Identification of the Haloarchaeal Phasin (PhaP) That Functions inPolyhydroxyalkanoate Accumulation and Granule Formation inHaloferax mediterranei

Shuangfeng Cai, Lei Cai, Hailong Liu, Xiaoqing Liu, Jing Han, Jian Zhou, and Hua Xiang

State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese Academy of Sciences, Beijing, People’s Republic of China

The polyhydroxyalkanoate (PHA) granule-associated proteins (PGAPs) are important for PHA synthesis and granule formation,but currently little is known about the haloarchaeal PGAPs. This study focused on the identification and functional analysis ofthe PGAPs in the haloarchaeon Haloferax mediterranei. These PGAPs were visualized with two-dimensional gel electrophoresis(2-DE) and identified by matrix-assisted laser desorption ionization–tandem time of flight mass spectrometry (MALDI-TOF/TOF MS). The most abundant protein on the granules was identified as a hypothetical protein, designated PhaP. A genome-wideanalysis revealed that the phaP gene is located upstream of the previously identified phaEC genes. Through an integrative ap-proach of gene knockout/complementation and fermentation analyses, we demonstrated that this PhaP is involved in PHA accu-mulation. The �phaP mutant was defective in both PHA biosynthesis and cell growth compared to the wild-type strain. Addi-tionally, transmission electron microscopy results indicated that the number of PHA granules in the �phaP mutant cells wassignificantly lower, and in most of the �phaP cells only a single large granule was observed. These results demonstrated that theH. mediterranei PhaP was the predominant structure protein (phasin) on the PHA granules involved in PHA accumulation andgranule formation. In addition, BLASTp and phylogenetic results indicate that this type of PhaP is exclusively conserved in halo-archaea, implying that it is a representative of the haloarchaeal type PHA phasin.

Polyhydroxyalkanoates (PHAs) are biodegradable polyesterspresent in most genera of bacteria (19, 38) and in Halobacte-

riaceae members of archaea (7, 20). PHAs usually accumulatewhen cells are cultivated in an environment with an excess ofcarbon sources and limited nitrogen, phosphorus, or oxygen (1).Serving as carbon and energy storage compounds, PHAs are oftenfound in the cytoplasm as insoluble inclusions that are also knownas PHA granules (1).

There has been a considerable amount of research carried outon PHA granules in bacteria. Early investigations indicated thatisolated native PHA granules contain approximately 97.5% PHA,2% proteins, and small amounts of lipids (9). Many proteinscoated onto PHA granules have been shown to be responsible forPHA synthesis and granule formation. Previously, these PHAgranule-associated proteins (PGAPs) were placed into fourcategories: (i) PHA synthases, (ii) PHA depolymerases and3-hydroxybutyrate oligomer hydrolases, (iii) the major structureproteins (phasins), and (iv) the regulatory proteins (29). A recentreview gave a broader overview of PGAPs and listed many newtypes of PGAPs, such as the newly found acyl-coenzyme A (CoA)synthetase (14, 33). In recent years, the major proteins present onPHA granules, the phasins (PhaPs), which may constitute approx-imately 5% (wt/wt) of total cellular proteins (41), have attractedmore attention. In addition to their main roles in preventing PHAgranules from aggregating and in preventing the nonspecific at-tachment of other proteins to PHA granules (37, 41), phasins areproposed to be involved in the regulation of PHA synthesis, PHAdegradation, PHA granule size control (13, 41–42), the formationof networks on the PHA granule surface (5), and even the distri-bution of PHA granules during cell division, a dramatic role dis-played by phasin PhaF (8) and the phasin-like PhaM (26).

Recently, a few enzymes involved in PHA metabolism havebeen characterized in haloarchaea, such as the PHA synthases

(PhaEC) and the PHA-specific acetoacetyl-CoA reductases(PhaB) (6, 10–12, 22). Among those, Haloferax mediterraneiPhaEC and Haloarcula marismortui PhaC have been revealed byWestern blotting to be PGAPs (12, 22). With the exception ofPhaEC, no PGAP has been investigated in haloarchaea. Sequencehomology searches for other PGAPs in haloarchaea using localBLAST (Basic Local Alignment Search Tool) searches with bacte-rial PGAPs have been performed, but no reliable sequences couldbe detected, indicating the low homology of haloarchaeal PGAPsto the bacterial ones.

As most haloarchaeal PGAP gene sequences could notbe found through homology searches, for this study, two-dimensional gel electrophoresis (2-DE) and matrix-assisted laserdesorption ionization tandem time-of-flight mass spectrometric(MALDI-TOF/TOF MS) analyses were used to separate and iden-tify the proteins located on the PHA granule in H. mediterranei. Amajor haloarchaeal phasin (PhaP) was successfully identified.Furthermore, the effects of PhaP on PHA accumulation and PHAgranule morphology also were investigated. This study providesnovel insights for the further exploration of PHA metabolism inhaloarchaea.

MATERIALS AND METHODSStrains and growth conditions. The strains used in this study are listed inTable 1. Escherichia coli JM109 was grown in Luria-Bertani medium at

Received 5 October 2011 Accepted 2 January 2012

Published ahead of print 13 January 2012

Address correspondence to Hua Xiang, xiangh@sun.im.ac.cn.

Copyright © 2012, American Society for Microbiology. All Rights Reserved.

doi:10.1128/AEM.07114-11

1946 aem.asm.org 0099-2240/12/$12.00 Applied and Environmental Microbiology p. 1946–1952

on August 21, 2018 by guest

http://aem.asm

.org/D

ownloaded from

37°C (34). H. mediterranei DF50 and �phaP were cultivated at 37°C innutrient-rich AS-168L medium (per liter, 150 g NaCl, 20 g MgSO4 · 7H2O,2 g KCl, 3 g trisodium citrate, 1 g sodium glutamate, 50 mg FeSO4 · 7H2O,0.36 mg MnCl2 · 4H2O, 5 g Bacto Casamino Acids, 5 g yeast extract, pH7.2). H. mediterranei strains harboring expression plasmids were culti-vated in AS-168SYL (medium with yeast extract omitted from AS-168L).For the PHA accumulation analysis, H. mediterranei first was grown at37°C for 2 days in AS-168L or AS-168SYL medium. Seed cultures (2.5 ml)then were inoculated into 50 ml of nutrient-limited MGL medium [perliter, 150 g NaCl, 20 g MgSO4 · 7H2O, 2 g KCl, 1 g sodium glutamate, 50mg FeSO4 · 7H2O, 0.36 mg MnCl2 · 4H2O, 10 g glucose, 5 g NH4Cl, 15 gpiperazine-N,N=-bis(2-ethanesulfonic acid), pH 7.2]. When needed, am-picillin, uracil, and 5-fluoroorotic acid (5-FOA) were added to the mediaat final concentrations of 100, 50, and 250 mg/liter, respectively.

Gene knockout and complementation. The plasmids and oligonucle-otides used in this study are listed in Tables 1 and 2. For the knockout ofthe phaP gene, a 758-bp DNA fragment located immediately upstream ofthe phaP open reading frame (ORF) and a 780-bp DNA fragment in the 3=region of the phaP gene were amplified with the primer pairs phaP-DF1/phaP-DR1 and phaP-DF2/phaP-DR2, respectively. These two DNA frag-ments were linked to the suicide plasmid pUHFX to form the integrationplasmid pDP, which was transformed into DF50, and the phaP deletionmutant was screened as previously described (17, 21). The phaP deletionmutant was confirmed by sequence analysis using the phaP-testF/phaP-testR primer pair.

For phaP gene complementation, the promoter sequence of phaP,which is located immediately upstream of the gap12 ORF (amplified byphaP-EF1 and phaP-ER1) and the coding sequence of phaP (amplified byphaP-EF2 and phaP-ER2) were linked and inserted into pWL502, result-ing in the plasmid pWLP. pWLP was transformed into the �phaP strain toverify the function of PhaP.

All PCR-amplified sequences were verified by DNA sequencing. Theplasmids were transformed into H. mediterranei with a polyethyleneglycol-mediated transformation method (3).

Isolation of PHA granules. PHA granules were isolated by sucrosedensity gradient centrifugation according to Wieczorek et al. (41). Briefly,

after a 2-day cultivation in MGL medium, the cells were collected, washed,and resuspended in TBSL buffer (per liter, 150 g NaCl, 20 g KCl, 5 gMgSO4 · 7H2O, 100 mM Tris-HCl, pH 7.1) with 1� protease inhibitorcocktail (PIC; Sigma). The suspension was subjected to three passagesthrough a French press (10,000 to 12,000 lb/in2) (Thermo SpectronicFrench pressure FA-078 cell), and 4 ml of cell lysate was loaded on adiscontinuous sucrose density gradient prepared from 2 ml each of 2.0,1.6, 1.3, and 1.0 M sucrose in 100 mM Tris-HCl (pH 7.1). After ultracen-trifugation (210,000 � g for 2 h at 4°C), a granule layer was obtainedbetween the 1.3 and 1.6 M fractions. The granules were isolated for resus-pension in 100 mM Tris-HCl (pH 7.1) buffer and subsequently wereloaded on the top of a second sucrose density gradient prepared as de-scribed above. After ultracentrifugation (210,000 � g for 2 h at 4°C), thegranules were isolated and washed twice with 100 mM Tris-HCl (pH 7.1)buffer via centrifugation (100,000 � g for 30 min at 4°C).

Analysis of PGAPs by 2-DE and MALDI-TOF/TOF MS. Proteinsfrom the native PHA granules were suspended in a solubilization buffer{7.0 M urea, 2 M thiourea, 4% (wt/vol) 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS)}. After 2 h of stirringat room temperature, the protein solution was separated by centrifuga-tion (20,000 � g at room temperature). For isoelectric focusing (IEF),25-�g protein samples were added to rehydration buffer (7.0 M urea, 2 Mthiourea, 4% [wt/vol] CHAPS, 0.28% dithiothreitol [DTT], 0.5% IPGbuffer [pH 3 to 5], 0.001% [wt/vol] bromophenol blue) for a total volumeof 450 �l. After centrifugation (20,000 � g, 10 min), the supernatant wasimmediately applied to the first dimension. The IPG strip (24 cm, pH 3.9to 5.1; Bio-Rad) was rehydrated with the protein samples overnight (0 V,5 h; 80 V, 7 h) at 20°C. The sample in the IPG strip was focused at 20°Caccording to a protocol (200 V, 30 min; 200 to 500 V, 1 min; 500 to 8,000V, 3 h; 8,000 V for a total of 80,000 volt-hours [Vh]) similar to the proce-dure described by Cho et al. (2). Following the isoelectric focusing, theIPG strips were equilibrated in buffers A and B, respectively, for 15 minwith gentle shaking. The equilibration buffers contained 50 mM Tris-HCl, pH 8.8, 6 M urea, 30% (vol/vol) glycerol, 2% (wt/vol) SDS and0.002% (wt/vol) bromophenol blue, with a supplement of 1% (wt/vol)DTT in buffer A and 2.5% (wt/vol) iodacetamide in buffer B. For thesecond dimension, the proteins were separated by electrophoresis in a14% SDS polyacrylamide gel at 1 W/gel for approximately 16 h. The pro-teins were stained with Coomassie tablets (PhastGel Blue R-350; GEHealthcare) overnight. The protein spots then were analyzed via MALDI-TOF/TOF MS using the method of Shevchenko et al. (36).

PHA accumulation assay. The PHA content and PHA compositionwere analyzed by gas chromatography as described previously (12, 22).

TEM studies. In addition, 5 to 10 ml of cell cultures in stationary phasewas harvested for transmission electron microscopy (TEM) analysis. Afterwashing twice with SP buffer (10% NaCl, 0.1 M sodium phosphate buffer,pH 7.2), the cells were resuspended in SP buffer supplemented with 2.5%(vol/vol) glutaraldehyde for primary fixation overnight at 4°C. Following

TABLE 2 Oligonucleotides used in this study

Primer 5=–3= sequencea

phaP-DF1 ATAGGTACCCCTCGTCTCCGTCCAGTCphaP-DR1 GAGGGATCCTCACTCATTTGAATCACCphaP-DF2 TCTGGATCC CTACAGGAGATAGAGGAGphaP-DR2 CGACAAGCTTCTTCGTTTGGGGTTTTGCphaP-testF GAAATCAGAGGTTCCCACAphaP-testR CGTAGTGGAGGAGTCTGAGTTphaP-EF1 GCAGGTACCCTTATGTACTTCGGTATGTGphaP-ER1 GCGGAATTCCTCCTAACTCGGTGTTGTACphaP-EF2 GCGGAATTCATGAGTGAACAAGCCAACCCphaP-ER2 TATGGATCCTCTCGGGCGGGCTAAART-F CACCCAACAACAACTCCGRF-R GCCTTCATACCATCGACCAa Sequences representing restriction sites are underlined.

TABLE 1 Strains and plasmids used in this study

Strain or plasmid Relevant characteristic(s)Source orreference

StrainsH. mediterranei

CGMCC 1.2087Wild-type strain (ATCC 33500) CGMCC

H. mediterraneiDF50

pyrF-deleted mutant of H. mediterranei 21

H. mediterranei�phaP

phaP-deleted mutant of H. mediterraneiDF50

This study

E. coli JM109 recA1 supE44 endA1 hsdR7 gyrA96relA1 thi

34

PlasmidspUBP 6.6 kb; derivative of pUBP2 by removing

the pHH9-ori region12

pUHFX 7.5 kb; derivative of pUBP by addingpyrF and its native promoter

This study

pDP 8.0 kb; integration vector of pUHFX forknockout of phaP of H. mediterranei

This study

pWL102 10.5-kb shuttle vector; Ampr Mevr 18pWL502 7.9 kb; derivative of pWL102 by

replacing Mevr with pyrF markerThis study

pWLP 8.6 kb; expression vector pWL502containing phaP and promoter ofgap12

This study

Haloarchaeal Phasin PhaP

March 2012 Volume 78 Number 6 aem.asm.org 1947

on August 21, 2018 by guest

http://aem.asm

.org/D

ownloaded from

the primary fixation, the cells were pelleted and washed three times withSP buffer. The cell pellets then were fixed with 1.0% osmium tetroxide inSP buffer for 2 h and subsequently washed three times with SP buffer. Theensuing steps were performed according to the procedure described byTian et al. (39). Photomicrographs were taken with a Philips JEOL-1400electron microscope.

Reverse transcription-PCR. The total RNA was extracted with TRIzolreagent (Invitrogen) from H. mediterranei grown in MGL medium for24 h. DNA-free total RNA was obtained after DNase (Promega) treat-ment. The cDNA was synthesized using Moloney murine leukemia virusRTase (M-MLV-RT; Promega) with random primers. The products am-plified through PCR with the primer pair RT-F/RT-R were separated byagarose gel electrophoresis.

Nucleotide sequence accession numbers. The DNA sequences ofphaP and the adjacent genes of H. mediterranei CGMCC 1.2087 reportedhere were deposited in GenBank under the accession numbers EU374220and JN980969.

RESULTSIdentification of PHA granule-associated proteins in H. medi-terranei. To isolate the PGAPs in H. mediterranei, the cells werecultivated in MGL medium, which favors PHA production due toits excess carbon and limited nitrogen and phosphorous sources.The PHA granules were collected and purified by sucrose densitygradient centrifugation. The PGAPs then were separated and an-alyzed by 2-DE. We used 2-DE methods to separate the PGAPs forseveral reasons. First, many bacteria possess multiple PhaP ho-mologs, and their molecular masses are usually similar. For exam-ple, the molecular masses of PhaP1, PhaP2, PhaP3, and PhaP4 arenearly identical in Ralstonia eutropha H16 (28). Second, opti-mized 2-DE methods have recently been established for the sepa-ration of the haloarchaeal proteins (most are around pI 4 to 5) (2,15–16). As little is known about the haloarchaeal PGAPs, we useda broad-pI-range strip (pI 3 to 10) for screening at first and a

narrow-range (pI 3.9 to 5.1) strip for the separation of the H.mediterranei PGAPs, which all are present at around pI 4 to 4.5(Fig. 1A). Interestingly, while only a few proteins were observed, aconspicuous protein spot with an apparent molecular mass ofapproximately 25 kDa accounted for more than 90% of the ob-served PGAPs (Fig. 1A). After trypsin digestion, these potentialPGAPs were analyzed by MALDI-TOF/TOF MS, and five proteinswere determined to locate on the PHA granules (Fig. 1A).

Notably, these five genes were unexpectedly located adjacent toeach other, forming a gene cluster (HFX_5217-HFX_5221) on amegaplasmid of H. mediterranei (Fig. 1B). As shown in Fig. 1B,this gene cluster likely contains two two-gene operons and amonocistronic operon. The operon constituted by HFX_5220 andHFX_5221 has been characterized to encode the two subunits ofthe PHA synthases (PhaE and PhaC) that are the key enzymes inPHA synthesis (22). HFX_5219 and HFX_5218 may compose anadditional operon exactly upstream of the phaEC operon. Inter-estingly, HFX_5219 and HFX_5218 encode two conserved hypo-thetical proteins, the predominant protein (�90%) on PHA gran-ules and a small protein with a SpoVT_AbrB domain (Pfam),respectively. As HFX_5219 encodes the predominant PGAP, wedesignated this PGAP the major phasin (PhaP) of H. mediterranei.We also temporarily named the HFX_5218-encoded proteinGAP12 based on its small mass (12 kDa). Directly upstream ofHFX_5218 is HFX_5217, which has a reading frame oriented awayfrom HFX_5218. HFX_5217 is annotated as a putative enoyl-CoAhydratase (MaoC), an enzyme that also may be involved in PHAmetabolism, as it shows high identities (45 and 36%, respectively)to PhaJ1 and PhaJ4 of Pseudomonas aeruginosa.

Analysis of phaP transcription in H. mediterranei. The pre-dicted ORF of phaP overlaps with the gap12 ORF by 8 bp (Fig. 2A).The genetic organization of gap12 and phaP suggested theircotranscription. Whether they were transcribed as a unit was in-vestigated by reverse transcription-PCR (RT-PCR). As PhaP andGAP12 have been shown to exist on PHA granules, we onlychecked the transcription unit spanning both genes with theprimer pair RT-F and RT-R inside the ORFs of gap12 and phaP. APCR product with the expected length was detected in the cDNA

FIG 1 PHA granule-associated proteins of H. mediterranei. (A) A 2-DE mapof PGAPs of H. mediterranei. The granule samples were collected from cells instationary phase in MGL medium. Twenty-five �g of PHA granule proteinswas loaded for the first-dimension IEF. (B) Genetic organization of the PGAPgene cluster. The arrows indicate the directions of gene transcription.HFX_5217, MaoC (219 aa), enoyl-CoA hydratase; HFX_5218, GAP12 (110aa), conserved hypothetical protein; HFX_5219, PhaP (154 aa), phasin;HFX_5220, PhaE (182 aa), PHA synthase subunit PhaE; HFX_5221, PhaC(492 aa), PHA synthase subunit PhaC.

FIG 2 Transcriptional analysis of the gap12 and phaP genes. (A) The geneticorganization of gap12 and phaP in H. mediterranei. The overlapping region isshown in detail. The locations of the primers RT-F and RT-R are indicated. (B)Agarose gel of RT-PCR products (385 bp) amplified with primers RT-F/RT-Rusing the following templates: lane 1, total RNA; lane 2, reverse transcripts oftotal RNA; lane 3, water; lane 4, H. mediterranei genomic DNA.

Cai et al.

1948 aem.asm.org Applied and Environmental Microbiology

on August 21, 2018 by guest

http://aem.asm

.org/D

ownloaded from

sample as well as the genomic DNA sample but was absent fromthe mRNA sample (Fig. 2B). These results indicated that gap12and phaP could be cotranscribed during PHA accumulation.

In Pseudomonas oleovorans, two independent promoters forthe major phasin gene phaF have been identified (30, 35). As theprotein level of PhaP is much higher than that of GAP12, as de-tected by 2-DE (Fig. 1A), we examined whether an additionalphaP promoter was present in H. mediterranei. We constructedexpression plasmids with a modified gfp gene (32) fused to theupstream region of the gap12 and phaP genes, named putativepromoters Pgap12 and Pp, respectively. After plasmid transforma-tion, the expression of the gfp gene in H. mediterranei was moni-tored during different growth phases. A remarkable fluorescencesignal of green fluorescent protein was detected under the controlof the promoter Pgap12, whereas no fluorescent signal was detectedfrom that controlled by the putative promoter Pp. These resultssuggest that the upstream region of the phaP gene did not havepromoter activity. Therefore, there is likely only one promoter(Pgap12) for the phaP gene, and the higher abundance of PhaPproteins compared to that of GAP12 proteins may be due to thehigher translation efficiency or stability of PhaP.

Effect of PhaP on cell growth and PHA accumulation in H.mediterranei. As part of the functional analysis of the putativePhaP, the phaP gene was deleted using a double-crossover homol-ogous recombination method in the uracil auxotrophic strain(�pyrF) named H. mediterranei DF50 (21). The DF50 strain ex-hibits a wild-type phenotype with respect to growth behavior andPHA accumulation (data not shown). The knockout of phaP(�phaP mutant) was confirmed by DNA sequence analysis.

To determine the growth behavior and the PHA accumulationcapability of the �phaP mutant, the �phaP and DF50 strains werecultivated in MGL medium. The growth of the �phaP mutant wasdefective, as measured by optical density. The growth rate and thefinal cell concentration at the stationary phase for the �phaP mu-

tant both were lower than that of DF50. After cultivation for 3 and5 days, the cells were collected for the gas chromatographic anal-ysis of PHA production. A significant decrease in PHA productionin the �phaP mutant strain was observed compared to that of theDF50 strain (Table 3). The DF50 strain, at early stationary phase (3days), produced 1.95 g/liter of PHA, while the �phaP mutantstrain only produced 1.32 g/liter PHA even after 5 days of fermen-tation. When phaP was deleted, the 3-hydroxyvalerate (3HV) con-tent was slightly decreased. When the �phaP mutant strain har-bored a plasmid that expressed the phaP gene, high PHAaccumulation was restored (Table 3). These results revealed thatPhaP was important for cell growth and PHA production but wasnot essential.

Effect of PhaP on PHA granule morphology in H. mediterra-nei. The PHA granule morphology of cells in the stationary phasewas investigated by transmission electron microscopy (Fig. 3). InDF50 and wild-type strains, most cells harbored multiple granulesthat were generally 100 to 500 nm in diameter. However, in the�phaP mutant strain, usually only one large round granule, ap-proximately 1 �m in diameter, existed in most cells, while in asignificant proportion of the other cells no granule was observed.The complementary expression of the phaP gene in the �phaPmutant resulted in a return to multiple moderately sized granulesbeing produced in the cell (Fig. 3). These phenotypes were consis-tent with reduced PHA accumulation, implying that PhaP is im-portant for PHA granule formation and separation. It played im-portant roles in preventing PHA granules from aggregating. Asimilar phenomenon was reported for several bacteria strains withphasin proteins absent or truncated (27, 41). Therefore, this pre-dominant PhaP identified in the PHA granules would be a sub-stantial PHA granule structural protein in H. mediterranei.

Sequence and phylogenetic analysis of PhaP homologs inHaloarchaea. A search of the homologous proteins of this H.mediterranei PhaP with NCBI BLAST indicated that 16 conserved

TABLE 3 PHA accumulation in H. mediterranei strainsa

Day Strain PHBVb content (% [wt/wt]) 3HV fraction (mol%)Cell dry wt(g/liter)

PHBV concn(g/liter)

3 DF50 38.37 � 0.23 10.28 � 0.12 5.09 � 0.10 1.95 � 0.033 �phaP 22.39 � 0.32 9.02 � 0.25 5.42 � 0.07 1.21 � 0.023 �phaP(pWLP) 38.73 � 0.57 11.60 � 0.59 4.20 � 0.04 1.63 � 0,025 DF50 37.20 � 0.48 10.08 � 0.19 4.49 � 0.17 1.67 � 0.055 �phaP 26.95 � 1.55 8.80 � 0.20 4.89 � 0.11 1.32 � 0.105 �phaP(pWLP) 47.30 � 1.76 9.54 � 0.07 4.26 � 0.07 2.01 � 0.09a Cells were cultured at 37°C for 3 and 5 days. Data are shown as means � standard deviations (n � 3).b PHBV, poly(3-hydroxybutyrate-co-3-hydroxyvalerate).

FIG 3 Transmission electron microphotographs of PHA granules in H. mediterranei strains. (A) H. mediterranei DF50. (B) H. mediterranei DF50/�phaP mutant.(C) H. mediterranei DF50/�phaP::pWLP. The cells were cultivated in MGL medium.

Haloarchaeal Phasin PhaP

March 2012 Volume 78 Number 6 aem.asm.org 1949

on August 21, 2018 by guest

http://aem.asm

.org/D

ownloaded from

hypothetical proteins from 11 haloarchaeal species (Halorhabdusutahensis, Haloarcula hispanica, Halomicrobium mukohataei,H. marismortui, Halorhabdus tiamatea, Halogeometricumborinquense, Haloterrigena turkmenica, Halalkalicoccus jeotgali,Halopiger xanaduensis, Haloquadratum walsbyi, and Natronomo-nas pharaonis) were significantly similar, with identity of approx-imately 30% and similarity greater than 50%. The putative halo-archaeal phasins were clustered together on a phylogenetic treegenerated using the phasins from representative bacteria and thehaloarchaeal PhaP homologs (Fig. 4). A multiple-alignment anal-ysis of the amino acid sequences from the putative haloarchaealPhaPs revealed several conserved amino acid residues (Fig. 5). TheC-terminal regions of these proteins were rich in the acidic resi-dues Glu (E) and Asp (D). These conserved residues and D/E-richregions may play an important role in their function in haloar-chaea.

We have also analyzed the genes adjacent to the phaP ho-mologs in the 11 haloarchaea species using available genomic data.With the exception of N. pharaonis, all of the species carried thephaE and phaC genes, which all were located adjacent to the phaP-homologous genes. Interestingly, a similar gene cluster composedof maoC-gap12-phaP-phaE-phaC was present in 7 of the 10 spe-cies, with the exception of H. utahensis, H. borinquense, and H.jeotgali, which harbored a PGAP gene cluster lacking the maoCgene. Based on the phylogenetic analysis, alignment data, andgenomic arrangement, we propose that the homologs of H. medi-terranei PhaP represent unique haloarchaeal phasins and performan important function in haloarchaeal PHA biosynthesis.

DISCUSSION

While an increasing number of studies have addressed the metab-olism of PHA in haloarchaea, there are few studies that focused onhaloarchaeal PHA granule proteins. In this study, with the explo-ration of the PHA granule proteome of H. mediterranei, fivegranule-associated proteins were identified, and they were found,unexpectedly, to be encoded by genes in a cluster. The two PHAsynthase subunits (PhaE and PhaC) were determined to be PHAgranule associated, which is consistent with previous observations(22). The other PGAPs detected were a putative enoyl-CoA hydra-tase (MaoC) and the small conserved hypothetical proteinsGAP12 and PhaP, the most abundant PGAPs. The inconsistencybetween the apparent molecular mass (25 kDa) of PhaP in the2-DE gel and the deduced value (18 kDa) from amino acid se-quence analysis could be due to the strong acidic character ofhalophilic proteins, which usually significantly affects their appar-ent molecular mass as measured by SDS-PAGE. Notably, al-though many proteins are characterized as phasins in bacteria,including PhaP/PhaP1, PhaP2, PhaP3, PhaP4, PhaF, PhaI, thenewly identified PhaP5 (25), and phasin-like PhaM (26), the ho-mologous PhaP proteins of H. mediterranei (PhaPhme) only existin haloarchaea. Thus, the PhaPhme protein identified in this studyrepresents a novel (haloarchaeal type) phasin family.

After a genome-wide investigation into the 12 haloarchaea thatharbored the phaP gene, most of these archaea were found to possessa similar pha cluster, with the five genes (maoC-gap12-phaP-phaE-phaC) having the same organization as that in H. mediterranei. The

FIG 4 Bootstrap neighbor-joining phylogenetic tree of the conserved phasin sequences from haloarchaea and bacteria. The tree was constructed based on thededuced amino acid sequence of each protein using MEGA version 5.0. The GenBank accession numbers or locus tags are given. The numbers on the branchesindicate the bootstrap values (percentages) based on 1,000 replications. Scale bar, 0.2 substitution per site.

Cai et al.

1950 aem.asm.org Applied and Environmental Microbiology

on August 21, 2018 by guest

http://aem.asm

.org/D

ownloaded from

extensive existence of this pha gene cluster indicates an evolutionarilyconserved pha gene cluster unique to haloarchaea. Therefore, thisconfirms that the five genes are functionally related. During the in-vestigation of the organization of the phaP genes and their neighborgenes in bacteria, most of the phaP genes were found to be carried inmonocistronic operons (23, 40). In the Pseudomonas genus, althoughthe two phasin genes phaI and phaF are in an operon, the gene phaFstill possesses its own promoter nearby (30, 35). In the known regu-lation models for phasins, all phasin genes harbor their own pro-moter, which is regulated by PhaR. However, RT-PCR analysis andpromoter activity analysis in this study revealed that gap12 (likely aregulator) and phaPhme were cotranscribed under a single promoter,implying that there is a novel mechanism for phaPhme expressionregulation in haloarchaea. The further exploration of the roles of thepha cluster genes could help elucidate the regulation of PHA synthesisand granule assembly.

Phasins in bacteria, which function as PHA granule structureproteins, have been characterized as small amphiphilic proteins(mostly 11 to 25 kDa) that consist of hydrophobic domains forPHA binding and hydrophilic domains exposed to the cytoplasm(29). A hydrophobicity profile of PhaPhme also displays amphiphi-lic characteristics. Although PhaPhme shares no sequence homol-ogy with bacterial phasins, secondary-structure prediction analy-sis of PhaPhme indicates high alpha helix (83.23%) content,

resembling that of phasins in bacteria (24). Studies of bacteriaindicate that the absence of the granule structure protein phasinled to a decrease in PHA synthase activity (31). When the phasingenes are knocked out or disrupted, the bacterial strains suffer aPHA accumulation defect. PHA fermentation experiments indi-cate that the knockout of phaPhme also significantly reduces PHAproduction in H. mediterranei. In addition, in transmission elec-tron microscopy studies, only one large granule was produced bymost of the cells lacking the PhaP protein. These results suggestthat PhaPhme acted as the major structural protein on the PHAgranules, and that the protein facilitates PHA accumulation andgranule segregation.

It is worth mentioning that three putative phaP genes are found inN. pharaonis, but the species lacks detected phaEC genes in the ge-nome. As several new functions of PhaP have been proposed recently,including a stress-reducing effect (4) and a role in granule distribu-tion during cell division (8), the autonomous existence of phaP sug-gests that phaP has other functions independent of PHA synthesis inN. pharaonis and in other haloarchaea, and comprehensive futureinvestigations are needed to resolve these issues.

ACKNOWLEDGMENTS

This work was supported by grants from the National 863 Programof China (2009AA09Z401), the National Natural Science Foundation of

FIG 5 Multiple alignments of amino acid sequences of PhaP homologous proteins from 11 haloarchaea species: H. mediterranei, H. utahensis, H. hispanica, H.mukohataei, H. marismortui, H. tiamatea, H. borinquense, H. turkmenica, H. jeotgali, H. xanaduensis, and H. walsbyi. The corresponding locus tags are given asshown in Fig. 4. Amino acids are given using standard one-letter abbreviations, and the numbers indicate the positions of the amino acids within the respectiveproteins. The black shading indicates identical residues, and the gray shading indicates similar residues.

Haloarchaeal Phasin PhaP

March 2012 Volume 78 Number 6 aem.asm.org 1951

on August 21, 2018 by guest

http://aem.asm

.org/D

ownloaded from

China (30621005, 30830004, 30925001), and the Chinese Academy ofSciences (KSCX2-EW-G-2-4).

REFERENCES1. Anderson AJ, Dawes EA. 1990. Occurrence, metabolism, metabolic role,

and industrial uses of bacterial polyhydroxyalkanoates. Microbiol. Rev.54:450 – 472.

2. Cho CW, et al. 2003. Improvement of the two-dimensional gel electro-phoresis analysis for the proteome study of Halobacterium salinarum. Pro-teomics 3:2325–2329.

3. Cline SW, Lam WL, Charlebois RL, Schalkwyk LC, Doolittle WF. 1989.Transformation methods for halophilic archaebacteria. Can. J. Microbiol.35:148 –152.

4. de Almeida A, Catone MV, Rhodius VA, Gross CA, Pettinari MJ. 2011.Unexpected stress-reducing effect of PhaP, a poly(3-hydroxybutyrate)granule-associated protein, in Escherichia coli. Appl. Environ. Microbiol.77:6622– 6629.

5. Dennis D, Sein V, Martinez E, Augustine B. 2008. PhaP is involved in theformation of a network on the surface of polyhydroxyalkanoate inclusionsin Cupriavidus necator H16. J. Bacteriol. 190:555–563.

6. Feng B, et al. 2010. Identification of the phaB genes and analysis of thePHBV precursor supplying pathway in Haloferax mediterranei. Wei ShengWu Xue Bao 50:1305–1312.

7. Fernandez-Castillo R, Rodriguez-Valera F, Gonzalez-Ramos J, Ruiz-Berraquero F. 1986. Accumulation of poly(beta-hydroxybutyrate) byhalobacteria. Appl. Environ. Microbiol. 51:214 –216.

8. Galán B, et al. 2011. Nucleoid-associated PhaF phasin drives intracellularlocation and segregation of polyhydroxyalkanoate granules in Pseudomo-nas putida KT2442. Mol. Microbiol. 79:402– 418.

9. Griebel R, Smith Z, Merrick JM. 1968. Metabolism of poly-beta-hydroxybutyrate. I. Purification, composition, and properties of nativepoly-beta-hydroxybutyrate granules from Bacillus megaterium. Biochem-istry 7:3676 –3681.

10. Han J, et al. 2010. Wide distribution among halophilic archaea of a novelpolyhydroxyalkanoate synthase subtype with homology to bacterial typeIII synthases. Appl. Environ. Microbiol. 76:7811–7819.

11. Han J, Lu Q, Zhou L, Liu H, Xiang H. 2009. Identification of thepolyhydroxyalkanoate (PHA)-specific acetoacetyl coenzyme A reductaseamong multiple FabG paralogs in Haloarcula hispanica and reconstruc-tion of the PHA biosynthetic pathway in Haloferax volcanii. Appl. Envi-ron. Microbiol. 75:6168 – 6175.

12. Han J, Lu Q, Zhou L, Zhou J, Xiang H. 2007. Molecular characterizationof the phaECHm genes, required for biosynthesis of poly(3-hydroxybutyrate) in the extremely halophilic archaeon Haloarcula maris-mortui. Appl. Environ. Microbiol. 73:6058 – 6065.

13. Handrick R, et al. 2004. Unraveling the function of the Rhodospirillumrubrum activator of polyhydroxybutyrate (PHB) degradation: the activa-tor is a PHB-granule-bound protein (phasin). J. Bacteriol. 186:2466 –2475.

14. Jendrossek D. 2009. Polyhydroxyalkanoate granules are complex subcel-lular organelles (carbonosomes). J. Bacteriol. 191:3195–3202.

15. Karadzic IM, Maupin-Furlow JA. 2005. Improvement of two-dimensional gel electrophoresis proteome maps of the haloarchaeon Ha-loferax volcanii. Proteomics 5:354 –359.

16. Kirkland PA, Busby J, Stevens S, Jr, Maupin-Furlow JA. 2006. Trizol-based method for sample preparation and isoelectric focusing of halo-philic proteins. Anal. Biochem. 351:254 –259.

17. Krebs MP, Mollaaghababa R, Khorana HG. 1993. Gene replacement inHalobacterium halobium and expression of bacteriorhodopsin mutants.Proc. Natl. Acad. Sci. U. S. A. 90:1987–1991.

18. Lam WL, Doolittle WF. 1989. Shuttle vectors for the archaebacteriumHalobacterium volcanii. Proc. Natl. Acad. Sci. U. S. A. 86:5478 –5482.

19. Lee SY. 1996. Bacterial polyhydroxyalkanoates. Biotechnol. Bioeng.49:1–14.

20. Legat A, Gruber C, Zangger K, Wanner G, Stan-Lotter H. 2010. Iden-tification of polyhydroxyalkanoates in Halococcus and other haloarchaealspecies. Appl. Microbiol. Biotechnol. 87:1119 –1127.

21. Liu H, Han J, Liu X, Zhou J, Xiang H. 2011. Development of pyrF-basedgene knockout systems for genome-wide manipulation of the archaea Ha-

loferax mediterranei and Haloarcula hispanica. J. Genet. Genomics 38:261–269.

22. Lu Q, Han J, Zhou L, Zhou J, Xiang H. 2008. Genetic and biochemicalcharacterization of the poly(3-hydroxybutyrate-co-3-hydroxyvalerate)synthase in Haloferax mediterranei. J. Bacteriol. 190:4173– 4180.

23. McCool GJ, Cannon MC. 1999. Polyhydroxyalkanoate inclusion body-associated proteins and coding region in Bacillus megaterium. J. Bacteriol.181:585–592.

24. Neumann L, et al. 2008. Binding of the major phasin, PhaP1, fromRalstonia eutropha H16 to poly(3-hydroxybutyrate) granules. J. Bacteriol.190:2911–2919.

25. Pfeiffer D, Jendrossek D. 2011. Interaction between poly(3-hydroxybutyrate)granule-associated proteins as revealed by two-hybrid analysis and iden-tification of a new phasin in Ralstonia eutropha H16. Microbiology 157:2795–2807.

26. Pfeiffer D, Wahl A, Jendrossek D. 2011. Identification of a multifunc-tional protein, PhaM, that determines number, surface to volume ratio,subcellular localization and distribution to daughter cells of poly(3-hydroxybutyrate), PHB, granules in Ralstonia eutropha H16. Mol. Micro-biol. 82:936 –951.

27. Pieper-Fürst U, Madkour MH, Mayer F, Steinbüchel A. 1995. Identifi-cation of the region of a 14-kilodalton protein of Rhodococcus ruber that isresponsible for the binding of this phasin to polyhydroxyalkanoic acidgranules. J. Bacteriol. 177:2513–2523.

28. Pötter M, et al. 2004. The complex structure of polyhydroxybutyrate(PHB) granules: four orthologous and paralogous phasins occur in Ral-stonia eutropha. Microbiology 150:2301–2311.

29. Pötter M, Steinbüchel A. 2005. Poly(3-hydroxybutyrate) granule-associated proteins: impacts on poly(3-hydroxybutyrate) synthesis anddegradation. Biomacromolecules 6:552–560.

30. Prieto MA, Bühler B, Jung K, Witholt B, Kessler B. 1999. PhaF, apolyhydroxyalkanoate-granule-associated protein of Pseudomonas oleo-vorans GPo1 involved in the regulatory expression system for pha genes. J.Bacteriol. 181:858 – 868.

31. Ren Q, de Roo G, Witholt B, Zinn M, Thöny-Meyer L. 2010. Influenceof growth stage on activities of polyhydroxyalkanoate (PHA) polymeraseand PHA depolymerase in Pseudomonas putida U. BMC Microbiol. 10:254.

32. Reuter CJ, Maupin-Furlow JA. 2004. Analysis of proteasome-dependentproteolysis in Haloferax volcanii cells, using short-lived green fluorescentproteins. Appl. Environ. Microbiol. 70:7530 –7538.

33. Ruth K, de Roo G, Egli T, Ren Q. 2008. Identification of two acyl-CoAsynthetases from Pseudomonas putida GPo1: one is located at the surfaceof polyhydroxyalkanoates granules. Biomacromolecules 9:1652–1659.

34. Sambrook J, Russell DW. 2001. Molecular cloning: a laboratory manual,3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

35. Sandoval Á., et al. 2007. Genetic and ultrastructural analysis of differentmutants of Pseudomonas putida affected in the poly-3-hydroxy-n-alkanoate gene cluster. Environ. Microbiol. 9:737–751.

36. Shevchenko A, Wilm M, Vorm O, Mann M. 1996. Mass spectrometricsequencing of proteins silver-stained polyacrylamide gels. Anal. Chem.68:850 – 858.

37. Steinbüchel A, et al. 1995. Considerations on the structure and biochem-istry of bacterial polyhydroxyalkanoic acid inclusions. Can. J. Microbiol.41(Suppl. 1):94 –105.

38. Steinbüchel A, Füchtenbusch B. 1998. Bacterial and other biologicalsystems for polyester production. Trends Biotechnol. 16:419 – 427.

39. Tian J, Sinskey AJ, Stubbe J. 2005. Kinetic studies of polyhydroxybu-tyrate granule formation in Wautersia eutropha H16 by transmission elec-tron microscopy. J. Bacteriol. 187:3814 –3824.

40. Wang C, et al. 2007. Influence of the poly-3-hydroxybutyrate (PHB)granule-associated proteins (PhaP1 and PhaP2) on PHB accumulationand symbiotic nitrogen fixation in Sinorhizobium meliloti Rm1021. J. Bac-teriol. 189:9050 –9056.

41. Wieczorek R, Pries A, Steinbüchel A, Mayer F. 1995. Analysis of a24-kilodalton protein associated with the polyhydroxyalkanoic acid gran-ules in Alcaligenes eutrophus. J. Bacteriol. 177:2425–2435.

42. York GM, Stubbe J, Sinskey AJ. 2001. New insight into the role of thePhaP phasin of Ralstonia eutropha in promoting synthesis of polyhydroxy-butyrate. J. Bacteriol. 183:2394 –2397.

Cai et al.

1952 aem.asm.org Applied and Environmental Microbiology

on August 21, 2018 by guest

http://aem.asm

.org/D

ownloaded from