutant (TSRM0667), the disruption of BF0667 significantlyreduced the DNA inversion in this region (Fig. 3B). In

FIG. 2. Clustering analysis of Tsr amino acid sequences from B. fragilis strains YCH46 (red) and NCTC9343 (blue) and B. thetaiotaomicronstrain VPI-5482 (green). The deduced amino acid sequences of Tsr were aligned and compared by using the CLUSTAL W program (34), and theunrooted trees were drawn by using MEGA-4 software (33). The outermost circle indicates the three major Tsr families (clusters 1 to 3). Thesecond circle indicates the Tsr-encoding genes that mediate DNA inversion at the regions indicated. New classes indicate the putative invertibleregions found in the present study. Tsr proteins of B. fragilis strain YCH46 that are conserved between B. fragilis strain NCTC9343 and B.thetaiotaomicron strain VPI-5482, and those conserved between B. fragilis strains only are labeled by yellow and blue circles, respectively. The B.fragilis strain YCH46 Tsr-encoding genes that were disrupted in the present study are indicated by asterisks. A bar indicates the phylogeneticdistance.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

TSRM0667, shufflon-type multiple DNA inversions in thesusC/susD gene cluster (class II-3 in Fig. 1) were also abro-gated (Fig. 3D). Complementation with plasmid-encodedBF0667 restored the DNA inversions to wild-type levels in allof the regions tested. Thus, the Tsr encoded by BF0667 (des-ignated Tsr0667) is considered to be the third globally actingDNA invertase in B. fragilis and the master DNA invertase ofthe inverlon responsible for the variable expression of theSusC/SusD outer membrane protein family.

Role of Tsr0667 in shufflon-type multiple DNA inversions insusC/susD gene clusters. The B. fragilis genome possesses threesusC/susD gene clusters (class II-3, class V, and class VI re-gions) localized distantly from each other, where shufflon-typemultiple DNA inversions have been reported to occur (19).Interestingly, as shown in Fig. 4A, BF0667 is localized withinone of these susC/susD gene clusters (class V region) distantfrom the class II-3 region. This characteristic localization sug-gested that Tsr0667 may also mediate shufflon-type multipleDNA inversions in this cluster despite the different IRs (TCTGCAAAGTCTTTGCAGAACTTG) compared to class II re-gions. As predicted, PCR screening demonstrated that BF0667disruption also diminished genetic shuffling in the class V re-gion (Fig. 4B).

Unexpectedly, DNA inversions in the remaining susC/susDgene cluster (class VI region) that contained the IRs ACTAA

GTTCTATCGGTACTTG, distinct from the other susC/susDgene clusters, were also abrogated in TSRM0667 (Fig. 4D).DNA inversions at other invertible regions (class I, III, and IVregions) were not affected (data not shown). We constructeddeletion mutants of all 21 site-specific recombinase genes (19tsr and 2 ssr genes) conserved between the two B. fragilis ge-nomes. However, we failed to disrupt the Ssr gene BF0513despite the repeated trials. Except for BF0667, none of thesite-specific recombinase genes tested affected genetic shufflingin the three susC/susD gene clusters or DNA inversions at theother nine loci of the Tsr0667-inverlon. In addition, DNAinversions occurred in the recA-negative B. fragilis mutant(data not shown). Together, our results indicated that theTsr0667-inverlon consisted of at least 12 invertible regionsincluding three susC/susD gene clusters and that Tsr0667 isnecessary for these inversions.

Possible recognition sequence of Tsr0667. Site-specific DNAinvertases generally recognize and bind to a specific sequencewithin IRs. Based on our findings, it would be expected that allof the invertible regions in the Tsr0667-inverlon contain aconsensus motif sequence recognized by Tsr0667. To extract aconsensus motif sequence, the Tsr0667-inverlon invertible re-gion IRs were aligned and compared. As shown in Fig. 5, weidentified the consensus motif AGTYYYN4GDACT as a pos-sible recognition sequence of Tsr0667.

FIG. 3. PCR assay for DNA inversions in class II regions of wild-type (WT) and BF0667-deletion mutant (TSRM0667) strains. TSRM0667strain complemented with plasmid-borne BF0667 in trans, TSRM0667(pVAL0667), was also analyzed. The results of a 25-cycle amplification areshown. (A) Orientation-specific primer sets used to detect the DNA inversions. (B) Agarose gel electrophoresis of the amplification products fromthe class II regions as indicated above each lane. F and R show the PCR protocol indicated in panel A. (C) Genetic structure of the B. fragilis strainYCH46 susC/susD gene cluster (class II-3). Genes for SusC and SusD are indicated by black and gray arrows, respectively. Arrowheads indicateIRs. (D) Shufflon-type multiple DNA inversions in the class II-3 susC/susD gene cluster. The annealing position and orientation of each PCRprimer used to detect DNA inversions is indicated below the schematic representation of the susC/susD cluster in panel C. Three types of DNAinversions are shown in panel C. Inversions 1�2, 2�3, and 1�3 indicate the combinational DNA inversions of inversion 1 and inversion 2, inversion2 and inversion 3, and inversion 1 and inversion 3, respectively. The primer pairs used are shown above the lanes, and DNA inversions to bedetected are indicated above the primer pairs. For example, the primers 2F and 2R face to each another in a distance that generate 513-bp PCRproduct in size when the combinational DNA inversions (inversion 1�2) occur. M, 100-bp ladder molecular size markers.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

Reconstruction of the Tsr0667-inverlon in E. coli. To deter-mine the specificity and direct association of Tsr0667 with theTsr0667-inverlon invertible regions, we reconstructed the com-ponents of the inverlon in E. coli strain DH5�. As shown inFig. 6A, BF0667 was cloned into pBluescript II KS in the sameor the opposite orientation with respect to the lac promoter,generating pKS0667(�) and pKS0667(�), respectively. Thegene encoding Mpi was also cloned into pBluescript II KS togive pKSmpi(�) and pKSmpi(�), respectively. The invertibleregions that constitute the Tsr0667-inverlon or the invertiblePS-3 promoter region (corresponding to PS A promoter re-gions in B. fragilis strain NCTC9343) were individually clonedinto pACYC184, and these constructs were used as reporterplasmids for DNA inversions (pRep-1 to -13). Each reporterplasmid coexisted with a plasmid harboring either BF0667 or

mpi in E. coli cells. As shown in Fig. 6A, DNA inversions withinthe cloned fragment on the reporter plasmids were assessed bycolony PCR using orientation-specific primer sets. Of the in-vertible regions tested, all regions except for class II-5 and classVI underwent DNA inversion when pKS0667(�) but notpKS0667(�) was also present (columns I and II in Fig. 6B).For the class II-5 and class VI regions, DNA inversions oc-curred in the E. coli background regardless of whether BF0667was present or not. Expression of mpi did not promote DNAinversions other than in the PS-3 promoter (column IV in Fig.6B). Interestingly, spontaneous DNA inversions within theclass II-5 and class VI regions in E. coli cells were diminishedwhen mpi was expressed. These findings suggested thatTsr0667 directly regulates the DNA inversions for at least 10 ofthe 12 invertible regions of the Tsr0667-inverlon.

FIG. 4. Involvement of Tsr0667 in shufflon-type multiple DNA inversions in the two distantly located susC/susD clusters in B. fragilis. Geneticstructures of the class V susC/susD cluster (A) and the class VI susC/susD cluster (C) are shown. The results of 25-cycle PCR assays to detect DNAinversions are shown in panels B and D, respectively. Annealing positions and orientations of the PCR primers used to detect DNA inversions areindicated by bent arrows and IRs are indicated by arrowheads in panels A and C. Genes for SusC and SusD are indicated by black and gray arrows,respectively. The primer pairs used are shown above the lanes. DNA inversions to be detected are indicated above the primer pairs. M, 100-bpladder molecular size markers.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

DISCUSSION

Numerous microbes inhabit the human digestive tract andconstitute a complex microbial ecosystem (10, 17, 20). Theprecise roles of gut microbes on human health and diseaseremain largely unknown due to their diversity (�1,000 species)and population levels (1014 microorganisms in all). Recentstudies on the human gut commensal B. fragilis have giveninsights into the molecular basis of human-microbe mutualism.For instance, a particular polysaccharide (PS A) produced byB. fragilis can modulate the host immune response and preventtissue damage due to an excessive inflammatory response (24,25). Bacteroides species tend to produce multiple types of cap-sular polysaccharide and a large number of outer membraneproteins (especially those of the SusC/SusD family) and canalter the expression levels of these surface molecules throughreversible DNA inversions. Of the Bacteroides species se-quenced thus far, B. fragilis is unique in that the most of theinvertible regions are controlled by single DNA invertases suchas Mpi specific for PS promoters (8) and Tsr19 specific for twodistant invertible promoters associated with the large encap-sulation phenotype (6, 26, 29). This mode of regulation issimilar to that of a regulon, in that a transcriptional regulatorsimultaneously controls the expression of a number of genes.

FIG. 5. Alignment of IRs within the invertible regions of theTsr0667-inverlon. IR sequences are underlined. Conserved nucleotidesare shadowed and indicated by boldface letters. The consensus motifsequence is shown below the alignments (Y � C or T; D � A, G, orT; and N � A, G, C, or T). IR-L and IR-R indicate the IRs at the leftand right junctions of each invertible region, respectively.

FIG. 6. Reconstruction of the B. fragilis Tsr0667-inverlon in an E. coli background. (A) Schematic representation of E. coli strainscontaining BF0667- or mpi-bearing plasmids and reporter plasmid harboring the substrate region for Tsr0667 (pRep 1 to 12, class II-, V-,and VI-derived invertible DNA fragments) or Mpi (pRep 13, invertible promoter region from capsular polysaccharide biosynthesis locusPS-3). BF0667 and mpi are cloned in both orientations with respect to the lac promoter (plac) of pBluescript KS II. IR indicates the IRsequence. Reporter plasmid-specific (rep-F and rep-R) and region-specific PCR primers (rep-M) for assessment of DNA inversions areshown by bent arrows. (B) PCR to assess DNA inversions on reporter plasmids. Twenty-cycle PCR amplifications were performed. F andR above each lane indicate the primer set as shown in panel A: F, rep-F � repM; and R, repM � rep-R. In the class VI inversion assay,F and R indicate the primer set shown in Fig. 4C: F, A2 � 4F; and R, A2 � 4R. Roman numerals above the lanes indicate the E. coli cloneshown in panel A.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

Therefore, we defined a regulatory unit consisting of at leasttwo invertible regions and a single master DNA invertase as an“inverlon” by combining the terms “inversion” and “regulon.”In the present study, we identified Tsr0667 in B. fragilis strainYCH46 as a master DNA invertase for an additional B. fragilisinverlon due to its apparent role in conferring the phase-variable phenotype on the SusC/SusD family of outer mem-brane proteins.

The SusC/SusD protein complex was firstly characterized inB. thetaiotaomicron as a part of the starch utilization locus (7,27, 28, 30). The SusC family of outer membrane proteinsconstitutes the largest paralogous family in the sequenced Bac-teroides species (39), which suggests that this family may play acrucial role in the stable colonization of Bacteroides in thelower digestive tract. The SusC/SusD family proteins in Bac-teroides proteomes confer the ability to bind and utilize a widerange of otherwise indigestible dietary polysaccharides (3, 23).In Bacteroides genomes, there are many loci where susC/susDpairs tightly clustered. The B. fragilis susC/susD cluster con-taining BF0667 (class V region) is conserved between the se-quenced Bacteroides species, suggesting that the clustersevolved from a common ancestor. Since the class V susC/susDcluster in B. thetaiotaomicron and B. vulgatus also contains IRssimilar to that observed in B. fragilis, the BF0667 homologuewithin this cluster in B. thetaiotaomicron and B. vulgatus is alsolikely to be involved in shufflon-type multiple DNA inversionsof the susC/susD cluster. Recent comparative transcriptomeanalysis of B. thetaiotaomicron in the ceca of suckling andweaned gnotobiotic mice have demonstrated that the expres-sion of particular sets of susC/susD homologues (BT2259,BT2260, BT2268, and BT2269) within the class V susC/susDcluster were elevated two- to sevenfold in suckling mice com-pared to weaned mice (3). Thus, the class V SusC/SusD com-plexes may be involved in the recognition or utilization ofhost-derived polysaccharides.

In our previous analysis of the B. thetaiotaomicron genome,we identified five class II regions that contain the same con-sensus motif sequence as the Tsr0667-inverlon in B. fragilis(19). In addition to the susC/susD paralogs in the class Vregion, expression of susC/susD paralogs (BT0866/BT0867,BT4038/BT4039, and BT4246/BT4247) in three of the five classII regions of B. thetaiotaomicron was also elevated in sucklingmice (3) and mice consuming dietary polysaccharide-deficientdiets (32). Furthermore, expression of these susC/susD paral-ogs was also elevated during growth on host glycan fractionsenriched for mucin O-glycans (23). These findings indicatedthat this B. thetaiotaomicron inverlon (corresponding to theTsr0667-inverlon in B. fragilis) is associated with the utilizationof host-derived glycan. Phase variation within the class II andclass V susC/susD clusters in B. fragilis and B. thetaiotaomicronmight enable these species to access areas closer to the muco-sal surface by producing a population adapted to that partic-ular niche.

As shown in the reconstruction experiment of the B. fragilisTsr0667-inverlon in an E. coli background, there appears to bea direct association of Tsr0667 with the DNA inversions of thisinverlon (Fig. 6). However, some DNA inversions occurred atseveral regions even under BF0667-negative backgrounds inboth B. fragilis (Fig. 3 and 4) and E. coli (Fig. 6). These regionstended to have long homologous stretches around the IRs.

Nucleotide sequencing of these “leaky” amplification productsrevealed that the DNA inversions occurred at breakpointsother than those associated with Tsr0667 (data not shown).Thus, it is possible that a common RecA-independent recom-bination system in prokaryotes (2, 22) involves in these leakyDNA inversions under a BF0667-negative background. Itmight also be possible that E. coli FimBE cross-react with theseregions. It has been reported that when the all-OFF mutant offlippable PS promoters was constructed in B. fragilis with thePS C locus also disrupted, the PS B promoter reverted to theON orientation even under an Mpi-negative background (21),which indicated that PS promoter DNA inversions in B. fragilismay be controlled by several mechanisms. Indeed, PS pro-moter inversions in the B. fragilis strain NCTC9343 have beenreported to be mediated not only by mpi but also by a plasmid-encoded mpi homologue when present in a heterologous strain(21). Also, it is well known that the flippable promoter (fimS)involved in the synthesis of type I pili in E. coli is controlled bya number of DNA invertases, such as FimB, FimE, IpuA,IpuB, and IpbA (HbiF) (4, 15, 37). Since the PCR assay for theTsr0667-inverlon in TSRM0667 over 30 cycles amplificationproduced amplicons from both orientation-specific primer setsfrom several regions (data not shown), it is possible that cer-tain DNA invertases cross-react with Tsr0667 recognitionsequences. To answer this question, it will be necessary toconstruct and screen multiple Tsr mutants under a BF0667-negative background.

Another important point raised from the Tsr0667-inverlonreconstruction experiments in E. coli is that leaky DNA inver-sions observed in the class II-5 and class VI regions werediminished in the presence of Mpi (Fig. 6B). Although it ispossible that Mpi is sequestering a necessary accessory factorthat is needed for the inversion, this finding indicated thepossibility of some cross talk between the Tsr0667-regulatedand Mpi-regulated inverlons. Cross talk and coordination be-tween inverlons may offer the advantage of rapid and effectivetuning of surface adaptations in response to environmentalchanges.

In summary, the present study revealed that BF0667-en-coded Tsr (Tsr0667) globally regulated DNA inversions in asmany as 12 distantly located regions, including three susC/susDclusters. Recent whole-genome sequence analyses have re-vealed that marked expansion of polysaccharide utilization(SusC/SusD family proteins, ABC transporters, and glycosyl-hydrolases) and biosynthesis (capsular polysaccharides) genesis a significant characteristic of the genus Bacteroides. An-other characteristic feature is the number of phase-variablephenotypes for large arrays of surface molecules. To estab-lish these phase-variable phenotypes, B. fragilis has evolvedat least three types of DNA invertases that are unique inthat they regulate DNA inversions at distant loci. TheseDNA invertases clearly share functional roles in surfaceadaptation: Mpi is associated with capsular polysaccharidebiosynthesis (8), Tsr19 with large encapsulation phenotypes(6, 26), and now Tsr0667 with selective expression of SusC/SusD family outer membrane proteins. It would be interest-ing to explore in future studies how these three inverlontypes interact to more deeply understand the processes ofcommensalism in human gut microbes.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

ACKNOWLEDGMENTS

This study was supported by Grants-in Aid for Encouragement ofYoung Scientists (B) and Scientific Research on the Priority Area“Applied Genomics” from the Ministry of Education, Science, Sports,Culture, and Technology of Japan.

REFERENCES

1. Bayley, D. P., E. R. Rocha, and C. J. Smith. 2000. Analysis of cepA and otherBacteroides fragilis genes reveals a unique promoter structure. FEMS Micro-biol. Lett. 193:149–154.

2. Bi, X., and L. F. Liu. 1996. DNA rearrangement mediated by invertedrepeats. Proc. Natl. Acad. Sci. USA 93:819–823.

3. Bjursell, M. K., E. C. Martens, and J. I. Gordon. 2006. Functional genomicand metabolic studies of the adaptations of a prominent adult human gutsymbiont, Bacteroides thetaiotaomicron, to the suckling period. J. Biol. Chem.281:36269–36279.

4. Bryan, A., P. Roesch, L. Davis, R. Moritz, S. Pellett, and R. A. Welch. 2006.Regulation of type 1 fimbriae by unlinked FimB- and FimE-like recombi-nases in uropathogenic Escherichia coli strain CFT073. Infect. Immun. 74:1072–1083.

5. Cerdeño-Tárraga, A. M., S. Patrick, L. C. Crossman, G. Blakely, V. Abratt,N. Lennard, I. Poxton, B. Duerden, B. Harris, M. A. Quail, A. Barron, L.Clark, C. Corton, J. Doggett, M. T. Holden, N. Larke, A. Line, A. Lord, H.Norbertczak, D. Ormond, C. Price, E. Rabbinowitsch, J. Woodward, B.Barrell, and J. Parkhill. 2005. Extensive DNA inversions in the Bacteroidesfragilis genome control variable gene expression. Science 307:1463–1465.

6. Chatzidaki-Livanis, M., M. J. Coyne, H. Roche-Hakansson, and L. E. Com-stock. 2008. Expression of a uniquely regulated extracellular polysaccharideconfers a large-capsule phenotype to Bacteroides fragilis. J. Bacteriol. 190:1020–1026.

7. Cho, K. H., and A. A. Salyers. 2001. Biochemical analysis of interactionsbetween outer membrane proteins that contribute to starch utilization byBacteroides thetaiotaomicron. J. Bacteriol. 183:7224–7230.

8. Coyne, M. J., K. G. Weinacht, C. M. Krinos, and L. E. Comstock. 2003. Mpirecombinase globally modulates the surface architecture of a human com-mensal bacterium. Proc. Natl. Acad. Sci. USA 100:10446–10451.

9. Coyne, M. J., and L. E. Comstock. 2008. Niche-specific features of theintestinal Bacteroidales. J. Bacteriol. 190:736–742.

10. Eckburg, P. B., E. M. Bik, C. N. Bernstein, E. Purdom, L. Dethlefsen, M.Sargent, S. R. Gill, K. E. Nelson, and D. A. Relman. 2005. Diversity of thehuman intestinal microbial flora. Science 308:1635–1638.

11. Flint, H. J., E. A. Bayer, M. T. Rincon, R. Lamed, and B. A. White. 2008.Polysaccharide utilization by gut bacteria: potential for new insights fromgenomic analysis. Nat. Rev. Microbiol. 6:121–131.

12. Hooper, L. V., M. H. Wong, A. Thelin, L. Hansson, P. G. Falk, and J. I.Gordon. 2001. Molecular analysis of commensal host-microbial relationshipsin the intestine. Science 291:881–884.

13. Hooper, L. V., T. Midtvedt, and J. I. Gordon. 2002. How host-microbialinteractions shape the nutrient environment of the mammalian intestine.Annu. Rev. Nutr. 22:283–307.

14. Hooper, L. V., T. S. Stappenbeck, C. V. Hong, and J. I. Gordon. 2003.Angiogenins: a new class of microbicidal proteins involved in innate immu-nity. Nat. Immunol. 4:269–273.

15. Johnson, R. C. 2002. Bacterial site-specific DNA inversion systems, p. 230–271. In N. L. Craig, R. Craigie, M. Gellert, and A. M. Lambowitz (ed.),Mobile DNA II. ASM Press, Washington, DC.

16. Krinos, C. M., M. J. Coyne, K. G. Weinacht, A. O. Tzianabos, D. L. Kasper,and L. E. Comstock. 2001. Extensive surface diversity of a commensal mi-croorganism by multiple DNA inversions. Nature 414:555–558.

17. Kurokawa, K., T. Itoh, T. Kuwahara, K. Oshima, H. Toh, A. Toyoda, H.Takami, H. Morita, V. K. Sharma, T. P. Srivastava, T. D. Taylor, H. Nogu-chi, H. Mori, Y. Ogura, D. S. Ehrlich, K. Itoh, T. Takagi, Y. Sakaki, T.Hayashi, and M. Hattori. 2007. Comparative metagenomics revealed com-monly enriched gene sets in human gut microbiomes. DNA Res. 14:169–181.

18. Kuwahara, T., M. R. Sarker, H. Ugai, S. Akimoto, S. M. Shaheduzzaman, H.Nakayama, T. Miki, and Y. Ohnishi. 2002. Physical and genetic map of theBacteroides fragilis YCH46 chromosome. FEMS Microbiol. Lett. 207:193–197.

19. Kuwahara, T., A. Yamashita, H. Hirakawa, H. Nakayama, H. Toh, N. Okada,S. Kuhara, M. Hattori, T. Hayashi, and Y. Ohnishi. 2004. Genomic analysisof Bacteroides fragilis reveals extensive DNA inversions regulating cell sur-face adaptation. Proc. Natl. Acad. Sci. USA 101:14919–14924.

20. Ley, R. E., M. Hamady, C. Lozupone, P. J. Turnbaugh, R. R. Ramey, J. S.Bircher, M. L. Schlegel, T. A. Tucker, M. D. Schrenzel, R. Knight, and J. I.Gordon. 2008. Evolution of mammals and their gut microbes. Science 320:1647–1651.

21. Liu, C. H., S. M. Lee, J. M. Vanlare, D. L. Kasper, and S. K. Mazmanian.2008. Regulation of surface architecture by symbiotic bacteria mediates hostcolonization. Proc. Natl. Acad. Sci. USA 105:3951–3956.

22. Lyu, Y. L., C. T. Lin, and L. F. Liu. 1999. Inversion/dimerization of plasmidsmediated by inverted repeats. J. Mol. Biol. 285:1485–1501.

23. Martens, E. C., H. C. Chiang, and J. I. Gordon. 2008. Mucosal glycanforaging enhances fitness and transmission of a saccharolytic human gutbacterial symbiont. Cell Host Microbe 4:447–457.

24. Mazmanian, S. K., C. H. Liu, A. O. Tzianabos, and D. L. Kasper. 2005. Animmunomodulatory molecule of symbiotic bacteria directs maturation of thehost immune system. Cell 122:107–118.

25. Mazmanian, S. K., J. L. Round, and D. L. Kasper. 2008. A microbialsymbiosis factor prevents intestinal inflammatory disease. Nature 453:620–625.

26. Patrick, S., S. Houston, Z. Thacker, and G. W. Blakely. 2009. Mutationalanalysis of genes implicated in LPS and capsular polysaccharide biosynthesisin the opportunistic pathogen Bacteroides fragilis. Microbiology 155:1039–1049.

27. Reeves, A. R., J. N. D’Elia, J. Frias, and A. A. Salyers. 1996. A Bacteroidesthetaiotaomicron outer membrane protein that is essential for utilization ofmaltooligosaccharides and starch. J. Bacteriol. 178:823–830.

28. Reeves, A. R., G. R. Wang, and A. A. Salyers. 1997. Characterization of fourouter membrane proteins that play a role in utilization of starch by Bacte-roides thetaiotaomicron. J. Bacteriol. 179:643–649.

29. Roche-Hakansson, H., M. Chatzidaki-Livanis, M. J. Coyne, and L. E. Com-stock. 2007. Bacteroides fragilis synthesizes a DNA invertase affecting both alocal and a distant region. J. Bacteriol. 189:2119–2124.

30. Shipman, J. A., J. E. Berleman, and A. A. Salyers. 2000. Characterization offour outer membrane proteins involved in binding starch to the cell surfaceof Bacteroides thetaiotaomicron. J. Bacteriol. 182:5365–5372.

31. Shoemaker, N. B., E. P. Guthrie, A. A. Salyers, and J. F. Gardner. 1985.Evidence that the clindamycin-erythromycin resistance gene of Bacteroidesplasmid pBF4 is on a transposable element. J. Bacteriol. 162:626–632.

32. Sonnenburg, J. L., J. Xu, D. D. Leip, C. H. Chen, B. P. Westover, J. Weather-ford, J. D. Buhler, and J. I. Gordon. 2005. Glycan foraging in vivo by anintestine-adapted bacterial symbiont. Science 307:1955–1959.

33. Tamura, K., J. Dudley, M. Nei, and S. Kumar. 2007. MEGA4: MolecularEvolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol.Evol. 24:1596–1599.

34. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W:improving the sensitivity of progressive multiple sequence alignment throughsequence weighting, position-specific gap penalties and weight matrix choice.Nucleic Acids Res. 22:4673–4680.

35. Valentine, P. J., N. B. Shoemaker, and A. A. Salyers. 1988. Mobilization ofBacteroides plasmids by Bacteroides conjugal elements. J. Bacteriol. 170:1319–1324.

36. Weinacht, K. G., H. Roche, C. M. Krinos, M. J. Coyne, J. Parkhill, and L. E.Comstock. 2004. Tyrosine site-specific recombinases mediate DNA inver-sions affecting the expression of outer surface proteins of Bacteroides fragilis.Mol. Microbiol. 53:1319–1330.

37. Xie, Y., Y. Yao, V. Kolisnychenko, C. H. Teng, and K. S. Kim. 2006. HbiFregulates type 1 fimbriation independently of FimB and FimE. Infect. Im-mun. 74:4039–4047.

38. Xu, J., M. K. Bjursell, J. Himrod, S. Deng, L. K. Carmichael, H. C. Chiang,L. V. Hooper, and J. I. Gordon. 2003. A genomic view of the human-Bacteroides thetaiotaomicron symbiosis. Science 299:2074–2076.

39. Xu, J., M. A. Mahowald, R. E. Ley, C. A. Lozupone, M. Hamady, E. C.Martens, B. Henrissat, P. M. Coutinho, P. Minx, P. Latreille, H. Cordum, A.Van Brunt, K. Kim, R. S. Fulton, L. A. Fulton, S. W. Clifton, R. K. Wilson,R. D. Knight, and J. I. Gordon. 2007. Evolution of symbiotic bacteria in thedistal human intestine. PLoS Biol. 5:1574–1586.



http://jb.asm.org/

Dow

nloaded from
http://jb.asm.org/

Identification of the Site-Specific DNA Invertase ... · invertase for this inverlon (designated...

Documents

Transcript of Identification of the Site-Specific DNA Invertase ... · invertase for this inverlon (designated...