(:opyright 0 1991 by the Genetics Society of America

Identification of Nucleotide Substitutions Necessary for Trans-Activation of mariner Transposable Elements in Drosophila: Analysis of Naturally

Occurring Elements

Kyoko Maruyama, Kathleen D. Schoor and Daniel L. Hart1 Department of Genetics, Washington University School of Medicine, St. Louis, Missouri 631 10-1095

Manuscript received February 5 , 1991 Accepted April 13, 199 1

ABSTRACT Six copies of the mariner element from the genomes of Drosophila mauritiana and Drosphila simulans

were chosen at random for DNA sequencing and functional analysis and compared with the highly active element Mosl and the inactive element peach. All elements were 1286 base pairs in length, but among them there were 18 nucleotide differences. As assayed in Drosophila melanogaster, three of the elements were apparently nonfunctional, two were marginally functional, and one had moderate activity that could be greatly increased depending on the position of the element in the genome. Both molecular (site-directed mutagenesis) and evolutionary (cladistic analysis) techniques were used to analyze the functional effects of nucleotide substitutions. The nucleotide sequence of the element is the primary determinant of function, though the activity level of elements is profoundly influenced by position effects. Cladistic analysis of the sequences has identified a T --$ A transversion at position 1203 (resulting in a Phe + Leu amino acid replacement in the putative transposase) as being primarily responsible for the low activity of the barely functional elements. Use of the sequences from the more distantly related species, Drosophila yakuba and Drosophila teissieri, as outside reference species, indicates that functional mariner elements are ancestral and argues against their origination by a novel mutation or by recombination among nonfunctional elements.

M ANY mutations that have major phenotypic ef- fects in higher organisms are the result of

insertions of transposable elements in or near struc- tural or regulatory genes (review in BERG and HOWE 1989). For example, in Drosophila melanogaster the transposable elements P , Z and hobo are mobilized in the progeny of certain crosses, resulting in high rates of transposition, mutation and other genetic abnor- malities referred to collectively as “hybrid dysgenesis” (BLACKMAN and GELBART 1989; ENGELS 1989; FIN- NEGAN 1989). With regard to some other transposable elements, strains with high rates of transposition some- times arise spontaneously from genetic backgrounds in which the transposable element is relatively quies- cent. These strains are also characterized by high rates of forward and reverse mutation. Examples of this type include the transposable element mariner, discov- ered originally in Drosophila mauritiana (BRYAN, JA- COBSON and HARTL 1987), in which strains with high levels of transposition and excision result from the presence of highly active mariner elements in the genome (MEDHORA, MACPEEK and HARTL 1988).

For purposes of this paper, we define an active mariner element as one capable of mobilizing itself or other mariner elements. Operationally, highly active mariner elements can be identified through their ef- fect on a particular allele of the white gene, (BRYAN, JACOBSON and HARTL 1987; MEDHORA,

( ;wrt ics 128: 777-784 (Auguat. 1991)

MACPEEK and HARTL 1988), which contains an inac- tive copy of mariner, designated peach ( p c h ) , inserted in the 5’ noncoding region of the white gene. In the absence of active mariner elements elsewhere in the genome, the phenotype of z P h is one of uniformly peach-colored eyes (GARZA et al. 1991). Functional, but low activity, mariner elements elsewhere in the genome result in occasional red patches of pigmented facets on an otherwise peach-colored background. However, when one or more highly active mariner elements are present in the genome, very high rates of somatic and germline excision ofpch occur. Somatic excision of pch is observed phenotypically as eye-color mosaicism in virtually every fly, ranging in extent from a salt-and-pepper sprinkling of pigmented facets to large, overlapping patches. In extreme cases, the eye is almost fully pigmented. Germline excision of pch is observed as a high rate of reversion to wildtype eye color in the offspring. The highly active mariner elements are designated Mos (for mosaic) elements, and they have been shown to be responsible for high forward mutation rates at other loci (BRYAN, GARZA and HARTL 1990).

In principle, highly active mariner elements may be generated spontaneously by several mechanisms, which may not be mutually exclusive. In one model, based on position effects, a highly active element arises from a moderate or low activity element that trans-

778 K. Maruyama, K. D. Schoor and D. L. Hart1

poses to a new genomic position and becomes highly expressed. Another model invokes mutation as the process by which a highly active element arises from an inactive element. A third model ascribes a key role to recombination or gene conversion in forming highly active elements by exchange between low activ- ity or inactive elements. This is the mechanism sug- gested to be responsible for generating variability in Ty elements in Saccharomyces cerevisiae (BOEKE 1989). Another mechanism, methylation, is shown to be as- sociated with the change in the state of activity in some transposable elements in maize (FEDOROFF 1989), but methylation is not observed in Drosophila (ASHBURNER 1989). In the case of mariner, the highly active element Mosl is the same length as the inactive pch element (1286 base pairs) and differs from pch at 11 nucleotide positions (MEDHORA, MARUYAMA and HARTL 199 1). Experimental analysis of chimeric mol- ecules between Mosl and pch has shown that more than one nucleotide substitution is responsible for the loss of function in pch, indicating that pch could not become active by position effect or any single nucleo- tide substitution resulting from mutation or recom- bination. The source of highly active mariner elements must therefore be other elements in the genome. Therefore, to understand the origin of Mos elements, it is necessary to examine other mariner elements in the genome, to analyze the functional effects of dif- ferences in nucleotide sequence, and to evaluate the role genomic position plays in Mos expression,

The experimental system poses a number of prac- tical difficulties, however. The first problem results from the fact that 20-30 copies of mariner are found in the genome of D. mauritiana UACOBSON, MEDHORA and HARTL 1986). These elements make it difficult to separate the activity of any particular mariner from the background effect of the others, or to trace the transposition of a specific element into new positions in the genome. The second problem arises in attempt- ing to analyze the effects of multiple nucleotide sub- stitutions on the function of mariner elements. Given a high degree of heterogeneity at the nucleotide level, it is difficult to assess the functional importance of any single nucleotide substitution by simply inspecting sequences and employing site-directed mutagenesis.

To eliminate problems resulting from copies of mariner present in the genetic background, we have used strains of D. melanogaster into which the Wpch

allele was introduced by germline transformation (GARZA et al. 1991). Other than the pch element, these strains carry no other mariner elements. Germline transformation with the P element (RUBIN and SPRA- DLING 1983) was used to transfer single mariner ele- ments from D. mauritiana into the Wpch D. melanogaster, and the activity of the transferred elements was as- sayed by estimating the rate of excision of pch element

in somatic and germline cells. The absence of mariner elements in the D. melanogaster genetic background enables the functional assay of individual elements and also allows the study of the position effects as they transpose to a new genomic location.

T o address the problem which arises as a result of the high sequence heterogeneity of mariner elements, we have used the technique of cladistic analysis, a tool from evolutionary biology, to study the association between nucleotide differences and functional varia- tion among mariner elements. (For a similar applica- tion of cladistic analysis, see AQUADRO et al. 1986; TEMPLETON, BOERWINKLE and SING 1987.) Cladistic analysis is a way of organizing objects ( i . e . , mariner sequences) into hierarchically ordered sets, according to shared derived characters ( i e . , nucleotide substi- tutions) that are unique to, and thus defining charac- teristics of, particular lineages (HENNIG 1966). Rec- ognition of the shared derived characters among a set of mariner elements allows one to classify them into nested sets and construct a cladogram that represents mutational steps describing the evolutionary relation- ships among the elements. Our basic assumption in using the cladistic analysis is that any mutation that affects function should be recognizable within the historical relationships of mariner elements organized into a cladogram. This approach should allow us to identify functionally important mutations that hap- pened earliest in the history of mariner evolution, since they are expected to be shared by the largest subset of elements showing a similar degree of activity, with- out having to study the effect of every base substitu- tion. In particular, the cladistic approach should iden- tify which base substitutions are responsible, in a historical sense, for causing the functional difference between pch and M o s l , as well as other mariner ele- ments. An additional advantage of the cladistic ap- proach is that, if highly active elements are generated by recombination, they should be associated with in- consistencies in the cladogram.

Multiple mariner elements have been isolated from D. mauritiana and its sibling species, Drosophila simu- lans, and their functional effects have been studied by introducing them into the germline of D. melanogaster. Our results suggest that functional mariner sequences are ancestral. Functional elements constitute only a small subset of the mariner elements that have been sequenced, and they are capable of becoming highly active by transposition into the genomic sites where position effects enhance expression. We have not found any evidence supporting a role for recombina- tion in creating active elements.

MATERIALS AND METHODS

Cloning and sequencing: A X1059 library was prepared from a nonmosaic up'* strain of D. mauritiana UACOBSON,

Functional Analysis of mariner 779

MEDHORA and HARTL 1986). After screening the library with an SspI-NheI internal fragment from mariner (MARUY- AMA and HARTL 1991), DNA was prepared from 20 positive hybridizing clones by the method of HELMS et al. (1 985), 18 of which were confirmed to represent independent copies of mariner by agarose gel electrophoresis. Five clones were chosen randomly for further study. The DNA fragment containing mariner from each lambda clone was subcloned into M13mp18 and M13mp19 and sequenced by the di- deoxy chain termination method (SANCER, NICKLEN and COULSON 1977) using Sequenase (United States Biochemi- cal).

Sitdirected mutagenesis: Mutagenesis was carried out as described in DUBOSE and HARTL (1989). Transformants were screened with the mutagenic oligonucleotide labeled with [y-:''P]ATP, and putative mutants were sequenced for confirmation. For Ma351, ACGCTCAATTCGCGCCAA- AC (866), CGTTACTGGAGATGAAAAATGG (864) and GGACAACCGCCCACATCGAC (902) were used (both 864 and 902 were for the sense strand, whereas 866 was for the anti-sense strand). For Mosl , GTTTGGCGCA-

ATG (891) and GGACAACCGLCCACI\TCGAC (893) were used (all are for the sense strand).

Germline transformation: Each mariner element was cloned into the P element transformation vector Carnegie 20 (RURIN and SPRADLINC 1983). The DNA fragment con- taining mariner and its flanking regions was isolated from each M13 clone, the ends repaired with the Klenow frag- ment of DNA polymerase, and ligated into the HpaI site of the transformation vector. The orientation of each insert was determined by digesting the clones with SalI, which is a unique restriction site present in mariner at position 349. For the transformation experiments, we used clones with the same orientation of mariner as the clones in GARZA et al. (1991).

Both the transformation vector DNA and helper DNA (the pr25.7WC plasmid of KARESS and RUBIN 1984) were prepared by density gradient centrifugation. Injection of embryos was carried out by standard procedures (SPRA- DLINC 1986), using a cn; ry strain obtained from P. M. BINCHAM. Isofemale lines were established from independ- ent transformed lines and examined by Southern blot hy- bridization to determine the number of insertions. The strains were subsequently balanced or made homozygous. Functional assays for activity of the mariner elements intro- duced into D. melanogaster were carried out by crossing to the f l h strain P735 described in GARZA et al. (1991).

General procedures for DNA manipulation were carried out as described in MARUYAMA and HARTL (1991).

AATTGAGCGT (865), CGTTACTGGCGATGAAAA-

RESULTS

In order to obtain a random sample of mariner elements, a library from D. mauritiana Wpch was screened with mariner, and 18 clones derived from different genomic locations were isolated. Five of these were chosen for further sequence analysis, which are designated Ma310, Ma31 1, Ma331, Ma341 and Ma351. Figure 1 summarizes the variable nucleotide sites in these sequences and the additional mariner elements pch, Mosl and MBI which have been de- scribed previously ( JACOBSON, MEDHORA and HARTL 1986; MARUYAMA and HARTL 1991; MEDHORA, MA- RUYAMA and HARTL 199 1). The MBI sequence is from

Ma31 0 Ma31 1 Ma341

MBl Ma351 Ma331 Mosl

Yak3

PCh

1 1 1 I 1 1 1 1 1 1 1 2 3 4 6 6 6 7 8 8 1 1 1 2 2 2 2 2

6 2 3 5 2 0 1 3 6 8 0 0 1 1 9 9 0 2 4 5 5 4 ~ 2 1 1 5 4 6 2 2 3 0 0 1 1 6 3 6 8 3 4

CGATGAACGTGGGCCAAC-AA CGATGAACATGCGTCAAC-AA CGATGAACATGCGTCAAC-AA TGAAGCGCATGCGCCAAC-AA TGAAGCACATGCGCCAAC-AA TGAAGCACATTCGCCATCTT- TAGAACACAAGCTC-TTGTTA TGGAGCAAATGCGCCATCTT-

TTCAGCACATGCGCCATCTT- * * * * * *

FIGURE 1.-Alignnlent of eight mariner sequences along with Yak3 from D. yakuba as outside reference. Only sitesdifferingamong the sequences are shown. The numbers at the top indicate the positions of the variable sites i n the mariner sequence. The putative amino acid changes are indicated by shading. Phylogenetically informative sites are indicated by asterisks and deletions by minus signs. The best alignment is obtained by introducing gaps at posi- tions 1248 (pch , Ma310.1Ma311, Ma341 and MBI) , 1254 (iMa351 and M o s l ) and 1194 (Ma331). The aligned sequences in the region are TSGAT~AIO, T,;GATA and T6CAT&, respectively. l h u s the numbering of nucleotides is through 1287 instead of 1286.

D. simulans, a sibling species of D. mauritiana, and it was included in the study because it is very closely related to the sequences from D. mauritiana. One mariner sequence from Drosophila yakuba is also shown. This was used as an outside reference group in order to orient the character state transitions (see MARUYAMA and HARTL 1991). Although the Ma310 and Ma31 I clones were found to have the same nu- cleotide sequences, the sequences of the flanking re- gions confirm that they are different insertions of mariner. The length of each of the sequenced mariner elements is 1286 base pairs, but the alignment is optimized when gaps are introduced at positions 1248 (pch, Ma310, Ma311, Ma341 and M B I ) , 1254 (Ma351 and M o s l ) and 1194 (Ma331) . The aligned sequences in the region are T5GAT2Alo, T ~ G A T J A ~ and T6GAT9A9, respectively.

Figure 2 shows a phylogenetic tree constructed from the eight mariner sequences in Figure 1. We excluded the yakuba sequence since the rooting of the tree is not required for the analysis. (The yaituba sequence will be considered later.) If each of the three gap positions (1 194, 1248 and 1254) is treated as a single informative character, maximum parsimony analysis yields two equally likely alternative trees. The only difference in the trees is in the position of Ma331. In Figure 2, one of the alternative placements of Ma331 is shown by a heavy line and the other by a dotted line.

On the other hand, if the mismatches in the region 1194-1254 are treated as a single informative char- acter, rather than as independent characters, then pch, Ma310, Ma311, Ma341, and MBI are placed together in one group, Ma351 and Mosl in another, and Ma331 by itself because of its unique character. Maximum parsimony analysis (Paup, SWOFFORD 1985) using this alignment yields only one tree with no

780 K. Maruyama, K. D. Schoor and D. L. Hart1

Ha33 1

Ha34 I Ma3 10 Ha31 I

61

3 305 1 5 1

Nos 1 : 127 .: 221 \

FIGURE 2.-Two alternative phylogenetic trees of eight mariner sequences. The only difference between the two trees is in the position of Ma33l. One of the alternative placements of Ma331 is shown by a heavy line and the other by a dotted line. Mutational steps between nodes are shown by bold numbers, and changed sites are shown by plain numbers. The region with the gaps causing different placements of Ma331 is indicated as position 1248*.

inconsistencies. This tree is shown in Figure 2 with the Ma331 branch indicated by a heavy line. The possibility that the mismatches may result from a single event is supported by the observation that mu- tations are influenced by neighboring DNA sequences and may occur preferentially in runs of identical bases (GOLDING and GLICKMAN 1985; MILKMAN and CRAW- FORD 1983). Furthermore, if the characters were in- dependent, intermediate sequences with two deletions or no deletion might be expected to occur, and these have not been found. We therefore favor the assump- tion of nonindependence, but the difference in the placement of Ma331 does not affect the subsequent analysis in any event. Whichever tree one prefers, the cladogram clearly shows that all mariner elements studied are intermediates between the active element Mosl and the inactive element pch. This is the basis for interpreting the functional assays discussed below.

In order to introduce the mariner elements into D. melanogaster, each element, along with at least 0.9 kb of flanking sequence on each side, was subcloned into the Carnegie 20 vector, yielding constructs denoted P[ry+ Mar] . In all the constructs, except Ma311, the orientation of the insert was the same as in the Mosl transformation vector described in GARZA et al. (1 99 l), in which the 5' end of mariner and its flanking DNA are adjacent to the 7.2-kb rosy sequence. Since Ma310 and Ma311 differ only in the flanking se- quences, we used only Ma311 for the transformation experiments. DNA was injected into the cn; ry strain of D. melanogaster along with the wings-clipped helper plasmid (KARESS and RUBIN 1984). Multiple trans- formed lines were obtained from each P[ry+ Mar] , and most of them were confirmed by Southern blotting to contain a single copy of the P[ry+ Mar] transposon.

GO P Nry') Mer1 6 TM3; ry Sb e x GQQ

or

+" SQ) 62 Score for wildtype

males or females caused by germline excision o f pch in male parent

FIGURE 3.--Somatic and germline excision assay of u P h . The Go male parent, balanced for the P[ry+ mariner], was crossed to the P735 female (X-linked WP"'). To balance the chromosomes, Cy0 was used for chromosome 2 and TM3; ry Sb e was used for chromosome 3. GI male offspring which are noncurly or nonstubble were scored for eye-color mosaicism. The same males were then crossed with r P h or attached-X females to determine germline excision. The wild-type chromosome is denoted here by [+] in the GI offspring. Excision frequencies were calculated as the ratio of wild-type males to the total number of males in matings with attached-X females, or as the ratio of wild-type females to the total number of females in matings with I P * females. For X-linked Ma31 1 , a third chromosome UP* line (P734) was used for the assay.

Only lines with a single insert were used for subse- quent experiments.

Two aspects of mariner activity were assayed in each P[ry+ Mar] line, as outlined in Figure 3. For each line, males carrying the P[ry+ Mar] were crossed to V p c h

females to detect any eye-color mosaicism in the male GI offspring heterozygous for the P[ry+ Mar] . The rate of germline reversion of W p c h was determined in the heterozygous GI males by crossing them with attached-X or W p c h females. The reversion frequency was calculated as the ratio of wild-type males to the total number of males in matings with attached-X females, or as the ratio of wildtype females to the total number of females in matings with W p c h females. From the results shown in Table 1, it can be seen that a wide range of activity exists among different mariner elements. Our control experiments have shown that, as demonstrated previously, pch is completely inactive, while Mosl produces mosaic eyes in every fly that carries it and has a germline reversion rate of 11.6- 15.6% at 25", depending on the strain (GARZA et al. 1991). In the case of Ma31 1 and Ma331, none of the lines showed any activity either in the germline or somatic cells. On the other hand, Ma351, MBl and Ma341 showed varying degrees of activity. For MBI and Ma341, the majority of flies in all transformed lines had completely peach-colored eyes, but occa- sional flies had a few red-pigmented facets. However, the elements differed substantially in the proportion of wild-type offspring produced. All three P[ry+ M B l ]

Functional Analysis of mariner 78 1

'IASLK I

Excision frequency of fib in D. melanogaster

Construct expression GP Total Excision Mosaic Wild-type

in GI progeny GP progeny frequency

M B 1 2 (2) f 1 1648 7 (2) f 2 944 -10-3

13 (3) f 2 1274

Ma341 7 ( 2 ) f 0 1358 12 (2) k 2 1591 -10-3 34 (2) f 0 1208 46 (3 ) k 2 1248

Ma351 14 (3) + 28 928 0.03

38 (ND) + 18 646 0.03 14e (ND) + 35 797 0.04

19 (3) + 104 2356 0.04

Ma331 1 (ND) - 0 >2000 <10-$ 4 (ND) - 0 >2000

Ma311 16 ( X ) - 0 >IO00 <lo-$ Mos893 2 (2 ) + 55 1609 0.03

mariner elements are indicated at the far left, followed by the transformant strain number and the chromosome into which the P[ryf mariner] is inserted. Mosaic expression is classified qualita- tively as -, k, or + according to the level (- = none; f <5% of flies with mosaic eyes, 1-3 pigmented facets per mosaic eye; + = 10-30% of flies with mosaic eyes and usually more pigmented facets per mosaic eye than in f). The last three columns give data on rates of reversion to w+ in the germline. All the elements other than Mos893 are naturally occurring. Among the elements created by site-directed mutagenesis, only Mos893 was studied for germline reversion.

lines we studied showed low rates of germline excision varying from 2 X lO-3 to 5 X lO-4, while only two of four P[ry+ Ma3411 lines showed any germline activity at all. In contrast, P[ry+ Ma3511 lines showed higher rates ranging from 3 X 1 O-* to 4 X 1 O-*. The level of somatic mosaicism in the P[ry+ Ma3511 lines was also higher than in the P[ry+ M B I ] and P[ry+ Ma341 lines, though not all flies were mosaic.

Although there are some differences among the independently transformed lines of each P[ry+ Mar] transposon, these differences are not as great as those among the different transposons. For example, all the lines carrying M B l show less activity than those car- rying Ma351, and these show consistently less activity than the Mosl lines. There is not strong evidence for heterogeneity in activity among the four lines of Ma351 ( P > 0.05 in a x* test). Homogeneity was not tested for other constructs since the number of wild- type offspring was too small. The difference between Ma351 and M B l is significant, however, when all the lines within each construct are pooled (P < 0.01 in a x2 test).

On the other hand, position effects on mariner expression can occasionally be drastic. It was previ- ously shown that one Ma351-bearing line produced heavily mosaic flies as a result of transposition of the original mariner element to a new genomic location

FIGURE 4.-Schematic representation of mutants. Both the Mosl sequence and Ma351 sequence were converted at each of the three positions in which they differ. Nucleotide 132 is in the putative promoter region, 636 is a presumed silent substitution, and 703 results in a putative amino acid replacement.

(MEDHORA, MARUYAMA and HARTL 1991). Thus, Ma351 can become highly active depending on posi- tion in the genome. All lines carrying the Ma351 element were occasionally observed to give rise to heavily mosaic flies during regular stockkeeping. However, no such events have been observed for Ma311, Ma331, Ma341 or M B l .

In order to study the effects of particular nucleotide substitutions on the activity difference between Mosl and Ma351, apart from the effects of flanking se- quences, we have used site-directed mutagenesis to change specific nucleotides while keeping the flanking sequences intact (Figure 4). The Mosl sequence was converted to the Ma351 sequence at each of the three positions in which they differ. One difference, at position 132, is in the putative promoter region; an- other, at position 636, is a presumed silent substitu- tion; and the third, at position 703, results in a puta- tive amino acid replacement. The Mosl sequences with these substitutions are denoted Mos865 (position 132), Mos891 (position 636), and Mos893 (position 703). Likewise, the Ma351 sequence was converted to that of Mosl at each of the three positions, yielding the sequences Ma866 (position 132), Ma864 (position 636) and Ma902 (position 703). The mutant se- quences were cloned into Carnegie 20 and injected into D. melanogaster. Multiple transformed lines were obtained for Mos865, Ma866 and Ma864, but Mos893 yielded only one transformant. No transformants were obtained for Mos891 and Ma902 due to the small number of embryos injected. Assays of activity were carried out as described above.

Judging from the level of mosaicism in Ma864 lines, which, like Ma351, produced occasional flies with a few flecks of red eye pigment, the change at position 636 does not appear to affect activity. Likewise, the change at position 132 does not affect the level of mosaicism, since both Mos865 and Ma866 produced the same degree of mosaicism as the mariner elements from which they were derived. Since they showed a similar level of somatic activity to their parental ele-

782 K. Maruyama, K. D. Schoor and D. L. Hart1

ments, the germline excision rates were not deter- mined for these lines. However, the change at position 703 does affect activity: the level of mosaicism of the Mos893 line is almost as low as that of the Ma351 lines, and germline excision rate is less than 4%, which is comparable to the Ma351 lines (Table 1). Like Ma351, Mos893 occasionally produced heavily mosaic flies. These results indicate that the nucleotide differ- ence between Mosl and Ma351 at position 703, in addition to the flanking sequences, contributes to the difference in activity.

DISCUSSION

A wide range of activity is observed among different mariner elements introduced into the genome of D. melanogaster. As expected, the mutator factor Mosl is highly active, and multiple patches of eye-color mo- saicism are observed in every fly that carries it. On the other hand, the Ma351 element, which was de- rived from a nonmosaic strain of D. mauritiana, pro- duces few mosaic patches, and only in a small propor- tion of the flies that carry it. The MBl and Ma341 elements are even less active than Ma351, and only occasional pigmented facets are observed (GARZA et a l . 199 1; MEDHORA, MARUYAMA and HARTL 1991). No somatic activity detectable as W p c h mosaicism was observed with Ma31 1 and Ma331. Rates of germline reversion among these elements were consistent with their relative somatic activities. Since the assay for activity of a mariner element is the ability to excise peach or to transpose, our data provide no information about other possible functions of inactive or low activ- ity elements. In particular, there is the possibility that some of the inactive or low activity elements may act as repressors of mariner activity. With respect to the P transposable element, truncated products of the transposase produced by various deletion derivatives of P can repress transposition and excision of other P elements (ENCELS 1989; MISRA and RIO 1990), and there are also regulatory effects mediated by inactive P elements through titration of the P transposase (RASMUSSON et al. 1990).

Important chromosomal position effects on gene expression have been observed with lines carrying Ma351. Normally these lines show only a low level of mosaicism, but flies with heavy mosaicism are occa- sionally observed. The higher activities are associated with transpositions to new genomic locations where the element is presumably expressed at higher levels. Thus, the level of activity of functional elements such as Ma351 can be affected drastically by position ef- fects, as seen with other genes in Drosophila [see DANIELS et al. (1 986), O’KANE and GEHRING (1 987), and GARZA et al. (1 99 1) for other examples]. On the other hand, the increased activities were not observed

in lines carrying the low activity or inactive elements Ma341, MBI, Ma311 or Ma331.

Functional analysis of sequences created by site- directed mutagenesis clearly demonstrates that nu- cleotide substitutions, separate from position effects, account for a large part of the variation in mariner activity. The G + T transversion at position 703 be- tween Mosl and Ma351 results in a putative Ala + Ser replacement. When this change was introduced

into Mosl (in the construct Mos89?), the activity of the element was virtually the same as that of Ma351 itself. As with Ma351, the activity of the Mos893 element can be greatly increased by transposition to genomic positions favorable for expression. Site-di- rected mutagenesis of Mosl and Ma351 also indicated that there are only minor, if any, effects on activity of both the G A transition at position 132 (which is in the putative promoter region) and the A 4 C trans- version at position 636 (a synonymous change).

Among all the sequenced mariner elements, taken as a whole, there are too many changes to make exhaustive analysis by site-directed mutagenesis prac- tical. However, strong inferences about function can be derived from cladistic analysis of the sequences. The cladogram indicates that M B l , which is barely active, contains only two mutations, at positions 1203 and 1248, that separate it from the common ancestor of Mosl /Ma351. From the fact that the two descen- dant sequences Mosl and Ma351 are functional, we infer that the Mosl /Ma351 ancestral sequence was also functional. Thus, either or both of the nucleotide changes at positions 1203 and 1248 must be respon- sible for the drastic decrease in activity of M B l . The change at position 1248 is downstream of the putative coding region, which makes it an unlikely candidate. However, the T += A transversion at position 1203 results in a putative Phe Leu amino acid replace- ment. Although we cannot dismiss a formal possibility that the immediate flanking sequence is acting as a repressor for the expression of MBI, the functional importance of the 1203 site is supported by sequence analysis of four additional, independent Mos elements. All four Mos elements are shown to have a T at position 1203, whereas position 1248 is polymorphic (A. KOCA and D. L. HARTL, unpublished).

The cladistic analysis also suggests that active mari- ner elements represent an ancestral sequence rather than a novel sequence created by recombination, since all mariner elements, regardless of activity, can be placed in the cladogram without inconsistency (see Figure 2). Moreover, a comparison with mariner se- quences from other species, in particular sequences from D. yakuba and Drosophila teissieri indicates that the base T (Phe) at position 1203 is a primitive char- acter (since it is shared by the outgroup sequences) while the base A (Leu) is restricted to mariner se-

Functional Analysis of mariner 783

quences from D. mauritiana (Figure 1 ; also see MA- RUYAMA and HARTL 199 1). Comparison with distantly related species also allows the cladogram to be rooted. Even though the number of the informative sites is small, the root clearly links to the internal node rep- resenting the common ancestor of Mosl/Ma351. These observations suggest that functional elements like Mosl and Ma351 represent ancestral sequences and that inactive sequences are derived. In particular, the change at position 1203 resulted in the very low activity of the MBl element. The conclusion that active mariner elements are ancestral is also consistent with the observation that active elements are found in D. simulans, a sibling species of D. mauritiana, indicating that active elements existed before the spe- cies diverged (CAPY et al. 1990). Since functional mariner elements are ancestral, inactivating mutations can occur at any of a large number of nucleotide sites, and therefore no single nucleotide difference would be adequate to classify a set of elements into functional and nonfunctional categories. Furthermore, the cla- dogram shows that functional mariner elements may represent only a fraction of the set of mariner se- quences in D. mauritiana. Among seven copies of mariner chosen at random from the WPch library, only Ma351 is capable of becoming highly active. We do not know if this is the case with other strains of D. mauritiana, particularly those with highly active Mos elements. Although the presence of active Mos ele- ments may lead to the increase in the copy number of mariner elements in the genome (GARZA et al. 1991), it is not known whether autonomous elements are preferentially amplified. Experimental results in D. melanogaster show that rates of Mos excision and trans- position are not as high as those of Pch excision, implying that nonautonomous elements are easily mo- bilized in trans by active elements (GARZA et al. 199 l).

The results of our analysis also demonstrate the utility of an evolutionary perspective, as represented by the cladistic analysis, in interpreting naturally oc- curring variation in nucleotide sequences. Cladistic analysis can also be useful in interpreting other types of genetic variation (TEMPLETON, BOERWINKLE and SING 1987). In our analysis, the goal was to identify the nucleotide substitutions responsible for the func- tional difference between active (Mosl) and inactive ( p c h ) mariner elements. Studying the effect of every possible nucleotide substitution, or combination of substitutions, by means of site-directed mutagenesis, or by constructing chimeric molecules, is a realistic approach only if the number of nucleotide differences is very small. Instead, we have studied other naturally occurring mariner elements by cladistic analysis. From this analysis we were able to infer that the original nucleotide substitution responsible for the loss of func- tion of pch was the one at position 1203; the other

inactivating substitutions in pch came later, after the element was essentially nonfunctional. In this and other cases, the earliest mutations affecting function are likely to be the most interesting from an evolu- tionary standpoint, because these are the changes that directly affect the population dynamics of the trans- posable element family.

We would like to thank G. BRYAN, P. CAPY, R. DUBOSE, D. GARZA, A. KOGA, M. MEDHORA and I. MORI for helpful discussions and J. AJIOKA, D. BERG, J. CARULLI, R. DUBOSE, P. GREEN, E. ROUTMAN and A. TEMPLETON for critical comments on the manu- script. We are grateful to D. GARZA for providing fly strains and A. MACPEEK for her help in preparing the manuscript. This work was

supported by National Institutes of Health grant GM33741.

LITERATURE CITED

AQUADRO, C. F., S. F. DESSE, M. M. BLAND, C. H. LANGLEY and C. C. LAURIE-AHLBERG, 1986 Molecular population genetics of the alcohol dehydrogenase gene region of Drosohila melano- gaster. Genetics 114: 1 165-1 190.

ASHBURNER, M., 1989 Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.

BERG, D. E., and M. HOWE, 1989 Mobile DNA. American Society for Microbiology, Washington, D.C.

BLACKMAN, R. K., and W. M. GELBART, 1989 The transposable element hobo ofDrosophila melanogaster, pp. 523-529 in Mobile DNA, edited by D. E. BERG and M. HOWE. American Society for Microbiology, Washington, D.C.

BOEKE, J. D., 1989 Transposable elements in Saccharomyces cere- visiae, pp. 335-374 in Mobile DNA, edited by D. E. BERG and M. HOWE. American Society for Microbiology, Washington, D.C.

BRYAN, G., D. GARZA and D. L. HARTL, 1990 Insertion and excision of the transposable element mariner in Drosophila. Genetics 125: 103-1 14.

BRYAN, G. J., J. W. JACOBSON and D. L. HARTL, 1987 Heritable somatic excision of a Drosophila transposon. Science 235:

CAPY, P., F. CHARKRANI, F. LEMEUNIER, D. L. HARTL and J. R. DAVID, 1990 Active mariner transposable elements are wide- spread in natural populations of Drosophila simulans. Proc. R. SOC. Lond. Ser. B 242: 57-60.

DANIELS, S. B., M. MCCARRON, C. LOVE, S. H. CLARK and A. CHOVNICK, 1986 The underlying bases of gene expression differences in stable transformants of the rosy locus in Drosoph- ila melanogaster. Genetics 113: 265-285.

DUBOSE, R. F., and D. L. HARTL, 1989 An experimental approach to testing modular evolution: directed replacement of a-helices in a bacterial protein. Proc. Natl. Acad. Sci. USA 86 9966- 9970.

ENGELS, W. R., 1989 P Elements in Drosophila melanogaster, pp. 437-484, in Mobile DNA, edited by D. E. BERG and M. M. HOWE. American Society for Microbiology, Washington, D.C.

FEDEROFF, N. V., 1989 Maize transposable elements, pp. 375- 41 1 in Mobile DNA, edited by D. E. BERG and M. M. HOWE. American Society for Microbiology, Washington, D.C.

FINNEGAN, D. J., 1989 The I factor and I-R hybrid dysgenesis in Drosophila melanogaster, pp. 503-517 in Mobile DNA, edited by D. E. BERG and M. M. HOWE. American Society for Microbi- ology, Washington, D.C.

GARZA, D., M. MEDHORA, A. KOCA and D. L. HARTL, 1991 Introduction of the transposable element mariner into the germline of Drosophila melanogaster. Genetics 128: 303- 310.

GOLDING, G. B., and B. W. GLICKMAN, 1985 Sequence-directed

1636-1638.

784 K. Maruyama, K. D. Schoor and D. L. Hart1

nlutagenesis: Evidence from a phylogenetic history of human a-interferon gene family. Proc. Natl. Acad. Sci. USA 82: 8577- 8.58 1.

HELMS, C., M. Y . GRAHAM, J. E. DUTCHIK and M. V. OLSON, 1985 A new method for purifying lambda DNA from phage lysates. DNA 4: 39-49.

1 ~ N N I G , W., 1966 Phylogenetic Systematics. University of Illinois Press, Urbana.

JACOBSON, J . W., M. M. MEDHORA and D. L. HARTL, 1986 Molecular structure of a somatically unstable transpos- able element in Drosophila. Proc. Natl. Acad. Sci. USA 83: 8684-8688.

KARESS, R. E., and G. M. RUBIN, 1984 Analysis of transposable element functions in Drosophila. Cell 38: 135-146.

MARUYAMA, K., and D. L. HARTL, 1991 Evolution of the trans- posable element mariner in Drosophila species. Genetics 128: 3 19-329.

MEDHORA, M. M., A. H. MACPEEK and D. L. HARTL, 1988 Excision of the Drosophila transposable element mari- ner: identification and characterization of the Mas factor. EMBO J. 7: 2185-2189.

MEDHORA, M., K. MARUYAMA and D. L. HARTL, 1991 Molecular and functional analysis of the mariner mutator element Mosl in Drosophila. Genetics 128: 31 1-318.

MILKMAN, R., and I. P. CRAWFORD, 1983 Clustered third-base substitutions among wild strains of Escherichia coli. Science 221: 378-580.

MISRA, S., and D. C. RIO, 1990 Cytotype control of Drosophila P element transposition: The 66 kd protein is a repressor of transposase activity. Cell 62: 269-284.

O’KANE, C. J., and W. J. GEHRING, 1987 Detection in situ of genomic regulatory elements in Drosophila. Proc. Natl. Acad. Sci. USA 84: 9123-9127.

RASMUSSON, K. E., M. J. SIMMONS, J. D. RAYMOND and C. F. MCLARNON, 1990 Quantitative effects o f P element on hybrid dysgenesis in Drosophila melanogaster. Genetics 124 647-662.

RUBIN, G. M., and A. C. SPRADLING, 1983 Vectors for P element- mediated gene transfer in Drosophila. Nucleic Acids Res. 11: 6341-6351.

SANGER, F., S. NICKLEN and A. R. COULSON, 1977 DNA sequenc- ing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74: 5463-5467.

SPRADLING, A. C., 1986 P element-mediated transformation, pp. 175-197 in Drosophila: A Practical Approach, edited by D. B. ROBERTS. IRL Press, Washington, D.C.

SWOFFORD, D. I>., 1985 PAUP: Phylogenetic Analysis Using Parsi- mony, Version 2.4. Illinois Natural History Survey, Champaign, Ill.

TEMPLETON, A. K., E. BOERWINKLE and C. F. SING, 1987 A cladistic analysis of phenotypic associations with haplotypes inferred from restriction endonuclease mapping. 1. Basic the- ory and an analysis of alcohol dehydrogenase activity in Dro- sophila. Genetics 117: 343-35 1.

Communicating editor: A. G. CLARK