IDENTIFICATION OF Cav 3.2 T-TYPE VOLTAGE GATED CALCIUM ...

1

IDENTIFICATION OF Cav 3.2 T-TYPE VOLTAGE GATED CALCIUM CHANNELS AS KEY MEDIATORS OF TARGETED INHIBITION OF HEPATOCELLULAR CARCINOMA BY AMPLITUDE-MODULATED

RADIOFREQUENCY ELECTROMAGNETIC FIELDS

BY

HUGO JIMENEZ

A Dissertation Submitted to the Graduate Faculty of

WAKE FOREST UNIVERSITY GRADUATE SCHOOL OF ARTS AND SCIENCES

In Partial Fulfillment of the Requirements

For the Degree of

DOCTOR OF PHILOSOPHY

Cancer Biology

May, 2018

Winston-Salem, North Carolina

Approved By:

Boris C. Pasche, M.D., Ph.D., Advisor

Glenn Lesser, M.D., Chair

Carl F. Blackman, Ph.D.

Waldemar Debinski, M.D., Ph.D.

Ravi Singh, Ph.D.

2

DEDICATION AND ACKNOWLEDGEMENTS

I dedicate this dissertation to my family and friends who supported me

throughout the process of attaining my doctorate. Their support is constant

reminder of why I chose to complete my doctorate and why I must continue to

strive onward.

I would like to acknowledge Boris C. Pasche, M.D., Ph.D. for his guidance

in my doctoral studies, mentorship in understanding the logistics of academia

and trust in believing that I was capable of deducing the puzzle that is AM RF

EMF. Additionally, I would to like acknowledge Carl F. Blackman, Ph.D. for taking

the time to come to Winston-Salem every week and choosing to spend his

retirement working with our lab to further a field of research that he was

instrumental in founding. Lastly, I would like to acknowledge my predecessor

Jacquelyn W. Zimmerman, M.D., Ph.D. for taking the time to show me the

potential of this project.

I would like to thank the members of my committee Waldemar Debinski,

M.D., Ph.D., Glenn Lesser, M.D. and Ravi Singh, Ph.D. for their understanding,

time and patience.

Finally, I would like to thank all the members of my lab (past and present)

for their help throughout my student career.

3

Contents

LIST OF ILLUSTRATIONS AND TABLES............................................................................................... 7

LIST OF ABBREVIATIONS .................................................................................................................. 9

ABSTRACT ....................................................................................................................................... 11

INTRODUCTION .............................................................................................................................. 12

CHAPTER I: Use of non-ionizing electromagnetic fields for the treatment of cancer ................... 13

Abstract ...................................................................................................................................... 14

Introduction ............................................................................................................................... 14

History of radiofrequency electromagnetic fields (RF EMF) ...................................................... 14

Minimally-invasive RF EMF for therapeutic use in cancer ......................................................... 21

Nano-radio-frequency ablation (Na-RFA) .............................................................................. 21

TheraBionic: tumor-specific AM RF EMF ............................................................................... 24

Novocure ................................................................................................................................ 28

Novocure and TheraBionic: two novel modalities for cancer treatment .................................. 30

Relevant literature for Novocure/Optune ............................................................................. 31

Relevant Literature for TheraBionic ....................................................................................... 31

Conclusion .................................................................................................................................. 33

Acknowledgement ..................................................................................................................... 34

References ................................................................................................................................. 35

Figures, tables and legends ........................................................................................................ 50

CHAPTER II: Cav3.2 T-type VGCCs mediate targeted blockade and myofibroblast differentiation

of hepatocellular carcinoma by tumour-specific AM RF EMF ....................................................... 53

Abstract ...................................................................................................................................... 54

Introduction ............................................................................................................................... 54

Results ........................................................................................................................................ 56

Whole-body and organ-specific dosimetry ............................................................................ 56

Analysis of in vivo effects of amplitude-modulated radiofrequency electromagnetic fields 59

Tumour shrinkage is caused by HCC cell differentiation into quiescent myofibroblasts ...... 61

Calcium influx and Cav3.2 T-type Voltage Gated Calcium Channels mediate AM RF EMF

antiproliferative effects ......................................................................................................... 62

4

HCC-specific AM RF EMF block HCC cancer stem cells .......................................................... 64

Discussion .................................................................................................................................. 65

Online methods: ........................................................................................................................ 70

Acknowledgements: .................................................................................................................. 84

Author contributions: ................................................................................................................ 84

References ................................................................................................................................. 86

Figures and legends ................................................................................................................... 93

Supplemental Figures .............................................................................................................. 101

CONCLUSION ................................................................................................................................ 113

APPENDICES ................................................................................................................................. 115

APPENDIX a: The role of cell death in hepatocellular carcinoma-specific amplitude-modulated

radiofrequency electromagnetic fields .................................................................................... 115

Introduction ......................................................................................................................... 116

Results .................................................................................................................................. 117

Discussion / future direction ................................................................................................ 117

Materials and methods ........................................................................................................ 118

References ........................................................................................................................... 119

Figure, tables and legends ................................................................................................... 120

APPENDIX b: Ambient electromagnetic fields do not affect AM RF EMF antiproliferative

effects ...................................................................................................................................... 122

Introduction ......................................................................................................................... 123

Results .................................................................................................................................. 124



References ........................................................................................................................... 127

Figures, tables, and legends ................................................................................................. 128

APPENDIX c: MMTV.HER2 / NEU spontaneous mouse model of breast cancer exposed to

breast cancer-specific amplitude modulated radiofrequency electromagnetic fields ............ 129

Introduction ......................................................................................................................... 130

Results .................................................................................................................................. 130



5

References ........................................................................................................................... 133

Figures, tables and legends .................................................................................................. 134

APPENDIX d: Glioblastoma-specific amplitude modulated radiofrequency electromagnetic

fields ......................................................................................................................................... 135

Introduction ......................................................................................................................... 136

Results .................................................................................................................................. 138



References ........................................................................................................................... 149


APPENDIX e: Testing the specific response of individual cell lines, from multiple cancer

models, to tumor-specific amplitude modulated radiofrequency electromagnetic fields ..... 162

Introduction ......................................................................................................................... 163

Results .................................................................................................................................. 163



References ........................................................................................................................... 165


APPENDIX f: The combined use of anti-mitochondrial metabolism agent, lipoate derivative

CPI-613, and hepatocellular carcinoma-specific amplitude-modulated radiofrequency

electromagnetic fields on Huh-7 cells ...................................................................................... 173

Introduction ......................................................................................................................... 174

Results .................................................................................................................................. 175



References ........................................................................................................................... 177


APPENDIX g: Determination of frequency bandwidths for effective Hepatocellular Carcinoma

specific-amplitude-modulated radiofrequency electromagnetic fields treatment. ................ 181

Introduction ......................................................................................................................... 182

Results .................................................................................................................................. 183



6

References ........................................................................................................................... 185


APPENDIX h: Inducible mouse model of hepatocellular carcinoma and species specificity of

hepatocellular carcinoma-specific amplitude-modulated radiofrequency electromagnetic

fields ......................................................................................................................................... 190

Introduction ......................................................................................................................... 191

Results .................................................................................................................................. 191



References ........................................................................................................................... 194


CURRICULUM VITAE ..................................................................................................................... 196

7

LIST OF ILLUSTRATIONS AND TABLES

CHAPTER I Figure 1. 50 Figure 2. 51 Table 1. 52 CHAPTER II Figure 1. 93 Figure 2. 95-96 Figure 3. 98 Table 1. 99 Table 2. 100 Suppl Figure 1. 101-103 Suppl Figure 2. 104 Suppl Figure 3. 105-107 Suppl Figure 4. 108-109 Suppl Table 1. 110-111 Suppl Table 2. 112 APPENDIX a Figure 1. 120 Figure 2. 121 APPENDIX b Figure 1. 128 APPENDIX c Figure 1. 134 APPENDIX d Figure 1. 152 Figure 2. 153 Figure 3. 154 Figure 4. 155 Figure 5. 156 Figure 6. 157 Figure 7. 158 Figure 8. 159 Figure 9. 160 Table 1. 161 APPENDIX e Figure 1. 166 Figure 2. 167 Figure 3. 168

8

Figure 4. 169 Figure 5. 170 Figure 6. 171 Figure 7. 172 APPENDIX f Figure 1. 179 Figure 2. 180 APPENDIX g Figure 1. 187 Table 1. 188 Table 2. 189 APPENDIX h Figure 1. 195

9

LIST OF ABBREVIATIONS

AM RF EMF: Amplitude-Modulated Radiofrequency Electromagnetic Fields RF EMF: Radiofrequency Electromagnetic Fields HCC: Hepatocellular Carcinoma VGCC: Voltage-Gated Calcium Channel GBM: Glioblastoma Multiforme TTF: Tumor Treating Fields R&D: Research and development V: Volts cm: centimeter nm: nanometer ft: foot m: meter μT: microTesla Hz: Hertz kHz: Kilohertz VHF: Very high frequency EEG: Electroencephalography Na-RFA: Nano-radio frequency ablation SWNT: Single-walled carbon nanotube C-Co-NP: Carbon coated nano particles P: Power R: Resistance I: Electric current J: Joule W: Watt CI: Confidence interval HR: Hazard Ratio RR: Response rate Ca2+: Calcium K+: Potassium Na+: Sodium GABA: Gamma-aminobutyric acid NCI: National Cancer Institute FDA: Food and Drug Administration MHz: Megahertz SAR: Specific Absorption Rate mW: Milliwatt kg: Kilogram wbSAR: Whole Body Specific Absorption Rate psSAR: Peak Spatial Specific Absorption Rate CSC: Cancer Stem Cell GFP: Green Fluorescent protein RFP: Red Fluorescent protein

10

PBS: Phosphate buffered saline XCL2: X-C motif chemokine ligand 2 PLP2: Proteolipid protein 2 IDH1: Isocitrate dehydrogenase 1 IDH2: Isocitrate dehydrogenase 2 GAPDH: Glyceraldehyde 3-phosphate dehydrogenase APC: Adenomatous polyposis coli ASPM: Abnormal spindle-like microcephaly-associated protein CEP 152: Centrosomal Protein 152 PLK 1: Polo-Like Kinase 1 PLK 4: Polo-Like Kinase 4 SHAM: No treatment control group RCF: Random-chosen frequency PFS: Progression-free survival OS: Overall survival mM: milliMolar μM: microMolar NOD SCID: Nonobese diabetic/severe combined immunodeficiency BrdU: Bromodeoxyuridine SEM: Standard error of the Mean CACNA1g: T-type voltage gated calcium channel isoform 3.1 (Cav3.1) CACNA1h: T-type voltage gated calcium channel isoform 3.2 (Cav 3.2) CACNA1i: T-type voltage gated calcium channel isoform 3.3 (Cav 3.3) PDH: Pyruvate dehydrogenase PDK: Pyruvate dehydrogenase kinase LDH: Lactate dehydrogenase TCA: Tricarboxylic acid cycle

11

ABSTRACT

Amplitude-modulated 27.12 MHz radiofrequency electromagnetic fields

(AM RF EMF) delivered via a spoon-shaped antenna placed on the patient’s

tongue results in shrinkage of the primary and metastatic tumors in patients with

advanced hepatocellular carcinoma (HCC). The mechanism by which AM RF

EMF have direct antiproliferative effect cancer cells is largely unknown.

In order to deduce the unknown mechanism of action we have assessed

the Specific Absorption Rate (SAR) level and distribution inside the human body.

Additionally, we performed various in vitro and in vivo experiments that were

exposed to HCC-specific AM RF EMF using systems replicating human exposure

levels and treatment duration. The resulting data provided new insights into the

mechanism of action of a novel systemic therapy.

Therefore, this dissertation will show that HCC-specific AM RF EMF’s

antiproliferative effects are mediated by Ca2+ influx through Cav3.2 T-type

voltage-gated calcium channel (CACNA1H). This finding establishes a key

functional role for Cav3.2 in control of HCC proliferation, and furthermore

establishes this transmembrane protein complex as a main target for HCC-

specific AM RF EMF.

12

INTRODUCTION

In spite of the recent approval of additional treatment modalities the

outcome of patients with advanced hepatocellular carcinoma remains poor and

new therapeutic approaches are sorely needed. There is growing experimental

and clinical evidence that alternating electric fields and amplitude-modulated

electromagnetic fields are capable of blocking tumor growth in a non-ionizing,

non-thermal manner. However, little is known regarding the kHz to THz range of

electromagnetic field interactions with biological systems, which do not result in

changes in temperature within tumor tissues or in tumor cell membrane

electroporation.

Despite the fact that electromagnetic fields (EMF) in medicine have been

used for therapeutic or diagnostic purposes, the use of non-ionizing EMF for

cancer treatment is a new emerging concept in which this dissertation will

summarize the history of EMF, beginning in the 1890’s, to its development in the

early 20th century and end by providing insight on an innovative form of non-

thermal, non-ionizing radiation cancer treatment that may very well provide the

basis for identifying a potential “bio-antenna like” structure in a cell.

13

CHAPTER I: Use of non-ionizing electromagnetic fields for the treatment of

cancer

Hugo Jimenez1,2, Carl Blackman1,2, Glenn Lesser2,3,4, Waldemar Debinski1,2,4, Michael Chan2,5, Sambad Sharma1, Kounosuke Watabe1,2, Hui-Wen Lo1,2, Alexandra Thomas2,3, Dwayne Godwin6, William Blackstock2,5, Albert Mudry7, James Posey8, Rodney O’Connor9, Ivan Brezovich10, Keith Bonin11, Daniel Kim-Shapiro11, Alexandre Barbault12, Boris Pasche1,2,3,12 The following chapter was published online as a review article in the Frontiers in Bioscience (Landmark Ed.) on January 1st, 2018.

PMID: 28930547

14

Abstract

Cancer treatment and treatment options are quite limited in circumstances

such as when the tumor is inoperable, in brain cancers when the drugs cannot

penetrate the blood-brain-barrier, or when there is no tumor-specific target for

generation of effective therapeutic antibodies. Despite the fact that

electromagnetic fields (EMF) in medicine have been used for therapeutic or

diagnostic purposes, the use of non-ionizing EMF for cancer treatment is a new

emerging concept. Here we summarize the history of EMF from the 1890’s to the

novel and new innovative methods that target and treat cancer by non-ionizing

radiation.

Introduction

In this review, we summarize current technologies that utilize non-ionizing

RF EMF for cancer therapy and the existing research that may potentially

elucidate the mechanisms underlying their anti-cancer effects. These include

tissue heating/ablation, altered mitotic spindle formation and channel specific

calcium signaling. We also discuss the development of these technologies and

field of research by reviewing the history of Radiofrequency Electromagnetic

Fields.

History of radiofrequency electromagnetic fields (RF EMF)

The notion that electromagnetic radiation (see Figure 1 for EMF spectrum)

could have a biological impact by releasing heat in tissues emerged in the 1890’s

as electricity began to be produced in a controlled form. Arsène d’Arsonval was

one of the first to identify increases in temperature and metabolism of the

microbial cell in contact with electricity, and then, with Albert Charrin, he reported

15

the attenuation of diphtheria and pyocyanic toxins by radiation at a frequency of 2

x 103 cycles per second (200 kHz) without a significant increase in temperature

(1–3). In 1924, it was shown that when tumorous plants were subjected to ultra-

short wavelengths, tumors would initially grow rapidly but then completely and

selectively necrose (4). Some years later, it was reported that malignant tumors

in mice could be destroyed by currents of very high frequency (VHF) (5). These

reports also opened a large debate over thermal, which predominate, and non-

thermal effects on living tissue (6–8). This scientific research was primarily

conducted in a medical environment, which was interested in therapeutic

applications.

At about the same time the invention of the split-anode magnetron (1920

General Electric research laboratories, New York; Albert W. Hull) and mainly the

klystron (1938 Stanford University; Varian brothers, W.W. Hausen and D.L.

Webster), which generated higher frequencies and power outputs, led to the

development of new microwave energy generators and expanded their potential

uses (9,10). While this was of interest to physicians at the Mayo Clinic in 1937,

the power was far too low for therapeutic use. Over time the power levels began

to increase and in 1938, the magnetron could produce 100 watts of power, then

in 1939 it was found that the klystron could produce several hundred watts of

power. As power began to reach a level high enough for therapeutic use, the

magnetron and klystron became “mysteriously” unavailable (11). It was not until

much later that it was discovered that the development of the magnetron and

klystron were only designated for military application during World War II, in

16

particular for radar, which did not seem harmful to personnel (12). Specifically,

the development of a multicavity, air-cooled magnetron (1940 University of

Birmingham, England; John Randall and Harry Boot) had been very important in

perfecting radar (13). The same year, this multi-cavity magnetron was brought to

the United States, after which the development of tubes that could produce a

power output as high as one million watts was generated (14). The microwaves

these new tubes could create had optical properties that could be reflected,

refracted and diffracted. The cavity magnetron became largely used in radar

technology by the Allies; the klystron being preferred by the Germans. The

impact of war on research was without a doubt important.

In 1946 a microwave generator (cavity magnetron) became available to

the Mayo Clinic for renewed studies on living animals (11). Much more careful

investigation needed to be conducted with microwave energy to understand its

way of functioning and its possible safe place in medical therapy (16). During the

1950’s a considerable push was under way to examine the biological effects of

microwave radiation and possible harmful effects to the human body because

“they have important uses in defense projects, industrial developments, and

basic physical research” (17). A 1957 report described the death of a man

standing in the direct beam of a radar transmitter. It was reported that the man

experienced a sensation of heat, which quickly became intolerable in less than a

minute. Within 30 minutes he developed acute abdominal pain and vomiting,

which prompted surgical opening of the abdomen and draining of approximately

500 cc of serosanguinous fluid with the excision of the appendix that appeared

17

gangrenous. The post-operative course was at first good but abdominal

distention recurred and inflammation of the intestines with evisceration of the

wound led the patient to his death ten days after the incident (18). It reinforced

considerable interest and research in the biological aspects of exposure to radio

frequency electromagnetic field (RF EMF) (19). U.S. government officials and

business companies, such as Chief of R&D of Ordnance Missile Laboratory,

Sylvania Electric Company and Bell telephone labs, began to issue statements

related to the untoward effects of high powered radar for which safety limits

should be determined (1,19). In March 1959, experiments to determine the

effects of close-range exposure of the brain of a monkey to high intensity radio

waves were conducted by the National Institutes of Health and reported before

the House of Representatives Appropriations subcommittee. In examining the

brains of ten monkeys, which died during the experiments, no pathological cause

of death could be found. In a separate set of 10 monkeys whose exposure was

cut short of death, the monkeys had convulsions resembling Parkinson’s disease

in humans (20). Another main aspect of research was to find out non-thermal

non-ionizing biological effect of living tissue (21).

In 1968, James R. Hamer, reported that in 29 human subjects exposed to

sinusoidal electric fields at field magnitudes of four volts per meter in the

frequency range of 2–12 Hertz, reaction time performance was found to be

approximately 1.6 milliseconds faster during “field on” compared to “field off”

conditions. The experiments revealed that the effects were frequency sensitive

and not merely due to the presence of the field (22). This work was a prime

18

example showing that exposure to a low level, low frequency electric field could

impact a biological system in a non-thermal, non-ionizing manner.

In 1969, Gavalas, Walter, Hamer and Adey reported that exposure to low-

level, low frequency sinusoidal electric fields had an effect on the behavior and

pattern of electrical activity (EEG) of monkey brains. Behaviorally, monkeys

displayed a shorter inter response (time between signal and response behavior,

i.e. push a lever in front of each subject) when exposed to 7 cycles per second

but not to 10 cycles per second electric fields. EEG results showed an increase

in percent power at the frequency of the fields for the hippocampus but less

consistently in the amygdala and center median (the brain structures used for

recording EEG and measuring percent power). Percent power is calculated by

averaging spectral intensity and coherences for each brain structure. The

“Coherence,” parameter is calculated by analyzing the coherence between the

imposed field and the activity in each structure, as well as between the brain

structures themselves. The “Spectral intensity,” is a specialized statistical test for

the effect of the imposed field on recorded activity. The increased percent power,

in some brain structures, was observed during two different conditions, one being

7 cycles per second and the other being 10 cycles per second, a previously

reported frequency exposure used by Hamer and identified to have an effect on

human reaction time (23).

In 1973 Bawin, Gavalas-Medici and Adey studied the effects of exposures

to low intensity, very high frequency (VHF-147 MHz) electromagnetic fields,

amplitude-modulated at biologically relevant frequencies (1–25 Hz) on cats with

19

chronically implanted electrodes. To minimize interference with VHF fields due to

behavioral responses and/or gross body movements, cats underwent pattern

conditioning of specific brain locations. This was accomplished by directly

conditioning specific patterns in specific brain locations which would then allow

consideration of the overt behavior as a correlate of the conditioned response

(24). The authors found that low level VHF, amplitude-modulated at specific

frequencies, produced marked effects on conditioned specific brain rhythms

(enhanced regularity of patterns, sharpening of the spectral peaks around the

central frequency of the response, extremely prolonged resistance to extinction).

This work brought attention to the realm of non-thermal biological response to

EMF by showing changes in brain wave patterns. Up until this time, much of the

work had been accomplished by Russian and Eastern European investigators,

although Gavalas et al., 1970, may have been first to report changes in brain

electrical activity (23,24). Building on their previous work, in 1975, Bawin et al.

identified enhanced calcium efflux from chick brain tissue in a test tube following

exposure to amplitude-modulated (AM) radio frequency (RF) waves. This effect

appeared to occur without involvement of heating and appeared to be mediated

by release of calcium. Specifically, the radiofrequency-dependent calcium efflux

from chick brains was only reported when a carrier wave (147 MHZ) was

sinusoidally amplitude-modulated (see Figure 2 for example of amplitude

modulation) at specific frequencies of 6, 9, 11, 16, and 20 Hz. No altered efflux

compared to control was found without modulation nor at 0.5., 3, 25 or 35 Hz

modulations (25). Another, more limited report by the Bawin group show that 450

20

MHz EMF, amplitude modulated at 16 Hz, enhanced calcium release in a narrow

window of intensities (26). Additionally, when chick brains were co-treated with

cyanide (a compound which prevents electron transport in the cytochrome,

shutting down metabolism) calcium efflux still occurred, which indicates that

amplitude modulation-dependent calcium efflux does not depend on metabolic

processes. These findings provided the experimental basis that suggested a

molecular mechanism explaining Bawin et al.’s (1973) work on the inhibition and

excitation of the cerebral cortex of cats, as well as the work of Hamer, Gavalas,

and Subbota (22,25,27,28).

On the heels of Bawin’s work, the focus began to turn to the molecular

mechanism behind EMF exposure effects on biological systems and the

understanding that EMF demodulation could explain such a mechanism.

In 1980 Blackman et al. independently reproduced the work of Bawin et al.

by showing that calcium efflux from chick brains occur in a windowed,

sinusoidally amplitude-modulated, frequency-specific fashion (32). Moreover,

Blackman built on the research performed by Bawin et al. and showed that

calcium efflux depends on specific amplitude-modulations independently of the

carrier wave (50 MHz). Importantly, Blackman et al. validated specific

“modulation frequency windows” at which calcium efflux occurred. They also

demonstrated that such effects only occurred within certain levels of power

exposure and were amplitude-modulation dependent; an effect first identified by

Bawin et al (1975) (25,33,34).

21

In 1984 Dutta et al. (35) published work focusing on calcium ions and their

relationship to microwave radiation (915 MHz) with or without sinusoidal,

amplitude-modulation (80%) at 16 Hz at various specific absorption rates (SAR).

They found that in human neuroblastoma cells (IMR-32) calcium efflux occurred

in a power and amplitude-modulation frequency-specific fashion. Specifically, a

significant efflux of calcium ions was found to occur at two SAR values 0.05 and

1 mW/g of an amplitude-modulated (16Hz AM) microwave (915 MHz-carrier

wave) compared to unexposed samples further validating the work of Bawin,

Adey, Blackman, and Joines. An additional validation of this phenomenon was

provided in 1990 by Schwartz who reported enhanced calcium ion release from

isolated, beating frog hearts only when they were exposed to 240 MHz EMF,

sinusoidally amplitude modulated at 16 Hz, but not when exposed at 0.5 Hz nor

when the EMF was unmodulated (36).

The research and development of EMF in biological systems has now

spanned over 100 years, from d’Arsonval to World War II to calcium efflux, and

now we are beginning to see the rise of therapeutic non-thermal, non-ionizing

EMF exposure. In this review we highlight some of the most innovative and

promising therapeutic research currently being performed in the field of cancer.

Minimally-invasive RF EMF for therapeutic use in cancer

Nano-radio-frequency ablation (Na-RFA)

Non-ionizing radio frequency (RF) radiation is a common thermal therapy

approach used in clinical oncology (37). In particular, radiofrequency ablation’s

(RFA) approach of hyperthermia (temperatures above 47oC) will expose target

tissue to high temperatures to destroy the tissue directly or render cancer cells

22

more susceptible to other treatment modalities (thermal sensitization; 41–45oC)

(37) (Table 1). While this technique does show success, RFA is a localized and

invasive method that requires a needle to penetrate directly into the tumor. Even

though this technique is very effective and widely used, specifically for the

treatment of hepatic (primary or metastatic), kidney, liver and a number of other

neoplasms, this indication is limited by tumor size and tumor location (38, 39).

Close proximity of the tumor to the biliary tree or blood vessels is considered a

contraindication to its use. Moreover, targeting a localized tissue and selecting an

appropriate or efficient method of heat delivery remains an issue. Multiple

sources of energy for heat delivery include microwaves, radiofrequency, laser

and ultrasound (37). Here we briefly summarize a few novel uses of radio

frequency exposure as a method of localized RFA using nano-particles.

Nano-Radio-Frequency Ablation (NaRFA) is an experimental method of

non-invasive RFA with the potential to improve the efficacy of thermal damage to

tumors while minimizing damage to normal healthy tissues. In order to

accomplish this, tumors are loaded with nanoparticles that enhance the

conversion of external energy source (RF) into heat, creating an inside-out

hyperthermia. This is possible because RF fields are able to penetrate deep into

the body without the need for an invasive procedure (37). One such example of

NaRFA is carbon based nanomaterials. Single-walled carbon nanotubes

(SWNTs) can be modified to increase efficacy by improving specificity through

surface engineering of SWNTs to have ligands, which can target receptors

specific to cancer cells (40,41). In a study performed by Gannon et al. RF

23

exposure of SWNT caused cytotoxicity of cancer cells in vitro and in vivo while

being well tolerated by rabbits bearing tumors. A second example can be found

in Carbon coated metallic nanoparticles (C-Co- NPs). C-Co-NPs are 7-nm cubic

crystalline graphitic carbon decorated ferromagnetic cobalt nanoparticles (40).

These nanoparticles have been shown to effectively enter HeLa cells and when

exposed to RF pulses of 350 kHz the nanoparticles generate localized heat, a

process that is dependent on RF power and nanoparticle concentration. The

treated HeLa cells showed DNA fragmentation, nucleus rupturing and membrane

disintegration (40). An additional example is found in the work of Tamarov et al.

and their use of crystalline silicon (Si) based nanomaterials. An aqueous

suspension of Si nanoparticles is able to generate temperatures above 45–50 oC

when exposed to 27 MHz RF EMF (41). Moreover, Si nanoparticles are

biocompatible and biodegradable in biological tissues, decaying into orthosilicic

acid, Si(OH)4,

which will be voided through the urinary tract. In vivo work

displayed inhibition of tumor growth and led to a decrease in tumor volume (42).

Mechanism of action for nano-radio-frequency ablation (NaRFA)

Heat generation in nanoparticles when exposed to low RF fields remains a

contentious subject (37, 43). The dominant mechanism behind RF heating is

joule heating (heat released due to resistivity of nanoparticle; Power (P) is

dissipated in the form of heat, and given I is electric current and R is resistance,

P = I2R). No optimal RF conditions for effective heating have been reported and

power has been reported to range from 40–800 W (37, 40, and 44). A number of

other factors such as electrical conductivity, size, shape, and concentration of the

24

nanoparticles contribute to heating effects as well (37). While systems such as

NaRFA appear to be promising it should be noted that there is a need for more in

vivo, clinical data as well as technological refinement to reduce unwanted tissue

damage and increased specificity of the nanomaterial to the target (37, 40).

Moreover, there are currently at least two other separate RF technologies in

existence that have no need for nanoparticles and have shown beneficial activity

in cancer patients.

TheraBionic: tumor-specific AM RF EMF

During the 1990’s Pasche et al. demonstrated that intrabuccal

administration of low and safe levels of 27.12 MHz RF EMF, amplitude-

modulated at 42.7 Hz, has a sleep-inducing effect in healthy patients but does

not improve sleep in patients with a diagnosis of insomnia (45,46). However,

when patients with a diagnosis of insomnia were treated with the same carrier

signal amplitude-modulated at four different frequencies (2.7 Hz, 21.9 Hz, 42.7

Hz and 48.9 Hz; i.e. insomnia-specific modulation) they experienced shorter

sleep latency, longer total sleep time, increased sleep efficiency, and increased

numbers of sleep cycles compared to controls (47,48). In early 2000, Pasche and

Barbault hypothesized that tumor-specific modulation frequencies could be used

to treat cancer. In 2009, Barbault et al. published the results of their

investigations to determine if tumors may be sensitive to specific RF EMF

modulated at specific frequencies. Using devices emitting a carrier frequency of

either 433 MHz or 27 MHz the authors exposed 163 patients, who had a

diagnosis of cancer, to RF EMF amplitude-modulated in the range of 0.1Hz to

114 kHz and the results of the study were remarkable (49). The authors reported

25

that patients with cancer, but not healthy patients, had changes in skin electrical

resistance, pulse amplitude and blood pressure (biofeedback responses) when

exposed to a subset of very discrete modulation frequencies. Interestingly,

patients with the same tumor type were found to exhibit biofeedback responses

when exposed to the same discrete modulation frequencies creating a frequency

set specific to tumor type. Moreover, the majority of frequencies found for any

given tumor type were specific to that tumor type only and only 4 frequencies

(1873.5 Hz, 2221.3 Hz, 6350.3 Hz and 10456.4 Hz) were found to overlap in

multiple tumor types specifically, breast cancer, hepatocellular carcinoma,

prostate cancer and pancreatic cancer (49). Post frequency identification, the

authors then proposed to determine if treatment with the recently discovered

tumor-specific frequency sets to corresponding cancer patients would have a

therapeutic effect and hence the authors offered compassionate treatment to

patients with limited therapeutic options. Again, the results were remarkable, of

sixteen patients evaluable for response, one patient with hormone-refractory

breast cancer metastatic to the adrenal gland and bones had a complete

response lasting 11 months. One patient with hormone-refractory breast cancer

metastatic to liver and bones had a partial response lasting 13.5 months, Four

patients had stable disease lasting more than: 7 years (thyroid cancer metastatic

to the lung), 5.1 months (non-small cell lung cancer), 4.1 months (pancreatic

cancer metastatic to liver) and 4.0 months (leiomyosarcoma metastatic to liver)

(15, 49). These results indicate that treatment not only has an impact on the

26

primary tumor but can also treat metastatic tumors implying that this treatment is

systemic.

Building upon their findings from 2009, Costa et al. conducted a single-

group; single-center, open-label, phase I/II study in patients with advanced

hepatocellular carcinoma (HCC). In this study, more than 75% of patients had

radiological evidence of disease progression and half of the patients had poor

liver function with limited treatment options at the time of treatment initiation. All

patients were exposed to electromagnetic fields amplitude modulated at HCC-

specific frequencies. A total of 41 patients with advanced HCC and Child Pugh A

or B disease were accrued and self-administered treatment three times daily for

60 minute (180 min) until disease progression or death and imaging studies were

obtained every eight weeks. The results supported the initial experience with the

same device: four patients had objective tumor response. One patient with prior

progressive disease experienced durable near complete response lasting more

than 5 years, and fourteen patients had stable disease for more than 6 months.

The median progression-free survival (PFS) was 4.4 months (95% CI: 2.1–5.3)

and median overall survival (OS) was 6.7 months (95% CI: 3.0–10.2). Subset

analysis of the patients with similar diagnostic criteria as those applied in phase

III studies such as the SHARP and Asia-Pacific sorafenib studies (Llovet et al.,

2008;Cheng et al., 2009), i.e. biopsy-proven disease and assessment of disease

with CT, shows an objective response rate (RR) by RECIST of 18.2.% (2/11),

and median PFS and OS of 4.9 months (95% CI .6 to 10.8 months) and 10.8

months (95% CI 2.1 to 34.0 months) (50,51). Overall, there were six long-term

27

survivors with an OS greater than 24 months and four long-term survivors greater

than three years. Despite long-term treatment duration and poor liver function in

the majority of patients, treatment was well tolerated and no NCI grade 2, 3, or 4

toxicities were reported (31).

To further evaluate the results found by the work of Barbault et al. (2009)

and Costa et al. (2011), Zimmerman et al. (2012) performed in vitro studies to

begin to elucidate the mechanism of this novel therapy. Using specifically

designed exposure devices to replicate the clinical exposure settings,

Zimmerman et al. investigated whether the proliferation of HCC (HepG2 and

Huh-7), breast cancer (MCF-7) and corresponding non-malignant THLE-2

(represent normal liver cells), MCF-10A (represent normal breast cells) cell lines

would be affected by the tumor-specific modulation RF EMF that were found in

the clinical setting. Using tumor-specific RF EMF vs control exposure, comprised

of randomly chosen modulation frequencies within the same range as cancer-

specific frequencies, authors found that tumor-specific frequencies were able to

inhibit the proliferation of cancer cells when used in a corresponding fashion i.e.

HCC-cell lines exposed to HCC-specific frequencies. Yet, when HCC-specific

frequencies were used on breast cancer cells, or vice versa, no proliferative

inhibition was noted. Furthermore, HCC-specific and breast cancer-specific

frequencies did not inhibit the proliferation of THLE-2 or MCF-10A cells,

respectively. These findings led to the conclusion that exposure to tumor-specific

RF EMF not only had an inhibitory effect on the proliferation of cells but that it did

so in a cancer-specific fashion, apparently not affecting normal healthy cells

28

(15,52). The authors also discovered that mitotic spindle formation was greatly

disrupted in HCC-specific treated HepG2 cell and genes relating to migration

(PLP2) and invasion (XCL2) were found to be significantly downregulated as

shown via RNA-seq and confirmed by qPCR (52). The exact mechanism of

action of this new therapeutic approach is unknown.

Novocure

NovoTTF-100A (brand name Optune®) is a device that delivers low-

magnitude (1–3 V/cm), intermediate frequency (100–300 kHz) tumor treating

electric fields (TTFields) by transducer arrays that are applied directly to the

scalp (53–55). The Novo TTF- 100A system slows tumor growth and inhibits

mitosis. More specifically, TTFields have been shown to disrupt glioblastoma

cells during mitosis, resulting in apoptosis, aneuploidy, asymmetric chromosome

segregation, and defects in centrioles and mitotic spindles. Additionally, TTFields

causes cytoplasmic stress which targets tumor cells for immunological

destruction and clearance TTFields have been demonstrated to inhibit

proliferation in multiple cancer cell lines, e.g., human melanoma, lung, prostate,

pancreas, breast and glioma after 24 hours of continuous exposure while not

having any impact on normal non-dividing cells (53, 54). In addition, mice bearing

tumors (mouse melanoma and rat glioma) also showed growth inhibition and a

decrease in angiogenesis after less than one week of treatment.

Optune® is approved by the U.S. FDA for use as a treatment for adult

patients with histologically-confirmed glioblastoma (55). The activity of TTFields

is intensity and frequency specific and is inversely proportional to tumor cell size.

Hence, the NovoTTF device can be optimized for multiple tumor types such as

29

pancreas adenocarcinoma, ovarian cancer and non-small cell lung cancer (54).

Of importance, the device and treatment is considered to be safe as normally

dividing cells would require a different frequency set to have mitotic interference

making the TTFields specific to dividing cancer cells (54). Due to the effects of

the TTFields being directional (TTF fields function best when applied in the

direction of the separation axis of the dividing cell) two sequential field directions

are applied to patients by wearing two pairs of transducer arrays that generate

fields that switch direction by 90o. Lastly, TTFields do not attenuate over

distance(s) used in treatment and are minimally impacted by biological tissues.

This gives TTFields the capability to cover large body regions that may be

commonly affected by metastases deep within organs, so long as the leads are

placed over the metastatic area. The clinical recommended treatment time is a

minimum of 18 hours continuous treatment per day (54).

In 2014, the Data Safety Monitoring Board recommended that the Phase

III clinical trial of this device in patients with newly diagnosed glioblastoma be

stopped after it was reported that during the interim analysis of 315 patients who

received standard chemoradiation therapy, adding TTFields to maintenance

temozolomide chemotherapy resulted in significant improvements in progression-

free survival (PFS) and overall survival (OS) (56). Specifically, median PFS in the

intent–to–treat population was 7.1 months (95% CI, 5.9–8.2 months) in the

TTFields plus temozolomide group and 4.0 months (95% CI, 3.3–5.2 months) in

the temozolomide alone group; hazard ratio (HR) 0.62; (98.7% CI, 0.43–0.89); P

= 0.001). The median overall survival in the per-protocol population was 20.5

30

months (95% CI, 16.7–25.0 months) in the TTFields plus temozolomide group

(n=196) and 15.6 months (95% CI, 13.3–19.1 months) in the temozolomide alone

group (n=84); HR 0.64 (99.4% CI, 0.42–0.98); P=0.004) (56).

Novocure TTF (tumor treating fields) mechanism of action

The use of intermediate-frequency electric fields (kHz-MHz range)

alternate too fast to cause nerve-muscle stimulation and involve a minimal

amount of heating; until the mid-2000’s fields in this range were generally

accepted as having no biological effect (54, 57). The mechanism of action

involves destabilization of spindle microtubules, consequently leading to mitotic

catastrophe. It is unknown whether this effect occurs by direct interference of the

addition of tubulin subunits to microtubules or by destruction of existing

microtubules structures (57). Hence, cells entering mitosis are those most likely

to respond to treatment and would exclusively impact dividing cells (54, 57).

Additionally, after spindle disruption by TTFields, and the prolonged mitotic arrest

that may occur, subsequent cell death is more likely the outcome than mitotic

arrest and yet it is still not understood what initially triggers the caspase

dependent apoptosis. Data generated by Giladi et al. suggests that the

accumulation of significant aneuploidy, in tandem with mitotic arrest, contributes

to the compromised viability of cancer cells (57).

Novocure and TheraBionic: two novel modalities for cancer treatment

The mechanism(s) of action for RF EMF on biological systems beyond

heating have not been fully established. Hence, we discuss published research

that will have important biological relevance to the likely mechanistic difference

31

that may underlie two distinct therapeutic options offered by Novocure’s TTF-

100A (Optune®) and the Therabionic™ device.

Relevant literature for Novocure/Optune

NovocureTM’s Optune® identified the improper formation of microtubules

as key to the inhibitory action on GBM. In literature relevant to the intracellular

mechanics of centrioles the presence of electromagnetic forces is evident (58).

Microtubules are hollow cylinders composed of 13 longitudinal filaments. The

filaments are strings of alpha/beta tubulin dimers connected end to end with the

alpha/beta tubulin dimers having positive and negative charges at their ends.

During filament movement, by means of their vibration, oscillation of these

charged dimers produces an electromagnetic field (58). Evidence of cellular

electromagnetic field activity occurs during mitosis when centriole pairs are

separated to diametrically opposite sides of the nucleus and extend out

microtubules toward each other to begin the separation the cell in two (58). This

electromagnetically active area certainly appears to continue to be a prime target

for NovocureTM’s treatment and future research.

Relevant Literature for TheraBionic

The work described in the 2009 Barbault et al. paper reports that

discovery of frequencies, used in the treatment of cancer, was based on the

measurement of variations in skin electrical resistance, pulse amplitude and

blood pressure (49). Calcium (Ca2+), Ca2+ signaling and Ca2+ channels are an

important feature of blood pressure regulation and cardiovascular health. Here

we highlight the work performed by Buckner et al. that potentially sheds light on

the work related to calcium ion channels (59, 60). The studies performed by

32

Buckner et al. show that exposure to a specially designed, weak (2–10 μTesla),

frequency-modulated, patterned EMF signal called the Thomas-EMF signal, can

inhibit the growth of malignant cells by promoting Ca2+ uptake through T-type

voltage-gated calcium channels (VGCC) (61). This effect does not appear to be

mediated by L-type voltage-gated calcium channels (61). The Thomas- EMF

pattern is a digital file composed of 849 points programmed to deliver each point

for 3 milliseconds. Exposure to the Thomas-EMF pattern at various time intervals

has been previously associated with an analgesic response, an outcome whose

mechanism was suspected to be due to or include metal binding ions (Ca2+ and

K+) (62). Additionally, the Thomas-EMF pattern was designed to affect

membrane activity associated with epileptic seizures, a disease state known to

be related to alterations in various types of ion channels (Ca2+, K+, Na+, GABA)

(61–63). Buckner et al. exposed cultured cells of mouse and human origin (B16-

BL6, MDA-MB-231, MCF-7, HSG, HBL- 100, HEK293 and HeLa) or mice

(bearing tumors from hind flank injected B16-BL6 cells) to Thomas- EMF signal

(2–10 microT). Proliferative inhibition was found to occur in malignant cells only,

e.g., MDA-MB-231, MCF-7 and HeLa cells and in mice bearing tumors whereas

non-malignant cells, e.g., HBL-100, HEK293 and HSG cells were unaffected. In

attempting to understand the mechanism for proliferative inhibition Buckner et al.

reported that in malignant cells an increase in Ca2+ influx occurred, specifically

through the T-type VGCC while in non-malignant cells no increase in Ca2+ influx

was found. Moreover, blocking Ca2+ influx with T-type VGCC blockers appeared

to block the ability of Thomas- EMF signal to inhibit cell proliferation. Additionally,

33

malignant cells, exposed to Thomas-EMF signal, also showed a slowed entry

into the S-phase of the cell cycle as noted by temporal changes in cyclin

expression but, did not show cell death or DNA fragmentation (61). Hence,

Buckner et al. concluded that specific EMF patterns can affect biological systems

by allowing for increased cytoplasmic Ca2+ which then impacts the cell cycle by

changes in cyclin expression (61, 64, 65). This provides a potential anti-cancer

therapy that acts through the T-type VGCC to allow inappropriate influx of Ca2+

resulting in proliferative inhibition (61).

The research reports published by Buckner et al. appear to have

relevance to Therabionic’s cancer treatment, particularly given the fact that their

initial focus of work was on the treatment of insomnia, a disease state that can be

mediated by Ca2+ and T-type VGCC dysregulation (48, 66, 67). Moreover,

enhanced Ca2+ flux has been shown to be affected by RF exposure in research

that dates as far back as the 1970s and in a modulation specific fashion (68–72).

Hence, hypothetically, amplitude-modulated RF exposure eliciting a calcium

dependent anti-cancer specific response could represent a promising, if not

paradigm changing, direction in the treatment of cancer (30).

Conclusion

In closing, with the number of tumor types currently under investigation

with the NovocureTM technology combined with the tumor types in which

Therabionic™ has already shown some efficacy, treatment, either local or

systemic, of tumors with electromagnetic fields should still be considered in its

infancy. Moreover, as a field of research, we expect that these technologies will

quickly expand over the next ten years to become possibly as common place as

34

chemotherapy with the hope that at the very worst it will allow cancer to become

a chronic condition instead of a life-ending disease.

Acknowledgement

Conflict of Interest: Boris Pasche and Alexandre Barbault hold stocks in

TheraBionic LLC and TheraBionic GmbH.

35

References

1. J J Turner. Ed U.S. Army Ordnance Missile Command. Whippany, New

Jersey (1962)

2. A Arsonval: Influence de I’electricite sur la cellule microbienne. Arch

Physiol Norm Pathol 5, 664–669 (1893)

3. A Arsonval, A Charrin: Action des diverses modalites electriques sur les

toxins bacteriennes. C R Seances Soc Biol Fil 3, 96–99 (1893)

4. A Gosset, A Gutmann, G Lakhovsky, I Magrou: Essai de therapeutique du

cancer experimental des plantes. C R Seances Soc Biol Fil 91, 626–628

(1924)

5. J Schereschewsky: The action of currents of very high frequency upon

tissue cell. Pub Health Rep 43, 927–945 (1928) DOI: 10.2307/4578796

6. W E Curtis, F Dickens, S F Evans: The specific action of ultra-short

wireless waves. Nature 138, 63–65, 591, 110–1101 (1936)

DOI: 10.1038/1381100b0

DOI: 10.1038/138063a0

7. R V Christie: An experimental study of diathermy. VI. Conduction of high

frequency currents through the living cell. J Exp Med 48, 235–246 (1928)

DOI: 10.1084/jem.48.2.235

PMid:19869480 PMCid:PMC2131452

8. W T Szymanowski, R A Hicks: The biological action of ultra-high

frequency currents. J Infect Dis 50, 1–25 (1932)

DOI: 10.1093/infdis/50.1.1

36

9. US patent. USA patent 1.6.28.4.66 (1927)

10. US Patent. USA patent 2.2.50.5.11 (1941)

11. F H Krusen, J F Herrick, K G Wakim: Microkymatotherapy: preliminary

report of experimental studies of the heating effects of microwaves (radar)

in living tissues. Proc Staff Meet Mayo Clin 22, 209–224 (1947)

12. R H J Follis: Studies on the biological effect of high frequency radio waves

(radar) AM J Physiol 147, 281 (1946)

PMid:21000748

13. US patent. USA patent 2.5.42.9.66 (1951)

14. P A Redhead: The invention of the cavity magnetron and its introduction

into Canada and the U.S.A. Phys Can, 321–328 (2001)

15. J W Zimmerman, H Jimenez, M J Pennison, I Brezovich, D Morgan, A

Mudry, F P Costa, A Barbault, B Pasche: Targeted treatment of cancer

with radiofrequency electromagnetic fields amplitude-modulated at tumor-

specific frequencies. Chin J Cancer 32, 573–581 (2013)

DOI: 10.5732/cjc.013.10177


16. K G Wakim, J F Herrick, G M Martin, F H Krusen: Therapeutic possibilities

of microwaves. J Am Med Assoc 139, 989–993 (1949)

DOI: 10.1001/jama.1949.02900320019006

PMid:18113906

17. E L Ginzton: Microwaves. Science 127, 841–851 (1958)

DOI: 10.1126/science.127.3303.841

37

PMid:17733817

18. J T McLaughlin: Tissue destruction and death from microwave radiation

(Radar) Calif Med 86, 336–339 (1957)

DOI: 10.1097/00006534-195708000-00021

19. C I Barron, A A Baraff: Medical considerations of exposure to microwaves

(radar) J AM Med Assoc 168, 1194–1199 (1958)

DOI: 10.1001/jama.1958.03000090024006

PMid:13587196

20. P Bailey: High intensity radiation produces convulsions, death in monkey.

Aviation Week May, 29–30 (1959)

21. W Sawicki, K Ostrowski: Non-thermal effect of microwave radiation in vitro

on peritoneal mast cells of the rat. Am J Phys Med 47, 225–234 (1968)

DOI: 10.1097/00002060-196810000-00002

PMid:4175787

22. J R Hamer: Effects of Low Level, Low Frequency Electric Fields on

Human Reaction Time. Commun Behav Biol 2, 217–222 (1968)

23. R J Gavalas, D O Walter, J R Hamer, W R Adey: Effects of low-level, low

frequency electric fields on EEG and behavior in macaca nemestrina.

Brain Res 18, 491–501 (1970)

DOI: 10.1016/0006-8993(70)90132-0

24. S M Bawin, R J Gavalas-Medici, W R Adey: Effects of modulated very

high frequency fields on specific brain rhythms in cats. Brain Res 58,

365–384 (1973)

38

DOI: 10.1016/0006-8993(73)90008-5

25. S M Bawin, L K Kaczmarek, W R Adey: Effects of modulated VHF on the

central nervous system. Ann. N. Y. Acad. Sci. 28, 74–81 (1975)

DOI: 10.1111/j.1749-6632.1975.tb35984.x

26. A R Sheppard, S M Bawin, W R Adey: Models of long-range order in

cerebral macromolecules: Effects of sub-ELF and of modulated VHF and

UHF fields. Radio Sci 6s, 141–145 (1979)

DOI: 10.1029/RS014i06Sp00141

27. R J Gavalas, D O Walter, J Hamer, W R Adey: Effect of low-level, low-

frequency electric fields on EEG and behavior in Macaca nemestrina.

Brain Res. Bull 18, 491–501 (1970)

DOI: 10.1016/0006-8993(70)90132-0

28. A G Subbota: The effect of a pulsed superhigh frequency (SHF)

electromagnetic field on the higher nervous activity of dogs.

Bull Exp Biol Med. 46, 1206–1211 (1957)

DOI: 10.1007/BF00788065

29. teachurselfece. Digital Electronics Basic Electronics, Embedded systems

and VLSI Design (2012)

30. C F Blackman: Treating cancer with amplitude-modulated electromagnetic

fields: a potential paradigm shift, again? Br J Cancer 106, 241–242 (2012)

DOI: 10.1038/bjc.2011.576


39

31. F P Costa, A C Oliveira, R Meirelles, M C C Machado, T Zanesco, R

Surjan, M C Chammas, M Souza Rocha, D Morgan, A Cantor, J

Zimmerman, I Brezovich, N Kuster, A Barbault, B Pasche: Treatment

of advanced hepatocellular carcinoma with very low levels of amplitude-

modulated electromagnetic fields. Br J Cancer 105, 640–648 (2011)

DOI: 10.1038/bjc.2011.292


32. C F Blackman, S G Benane, J A Elder, D E House, J A Lampe, J M Faulk:

Induction of calcium-ion efflux from brain tissue by radiofrequency

radiation: effect of sample number and modulation frequency on the

power-density window. Bioelectromagnetics 1, 35–43 (1980)

DOI: 10.1002/bem.2250010104

PMid:7284014

33. W T Joines, C F Blackman: Power density, field intensity, and carrier

frequency determinants of RF-energy-induced calcium-ion efflux from

brain tissue. Bioelectromagnetics 1, 271–275 (1980)

DOI: 10.1002/bem.2250010303

PMid:7284025

34. C F Blackman, S G Benane, D E House, W T Joines: Effects of ELF

(1–120Hz) and Modulated (50Hz) RF Fields on the Efflux of Calcium Ion

From Brain Tissue In vitro. Bioelectromagnetics 6, 1–11 (1985)

DOI: 10.1002/bem.2250060102

PMid:3977964

40

35. S K Dutta, A Subramoniam, B Ghosh, R Parshad: Microwave radiation-

induced calcium ion efflux from human neuroblastoma cells in culture.

Bioelectromagnetics 5, 71–78 (1984)

DOI: 10.1002/bem.2250050108

PMid:6712751

36. J L Schwartz, D E House, G A R Mealing: Exposure of Frog Hearts to CW

or Amplitude-Modulated VHF Fields: Selective Efflux of Calcium Ions at

16Hz. Bioelectromagnetics 11, 349–358 (1990)

DOI: 10.1002/bem.2250110409

PMid:2285418

37. J Beik, Z Abed, F S Ghoreishi, S Hosseini-Nami, S Mehrzadi, A Shakeri-

Zadeh, S K Kamrava: Nanotechnology in hyperthermia cancer therapy:

From fundamental principles to advanced applications. J Control Release

235, 205–221 (2016)

DOI: 10.1016/j.jconrel.2016.05.062

PMid:27264551

38. Curley, S. A., Marra, P., Beaty, K., Ellis, L. M., Vauthey, J. N., Abdalla, E.

K., Scaife, C., Raut, C., Wolff, R., Choi, H., Loyer, E. Vallone, P., Fiore, F.,

Scordino, F., De Rosa, V., Orlando, R., Pignata, S., Daniele, B., & Izzo, F.

Early and Late Complications After Radiofrequency Ablation of Malignant

Liver Tumors in 608 Patients. Ann Surg 239, 450–458 (2004)

DOI: 10.1097/01.sla.0000118373.31781.f2


41

39. Jindal, G., Friedman, M., Lockin, J. & Wood, B. J. Palliative

Radiofrequency Ablation for Recurrent Prostate Cancer. Cardiovasc

Intervent Radiol 29, 482–485 (2006)

DOI: 10.1007/s00270-004-0200-8


40. Rejinold, N. S., Jayakumar, R. & Kim, Y.-C. Radio Frequency responsive

nanobiomaterials for cancer therapy. J Control Release 204, 85–97 (2015)

DOI: 10.1016/j.jconrel.2015.02.036

PMid:25744825

41. Gannon, C. J., Cherukuri, P., Yakobson, B. I., Cognet, L., Kanzius, J. S.,

Kittrell, C., Weisman, R. B., Pasquali, M., Schmidt, H. K., Smalley, R. E., &

Curley, S. A. Carbon Nanotube-enhanced Thermal Destruction of Cancer

Cells in a Noninvasive Radiofrequency Field. Cancer 110 (2007)

DOI: 10.1002/cncr.23155

42. Tamarov, K. P., Osminkina, L. A., Zinovyev, S. V., Maximova, K. A.,

Kargina, J. V., Gongalsky, M. B., Ryabchikov, Y., Alkattan, A., Sviridov, A.

P., Sentis, M., Ivanov, A. V., Nikiforov, V. N., Kabashin, A. V., &

Timoshenko, V. Y. Radio frequency radiation-induced hyperthermia using

Si nanoparticle-based sensitizes for mild cancer therapy. Sci Rep 4 (2014)

43. Collins, C. B., McCoy, R. S., Ackerson, B. J., Collins, G. J. & Ackerson, C.

J. Radiofrequency Heating Pathways for Gold Nanoparticles. nanoscale 6,

8459–8472 (2014)

DOI: 10.1039/C4NR00464G

42

PMid:24962620

PMCid:PMC4624276

44. Moran, C. H., Wainerdi, S. M., Cherukuri, T. K., Kittrell, C. & Wiley, B. J.

Size-Dependent Joule Heating of Gold Nanoparticles Using Capacitively

Coupled Radiofrequency Fields. Nano Res 2, 400–405 (2009)

DOI: 10.1007/s12274-009-9048-1

45. Reite, M., Higgs, L., Lebet, J. P., Barbault, A., Rossel, C., Kuster, N.,

Dafni, U., Amato, D., & Pasche, B. Sleep Inducing Effect of Low Energy

Emission Therapy. Bioelectromagnetics 15, 67–75 (1994)

DOI: 10.1002/bem.2250150110

PMid:8155071

46. Lebet, J. P., Barbault, A., Rossel, C., Tomic, Z., Reite, M., Higgs, L., Dafni,

U., Amato, D., & Pasche, B. Electroencephalographic changes following

low energy emission therapy. Ann Biomed Eng 24, 424–429 (1996)

DOI: 10.1007/BF02660891

PMid:8734063

47. Pasche, B., Erman, M. & Mitler, M. Diagnosis and Management of

Insomnia. N Engl J Med 323, 486–487 (1990)

DOI: 10.1056/NEJM199008163230714

PMid:2374572

48. Pasche, B., Erman, M., Hayduk, R., Mitler, M. M., Reite, M., Higgs, L.,

Kuster, N., Rossel, C., Dafni, U., Amato, D., Barbault, A., & Lebet, J. P.

Effects of Low Energy Emission Therapy in chronic psychophysiological

43

insomnia. Sleep 19, 327–336 (1996)

PMid:8776791

49. Barbault, A., Costa, P. F., Bottger, B., Munden, R. F., Bomholt, F., Kuster,

N., Pasche, B. Amplitude-modulated electromagnetic fields for the

treatment of cancer: discovery of tumor-specific frequencies and

assessment of a novel therapeutic approach. J Exp Clin Cancer Res 28,

51 (2009)

50. Llovet, J. M., Ricci, S., Mazzaferro, V., Hilgard, P., Gane, E., Blanc, J. F.,

Oliveira, A. C., Santoro, A., Raoul, J. L., Forner, A., Schwartz, M., Porta,

C., Zeuzem, S., Bolondi, L., Greten, T. F., Galle, P. R., Seitz, J. F.,

Borbath, I., Haussinger, D., Giannaris, T., Shan, M., Moscovici, M.,

Voliotis, D., & Bruix, J. Sorafenib in Advanced Hepatocellular Carcinoma.

N Engl J Med 359, 378–390 (2008)

DOI: 10.1056/NEJMoa0708857

PMid:18650514

51. Cheng, A. L., Kang, Y. K., Tsao, C. J., Qin, S., Kim, J. S., Luo, R., Feng,

J., Ye, S., Yang, T. S., Xu, J., Sun, Y., Liang, H., Liu, J., Wang, J., Tak, W.

Y., Pan, H., Burock, K., Zou, J., Voliotis, D., & Guan, Z. Efficacy and

safety of sorafenib in patients in the Asia-Pacific region with advanced

hepatocellular carcinoma: a phase III randomized, doubleblind, placebo-

controlled trial. Lancet Oncol 10, 25–34 (2009)

DOI: 10.1016/S1470-2045(08)70285-7

44

52. Zimmerman, J. W., Pennison, M. J., Brezovich, I., Yi, N., Yang, C. T.,

Ramaker, R., Absher, D., Myers, R. M., Kuster, N., Costa, F. P., Barbault,

A., & Pasche, B. Cancer cell proliferation is inhibited by specific

modulation frequencies. Br J Cancer 106, 307–313 (2012)

DOI: 10.1038/bjc.2011.523

PMid:22134506

PMCid:PMC3261663

53. Wong, E. T., Lok, E., Swanson, K. D., Gautam, S., Engelhard, H. H.,

Lieberman, F., Taillibert, S., Ram, Z., & Villano, J. L. Response

assessment of NovoTTF-100A versus best physician’s choice

chemotherapy in recurrent glioblastoma. Cancer Med 3, 592–602 (2014)

DOI: 10.1002/cam4.210


54. Davies, A. M., Weinberg, U. & Palti, Y. Tumor treating fields: a new

frontier in cancer therapy. Ann N Y Acad Sci 1291, 86–95 (2013)

DOI: 10.1111/nyas.12112

PMid:23659608

55. Novocure. (St. Helier, Jersey, 2014)

56. Stupp, R., Taillibert, S., Kanner, A. A., Kesari, S., Steinberg, D. M., Toms,

S. A., Taylor, L. P., Lieberman, F., Silvani, A., Fink, K. L.,

Barnett, G. H., Zhu, J. J., Henson, J. W., Engelhard, H. H., Chen, T. C.,

Tran, D. D., Sroubek, J., Tran, N. D., Sroubek, J., Tran, N. D., Hottinger,

A. F., Landolfi, J., Desai, R., Caroli, M., Kew, Y., Honnorat, J., Idbaih, A.,

45

Kirson, E. D., Weinberg, U., Palti, Y., Hegi, M. E., & Ram, Z. Maintenance

Therapy with Tumor-Treating Fields Plus Temozolomide vs

Temozolomide Alone for Glioblastoma JAMA 314, 2535–2543 (2015)

57. Giladi, M., Schneiderman, R. S., Voloshin, T., Porat, Y., Munster, M., Blat,

R., Sherbo, S., Bomzon, Z., Urman, N., Itzhaki, A., Cahal, S., Shteingauz,

A., Chaudhry, A., Kirson, E. D., Weinberg, U., & Palti, Y. Mitotic Spindle

Disruption by Alternating Electric Fields Leads to Improper Chromosome

Segregation and Mitotic Catastrophe in Cancer Cells. Sci Rep 5, 16

(2015)

DOI: 10.1038/srep18046

PMid: 26658786

PMCid: PMC4676010

58. Huston, R. L. A review of Electromagnetic Activity in Cellular Mechanics.

Adv Biosci Biotechnol 7, 360–371 (2016)

DOI: 10.4236/abb.2016.79035

59. Kawanabe, Y. & Nauli, S. M. Involvement of extracellular Ca2+ influx

through voltage independent Ca2+ channels in endothelin-1 function. Cell

Signal 17, 911–916 (2005)

DOI: 10.1016/j.cellsig.2005.01.001

PMid: 15894164

60. Mamo, Y. A., Angus, J. A., Ziogas, J., Soeding, P. F. & Wright, C. E. The

role of voltage-operated and non-voltage-operated calcium channels in

46

endothelin-induced vasoconstriction of rat cerebral arteries. Eur J

Pharmacol 742, 65–73 (2014)

DOI: 10.1016/j.ejphar.2014.09.002

PMid:25218985

61. Buckner, C. A., Buckner, A. L., Koren, S. A., Persinger, M. A. & Lafrenie,

R. M. Inhibition of Cancer Cell Growth by Exposure to a Specific Time-

Varying Electromagnetic Field Involves T-Type Calcium Channels. PLoS

ONE 10 (2015)

DOI: 10.1371/journal.pone.0124136

62. Thomas, A. W., Kavaliers, M., Prato, F. S. & Ossenkopp, K. P. Pulsed

Magnetic Fields Induced “Analgesia” in the Land Snail, Cepaea nemoralis,

and the Effects of μ,d, and k Opioid Receptor Agonist/Antagonist.

Peptides 18, 703–709 (1997)

DOI: 10.1016/S0196-9781(97)00004-1

63. Zamponi, G. W., Lory, P. & Perez-Reyes, E. Role of voltage-gated calcium

channels in epilepsy. Pflugers Arch 460, 395–403 (2010)

DOI: 10.1007/s00424-009-0772-x

PMid: 20091047

PMCid: PMC3312315

64. See, V., Rajala, N. K. M., G., S. D. & White, M. R. H. Calcium-dependent

regulation of cell cycle via a novel MAPK-NF-kappB pathway in swiss 3T3

cells. J Cell Biol 166 (2004) 65. Resende, R. R., Adhikari, A., Costa, J.L.,

47

Lorencon, E., Ladeira, M.S., Guatimosim, S., Kihara, A.H., Ladeira, L.O.

influence of spontaneous calcium events on cell-cycle progression in

embryonal carcinoma and adult stem cells. Biochim Biophys Acta 1803,

246–260 (2010)

DOI: 10.1016/j.bbamcr.2009.11.008

PMid: 19958796

66. Amato, D. & Pasche, B. An evaluation of the safety of low energy

emission therapy (published erratum appears in Compr Ther

1994;20(12):681) Compr.Ther. 19, 242–247 (1993)

PMid: 8275672

67. Lee, J., Kim, D. & Shin, H.-S. Lack of delta waves and sleep disturbances

during nonrapid eye movement sleep in mice lacking a1g-subunit of T-

type calcium channels. PNAS 101, 18195–18199 (2004)

DOI: 10.1073/pnas.0408089101

PMid: 15601764

PMCid: PMC539778

68. Bawin, S. M. & Adey, W. R. Sensitivity of Calcium Binding in Cerebral

Tissue to Weak Environmental Oscillating Low Frequency Electric Fields.

Proc Natl Acad Sci USA 73, 1999–2003 (1976)

DOI: 10.1073/pnas.73.6.1999

PMid: 1064869 PMCid:PMC430435

48

69. Adey, W. R., Bawin, S. M. & Lawrence, A. F. Effects of weak

amplitude-modulated microwave fields on calcium efflux from awake cat

cerebral cortex. Bioelectromagnetics 3, 295–307 (1982)

DOI: 10.1002/bem.2250030302

PMid: 6812594

70. Blackman, C. F., Elder, J. A., Weil, C. M., Benane, S. G., Eichinger, D. C.,

& House, D. E. Induction of calcium-ion efflux from brain tissue by

radiofrequency radiation. Bioelectromagnetics 1, 277–283 (1979)

DOI: 10.1002/bem.2250010304

71. Blackman, C. F., Benane, S., Kinney, L. S., Joines, W. T. & House, D. E.

Effects of ELF Fields on Calcium-ion Efflux from Brain Tissue in vitro.

Radiat Res 92, 510–520 (1982)

DOI: 10.2307/3575923

PMid: 7178417

72. Blackman, C. F., Benane, S. G., House, D. E. & Joines, W. T. Effect of

ELF (1–120 Hz) and modulated (50Hz) RF fields on the efflux of calcium

ions from brain tissue in vitro. Bioelectromagnetics 6, 1–11 (1985)

DOI: 10.1002/bem.2250060102

DOI: 10.1002/bem.2250060402

PMid: 3977964

73. Kirson, E. D., Gurvich, Z., Schneiderman, R., Dekel, E., Itzhaki, A.,

Wasserman, Y., Schatzberger, R., & Palti, Y. Disruption of Cancer Cell

Replication by Alternating Electric Fields. Cancer Res 64, 3288–3295

49

(2004)

DOI: 10.1158/0008-5472.CAN-04-0083

PMid: 15126372

74. Kirson, E. D., Giladi, M., Gurvich, Z., Itzhaki, A., Mordechovich, D.,

Schneiderman, R. S., Wasserman, Y., Ryffel, B., Goldesher, D., &

Palti, Y. Alternating electric fields (TTFields) inhibit metastatic spread of

solid tumors to the lungs. Clin Exp Metastasis 26, 633–640 (2009)

DOI: 10.1007/s10585-009-9262-y

PMid: 19387848 PMCid:PMC2776150

50

Figures, tables and legends

Figure 1. The EMF spectrum. As frequency and energy increase the wavelength decreases. Multiple medically related items and common environmental events are displayed in their respective range in the electromagnetic spectrum (15).

51

Figure 2. A & B. Radio frequency carrier signal as a function of time (horizontal axis). A. The physical appearance of an unaltered carrier signal (i.e. a radiofrequency wave) and amplitude-modulated carrier signal. B. An amplitude-modulated carrier signal showing modulation depth and frequency post modulation (29–31).

52

Table 1. Summary of RF treatment modalities used in oncology.

Table 1. Summary of RF treatment modalities used in oncology

Modality Indications/Mode of delivery

Mechanism of Action

RFA37-39 Predominantly used for the treatment of liver metastases. Treatment is administered during surgical procedure.

Tumor necrosis via thermal ablation

Novocure55,73,74 Treatment of glioblastoma following tumor resection and radiation therapy. Treatment is administered for 18 hr daily by means of electrodes glued to the skin.

Mitotic spindle disruption in proliferating cancer cells Exact molecular mechanism is unknown

Therabionic31,49,52 Treatment of advanced HCC with effect on the primary tumor and its metastases Treatment is administered 3 hr daily by means of a spoon-shaped antenna placed in the patient’s mouth that delivers EMF to the entire body

Direct anti-proliferative effect of cancer cells Mitotic spindle disruption Exact molecular mechanism is unknown

53

CHAPTER II: Cav3.2 T-type VGCCs mediate targeted blockade and

myofibroblast differentiation of hepatocellular carcinoma by tumour-

specific AM RF EMF

Jimenez, H.1, Wang, M.1, Zimmerman, J.W.2,3, Pennison, M.J.1, Sharma, S.1, Xu, Z.3, Brezovich, I.4, Absher, D.5, Myers, R.M.5, DeYoung, B.6, Caudell, D.6, Chen, D.7, Lo, H.W.1, Lin, H.K.1, Godwin, D.W.8, Olivier, M.9, Ghanekar, A.10, Chen, K.,11 Miller, L.D.1, Gong, Y.12, Capstick, M.12, Kuster, N.12, D’Agostino Jr, R.B.13, Munden, R.14, Merle, P.15, Barbault, A.16, Blackstock, A.W.17, Bonkovsky, H.L.18, Jin, G.1, Liu, L.1, Zhang, W.1, Watabe, K.1, Blackman, C.1, Pasche, B1.

1Department of Cancer Biology, Wake Forest Baptist Medical Center, Winston-Salem, NC 2Department of Medicine, The Johns Hopkins School of Medicine, Baltimore, MD 3Division of Hematology/Oncology, The University of Alabama at Birmingham, Birmingham, AL 4Department of Radiation Oncology, The University of Alabama at Birmingham, Birmingham, AL 5HudsonAlpha Institute for Biotechnology, Huntsville, AL 6Department of Pathology, Wake Forest Baptist Medical Center, Winston-Salem, NC 7Division of Preventive Medicine, The University of Alabama at Birmingham, Birmingham, AL 8Department of Neurobiology and Anatomy, Wake Forest Baptist Medical Center, Winston-Salem, NC 9Section of Molecular Medicine, Department of Medicine, Wake Forest Baptist Medical Center, Winston-Salem, NC 10Department of Surgery, University Health Network, Toronto, Ontario, Canada 11Toronto General Hospital Research Institute, Toronto, Ontario, Canada 12IT’IS Foundation, Swiss Federal Institute of Technology, Zurich, Switzerland 13Department of Biostatistical Sciences, Wake Forest Baptist Medical Center, Winston-Salem, NC 14Department of Radiology, Wake Forest Baptist Medical Center, Winston-Salem, NC 15Croix-Rousse University Hospital, Hepato-Gastroenterology and Digestive Oncology, Lyon, France 16TheraBionic GmbH, Ettlingen, Germany 17Department of Radiation Oncology, Wake Forest Baptist Medical Center, Winston-Salem, NC 18Section on Gastroenterology, Department of Medicine, Wake Forest Baptist Medical Center, Winston-Salem, NC Correspondence to: Carl Blackman, Ph.D. [email protected] or Boris Pasche, M.D., Ph.D. [email protected]

The following chapter is a manuscript submitted for publication.

mailto:[email protected]


54

Abstract

Delivery of amplitude-modulated 27.12 MHz radiofrequency

electromagnetic fields (AM RF EMF) by means of a spoon-shaped applicator

placed on the patient’s tongue yields either tumour shrinkage or disease

stabilization in 49% of patients with advanced hepatocellular carcinoma (HCC),

but the mechanism of action is unknown. We found that intrabuccal

administration results in systemic delivery of low and safe levels of AM RF EMF

in humans. We exposed immunocompromised mice carrying human HCC

xenografts to corresponding AM RF EMF levels. Here we show that HCC-specific

AM RF EMF-mediated tumour shrinkage occurs through differentiation of HCC

cells into quiescent myofibroblasts. We also show that AM RF EMF

antiproliferative effects and down-regulation of cancer stem cells in both hepatitis

B virus positive and negative HCC cells are mediated by Ca2+ influx through

Cav3.2 T-type voltage-gated calcium channel (CACNA1H). This finding

establishes a key functional role for Cav3.2 in control of HCC proliferation, and

furthermore establishes this transmembrane protein complex as the main cellular

target for HCC-specific AM RF EMF.

Introduction

Hepatocellular carcinoma (HCC) death rates in the U.S. are increasing

faster than for any other malignancy, having more than doubled in the past

decade.1,2 Worldwide, HCC is the fourth most common cause of cancer death

and the second most common cause of absolute years of life lost due to cancer.4

Despite the recent approval of additional treatment modalities, the outcome of

patients with advanced HCC remains poor and new therapeutic approaches are

55

sorely needed.5 There is growing experimental and clinical evidence that

alternating electric fields and amplitude-modulated electromagnetic fields are

capable of blocking tumour growth.6 However, little is known regarding the kHz to

THz electromagnetic interactions with biological systems, which do not result in

changes in temperature within tumour tissues or in tumour cell membrane

electroporation.

We previously hypothesized7 and subsequently provided experimental

evidence that delivery of 27.12 MHz radiofrequency electromagnetic fields, which

are amplitude-modulated at tumour-specific frequencies, has anticancer activity

both in vitro3 and in a significant percentage of patients with advanced HCC.8

Using HCC and breast cancer cell lines as well as immortalized hepatocytes and

breast epithelial cells, we demonstrated that amplitude-modulated (AM)

radiofrequency (RF) electromagnetic fields (EMF) control the growth of cancer

cells at tumour-specific modulation frequencies but do not affect the growth of

noncancerous cells.3 While both alternating electric fields9 and amplitude-

modulated electromagnetic fields3 have been shown to disrupt the mitotic spindle

of tumour cells, the mechanism by which amplitude-modulated radiofrequency

electromagnetic fields result in tumour shrinkage and long-term therapeutic

responses in patients with cancer is unknown.6 Furthermore, the human

dosimetry of intrabuccal administration has not been characterized.

Here we show that systemic administration of amplitude-modulated

radiofrequency electromagnetic fields by means of a spoon-shaped antenna

placed on the patient’s tongue results in whole body averaged specific absorption

56

rate (SAR) of 1.35 mW/kg with peak spatial SAR ranging from 146 to 352 mW/kg

averaged over 1g of tissue. Using a mouse exposure system replicating human

exposure conditions,10 we show that AM RF EMF-mediated shrinkage of

hepatocellular carcinoma results from differentiation of cancer cells into

quiescent myofibroblasts. We identify Ca2+ influx, mediated by Cav3.2 T-type

voltage calcium channels (CACNA1H) as necessary mediators of AM RF EMF

antiproliferative effects on HCC cells and down-regulation of cancer stem cells,

which is likely to account for the long-term responses observed in patients with

advanced HCC.

Results

Whole-body and organ-specific dosimetry

Intrabuccal administration of AM RF EMF has yielded objective tumour

shrinkage in the femur7, adrenal gland7, liver8, and lungs8 of several patients

suffering from unresectable or metastatic cancer. This strongly suggests that

intrabuccally-administered 27.12 MHz AM RF EMF have systemic anticancer

effects distant from the point of administration, i.e., the buccal mucosa. However,

the levels of AM RF EMF exposure in humans have not yet been characterized.

Therefore, we tested the hypothesis that intrabuccal administration of AM RF

EMFs are absorbed throughout the body because contact between the spoon-

shaped “antenna” applicator and the anterior part of the patient’s tongue could

result in the patient’s body acting as an extension of the antenna.11

The RF output of the previously described device is adjusted to 100 mW

into a 50 Ω load using a sinusoidal test signal.7,8 We assessed the SAR level and

distribution inside the human body and quantified the variability depending on

57

device positioning and patient posture (Fig. 1a). Homogeneous and

inhomogeneous model simulations show similar SAR distribution patterns (Fig.

1b,c). The whole-body (wbSAR) and the peak spatial SAR (psSAR) over any 10

g (psSAR10g) and 1 g (psSAR1g) of major organs according to IEEE standard12

are listed in Table 1a. As shown in Fig. 1b and 1c, intrabuccal delivery of 27.12

MHz AM RF EMF results in whole-body absorption from head to toe and the

highest peak spatial SAR (psSAR) is at the interface between the tongue and the

spoon-shaped applicator. As shown in Table 1b, there is more radiated power

when the device is far away from the body. Conversely, the wbSAR is slightly

higher when the device touches the body, regardless of position (Table 1c).

Experimental validation measurements based on a tank phantom show that the

SAR distribution inside the tank is similar to that of the homogeneous human

model (Fig. 1c, Suppl. Fig. 1a,1b). The wbSAR is 1.35 mW/kg with psSAR over

1 g from 146 to 352 mW/kg when the applicator spoon is perfectly matched,

which is significantly below the International Commission on Non-Ionizing

Radiation Protection (ICNIRP) standard safety limits of 80 mW/kg wbSAR, or

psSAR of 2,000 mW/kg (Table 2).13

Uncertainty and variation assessments were conducted with the patient

sitting with device placed away from the body (Fig. 1a). The posture variation

based on sitting positions as shown in Fig. 1a introduces 0.06 dB deviation. A

±10 kg variation in body weight introduces 0.39 dB deviation, the biggest

contribution, 2.19 dB comes from the variation of the applicator spoon impedance

with posture and device position and its effect on the power delivered to the

58

patient. Therefore, the total variation of 2.21 dB, as shown in Table 1d, mainly

depends on the delivered power. The SAR distributions along the center line

inside the tank phantom are compared to the simulations of the same

configurations (Suppl. Fig. 1a) to determine the effective power delivered by the

spoon-shaped applicator as a function of the positioning of the device. The

effective power per device location is shown in Suppl. Table 1a. Based on the

delivered power, and the power delivered when matched, the effective return loss

can be calculated and is also shown in Suppl. Table 1a. In the real use scenario,

the delivered power is between 11 and 51% of the perfectly matched case.

Reflection coefficient measurements of the applicator spoon were performed with

a portable vector network analyzer, Suppl. Fig. 1c, Suppl. Table 1b; when

compared to those calculated based on normalized fields, more than one effect

must be present, namely, impedance dependent output power variation as well

as mismatch. Consideration not only of the induced field levels, but also the field

distributions inside the rectangular phantom, shows that the measurements and

simulations are generally in agreement, as shown in Suppl. Fig. 1a for

configurations 1 and 3 in Fig. 1d, which are equivalent to the sitting position with

the device on the thigh and a short distance away from the body, respectively.

The differences are larger in locations with low field strength, e.g., at the far end

of the phantom from the applicator spoon, as the induced field strengths are

close to or below the measurement system noise floor. This is especially evident

in cases where the mismatch is largest and delivered power is low. E-field

measurements normalized to the same delivered power, for lines in the middle

59

and along the bottom of the phantom for the different positions of the device, are

shown in Suppl. Fig. 1b. Away from the immediate vicinity of the applicator

spoon, there is not much difference between the two distributions along the tank,

as might be expected; locations close to the surface are more sensitive to the

device location.

Analysis of in vivo effects of amplitude-modulated radiofrequency

electromagnetic fields

With a well-defined characterization of human exposure dosimetry, we set

out to replicate the human exposure conditions in an in vivo setting, therefore, we

used a custom-designed small animal AM RF EMF exposure system and

exposed tumour-bearing mice with tumours developing in subcutaneous tissue

predominantly surrounded by fat.10 The exposure system RF output was set for

delivery of a SAR level of 67 mW/kg. This SAR was selected so that it is 1) within

the range of previously demonstrated in vitro activity (30 - 400 mW/kg) 3 and 2)

within the range of wbSAR1g and psSAR1g in humans (1 - 352 mW/kg) (Table

2). We used Huh7 and patient-derived tumour cells as subcutaneous cellular

xenograft models of HCC.14-16 Thirty-seven of 40 mice injected with Huh7 cells

developed palpable tumours and were exposed to HCC-specific AM RF EMF

(HCC), randomly chosen AM RF EMF (RCF), or were not exposed to EMF

(SHAM) as controls. Both control subsets (randomly chosen AM RF EMF and no

exposure) were compared to the group exposed to HCC-specific frequencies (N

= 20). The treatment by time interaction was highly significant (p<0.001) showing

that tumour growth curves were different among the three groups. Comparison

between the two control subsets showed no statistical difference over the course

60

of 6 weeks; P = 0.655. The two groups were therefore combined as control

group. Comparison between the pooled control group (N = 17) and the HCC-

specific AM RF EMF (N = 20) group shows beginning separation between groups

at week 4 (p = 0.08), and significant separation at week 5 (p = 0.045), and week

6 (p = 0.019) (Figure 2a).

To characterize, in vivo, the temporal relationship between exposure to

HCC-specific modulation frequencies and HCC growth, we studied five mice,

which had been exposed to randomly chosen AM RF EMF three hours daily for

ten weeks. As shown in Fig. 2b, the growth of Huh7 xenografts stopped within

one week of exposure to HCC-specific AM RF EMF exposure (week 11) and the

tumours shrank by 62% within 3 weeks of exposure. To assess the carry-over

effect of HCC-specific AM RF EMF, we stopped exposure at the end of week 13.

As shown in Fig. 2b, the average volume of Huh7 xenografts increased by 109%

within two weeks. To determine whether repeat exposure to HCC-specific AM RF

EMF could again block tumour growth, mice were re-exposed to HCC-specific

AM RF EMF at week 15. As shown in Fig. 2b tumour growth was, again,

effectively blocked within one week of re-exposure. Lastly, to assess, in vivo, the

effect of HCC-specific AM RF EMF on HCC tissue sampled at the time of

surgery, patient-derived xenograft model (PDX), we exposed 6 PDX mice to

HCC-specific AM RF EMF, with 4 PDX mice observed as controls. As shown in

Fig. 2c, tumour growth was significantly inhibited by HCC-specific AM RF EMF,

test for treatment by time interaction (p = 0.0006).

61

In summary, we observed significant tumour shrinkage ranging from near

complete and partial response to tumour stabilization in two different mouse

models of HCC, which establishes that HCC-specific AM RF EMF exert

sustained control over the growth of HCC tumours in vivo at SAR levels

corresponding to the levels delivered in patients with advanced HCC.

Tumour shrinkage is caused by HCC cell differentiation into quiescent

myofibroblasts

Having observed accumulation of fibroblast-like cells at the site of HCC

xenografts, which had shrunken following exposure to HCC-specific AM RF EMF

(Fig. 2d), we sought to identify the origin of these cells using green-fluorescent

protein (GFP) tagged Huh7 cells.

As shown in Fig. 2e, there was strong GFP staining indicated by the red

staining in the cluster of cells long arrow of the fibroblast-like cells surrounding

and intermeshed with residual Huh7 cells demonstrating the HCC origin of the

fibroblast-like cells. To investigate the nature of this epithelial to mesenchymal

transition (EMT), we performed immunohistochemistry analysis of several EMT

markers. As shown in Fig. 2f, EMT marker analysis identified two separate

subpopulations of fibroblast-like cells in shrunken tumours, a peripheral region

surrounding a distinct central region. The peripheral cells are positive for E-

cadherin, fibronectin, smooth muscle actin (SMA), SNAIL and TWIST while the

centrally located cells are more intensely positive for fibronectin and SMA but did

not stain for E-cadherin, N-cadherin and SNAIL and had decreased staining for

TWIST, indicative of a myofibroblast-like profile (Fig. 2g). These findings suggest

62

that tumour shrinkage during exposure to HCC-specific AM RF EMF results in

the differentiation of HCC cells into a quiescent myofibroblastic phenotype.

To test the hypothesis that HCC-specific AM RF EMF only targets the

proliferation of HCC cells in vivo, we assessed tumour Ki67 as well as intestinal

crypt BrdU staining in mice in which HCC-specific AM RF EMF had yielded at

least 55% tumour shrinkage as well as in control mice. As shown in Fig. 2h, Ki67

and cyclin D1 staining was decreased and p21 increased in the tumours of mice

exposed to HCC-specific AM RF EMF compared to control mice. However, there

was no difference in either intestinal crypt BrdU staining among AM RF EMF-

exposed and control mice (Fig. 2h). Similarly, there were no differences in white

blood cells, red blood cells and platelets between AM RF EMF-exposed and

control mice at the time of sacrifice (Suppl. Table 2a).

Calcium influx and Cav3.2 T-type Voltage Gated Calcium Channels mediate

AM RF EMF antiproliferative effects

To agnostically assess the impact of HCC-specific AM RF EMF on HCC,

we performed a combined review of the previously published RNA-Seq data3 and

new microRNA array assays. Ingenuity pathway analysis identified the IP3/DAG

signaling pathway through differential expression of several genes and

microRNAs (Suppl. Fig 3a). Differential expression of several key genes and

microRNAs modulating this pathway was confirmed in Huh7 cells (Suppl. Fig.

3b). Ca2+ modulates several steps of this pathway,17 and we and others18 have

shown that Ca2+ flux from brain tissue is enhanced upon exposure to RF EMF

when modulated at specific frequencies, irrespective of the carrier frequency

63

used (50, 147, and 450 MHz).19 We therefore postulated that Ca2+ is involved in

HCC-specific AM RF EMF antiproliferative effects on HCC cells.

We first assessed changes in intracellular Ca2+ in HCC cells upon

exposure to HCC-specific AM RF EMF. As shown in Suppl. Fig. 3c, there was

an increase in intracellular Ca2+ following exposure to HCC- specific AM RF

EMF. To further characterize the role of Ca2+ in HCC-specific AM RF EMF, we

added BAPTA, a chelator of extracellular Ca2+, during each HCC-specific AM RF

EMF exposure. As shown in Fig. 3a, chelation of extracellular Ca2+ abrogated

HCC-specific AM RF EMF antiproliferative effects and did not affect the

proliferation of Huh7 cells exposed to randomly chosen AM RF EMF.

Having demonstrated that extracellular Ca2+ influx was necessary for

HCC-specific AM RF EMF inhibition of HCC cell proliferation, we sought to

identify how Ca2+ enters the cells. Ca2+ entry is mainly controlled by voltage-

gated Ca2+ channels (VGCC),20 which are overexpressed in several forms of

cancer and are implicated in limitless replicative potential, invasion, and

metastasis.21,22 We used inhibitors of L-type and T-type VGCCs to determine

whether these VGCCs are involved in HCC-specific AM RF EMF inhibition of cell

proliferation. Neither nifedipine nor amlodipine, both of which block L-type

VGCCs, had any impact on HCC-specific AM RF EMF’s inhibition cell

proliferation (data not shown). In contrast, ethosuximide, which blocks all three

isoforms (Cav 3.1, 3.2, 3.3) of T-type VGCCs,23 abrogated HCC-specific AM RF

EMF’s inhibition of Huh7 cell proliferation (Fig. 3b). Having identified T-type

VGCCs as the necessary mediators of HCC-specific AM RF EMF’s inhibition of

64

HCC cells, we sought to determine which of the three T-type VGCCs isoforms

accounted for this effect. While knockdown of the Cav3.1 and Cav3.3 isoforms did

not affect HCC-specific AM RF EMF-mediated inhibition of HCC cell proliferation,

knockdown of the Cav3.2 isoform did abrogate HCC-specific AM RF EMF’s

antiproliferative effects in Huh7 and Hep3B cell lines (Fig. 3c).

HCC-specific AM RF EMF block HCC cancer stem cells

It has been shown that sorafenib, a tyrosine kinase inhibitor, significantly

improves the survival of patients with advanced HCC.24,25 However, patients

invariably develop resistance to sorafenib and demonstrate objective evidence of

disease progression at 16 months,24-26 and there is growing evidence that HCC

cancer stem cells (CSCs) are responsible for tumour recurrence and resistance

to sorafenib.27-29 We have previously reported several long-term responses in

patients with advanced HCC receiving intrabuccally administered AM RF EMF.

Specifically, 6 (14.6%) of the 41 patients had an overall survival in excess of 26

months, and one patient was treated continuously for 5 years and 2 months

without any evidence of disease progression prior to expiring of causes unrelated

to her malignancy.8,11 One additional off-study patient with rapidly progressive

disease received continuous treatment with HCC-specific AM RF EMF for 6

years and 2 months prior to expiring with minimal progression of disease (Suppl.

Fig. 4). These unexpectedly long-lasting responses led us to test the hypothesis

that HCC-specific AM RF EMF target cancer stem cells (CSCs) as therapies

affecting CSCs are associated with long-term survival.30

We first assessed the anti-proliferative effects of HCC-specific AM RF

EMF on hepatitis B virus (HBV) positive cell lines as 53% of hepatocellular

65

carcinoma cases worldwide are attributable to HBV infection.31 As shown in Fig.

3d, the proliferation of HBV positive HCC cell lines from patients of Asian

(HCCLM3 and MHCC97L) and African-American (Hep3B) ancestry was

effectively blocked by HCC-specific AM RF EMF. Next, we assessed the impact

of HCC-specific AM RF EMF on HBV negative (Huh7) and HBV positive (Hep3B)

CSCs. As shown on Fig. 3e, exposure to HCC-specific AM RF EMF led to 57%

and 38% decreases in Huh7 and Hep3B CSCs (CD44+CD133+) cells,

respectively. Sphere formation was similarly decreased by 26% and 28% in Huh7

and Hep3B cells, respectively. However, in the presence of ethosuximide, there

were no significant decreases in CSCs or sphere formation in either Huh7 or

Hep3B cells demonstrating that inhibition of CSCs is also mediated by T-type

VGCCs (Suppl. Fig. 2). The experiments were repeated with cells in which

Cav3.2 VGCC had been knocked down. As shown in Fig. 3f, knockdown of

Cav3.2 VGCCs abrogated HCCMF downregulation of CSCs in Huh7 as well as

Hep3B cells.

Discussion

Dosimetry analysis shows that 27.12 MHz AM RF EMF administered by

means of a spoon-shaped applicator results in systemic EMF absorption. The

results also demonstrate that the human body acts as an antenna resulting in

head to toe delivery of AM RF EMF thereby enabling treatment of the primary

tumour and its metastases. These findings provide a biophysical rationale for the

antitumour effects documented in patients with metastases in the femur, liver,

adrenal glands, and lungs.7,8 Tumour-specific AM RF EMF appear to have a

broad therapeutic window as tumour shrinkage was observed in humans,7,8 in

66

human xenografts as presented in this report, and in vitro3 at SARs ranging from

0.02 mW/kg to 400 mW/kg. In all conditions studied, the device complies with the

two standards for human exposure to RF EMF, the ICNIRP13 and the IEEE12.

The animal experiments faithfully reproduce the antitumour effects observed in

patients with advanced HCC8 by demonstrating the antitumour activity of HCC-

specific AM RF EMF with partial responses and significant inhibition of cell

proliferation in Huh7 as well as patient xenografts derived from surgical samples.

These experiments show that the small animal exposure system replicates

human AM RF EMF exposure conditions in mice moving freely in the cage during

treatment.

The lack of antiproliferative activity of randomly chosen AM RF EMF

confirms in vivo the earlier in vitro findings3 and establishes that random AM RF

EMF do not affect HCC proliferation unless they are amplitude-modulated at

HCC-specific frequencies. We have previously shown that HCC-specific AM RF

EMF have a robust in vitro antiproliferative effect occurring after a week of daily

three 1-hour exposures. Similarly, the growth of Huh7 xenografts, which had

grown while exposed to randomly chosen frequencies, was stabilized within one

week of exposure HCC-specific AM RF EMF, which is indicative of in vivo

anticancer effect occurring within the same time interval. The targeted effect of

HCC-specific AM RF EMF compared to randomly chosen AM RF EMF is

illustrated by tumour reduction and changes in tumour Ki67, cyclin D1, and p21

while the proliferation of intestinal cells and complete blood counts are

unaffected. These findings are consistent with the absence of changes in

67

complete blood counts (CBC) in patients receiving HCC-specific AM RF EMF,

even after several years of treatment.8

Our findings establish that tumour reduction mediated by HCC-specific AM

RF EMF results from differentiation of HCC into quiescent myofibroblasts. The

transformation of HCC into quiescent myofibroblasts contrasts with the well

documented association between the EMT phenotype and aggressive HCC32

and unveils a new treatment related phenotype in hepatocellular carcinoma.

The data presented in this report and in our previous publication3 show that

HCC-specific AM RF EMF block the growth of HCC cells derived from African-

American (Hep3B), Asian (Huh7, HCCLM3, MHC97L), and Caucasian (HepG2)

patients with HCC, irrespective of their HBV status, indicating that HBV positive

and negative HCC cells derived from individuals of different ethnic backgrounds

respond to the antiproliferative effects of HCC-specific AM RF EMF. With respect

to CSCs, our results indicate that HCC-specific AM RF EMF have a profound

effect on HBV positive and negative HCC CSCs. This provides a plausible

mechanism for the unusually long therapeutic responses observed in several

patients with advanced HCC. These findings, together with the observation of a

complete response, as identified by the alpha-fetoprotein (AFP) tumour marker,

in a patient receiving a combination of sorafenib and HCC-specific AM RF EMF

provide a strong rationale for clinical studies combining HCC-specific AM RF

EMF with either multi-kinase inhibitors or immune oncology therapies.

From a mechanistic point of view, we show that both Ca2+ and, more precisely,

the Cav3.2 isoform of the T-type VGCCs, are key mediators of the tumour cell

68

response, capable of distinguishing HCC-specific AM RF EMF. We propose that

Cav3.2 VGCCs are selectively sensitive for tumour-specific AM RF EMF

frequencies in epithelial malignancies. That Cav3.2 is responsive to EMF is

strongly supported by prior reports33 and our own findings showing that the same

Cav3.2 VGCCs mediate the antiproliferative effects and repress CSCs in breast

cancer following exposure to breast cancer-specific AM RF EMF (Sharma et al,

co-submitted). We have previously reported that variation in pulse amplitude

constitutes the primary method for identification of tumour-specific modulation

frequencies,7 which have subsequently been shown to target cancer cell

proliferation in a tumour and tissue-specific fashion.3 Cav3.2 T-type VGCCs are

expressed in both endothelial cells and vascular smooth muscle cells of small

arteries, which in turn directly affect pulse amplitude.34 Hence, Cav3.2 T-type

VGCCs are the most probable link between the vascular system, crucial to the

tumour-specific frequency identification process7 and the anticancer effects

observed in vitro, in vivo and in patients with advanced HCC. They are also likely

to be necessary for the myofibroblastic differentiation of HCC during tumour

regression, a phenotype that can only be observed following long term exposure

to HCC-specific AM RF EMF resulting in Cav3.2 T-type VGCC-mediated

inhibition of tumour cell proliferation.

The importance of Cav3.2 VGCCs in cancer proliferation has been

reported in several recent studies across a variety of cancer types,35 including

breast carcinoma, retinoblastoma, neuroblastoma, glioma melanoma, and

HCC.35,36 The most likely functional role of these channels is in mediation of Ca2+

69

influx that may contribute to Ca2+ oscillations within carcinoma stem cells – these

have been observed to occur in the G(1) to S cell cycle transition.37-40

Pharmacological block of T-type channels is thought to slow the G(1) to S

transition, but may not necessarily kill proliferating cells.

In the current study, Cav 3.2 T-type VGCCs were found to be necessary

and sufficient to mediate the antiproliferative effects of tumour-specific AM RF

EMF. Surprisingly, blocking of the T-type channel did not affect HCC cell

proliferation and appears to protect against the antiproliferative effects of AM RF

EMF though a mechanism that is yet unknown. The blockade is counterintuitive

given the preliminary success of some T-type channel blockers in reducing

proliferation and enhancing survival in several cancer types.41 This suggests that

the nature of T-type channel is complex, potentially extending to orchestration of

intracellular events either in tandem with, or independently from voltage-

dependent calcium influx.36,42 The effect of AM RF EMF acting in concert with

these channels may be to perturb Ca2+ oscillations, disrupt intracellular Ca2+

levels, the G(1) to S transition, and promote transformation to a quiescent

myofibroblast. These findings also indicate that the use of T-type VGCCs

blockers such as ethosuximide at therapeutic doses does not affect the growth of

HCC. However, until this mechanism is better understood, our results suggest

that the use of T-type VGCCs blockers such as ethosuximide should be avoided

in patients receiving treatment with tumour-specific-AM RF EMF, as they are

likely to oppose the anticancer effects of the treatment.

70

What remains to be established is the site(s) where the HCC-specific AM

RF EMF signal is demodulated so as to influence the changes in pulse pressure

identified in patients with specific cancers7 and the mechanism(s) by which the

HCC-specific AM RF EMF signal influences the Cav 3.2 T-type VGCCs on

tumour cells. Knowledge of the mechanism(s) should also lead to a better

understanding of the precision and effectiveness of the HCC-specific

frequencies.

In summary, we have identified Cav3.2 T-type VGCCs as the necessary

and sufficient mediators of antiproliferative and CSCs downregulating effects of

non-ionizing, non-thermal RF EMF, which are amplitude-modulated at HCC-

specific frequencies. These findings may have broad implications for the

diagnosis and treatment of various forms of cancer.

Online methods:

Dosimetry simulation

The primary purpose of the dosimetry assessment is to determine the

safety of the device and provide insight into organ-specific absorption of AM RF

EMF. The predicted absorption of intrabuccally-administered 27.12 MHz AM RF

EMF and the observed clinical results showing shrinkage of the primary and/or

metastatic tumours in several parts of the body of several patients prompted us

to systematically characterize the overall and organ-specific levels of AM RF

EMF delivered during treatment with the previously described TheraBionic

device.7,8 As previously described, the AM RF EMF generator is a battery driven

device connected to a 1.5 m long 50 Ω coaxial cable, which ends with a

stainless-steel spoon-shaped mouthpiece connected via an impedance

71

transformer.7,8 The device operates at a carrier frequency of 27.12 MHz. The

carrier frequency is amplitude-modulated at tumour-specific frequencies with

85% modulation depth, sequentially switched every 3 seconds from the lowest to

the highest frequency in the range of 0.01 Hz to 150 kHz. Dosimetry simulation,

performed with SEMCAD X, was based on the adult male anatomical model

Duke (weight 73 kg) of the ‘Virtual Population’.43 For simplicity, the TheraBionic

device is represented by a metal box of dimensions 80 mm × 60 mm × 160 mm,

covered with a plastic layer. The wire, modeled as 1 m in length, is connected to

a metal block of size 5 mm × 30 mm × 50 mm to mimic the spoon-shaped

mouthpiece, which is placed on the anterior part of the human model’s tongue.

The simulation is set with 2 mm resolution for humans at a frequency of 27.12

MHz. The total power delivered, SAR distribution, and the organ specific SAR are

assessed, and compared with the experimental results based on a similar but

simplified scenario.

The scenarios of the different treatments are selected based on the three

most common postures used with the device, which are shown in Fig. 1a: 1)

sitting with the device on the leg; 2) sitting with the device on the abdomen; 3)

sitting with the device placed away from the body. 4) is a theoretical position to

test the hypothesis that the body can act as one half of a short dipole antenna –

with the cable and device forming the other half – that occurs when the device is

placed away from the head and aligned with the body and the patient lying down.

These human postures are first simulated on homogeneous models with

dielectric parameters of muscle (εr = 95.9 and σ = 0.65 S/m), which provides a

72

general view of the power dissipation and SAR distribution in the human models.

Furthermore, inhomogeneous human models – with all tissues segmented and

allocated appropriate electrical properties – are simulated for two of the four

cases, 1) and 3), which are the two most common adopted by patients receiving

treatment, to verify the power dissipation and SAR distribution compared with the

homogeneous model and to analyze the organ-specific SAR.

Dosimetry experimental validation

The validation measurements are based on a tank phantom due to its

simple construction and higher SAR levels for given input power. The size of the

chosen tank is 100 mm × 150 mm × 890 mm, with a tissue simulating liquid

composed of saline with εr = 78.9 and σ = 0.435 S/m. Similar configurations in

geometry are used as for human body simulation, thus allowing the same degree

of comparison, and are shown in Fig. 1d. In each configuration, two lines in the

tank have been measured with SPEAG’s Dosimetric Assessment System

(DASY) with EX3DV3 probe S/N 3515 (SPEAG, Switzerland); one line is 5 mm

above the spoon position, and the other is 5 mm above the bottom of tank. These

measured results are compared to the corresponding tank simulation to verify the

simulation reliability.

AM RF EMF exposure in vitro: Cell lines were exposed to 27.12 MHz

radiofrequency electromagnetic fields using exposure systems designed to

replicate clinical exposure levels. Experiments were conducted at an SAR of 30

and 400 mW/kg. Cells were exposed for three hours daily, seven days in a row.

Cells were exposed to tumour-specific modulation frequencies that were

73

previously identified by changes in pulse pressure7 in patients with a diagnosis of

HCC8 or modulation frequencies never identified in patients with a diagnosis of

cancer. Specifically, the randomly chosen frequencies have been selected at

random in the range of 500 Hz to 22 kHz, i.e., within the same range as the

hepatocellular carcinoma-specific and breast cancer-specific frequencies. The

only selection criterion within this range was for frequencies to be at least 5 Hz

higher or lower than any hepatocellular carcinoma or breast cancer-specific

frequency identified in patients with the corresponding diagnoses.3,7,8 We have

previously reported that the primary method for identification of tumour-specific

frequencies is an increase in the amplitude of the pulse for one or more beats

during scanning of frequencies.7 Using the same method, we monitored

variations in the amplitude of the radial pulse in thirty patients with a diagnosis of

cancer and did not observe any change in pulse amplitude during exposure to

the randomly chosen frequencies.

Cell lines: HCC cell lines of various ethnic background, HepG2

(Caucasian), Hep3B (African American, hepatitis B positive) and Huh7 (Asian),

HCCLM3 (Asian, hepatitis B positive), and MHCC97-L (Asian, hepatitis B

positive) were used as models of representation for HCC. THLE2 cells are an

immortalized non-malignant hepatocyte cell line. HepG2, Hep3B and THLE2

cells were purchased from ATCC (Manassas, VA) and Huh7 cells were

purchased from Creative Bioarray (Shirley, NY). HCCLM3 and MHCC97-L were

a gift from the Liver Cancer Institute, Fudan University, China. The Huh7/GFP

cells were established by infection with lentiviruses expressing Lv-EF1α-puro-

74

GFP (SignaGen, Rockville, MD) followed by selection with 1 µg/ml puromycin for

2 weeks. Pools of puromycin-resistant stable clones were collected. Expression

of GFP was determined by western blot and fluorescent microscopy.

Gene expression analysis: RNA extraction from cells was performed by

using RNeasy Mini Kit or miRNeasy Mini Kit (QIAGEN). qRT-PCR was

performed using a Roche LightCycler II and 1-Step Brilliant II SYBR Green qRT-

PCR master mix kit (Agilent Technologies). Data for qRT-PCR were expressed

as mean ± SEM and statistical differences between groups were calculated by a

2-tailed Student t-test.

shRNA knockdown of T-type voltage gated calcium channels: The

specific knockdown of all 3 T-type VGCC isoforms Huh-7 and Hep3B cells were

accomplished by using the following kits. CACNA1g Human shRNA Plasmid Kit

[Locus ID 8913] (Cat# TL305680 ORIGENE); CACNA1h Human shRNA Plasmid

KIT [Locus ID 8912] (Cat# TL314243 ORIGENE); CACNA1i Human shRNA

Plasmid Kit [Locus ID 8911] (Cat# TL314242 ORIGENE).

Quantitative real time PCR target primers and machine protocol:

CACNA1g (Cav 3.1)-Forward primer: 5’ CTT ACC AAC GCC CTA GAA ATC A 3’;

CACNA1g (Cav 3.1)-Reverse primer: 5’ GAT GTA GCC AAA GGG ACC ATA C

3’; CACNA1h (Cav 3.2)-Forward primer: 5’ CAA GGA TGG ATG GGT GAA CA 3’

; CACNA1h (Cav 3.2)-Reverse primer: 5’ GAT GAG CAG GAA GGA GAT GAA G

3’; CACNA1i (Cav 3.3)-Forward primer: 5’ GCC CTA CTA TGC CAC CTA TTG

3’; CACNA1i (Cav 3.3)-Reverse primer: 5’ AGG CAG ATG ATG AAG GTG ATG

3’; GAPDH-Forward primer: 5’ TGC ACC ACC AAC TGC TTA GC 3’; GAPDH-

75

Reverse primer: 5’ GGC ATG GAC TGT GGT CAT GAG 3’; MIR-1246-Forward

primer: 5’ CCG TGT ATC CTT GAA TGG ATT T 3’; MIR-1246-Reverse primer: 5’

CAT TGC TAG CCT ATG GAT TGA TTT 3’; HSA-LET-7G-Forward primer: 5’

GCT GAG GTA GTA GTT TGT ACA GTT 3’; HSA-LET-7G-Reverse primer: 5’

GCA GTG GCC TGT ACA GTT AT 3’; RPLPO-Forward primer: 5’ TTC ATA CCC

AGC TAG CCA ATC 3’; RPLPO-Reverse primer: 5’ TTT CCA TCC CAC TCC

CTT TC 3’; All primers were purchased from IDT. Roche LightCycler 489

Instrument II Protocol: 1 cycle for 30 min at 50oC, 1 cycle for 10 min at 95oC, 40 x

(30 sec at 95oC / 1 minute at 60oC), Rest at 4oC.

Extracellular Ca2+ chelation: Huh-7 cells – seeded in 35 mm dishes, 6

dishes per group – were cultured in the presence or absence of the extracellular

Ca2+ chelator 1,2-bis(2-aminophenoxy) ethane-N,N,Nʹ,Nʹ-tetraacetic acid

(BAPTA; Sigma-Aldrich). BAPTA was dissolved in dimethyl sulfoxide (DMSO;

Fisher), as per Sigma-Aldrich recommendations, to create a working solution.

The AM RF EMF treatment groups were as follows: HCC-specific, randomly

chosen, HCC-specific + BAPTA, randomly chosen + BAPTA. Cells were left to

adhere overnight then were cultured in Dulbecco’s Modified Eagle’s Medium

(DMEM; Cellgro) supplemented with heat inactivated fetal bovine serum (FBS,

final concentration 10%; Atlanta Biologicals). Cells were exposed to either HCC-

specific or randomly chosen frequencies daily for 3 hours in a row, either in the

presence or absence of BAPTA (final concentration 100 µM). The BAPTA

working solution was added to the culture medium within 5 min before exposure

to HCC-specific or randomly chosen frequencies. Within 5 min after completion

76

of the 3-hour exposure time, the BAPTA-containing media was discarded and

replaced with fresh media without BAPTA. On the day 7, cell proliferation was

assessed with the tritiated thymidine incorporation assay. Experiments were

repeated twice. Statistics: We fit a 2-way ANOVA model to examine the effect of

experiment (first/second) and group (four-levels: HCC, randomly chosen, HCC +

BAPTA, and randomly chosen + BAPTA).

L--type and T-type voltage gated calcium channel blockade:

L-type VGCC blockade: Huh-7 cells were seeded in 6-well plates and cultured

in the presence or absence of a L-type voltage gated calcium channel (VGCC)

blocker, nifedipine, (Sigma-Aldrich). Nifedipine was dissolved in dimethyl

sulfoxide (DMSO; Fisher), as per Sigma-Aldrich recommendations, to create

working solution. The treatment groups were as follows: HCC, randomly chosen

frequencies, HCC + nifedipine, and randomly chosen frequencies + nifedipine.

Cells were left to adhere overnight and then were cultured in Dulbecco’s Modified

Eagle’s Medium (DMEM; Cellgro) supplemented with heat inactivated FBS (final

concentration 10%). Cells were exposed to either HCC-specific or randomly

chosen frequencies daily for 3 hours in a row, either in the presence or in the

absence of nifedipine (final concentration 100 µM or 10 µM). Nifedipine working

solution was added to the culture medium within 5 min before exposure to HCC-

specific or randomly chosen frequencies. Within 5 min after completion of the 3-

hour exposure time, media was removed from all dishes and replaced with fresh

media, not containing nifedipine. On day 7, cell proliferation was assessed with

the tritiated thymidine incorporation assay. The experiment was repeated twice.

77

T-type VGCC blockade: Huh-7 cells were seeded in 6 well plates at 20,000 cells

per dish and cultured in the presence or absence of a pan T-type VGCC 2-ethyl-

2-methlysuccinimide (ethosuximide, ETHOS group) (1 mM) (Sigma-Aldrich).

Ethosuximide was dissolved in 100% ethanol as the vehicle control (VC) (Fisher)

as per Sigma-Aldrich recommendation to create working solution. The treatment

groups were as follows: SHAM (VC), RCF (VC), HCC (VC), SHAM (ETHOS),

RCF (ETHOS) and HCC (ETHOS). Cells were left to adhere overnight and were

then cultured in Dulbecco’s Modified Eagle’s Medium (DMEM; Cellgro)

supplemented with heat inactivated FBS (final concentration 10%). Cells were

exposed to either HCC-specific or randomly chosen AM RF EMF daily for 3

hours in a row or received no treatment, either in the presence or in the absence

of ethosuximide (final concentration 1mM). Ethosuximide working solution was

added to the culture medium within 10 min before exposure to HCC, RCF, or

SHAM groups. Within 5 min after completion of the 3-hour exposure time, media

was removed from all dishes and replaced with fresh media without

ethosuximide. On day 7, cell proliferation was assessed with the tritiated

thymidine incorporation assay, flow cytometry markers were stained, or cells

were cultured in tumour sphere media for sphere formation assays. Experiments

were repeated at least twice. Statistics: One-way ANOVA was used to

statistically compare the effect of experimental (HCC-specific AM RF EMF) and

control groups (SHAM and randomly chosen frequencies). Post hoc testing was

by the Tukey test. Data are expressed as mean ± SEM. Graphpad Prism was the

software used for statistical analysis.

78

Flow Cytometric Analysis: Cells cultured, divided and treated into HCC,

RCF or SHAM groups. After 7 days of treatment cells were labeled for CD44-

APC (mouse anti-human 1:20,000(Huh-7) and 1:10(Hep3B), Cat#103011

Biolegend) and CD133-PE (mouse anti-human 1:10 (Huh-7) and 1:20(Hep3B),

Cat# 130-098-826 Miltenyi Biotec) markers of cancer stem cell, fixed and

analyzed via flow cytometry. Data collection was performed on a C6 Accrui flow

cytometer while analysis was performed on CFlow Plus software (Becton

Dickinson).

Sphere formation assay: Cells were cultured, divided and treated in

HCC, RCF or SHAM groups. Cells were plated (200 cells/well) in 96-well ultra-

low attachment plates (Corning) with DMEM/F12 supplemented with 2% B27

(Invitrogen), 20 ng/ml EGF (Sigma Aldrich), and 4 μg/ml insulin (Sigma-Aldrich).

Cells seeded at a density of 100-500 viable cells per 100uL. 5-7 days post-

treatment cells were counted for the number of spheres present in each well and

data were represented as the means ± SEM.

In vivo effects of amplitude-modulated radiofrequency

electromagnetic fields: To replicate the dosimetric conditions resulting from

intrabuccal administration of AM RF EMF in vivo, we designed and developed a

small animal exposure system for AM RF EMF.10 This exposure system allows

for control of SAR levels in the same range as those generated by intrabuccal

administration.10 Mice were exposed to RF EMF amplitude-modulated at the

previously published HCC-specific3 or randomly chosen3 frequencies 3 hours

daily. Another group of control mice was not exposed to any RF EMF. All

79

procedures were approved by the Wake Forest Institutional Animal Care and Use

Committee (IACUC). A total of 40 non-obese diabetic severe combined

immunodeficient (NOD SCID; Jackson labs) mice (male and female) were used.

Mice were housed in plastic cages with up to 5 mice/cage at room temperature

and fed a standard mouse diet with water ad libitum (food and water were

autoclaved). Mice were injected subcutaneously in the right hind flank with 7.0 x

106 Huh-7 cells, re-suspended in 200 µL of DPBS, at 5-7 weeks of age and then

randomly assigned to HCC-specific RF EMF, randomly chosen frequencies, or

no exposure (SHAM) conditions. Thirty seven of the 40 (92.5%) mice developed

palpable Huh7 tumours. Upon establishment of a palpable tumour, measuring at

a minimum of 0.5 cm in one dimension (Length or Width), mice were exposure

with HCC-specific RF EMF or randomly chosen frequencies was initiated and

give 3 hours daily. An additional group of mice were not exposed to any RF EMF

(SHAM treatment group). Mice set to receive AM RF EMF exposure were placed

in a custom-designed exposure system,10 consisting of two transverse

electromagnetic (TEM) cells configured as half-wave resonators (sXv-27, IT’IS,

Zurich, Switzerland). Mice were exposed to 27.12 MHz EMF, modulated at HCC-

specific amplitude 8 or randomly chosen3 frequencies with a SAR of 400 mW/kg,

which results in an organ-specific SAR of 67 mW/kg for subcutaneous tumours,

i.e., tumours located in the subcutaneous fat.10 Tumours were measured with

calipers three times per week. Mice were euthanized when tumour burden was

excessive; 2 hours before euthanasia, a total of 12 mice (6 exposed to HCC-

specific AM RF EMF, 3 exposed to randomly chosen AM RF EMF, 3 not exposed

80

to EMF) were injected intraperitoneally with 200 µL bromodeoxyuridine labeling

reagent (BrdU; Life Technologies). Mouse tissue and xenograft tumour were

collected/fixed for paraffin embedding and evaluated by immunohistochemistry.

Patient derived Xenograft mice: 10 NSG female mice, with PDX implanted

tumours, were provided by Anand Ghanekar M.D. from University Health

Network (UHN) (Toronto, Ontario, Canada). Briefly, the patient derived tumour

was from a 63 year-old male HCC patient with negative viral serologies, no

metastases to lymph nodes, positive for microscopic and large vessel vascular

invasions, multiple satellites/intrahepatic metastatic smaller nodules, TNM stage:

pT3bN0 and no significant fibrosis or other active parenchymal or biliary injury.

The tumour was implanted into immunocompromised (NSG) mice as previously

described.44 After one month of quarantine, 6 mice were exposed to HCC-

specific AM RF EMF, and 4 mice were observed as controls. In total, mice

received HCC-specific AM RF EMF for 8 weeks. Statistics: In vivo tumour

volume comparisons were accomplished by repeated measures mixed models

analysis. In these models group and time were fixed effects and the individual

animals were treated as random effects. A time by group interaction was

examined to determine if tumour growth rates were different between groups. If

the time by group interaction was found to be significant, the mixed models were

fit again stratified by time to allow for groups to be compared at individual time

points to determine when the observed effects became statistically significant.

Immunohistochemistry: Xenografts were fixed in 10% neutral buffered

formalin (NBF), sectioned at 4 μm and stained for the following: Cyclin D1 [92G2]

81

(Rabbit anti-human 1:100, #2978s Cell Signaling Technology); Ki-67 [D2H10]

(Rabbit anti-human 1:800, #9027s Cell Signaling Technology); p21 Waf1/Cip1

[DCS60] (Mouse anti-human 1:100, #2946s Cell Signaling Technology); S100B

[9A11B9] (Mouse anti-human 1:100, sc-81709 Santa Cruz Biotechnology); BrdU

[Bu20a] (Mouse anti-human 1:400, #5292s Cell Signaling Technology); PCNA

[PC10] (Mouse anti-human 1:8000, #2586s Cell Signaling Technology); Green

Fluorescent Protein (GFP) (Rabbit 1:400, #2555s Cell Signaling Technology);

SLUG [A-7] (Mouse anti-human (no results), sc-166476 Santa Cruz

Biotechnology); E-Cadherin [HECD-1] (Mouse anti-human 1:100, ab1416

ABCAM); N-Cadherin [D4R1H] XP (Rabbit anti-human 1:125, #13116 Cell

Signaling Technology); SNAI1 [OTI5E12] (Mouse anti-human 1:25), TA500316

ORIGENE); Alpha Smooth Muscle Actin (Rabbit anti-human 1:200, ab5694

ABCAM); Vimentin [V9] (Mouse anti-human 1:1200, ab8069 ABCAM);

Fibronectin [F1] (Rabbit anti-human 1:300, ab32419 ABCAM); Twist [10E4E6]

(Mouse anti-human 1:100, ab175430 ABCAM); The small bowels of mice were

fixed in 10% Neutral buffered formalin and stained for BrdU (1:400). Average

number of positive staining cells was counted in a blinded fashion for both control

and treated groups. Tumour samples were from mice with established tumour

after subcutaneous xenograft injection of the Huh-7 cells, having received HCC-

specific, randomly chosen frequencies or SHAM treatment for ten weeks. EMT

and GFP tagged IHC slides were prepared and digitally scanned by the Wake

Forest Baptist Comprehensive Cancer Center Tumour Tissue and Pathology

Shared Resource. All images were prepared with Nano Zoomer Digital pathology

82

software (Hamamatsu Photonics K.K.) from digital slide scans (1x and 20x

magnification). IHC staining was performed by Dr. David Caudell. Visualization

and quantification were performed by Dr. Barry DeYoung, average number of

positive staining cells was counted for both control and treated groups. Tumour

samples were from mice with established tumour after subcutaneous xenograft

injection of the Huh-7 cells, having received HCC-specific, randomly chosen

frequencies or SHAM treatment for ten weeks. Statistics: One-way Analysis of

Variance (ANOVA) was used to statistically compare the effect of experimental

(HCC-specific AM RF EMF) and control groups (SHAM & Randomly chosen

frequencies). Post-Hoc testing was compared by a Tukey Test. Data for

Immunohistochemistry were expressed as mean ± SEM. Graphpad Prism was

the software used for statistical analysis.

RNA-Seq data analysis: We have generated two RNA-Seq data sets

using two cell lines, Huh-7 and HepG2. The RNA-Seq data of Huh-7 include 6

controls and 6 treated samples. HepG2 data set contains 2 controls and 2

treated samples. The alignment and quality control of RNA-Seq data followed the

pipeline developed by The NCI's Genomic Data Commons (GDC,

https://gdc.cancer.gov/). The alignment was performed using a two-pass method

with STAR2.45 The quality assessment was carried out by FASTQC

(https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) on the pre-

alignment, and RNA-SeQC46 and Picard tools

(http://broadinstitute.github.io/picard/) on the post-alignment. Read Counts were

performed by SummarizedExperiment of DESeq2.47 The count data were

https://gdc.cancer.gov/)

83

normalized by betweenLaneNormalization function of EDASeq48 to normalize the

data using upper-quartile (UQ) normalization and then estimate the factors of

unwanted variation using empirical control genes, e.g.,, least significantly

differentially expressed (DEGs) genes based on a first-pass DEG analysis

performed prior to RUVg normalization.49 Lastly, DEG analysis is implemented by

DESeq2 by adding the factors of unwanted variation into design of DESeq2 in

order to remove unwanted variation. MicroRNA arrays: the initial microRNA array

analysis did not reach any significance. Eighty percent of miRs are not expressed

and should not be penalized. After adjustment for the lack of expression of 80%

of the miRs, miR-1246 was the most significant miR showing differential

expression in both HepG2 and Huh7. There are additional miRs that are

invariably significant in addition to miR-1246: miR-4306, 378b, 1973, 3175, which

are similarly more expressed upon exposure to HCC-specific AM RF EMF.

Long-term antitumour effect in a patient with advanced

hepatocellular carcinoma: A 79-year-old man, diagnosed with hepatocellular

carcinoma in January 2011, underwent left hepatectomy in February 2011.

Histologic review revealed a 10-cm lesion consistent with poorly differentiated

hepatocellular carcinoma with negative margins, pT3NxMx. Recurrent disease

was identified by radiologic imaging in May 2011 revealing four new lesions

within the right lobe of the liver. The patient underwent chemoembolization of the

liver lesions with lipiodol and doxorubicin in June 2011. Follow-up magnetic

resonance imaging (MRI) obtained in July 2011 showed intrahepatic progression

of disease. The patient started sorafenib on August 15, 2011 and compassionate

84

use treatment with the TheraBionic device on September 15, 2011. As shown on

Suppl. Fig. 4 the patient had a complete response by marker and a partial

response as assessed by imaging studies, which lasted more than 6 years.

Acknowledgements:

Research reported in this publication was supported by the National

Cancer Institute’s Cancer Center Support Grant award number P30CA012197

issued to the Wake Forest Baptist Comprehensive Cancer Center (BP) and by

funds from the Charles L. Spurr Professorship Fund (BP). DWG is supported by

R01 AA016852. The content is solely the responsibility of the authors and does

not necessarily represent the official views of the National Cancer Institute. The

authors wish to acknowledge the support of the Wake Forest Baptist

Comprehensive Cancer Center Cancer Genomics, Proteomics, Biostatistics, and

Bioinformatics Shared Resource, supported by the National Cancer Institute’s

Cancer Center Support Grant award number P30CA012197. The content is

solely the responsibility of the authors and does not necessarily represent the

official views of the National Cancer Institute.”

Author contributions:

Jimenez, H., Wang, M., Zimmerman, J.W., Sharma, S., Xu, Z., and

Pennison, M., contributed directly to data generation and performance of in vitro

and in vivo experiments.

Brezovich, I., designed initial cell culture model of EMF exposure device

and provided physics related tutoring and initial EMF SAR calculations.

Lin, H.K., Blackstock, A.W., Bonkovsky, H.L. reviewed the manuscript and

provided critical comments.

85

Capstick, M., Gong, Y., and Kuster, N. designed and performed dosimetry

models, data analysis and write up of final results.

Ghanekar, A. and Chen, K. provided the implanted PDX tumour mouse

model.

Watabe, K., Lo, H.W., and Godwin, D.W., provided specialized training in

CSC-related cell culture, mouse handling, and Ca2+ related tools and signaling to

Jimenez, H.

Merle, P., and Munden, R. provided clinical HCC patient information and

data review.

Absher, D., Myers, R.M., Miller, L.D., Olivier, M., Jin, G., Liu, L., and

Zhang, W. were involved in microRNA and RNA-Seq data generation, analysis

and interpretation.

DeYoung, B. and Caudell, D. performed IHC staining, interpretation and

overall pathology review.

Jimenez, H. and D’Agostino Jr., R.B. performed all statistics

Jimenez, H., Blackman, C., Barbault, A., and Pasche, B. designed all

experiments, reviewed all data, and were responsible for data write up.

COMPETING FINANCIAL INTERESTS

Boris Pasche and Alexandre Barbault hold stocks in TheraBionic LLC and

TheraBionic GmbH.

86

References

1 Siegel, R. L., Miller, K. D. & Jemal, A. Cancer statistics, 2017. CA. Cancer

J. Clin. 67, 7-30, doi:10.3322/caac.21387 (2017).

2 Islami, F. et al. Disparities in liver cancer occurrence in the United States

by race/ethnicity and state. CA. Cancer J. Clin. 67, 273-289,

doi:10.3322/caac.21402 (2017).

3 Zimmerman, J. W. et al. Cancer cell proliferation is inhibited by specific

modulation frequencies. British journal of cancer 106, 307-313 (2012).

4 Global Burden of Disease Cancer, C. Global, regional, and national

cancer incidence, mortality, years of life lost, years lived with disability,

and disability-adjusted life-years for 32 cancer groups, 1990 to 2015: A

systematic analysis for the global burden of disease study. JAMA

Oncology 3, 524-548, doi:10.1001/jamaoncol.2016.5688 (2017).

5 Kudo, M. et al. Lenvatinib versus sorafenib in first-line treatment of

patients with unresectable hepatocellular carcinoma: a randomised phase

3 non-inferiority trial. Lancet, doi:10.1016/S0140-6736(18)30207-1 (2018).

6 Jimenez, H. et al. Use of non-ionizing electromagnetic fields for the

treatment of cancer. Front Biosci (Landmark Ed) 23, 284-297 (2018).

7 Barbault, A. et al. Amplitude-modulated electromagnetic fields for the


assessment of a novel therapeutic approach. J. Exp. Clin. Cancer Res.

28, 51, doi:10.1186/1756-9966-28-51 (2009).

87

8 Costa, F. P. et al. Treatment of advanced hepatocellular carcinoma with

very low levels of amplitude-modulated electromagnetic fields. British

journal of cancer 105, 640-648 (2011).

9 Kirson, E. D. et al. Disruption of Cancer Cell Replication by Alternating

Electric Fields. Cancer Res. 64, 3288-3295 (2004).

10 Capstick, M., Gong, Y., Pasche, B. & Kuster, N. An HF exposure system

for mice with improved efficiency. Bioelectromagnetics 37, 223-233,

doi:10.1002/bem.21969 (2016).

11 Zimmerman, J. W. et al. Targeted treatment of cancer with radiofrequency

electromagnetic fields amplitude-modulated at tumor-specific frequencies.

Chin J Cancer 32, 573-581, doi:10.5732/cjc.013.10177 (2013).

12 IEEE. IEEE Standards for Safety Levels with Respect to Human Exposure

to Radio Frequency Electromagnetic Fields, 3 kHz to 300 GHz, IEEE

C95.1-2005. (Institute of Electrical and Electronics Engineers, New York,

2006).

13 ICNIRP. Guidelines for limiting exposure to time-varying electric, magnetic

and electromagnetic fields (up to 300 GHz). Health Phys. 74, 494-522

(1998).

14 Schnater, J. M. et al. Subcutaneous and intrahepatic growth of human

hepatoblastoma in immunodeficient mice. J. Hepatol. 45, 377-386,

doi:10.1016/j.jhep.2006.03.018.

88

15 Sharma, D. et al. Adiponectin antagonizes the oncogenic actions of leptin

in hepatocellular carcinogenesis. Hepatology 52, 1713-1722,

doi:10.1002/hep.23892 (2010).

16 Ahmed, S. U. et al. Generation of subcutaneous and intrahepatic human

hepatocellular carcinoma xenografts in immunodeficient mice. J Vis Exp,

e50544, doi:10.3791/50544 (2013).

17 Albarran, L., Lopez, J. J., Salido, G. M. & Rosado, J. A. in Calcium Entry

Pathways in Non-excitable Cells (ed Juan A. Rosado) 3-24 (Springer

International Publishing, 2016).

18 Blackman, C. F. et al. Induction of calcium-ion efflux from brain tissue by

radiofrequency radiation. Bioelectromagnetics 1, 277-283 (1980).

19 Bawin, S. M., Kaczmarek, L. K. & Adey, W. R. Effects of modulated VHF

fields on the central nervous system. Ann.N Y.Acad.Sci. 247, 74-81

(1975).

20 Catterall, W. A. Voltage-Gated Calcium Channels. Cold Spring Harbor

Perspectives in Biology 3, doi:10.1101/cshperspect.a003947 (2011).

21 Prevarskaya, N., Skryma, R. & Shuba, Y. Ion channels and the hallmarks

of cancer. Trends in molecular medicine 16, 107-121,

doi:http://doi.org/10.1016/j.molmed.2010.01.005 (2010).

22 Prevarskaya, N., Skryma, R. & Shuba, Y. Calcium in tumour metastasis:

new roles for known actors. Nature Reviews Cancer 11, 609-618 (2011).

23 Gomora, J. C., Daud, A. N., Weiergräber, M. & Perez-Reyes, E. Block of

Cloned Human T-Type Calcium Channels by Succinimide Antiepileptic

http://doi.org/10.1016/j.molmed.2010.01.005

89

Drugs. Mol. Pharmacol. 60, 1121-1132, doi:10.1124/mol.60.5.1121

(2001).

24 Llovet, J. M. et al. Sorafenib in Advanced Hepatocellular Carcinoma. The

New England Journal of Medicine 359, 378-390 (2008).

25 Cheng, A. L. et al. Efficacy and safety of sorafenib in patients in the Asia-

Pacific region with advanced hepatocellular carcinoma: a phase III

randomised, double-blind, placebo-controlled trial. The lancet oncology

10, 25-34, doi:10.1016/S1470-2045(08)70285-7 (2009).

26 Abou-Alfa, G. K. et al. Phase II study of sorafenib in patients with

advanced hepatocellular carcinoma. J. Clin. Oncol. 24, 4293-4300 (2006).

27 Wang, A., Qu, L. & Wang, L. At the crossroads of cancer stem cells and

targeted therapy resistance. Cancer Lett. 385, 87-96,

doi:http://doi.org/10.1016/j.canlet.2016.10.039 (2017).

28 Tovar, V. et al. Tumour initiating cells and IGF/FGF signalling contribute to

sorafenib resistance in hepatocellular carcinoma. Gut 66, 530-540,

doi:10.1136/gutjnl-2015-309501 (2017).

29 Xu, Y. et al. MicroRNA-122 confers sorafenib resistance to hepatocellular

carcinoma cells by targeting IGF-1R to regulate RAS/RAF/ERK signaling

pathways. Cancer Lett. 371, 171-181,

doi:http://doi.org/10.1016/j.canlet.2015.11.034 (2016).

30 Jones, R. J. & Matsui, W. Cancer Stem Cells: From Bench to Bedside.

Biology of blood and marrow transplantation : journal of the American

http://doi.org/10.1016/j.canlet.2016.10.039

http://doi.org/10.1016/j.canlet.2015.11.034

90

Society for Blood and Marrow Transplantation 13, 47-52,

doi:10.1016/j.bbmt.2006.10.010 (2007).

31 Perz, J. F., Armstrong, G. L., Farrington, L. A., Hutin, Y. J. & Bell, B. P.

The contributions of hepatitis B virus and hepatitis C virus infections to

cirrhosis and primary liver cancer worldwide. J. Hepatol. 45, 529-538,

doi:10.1016/j.jhep.2006.05.013 (2006).

32 Critelli, R. et al. Microenvironment inflammatory infiltrate drives growth

speed and outcome of hepatocellular carcinoma: a prospective clinical

study. Cell Death Dis 8, e3017, doi:10.1038/cddis.2017.395 (2017).

33 Cui, Y., Liu, X., Yang, T., Mei, Y.-A. & Hu, C. Exposure to extremely low-

frequency electromagnetic fields inhibits T-type calcium channels via

AA/LTE4 signaling pathway. Cell Calcium 55, 48-58,

doi:https://doi.org/10.1016/j.ceca.2013.11.002 (2014).

34 Mikkelsen, M. F., Bjorling, K. & Jensen, L. J. Age-dependent impact of Cav

3.2 T-type calcium channel deletion on myogenic tone and flow-mediated

vasodilatation in small arteries. The Journal of physiology 594, 5881-5898,

doi:10.1113/JP271470 (2016).

35 Dziegielewska, B., Gray, L. S. & Dziegielewski, J. T-type calcium channels

blockers as new tools in cancer therapies. Pflügers Archiv - European

Journal of Physiology 466, 801-810, doi:10.1007/s00424-014-1444-z

(2014).

36 Li, Y. et al. A role of functional T-type Ca2+ channel in hepatocellular

carcinoma cell proliferation. Oncol. Rep. 22, 1229-1235 (2009).

https://doi.org/10.1016/j.ceca.2013.11.002

91

37 Resende, R. R. et al. Influence of spontaneous calcium events on cell-

cycle progression in embryonal carcinoma and adult stem cells.

Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1803,

246-260, doi:https://doi.org/10.1016/j.bbamcr.2009.11.008 (2010).

38 Keir, S. T., Friedman, H. S., Reardon, D. A., Bigner, D. D. & Gray, L. A.

Mibefradil, a novel therapy for glioblastoma multiforme: cell cycle

synchronization and interlaced therapy in a murine model. J. Neurooncol.

111, 97-102, doi:10.1007/s11060-012-0995-0 (2013).

39 Gray, L. S., Schiff, D. & Macdonald, T. L. A model for the regulation of T-

type Ca2+ channels in proliferation: roles in stem cells and cancer. Expert

Review of Anticancer Therapy 13, 589-595,

doi:http://dx.doi.org/10.1586/era.13.34 (2013).

40 Lory, P., Bidaud, I. & Chemin, J. T-type calcium channels in differentiation

and proliferation. Cell Calcium 40, 135-146,

doi:https://doi.org/10.1016/j.ceca.2006.04.017 (2006).

41 Krouse, A. J., Gray, L., Macdonald, T. & McCray, J. Repurposing and

Rescuing of Mibefradil, an Antihypertensive, for Cancer: A Case Study.

Assay and drug development technologies 13, 650-653,

doi:10.1089/adt.2015.29014.ajkdrrr (2015).

42 Tonelli, F. M. P. et al. Stem Cells and Calcium Signaling. Adv. Exp. Med.

Biol. 740, 891-916, doi:10.1007/978-94-007-2888-2_40 (2012).

43 Gosselin, M. C. et al. Development of a new generation of high-resolution

anatomical models for medical device evaluation: the Virtual Population

https://doi.org/10.1016/j.bbamcr.2009.11.008

http://dx.doi.org/10.1586/era.13.34

https://doi.org/10.1016/j.ceca.2006.04.017

92

3.0. Phys. Med. Biol. 59, 5287-5303, doi:10.1088/0031-9155/59/18/5287

(2014).

44 Chen, K., Ahmed, S., Adeyi, O., Dick, J. E. & Ghanekar, A. Human solid

tumor xenografts in immunodeficient mice are vulnerable to

lymphomagenesis associated with Epstein-Barr virus. PloS one 7,

e39294, doi:10.1371/journal.pone.0039294 (2012).

45 Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics

29, 15-21, doi:10.1093/bioinformatics/bts635 (2013).

46 DeLuca, D. S. et al. RNA-SeQC: RNA-seq metrics for quality control and

process optimization. Bioinformatics 28, 1530-1532,

doi:10.1093/bioinformatics/bts196 (2012).

47 Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change

and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550,

doi:10.1186/s13059-014-0550-8 (2014).

48 Risso, D., Schwartz, K., Sherlock, G. & Dudoit, S. GC-content

normalization for RNA-Seq data. BMC Bioinformatics 12, 480,

doi:10.1186/1471-2105-12-480 (2011).

49 Risso, D., Ngai, J., Speed, T. P. & Dudoit, S. Normalization of RNA-seq

data using factor analysis of control genes or samples. Nat Biotechnol 32,

896-902, doi:10.1038/nbt.2931 (2014).

93

Figures and legends

Figure 1.| Intrabuccal delivery results in systemic absorption of AM RF EMF. a,1) Patient sitting with device on thigh, 2) Patient sitting with device on the abdomen, 3) Patient sitting with device placed away from the body, 4) Patient in supine position to test the hypothesis that the body can act as one half of a short dipole antenna while the cable and device form the other half, or for treatment lying down while the device is behind the head. The device and coaxial cable are shown in blue. The electric dipole is shown in green. b, SAR slice views in the homogeneous human model: the images are normalized to 5 W/kg/W, with 3 dB/contour. 1) Patient sitting with device on thigh, 2) Patient sitting with device on the abdomen, 3) Patients sitting with device placed away from the body, 4) Patient in supine position. c, SAR slice views in the inhomogeneous model: the images are normalized to 5 W/kg/W, with 3 dB/contour. Left panels: patient sitting with device on thigh. Right panels: patient sitting with device located away from the body. d, Experimental validation measurements setups and results.1) The device is located at one extremity underneath the tank, 2) The device is in the middle underneath the tank, 3) The device is beside the tank, 4) The device is as far away from the tank as possible.

94

Figure 2 | Antiproliferative effects of HCC-specific AM RF EMF in vivo. a, Mice were exposed to either HCC-specific AM RF EMF exposure with a xenograft-specific SAR of 67 mW/kg or are assigned to the control treatment group 3 hours per day. Control group is comprised of mice receiving either randomly chosen frequency AM RF EMF with a xenograft-specific SAR of 67 mW/kg and those receiving no exposure to EMF. Tumour volume is measured 3 times per week and volume is calculated as (Length x Width2) / 2. After of 6 weeks of exposure, statistical significance between treated and control groups has been achieved; Week 5 (p = 0.045), Week 6 (p = 0.019). P-value was calculated via student’s t-test. Test for treatment by time interaction (p < 0.001). b, Sequential exposure to randomly chosen and HCC-specific AM RF EMF. Five mice carrying Huh7 xenografts were exposed to randomly chosen AM RF EMF (grey line) 3 hours per day for ten weeks during which the average tumour volume increased by 48%. Exposure was switched to HCC-specific AM RF EMF (blue line) after ten weeks. Exposure to EMF was discontinued for one week after four weeks exposure, then resumed. Mice were sacrificed at the end of week 16. c, Patient-derived HCC xenografts (PDX) exposed to HCC-specific AM RF EMF or not exposed to EMF. Patient derived xenografts from a 63-year-old male with hepatocellular carcinoma. Mice received either HCC-specific AM RF EMF exposure (HCC; N = 6) or received no treatment (SHAM; N =4). Tumour volume measured 3 times per week and volume is calculated as (Length x Width2) / 2. After 8 weeks of exposure, statistical significance had been achieved; Week 4 (p = 0.0176), Week 5 (p = 0.0211). At week 6, all mice in the Sham group expired and tumour volume was imputed, Week 6 (p = 0.0553). Test for treatment by time interaction (p = 0.0006). d, Origin of fibroblast-like cells intermeshed with tumour cells following HCC specific AM RF EMF mediated tumour shrinkage. Transition between epithelial neoplasm with strong GFP signal on the right contrasted with decreased but persistent GFP signal in cells with more spindle morphology on the left demonstrating the same cell of origin for the two populations (20x Lens). e, Epithelial to myofibroblast transition of Huh7 cells after exposure to HCC-specific AM RF EMF. IHC staining pattern. f, IHC summary of EMT staining pattern of responding tumours after HCC-specific AM RF EMF treatment. g, Fibroblast-like cells surrounding residual HCC cells following exposure to HCC-specific AM RF EMF. NOD SCID mice carrying palpable xenografts were exposed to HCC-specific AM RF EMF three hours daily at a SAR of 67 mW/kg. The Huh7 xenograft shrank by approximately 70% at the same time point. Histological analysis (20X) shows residual HCC cells () surrounded by layers of fibroblast-like cells (#) and occasional lipocytes. h. Tumor and intestinal crypt cell proliferation in mice exposed to HCC-specific AM RF EMF, randomly chosen AM RF EMF, and mice not exposed to EMF. IHC of Huh-7 Xenograft tumors, Representative figures and graphs represent mean +/- SEM (SHAM: N = 3; RCF: N = 3; HCC: N = 6). (1st row): Ki-67 staining of SHAM, RCF and HCC treated tumors. Anova: F = (2, 33) 67.55, P = <0.0001. Post-Hoc Tukey Test: Sham vs RCF p = 0.2067, SHAM vs HCC p <0.0001, RCF vs HCC p < 0.0001. (2nd row): Cyclin D1 staining of SHAM, RCF and HCC treated tumors. Anova: F = (2, 33) 23.29, p < 0.0001. Post-Hoc Tukey test: Sham vs RCF p =

95

0.1379, SHAM vs HCC p <0.0001, RCF vs HCC p = 0.0005. (Third row): p21 staining of SHAM, RCF and HCC treated tumors Anova: F = (2, 33) 6.907, p = 0.0031. Post-Hoc Tukey test: Sham vs RCF p = 0.7373, Sham vs HCC p = 0.0411, RCF vs HCC p = 0.0049. (Fourth row): BRDU staining of SHAM, RCF and HCC treated tumors. Positive staining in all crypts; no statistics performed.

97

Fig. 3 | HCC-specific AM RF EMF antiproliferative effects and downregulation of CSCs are mediated by Cav 3.2 T-type voltage gated calcium channels. a, Ca2+ chelation abrogates AM RF EMF-mediated inhibition of Huh7 cell proliferation. Huh7 cells were exposed to either randomly chosen (RCF) or hepatocellular carcinoma-specific (HCCMF) AM RF EMF three hours daily for seven days prior to cell proliferation assays with tritiated thymidine incorporation. ANOVA followed by tukey post hoc-test showed that only the proliferation of cells exposed to HCC-specific AM RF EMF was significantly lower than cells exposed to the extracellular Ca2+ chelator (BAPTA) or randomly chosen AM RF EMF (p = 0.0023). b, T-type voltage gated calcium channel blockade with ethosuximide abrogates HCC-specific AM RF EMF inhibition of Huh7 cell proliferation. Huh7 cells were exposed to HCC-specific AM RF EMF(HCCMF) three hours daily for seven days prior to cell proliferation assays. Huh7 cells not exposed to AM RF EMF (SHAM) were used as controls. Experiments were performed in the presence or absence of ethosuximide (Ethos). ANOVA followed by Tukey post-hoc indicates that only HCC-specific AM RF EMF block Huh7 cell proliferation (p < 0.0001). c, Inhibition of cell proliferation by HCC-specific AM RF EMF in Huh7 and Hep3B cells with selective knockdown of Cav 3.1, 3.2 and 3.3 T-type voltage gated calcium channels. The three T-type voltage-gated calcium channels Cav 3.1, Cav 3.2, and Cav 3.3 were selectively knocked down using siRNA targeting the CACNA1G (sh3.1), CACNA1H (sh3.2), and CACNA1I (sh3.3) genes, respectively. CACNA1I (sh3.3) expression in Hep3B cells was not detectable by qPCR, as noted in Cav isoform relative expression graph, hence knockdown was not attempted. Cell proliferation was assessed after exposure to HCC-specific AM RF EMF (HCCMF) three hours daily for seven days. Control cells were not exposed to AM RF EMF (SHAM). Huh7 data (LEFT): shScramble (N=5 for both groups) T-test p value: 0.0092; sh3.1 (N=6 for both groups) t test p value: <0.0001; sh3.2 (N=6 for both groups) t test p value: 0.4948; Sh3.3 (N=6 for both groups) t test p value: 0.0071. Hep3B data (RIGHT): shScramble (N=5 for SHAM and N=6 for HCCMF) T-test p value: 0.0493; sh3.1 (N=6 for SHAM and N=5 for HCCMF) t test p value: 0.0443; sh3.2 (N=6 for both groups) t test p value: 0.1691. (Lower): Basal expression levels of the three T-types voltage-gated calcium channels isoforms Cav 3.1, Cav 3.2, and Cav 3.3 in multiple cell lines (RED circles signify targets with no detectable expression via qRT-PCR). d, Antiproliferative effects of HCC-specific AM RF EMF on HBV positive HCC cells. Cell proliferation was assessed in HCC cells exposed to HCC-specific AM RF EMF using a [3H]thymidine incorporation assay as described before.3 e, Effect of HCC-specific AM RF EMF on HCC Cancer stem cells. The cancer stem cell population of Huh7 (upper panel) and Hep3B (lower panel) cells was assessed after one week of exposure to HCC-specific AM RF EMF. Control cells were not exposed to HCCMF. The population of cancer stem cells was significantly lower following exposure to HCC-specific AM RF EMF. (UPPER PAIR) Huh7 %CSC Data: SHAM (N = 4) and HCCMF (N = 4); T-test p value = 0.0091. Huh7 Sphere formation: SHAM (N = 5) and HCCMF (N = 5); T-test p-value = 0.0011. (LOWER PAIR) Hep3B %CSC Data: SHAM (N = 4) and HCCMF (N = 3); T-test p value = 0.0091. Hep3B Sphere formation: SHAM

98

(N = 7) and HCCMF (N = 6); T-test p-value = 0.0011. f, Effect of HCC-specific AM RF EMF on Cav 3.2 knockdown HCC Cancer stem cells. The cancer stem cell population of Huh7 Cav3.2 knockdown (upper panel) and Hep3B Cav 3.2 knockdown (lower panel) cells was assessed after one week of exposure to HCC-specific AM RF EMF. Control cells were not exposed to EMF. The population of cancer stem cells was equal to or greater than the control group following exposure to HCC-specific AM RF EMF. (UPPER) Huh7 Cav 3.2 knockdown sphere formation: SHAM (N = 5) and HCCMF (N = 5); T-test p-value = 0.2364. (LOWER) Hep3B Cav 3.2 knockdown sphere formation: SHAM (N = 6) and HCCMF (N = 7); T-test p-value = 0.0034.

99

Table 1. Dosimetry assessment

100

Table 2. Organ-specific SAR

101

Supplemental Figures

Suppl. fig. 1a: Measurement and simulation comparison for case 1 and 3. After correct normalization of the delivered power, the measurement and simulation data can be compared: they are generally in agreement for cases 1 and 3. The larger deviations between simulation and measurement at the far end of tank as for case 3 are due in part to the lower delivered power, resulting in a decrease in the fields too close to the noise floor of the measurement system.

102

Suppl. fig. 1b: Measurement data along a line in the middle of and close to the bottom surface of the tank phantom for the four cases The measured electric (E-) fields for the different positions of the treatment device, normalized to remove the effect of the mismatch, are shown below. The two graphs show the measurement results of the middle and bottom (close to the surface) measurement tracks. It can be observed that there is not much difference between the middle track and the bottom track in the tank when away from the immediate vicinity of the spoon. The measurement along a line at the bottom close to the surface is more sensitive to the device position. The position of the device influences the distribution of power deposition. There is a slight difference caused by the cable of the device and its proximity to the phantom. From the simulation, the influence of the cable has been evaluated with the cable attached to the phantom surface, which increases the coupling; an increase of 0.6 dB in average SAR is observed.

Middle of the tank phantom

Bottom close to the surface of the tank phantom

103

Suppl. fig 1c: Vector network analyzer (VNA) connected to the end of the coaxial cable. Matching of the device plays an important role with respect to power delivery. We have therefore measured the applicator spoon feed impedance and reflection coefficient using a vector network analyzer (VNA) connected wirelessly to the computer. We measured an applicator containing the standard matching network at the device end of the coaxial cable.

104

Suppl. fig. 2: Ethosuximide blocks HCC-specific AM RF EMF inhibition of CSC. a. Huh7 %Cancer Stem Cell population (CD44+CD133+) of SHAM and HCCMF groups cultured in the presence or absence of Ethosuximide (Ethos) (1mM) (N ≥ 3). Anova: F (3,10) = 11.16; p = 0.0016. Post-Hoc Tukey Test: SHAM vs HCCMF p = 0.0015 and SHAM+Ethos vs HCCMF+Ethos p = 0.5537. b. Number of Huh7 tumor spheres (counted 6 days post treatment) of SHAM and HCCMF groups cultured in the presence or absence of Ethosuximide (1mM) (N ≥ 5). Anova: F (3,18) = 39.69; p < 0.0001. Post-Hoc Tukey Test: SHAM vs HCCMF p = 0.0060 and SHAM+Ethos vs HCCMF+Ethos p = 0.0037. c. Hep3B %Cancer Stem Cell (CD44+CD133+) of SHAM and HCCMF groups cultured in the presence or absence of Ethosuximide (N = 4). Anova: F (3,12) = 5.416; p = 0.0137. Post-Hoc Tukey Test: SHAM vs HCCMF p = 0.0212 and SHAM+Ethos vs HCCMF+ Ethos p = 0.5426. d. Number of Hep3B tumor spheres (counted 6 days post treatment) of SHAM and HCCMF cultured in the presence or absence of Ethosuximide (N = 6). Anova: F (3,20) = 9.092; p = 0.0005. Post-Hoc Tukey Test: Sham vs HCCMF p = 0.0007 and SHAM+Ethos vs HCCMF+Ethos p = 0.2005.

105

Suppl. fig. 3a HCC-specific AM RF EMF modulation of the IP3/DAG signaling pathway. Pathway analysis using HepG2 RNA-seq and microRNA arrays identified the IP3/DAG signaling pathway. The brown background highlights the differentially expressed genes and microRNAs. The role of Ca2+ in this pathway is highlighted with yellow square frames.

106

Suppl. fig. 3b Validation of differently expressed IP3/DAG signaling pathway gene and miRNA in HepG2 and Huh7 cells exposed to HCC-specific AM RF EMF. (1st Row) S100b target validation in HepG2 [(Left; N = 8 both group) T-test p-value = 0.0265] and Huh7 [(Right; N = 10 Control / N = 9 HCC group) T-test p-value < 0.0001]. (2nd Row) miRNA-1246 target validation in HepG2 [(Left; N = 14 both groups) T-test p-value = 0.0214] and Huh7 [(Right; N = 15 both groups) T-test p-value = 0.0069]. (3rd Row) hsa-let-7g target validation in HepG2 [(Left; N = 14 Control / N = 15 HCC group) T-test p-value = 0.0462] and Huh7 [(Right; N = 18 both groups) T-test p-value = 0.0059].

107

Suppl. fig. 3c Distribution of calcium in HepG2 cells exposed to HCC specific AM RF EMF. Calcium was more diffusely distributed in the cytoplasm of HepG2 cells exposed to HCC specific AM RF EMF for 3 hours than in control HepG2 cells not exposed to AM RF EMF. (A) Oregon Green 488 BAPTA-AM was used to identify Ca2+ localization with the green fluorescent protein (GFP) channel of the microscope; (B) Overlayed bright field and GFP images to view Ca2+ localization in combination with the entire cell structure. Qualitiative experiment performed once.

108

Suppl. fig. 4a Long-term response in a patient with metastatic hepatocellular carcinoma receiving treatment with HCC specific AM RF EMF. A 79-year-old man was diagnosed with hepatocellular carcinoma in January 2011. He underwent left hepatectomy in February 2011, which revealed the presence of a poorly differentiated hepatocellular carcinoma. The tumors largest diameter was 10 cm and was staged as pT3NxMx. In May 2011, the patient had evidence of disease progression with four new lesions identified within the right lobe of the liver and new mediastinal adenopathy. Treatment with sorafenib was initiated in August 2011 and discontinued in February 2013 because of intolerable side effects. Simultaneous compassionate treatment with the TheraBionic device was administered 3 hours a day from September 2011 until April 2017 when the patient became unable to receive treatment on a regular basis because of hip fracture secondary to a fall, generalized weakness, and worsening renal failure. He passed away in October 2017. The patient had complete response by marker as the level of alpha fetal protein (AFP) decreased from 92,620 international units/ml (IU/ml) on August 12, 2011 prior to treatment initiation to 4.18 IU/ml on January 16, 2011. Following discontinuation of Nexavar in February 2013 the patient’s AFP level remained below 20 IU/ml until May 2014 when it started to rise slowly and was 553 IU/ml in June 2017 prior to admission to the hospital for left femur fracture repair. The AFP level began to rise more rapidly from the time the patient became unable to receive TheraBionic treatment until October 9, 2017, when it reached 2038 IU/ml.

109

Suppl. fig. 4b Key imaging studies of the same patient. Imaging studies obtained prior (upper panel: July 2011) and during (lower panel: December 2011) treatment show partial response as assessed by RECIST criteria.

110

Suppl. Table 1a: Effective treatment powers with the TheraBionic Device.

111

Suppl. Table 1b: Measured return loss for spoon shaped antenna.

112

Suppl. Table 2. Peripheral blood counts of tumour-bearing NOD-SCID mice exposed to HCC-specific AM RF EMF as well as mice not exposed to EMF.

113

CONCLUSION

This dissertation builds on prior scientific discoveries that identified

changes in vascular tone in patients exposed to radiofrequency electromagnetic

fields when modulated at specific frequencies. Exposure of patients with

advanced hepatocellular carcinoma to the same modulation frequencies has

yielded tumor shrinkage and tumor stabilization. Exposure of hepatocellular

carcinoma cells to the same modulation frequencies resulted in in vitro

proliferative inhibition, mitotic spindle disruption, and subtle changes in gene

expression.

First, using mouse models I discovered that hepatocellular carcinoma cells

differentiate into quiescent myofibroblasts during AM RF EMF-mediated tumor

shrinkage. Second, I found that AM RF EMF antiproliferative effects and down-

regulation of cancer stem cells are mediated by Ca2+ influx through Cav3.2 T-

type voltage-gated calcium channel (CACNA1H). Third, I demonstrated that this

mechanism of action is relevant to both hepatitis B virus positive and negative

HCC cells. The findings reported here represent a major milestone in

understanding the therapeutic action of tumor-specific AM RF EMF. The

discovery that Cav3.2 (CACNA1H) VGCC is a key mediator of the anticancer

effect of tumor-specific AM RF EMF exposure may broaden our understanding of

how electromagnetic fields in the kHz to the THz range interact with biological

systems, a known ‘black box’ in the research field of Bioelectromagnetics.

While some research has previously suggested ion channels being

affected by EMF exposure, this is the first report of a specific isoform of a

channel necessary and sufficient for the antiproliferative and stem-cell repressive

114

effects AM RF EMF. This may be a crucial step towards identification of a

potential broad reaching “bio-antenna” for an EMF.

It is my hope that these findings will lead to the establishment of a model

that can be used in identifying the point(s) of demodulation thereby advancing

the field of Bioelectromagnetics in diagnostics and therapeutics and lead to the

discovery of the cascade of events fundamental to the anticancer effect of tumor-

specific AM RF EMF.

115

APPENDICES

APPENDIX a: The role of cell death in hepatocellular carcinoma-specific

amplitude-modulated radiofrequency electromagnetic fields

Experimental design was conceived and analyzed by Boris C. Pasche, Carl F. Blackman, and Hugo Jimenez. Data Generation / Collection was performed by

Hugo Jimenez and Minghui Wang

116

Introduction



decade.1,2 In the last decade, HCC drug development has seen 4 global phase 3

trials fail (sunitinib, brivanib, linifanib, and erlotinib plus sorafenib), i.e., none of

these agents showed non-inferiority or superiority to sorafenib in terms of overall

survival (OS) as first-line treatment of HCC.3 While sorafenib remains the sole

first-line treatment available for HCC in the U.S. as of March 2018. A recent

study of lenvatinib (LenvimaR), an inhibitor of VEGF receptors 1-3, FGF receptors

1-4, PDGF receptor alpha, RET, and KTT, has shown that this drug is not inferior

to sorafenib. An application was submitted to the FDA in September 2017 and is

currently being reviewed to approve lenvatinib as another first-line therapy for

advanced hepatocellular carcinoma. Additionally, lenvatinib has displayed

significant and meaningful improvement in progression-free survival, time to

progression and objective response rate over sorafenib.3 Yet, despite lenvatinib’s

promising future or the recent approval of additional second-line treatment

modalities (regorafenib and nivolumab), the outcome of patients with advanced

hepatocellular carcinoma remains poor and new therapeutic approaches are

sorely needed.3

While the use of cancer-specific AM RF EMF has shown clinical, in vitro

and in vivo (unpublished) activity, the mechanism of action with regards to

proliferative inhibition is essentially unknown. Therefore, in order to understand

what is occurring, we sought to identify if any cell death mechanisms, such as

117

apoptosis and autophagy, were responsible. The following are the preliminary

results of our investigation into apoptosis.

Results

Results of the Tunel assay, seen in Fig 1, a and b, found no difference

between Huh-7 cells exposed to SHAM, RCF or HCC groups [F (2, 57) = 1.036,

p = 0.3613]. Additionally, the Tunel assay results, seen in Fig 2, a and b, also

found no difference between Hep3B cells exposed to SHAM, RCF or HCC

groups [F (2, 57) = 0.2478, p = 0.7813].

Discussion / future direction

The results of the Tunel assay, in both Huh-7 and Hep3B, show that

apoptosis is not the mechanism responsible for the anti-cancer effect of AM RF

EMF4-6. To confirm these results, we will further investigate at least 2 apoptosis

targets via western blot analysis. Additionally, to compliment and further

understand these findings, we will investigate the potential role of autophagy in

the action of AM RF EMF.

Tumor shrinkage and stable disease has been previously identified in

patients responding to AM RF EMF5,6. Hence, there must be some mechanism

of removal of cancer cells and we must therefore continue to investigate this

novel action as understanding its capabilities can lead to exploiting its potential.

118

Materials and methods

DeadEnd Tunel assay: 20,000 Huh-7 or 30,000 Hep3B cells were

seeded onto 35 mm IBIDI dishes (IBIDI, Cat #: 81156). Cells were placed into

three treatment groups SHAM, RCF or HCC; 4 dishes/group. Cells were treated

for 3 hours daily for seven days in the IT’IS in vitro exposure device. Media was

changed every two days and at the end of seven days the PROMEGA DeadEnd7

Colorimetric Tunel system assay kit (Cat #: G7130) was used for analysis.

Images were taken using the EVOS FL Auto microscope (Life Technologies).

Statistics and graphs were generated with Graphpad Prism. Experiments have

been repeated at least three times.

AM RF EMF exposure in vitro: Treatment of patients with intrabuccally-

administered AM RF (27.12 MHz) EMF results in whole body mean SAR ranging

from 0.2 to 1 mW/kg, with peak spatial SAR over 1g ranging from 150 to 350

mW/kg. Cell lines were exposed to 27.12 MHz radiofrequency electromagnetic

fields, identically amplitude modulated, using exposure systems designed to

replicate in vivo exposure levels. Experiments were conducted at an SAR of 0.03

and 0.4 W/kg. Cells were exposed for three hours daily, seven days in a row.

Cells were exposed to tumor-specific modulation frequencies that were

previously identified in patients with a diagnosis HCC or modulation frequencies

never identified in patients with a diagnosis of cancer (RCF) or no treatment

(SHAM). Experiments were repeated at least twice.

119

References


J. Clin. 67, 7-30, doi:10.3322/caac.21387 (2017).



doi:10.3322/caac.21402 (2017).


patients with unresectable hepatocellular carcinoma: a randomised phase

3 non-inferiority trial. Lancet, doi:10.1016/S0140-6736(18)30207-1 (2018).


modulation frequencies. Br J Cancer 106, 307-313,

doi:https://dx.doi.org/10.5732%2Fcjc.013.10177 (2012).


very low levels of amplitude-modulated electromagnetic fields. Br J

Cancer 105, 640-648 (2011).



assessment of a novel therapeutic approach. Journal of experimental &

clinical cancer research : CR 28, 51, doi:10.1186/1756-9966-28-51 (2009).

7 Jackson, S., Ghali, L., Harwood, C. & Storey, A. Reduced apoptotic levels

in squamous but not basal cell carcinomas correlates with detection of

cutaneous human papillomavirus. Br J Cancer 87, 319-323,

doi:10.1038/sj.bjc.6600431 (2002).

https://dx.doi.org/10.5732%2Fcjc.013.10177

120

Figure, tables and legends

Figure 1. TUNEL ASSAY OF THE Huh-7 cell line. a. Positive staining cells of Tunel assay (N = 4/group). b. Representative images of Huh-7 cells exposed to SHAM, RCF or HCC-specific frequencies for three hours daily for seven days. No statistical difference was found. a.

b.

121

Figure 2. TUNEL ASSAY OF THE Hep3B cell line. a. Positive staining cells of Tunel assay (N = 4/group). b. Representative images of Hep3B cells exposed to SHAM, RCF or HCC-specific frequencies for three hours daily for seven days. No statistical difference was found. a.

b.

122

APPENDIX b: Ambient electromagnetic fields do not affect AM RF EMF

antiproliferative effects

Experimental design was conceived and analyzed by Hugo Jimenez and Carl F.

Blackman. Data Generation / Collection was performed by Hugo Jimenez

123

Introduction

The impact of ambient electromagnetic fields in the research environment

has been of interest and concern as a potential confounder for researchers in the

field of bioelectromagnetics. For example, low-frequency, time-varying electric

and magnetic fields were reported by Wilson et al. to depress secretion of

melatonin into the blood stream.1 Additionally, it has been shown and

independently confirmed, that melatonin treatment of MCF-7 cells can result in

growth inhibition in a 0.2uT field but lead to enhanced cell growth in a 1.2uT

field.2 In 1997, Harland and Liburdy reported the first experimental evidence that

environmental-level magnetic fields can modify drug interaction with human

breast cancer cells, i.e., 1.2uT; 60Hz magnetic field exposure blocked the growth

inhibitory effect of Tamoxifen in MCF-7 cells.3 Moreover, in 2005 Trillo et al.

reported that the peak “no growth” response function of neurite outgrowth of PC-

12 cells was altered when the cells were grown in the magnetic fields (MF) of a

standard cell-culture incubator (Forma #3158) as compared to peak “no growth’

response in the absence of MF, which was achieved by Mu metal shielding.4

Hence, the authors determined that the magnetic fields present in some

manufacturer’s incubators during normal operation can alter cell responses to

intentionally imposed magnetic fields and that a Mu-metal chamber can be

satisfactorily placed inside an incubator to shield the unwanted, incubator-

generated ambient EMFs.

To determine the potential impact of these “incubator ambient”

electromagnetic fields on HCC-specific AM RF EMF’s anti-cancer effect, we

minimized the exposure using a similar experimental design.3-5 We used a MU

124

METAL box, ventilated to minimize EMF leakage to the inside. The box was

housed inside a standard cell-culture incubator, to virtually remove all ambient

fields5. The sole item inserted into the box was the antenna emitting HCC-

specific AM RF EMF to expose the cells. The results would determine if

incubator-generated ambient electromagnetic fields, plays any role in the anti-

cancer effects of HCC-specific AM RF EMF exposure.

Results

Results of the tritiated thymidine incorporation assay demonstrated that

the antiproliferative effects of cancer-specific AM RF EMF were not altered by the

MU METAL chamber, i.e., a virtual absence of ambient EMF. Specficially, HCC-

specific AM RF EMF inhibited proliferation of Huh-7 when the cells were in the

Mu Metal box; SHAM vs HCC p = 0.0032 and Random Chosen Frequencies

(RCF) vs HCC p = 0.0272 as identified by Post-Hoc Tukey Test (Figure 1).

Proliferation of the RCF treated group did not show any difference when

compared to SHAM; Sham vs RCF p = 0.6854 as identified by Post-Hoc Tukey

Test. Anova: F(2, 29) = 7.286; p = 0.0027 (Figure 1).


This data shows that ambient EMFs do not influence the anti-proliferative

effect observed when cells are exposed to cancer-specific AM RF EMF.

Moreover, the HCC-specific AM RF EMF treated group was the only group to

experience proliferative inhibition which is the expected trend as previously

identified.6 These data taken together indicate that the anti-proliferative effect is

due to cancer-specific AM RF EMF treatment only and not related to the ambient

125

fields of the environment. Moreover, these data are vitally important for future

researchers who will attempt to replicate our results.


[3H ] thymidine incorporation assay: Growth inhibition (GI) was

assessed in Huh-7 cells exposed to HCC-specific modulation frequencies as

previously described6. Briefly, cells were treated with the frequencies for 7 days,

3 hours every day. At day 7, cells were washed, [3H] thymidine (Amersham) was

added, and cells were incubated for 4 hrs. After 4 hrs incubation, cells were

washed with ice-cold PBS for 5 minutes then lysed with 800uL of 0.2 N NaOH.

[3H] thymidine incorporation was measured using a Beckman Coulter scintillation

counter. Statistics and graphs were generated with Graphpad Prism.

Experiments have been repeated twice. The Mu Metal box was provided by Carl

F. Blackman, PhD.


radiofrequency electromagnetic fields at an SAR of 0.03 W/kg. Cells were

exposed for three hours daily, seven days in a row. Cells were exposed to tumor-

specific amplitude modulation frequencies that were previously identified in

patients with a diagnosis HCC or modulation frequencies never identified in

patients with a diagnosis of cancer. Experiments were repeated twice.

Mu Metal Box: Magnetic shield box with door, 16’H x 16”W x 16”D, made

from 0.050 Co-Netic AA alloy, using Full Butt seam weld, top and bottom each

have 4 holes with cylinders (1” dia x 1”long) welded to outside, and annealed

after fabrication. See image below for design schematics; built for Carl F.

Blackman, Ph.D. by Magnetic Shield Corporation, Bensenville, IL.

127

References

1 Wilson, B. W., Anderson, L. E., Hilton, D. I. & Phillips, R. D. Chronic

exposure to 60‐Hz electric fields: Effects on pineal function in the rat.

Bioelectromagnetics 2, 371-380, doi:10.1002/bem.2250020408 (1981).

2 Liburdy, R. P., Blackman, C. F. & Luben, R. A. in Electricity and

Magnetism in Biology and Medicine (ed Ferdinando Bersani) 59-62 (Springer

US, 1999).

3 Harland, J. D. & Liburdy, R. P. Environmental magnetic fields inhibit the

antiproliferative action of tamoxifen and melatonin in a human breast cancer cell

line. Bioelectromagnetics 18, 555-562 (1997).

4 Trillo, M. A., Ubeda, A., Benane, S. G., House, D. E. & Blackman, C. F. in

Bioelectromagnetics Society and the European BioElectromagnetic Association.

(National Health and Enviromental Effects Research Laboratory2005).

5 Ishido, M., Nitta, H. & Kabuto, M. Magnetic fields (MF) of 50 Hz at 1.2

microT as well as 100 microT cause uncoupling of inhibitory pathways of

adenylyl cyclase mediated by melatonin 1a receptor in MF-sensitive MCF-7 cells.

Carcinogenesis 22, 1043-1048 (2001).





128

Figures, tables, and legends

Figure 1. Representative figure of tritiated thymidine Incorporation assay of the Huh-7 cell line. CPM count of SHAM (N=10), RCF (N=10) and HCC (N=12). Anova: F (2, 29) = 7.286; p = 0.0027. SHAM vs RCF p = 0.6854, SHAM vs HCC p = 0.0032, RCF vs HCC p = 0.0272

129

APPENDIX c: MMTV.HER2 / NEU spontaneous mouse model of breast

cancer exposed to breast cancer-specific amplitude modulated

radiofrequency electromagnetic fields

Experimental design was conceived and analyzed by Boris C. Pasche, Carl F.

Blackman, Hugo Jimenez and Minghui Wang. Data Generation / Collection was performed by Hugo Jimenez and Minghui Wang

130

Introduction

In 2012, Zimmerman et al. showed that AM RF EMF exposure blocked the

proliferation of the MCF-7 [ER+, PR+, and ERBB2-] breast cancer cell line.1 To

build off these results we sought to identify a mouse model that could be

representative of the in vitro and clinical response to breast cancer-specific AM

RF EMF exposure.2 In our preliminary unpublished data we found that MMTV-

PYMT mice (Jackson labs) bearing spontaneous tumors did not respond to

breast cancer-specific AM RF EMF. More specifically, we did not observe any

significant difference in percent tumor mass, treatment time to euthanasia, or rate

of weight increase (data not shown) between mice exposed to breast cancer-

specific AM RF EMF and control mice, which were not exposed to AM RF EMF.

In continuing to identify a mouse model, we chose to use the MMTV.Her2/Neu

mouse model from Jackson labs.

In this current pilot study we found that two of seven MMTV.Her2/Neu mice

(Jackson Labs), exposed to breast cancer-specific AM RF EMF, had an objective

response of either partial response (PR) or stable disease (SD) as identified by

revised RECIST criteria3.

Results

16 mice female mice were allocated for the experiment. One mouse was

used as a no treatment control, 7 mice did not develop any tumor, 1 mouse was

found dead and 8 mice had palpable tumor(s) available for measurement. Seven

of the 8 mice with palpable tumor were exposed to Breast cancer-specific AM RF

EMF for 3 to 8 weeks (Figure 1). M07 was found to have approximately 70%

tumor shrinkage over the course of 5 weeks of AM RF EMF before being

131

sacrificed. M06 experienced stable disease for six weeks before experiencing

progressive disease (PD) (Figure 1). The control mouse, receiving no exposure,

and 5 of the mice in the treatment group displayed PD of either a near doubling

of tumor volume or greater in just 2 weeks (Figure 1).3


The positive results of this pilot study show that it is feasible to use the

spontaneous MMTV.HER2/NEU mouse as a model for experiments to study

breast cancer. Even with only two of seven mice showing an objective response

to breast cancer-specific AM RF EMF the preliminary data has shown success.

Next, we will continue by characterizing the response of this mouse model, i.e.,

the frequency of response to breast cancer-specific AM RF EMF, difference in

tumor mass, time to progression during treatment, etc. Additionally, the

MMTV.Her2/Neu model has a competent immune system that can provide us

with an understanding of how or if the immune system is modulated by breast

cancer-specific AM RF EMF. Lastly, we will be able to combine breast cancer-

specific AM RF EMF with current standard-of-care (SOC) treatment to identify if

an improved outcome vs SOC alone may be possible.

132


Animal experiments: tumor measurements were taken three times a

week using calipers to find length and width. FVB/N-Tg(MMTVneu)202Mul/J

mice were obtained from Jackson Labs, Cat No: 002376.

AM RF EMF exposure: All mice were exposed to 27.12 MHz amplitude-

modulated radiofrequency electromagnetic fields using exposure systems

designed to replicate the clinical exposure setting. Experiments were conducted

at an SAR of 0.4 W/kg. Mice were exposed for three hours daily for the duration

of the experiment once palpable tumors were present.

Revised RECIST Response Criteria (v1.1): Complete Response (CR):

Disappearance of all target lesions. Any pathological lymph nodes (whether

target or non-target) must have reduction in short axis to <10 mm. Partial

Response (PR): At least a 30% decrease in the sum of diameters of target

lesions, taking as reference the baseline sum diameters. Progressive Disease

(PD): At least a 20% increase in the sum of diameters of target lesions, taking as

reference the smallest sum on study (this includes the baseline sum if that is the

smallest on study). In addition to the relative increase of 20%, the sum must also

demonstrate an absolute increase of at least 5 mm. (Note: the appearance of

one or more new lesions is also considered progression). Stable Disease (SD):

Neither sufficient shrinkage to qualify for PR nor sufficient increase to qualify for

PD, taking as reference the smallest sum diameters while on study.3

133

References





treatment of cancer: discovery of tumor-specific frequencies and assessment of a

novel therapeutic approach. Journal of experimental & clinical cancer research :

CR 28, 51, doi:10.1186/1756-9966-28-51 (2009).

3 Eisenhauer, E. A. et al. New response evaluation criteria in solid tumours:

revised RECIST guideline (version 1.1). European Journal of Cancer 45, 228-247

(2009).


134


Figure 1. MMTV-HER2 spontaneous mouse model of breast cancer tumor growth curve.

135

APPENDIX d: Glioblastoma-specific amplitude modulated radiofrequency

electromagnetic fields

Experimental design was conceived and analyzed by Boris C. Pasche, Carl F. Blackman, and Hugo Jimenez. Data Generation / Collection performed by Hugo Jimenez, Sambad Sharma, and Denise Gibo. RNA-seq analysis was performed by Liang Liu & Kyle Matsuo. Imaging studies were interpreted by Annette Johnson M.D.

136

Introduction

Glioblastoma (GBM) remains one of the most difficult cancers to manage

and is the most common primary tumor of the brain. It is estimated that more

than 16,000 individuals died of brain tumors in the US in 2016.1 Only two new

treatment approaches have led to improved survival in the past decades: 1)

addition of temozolomide to radiotherapy for newly diagnosed GBM has

increased the median survival by 2.5 month2, 2) addition of alternating electric

fields (Tumor Treating Fields) delivered by the Optune® device has further

extended survival by 4.9 months, results in a five year survival rate of 13%

compared to 5% for the control arm3 and did not have any negative impact on

health-related quality of life.4

Barbault and Pasche have developed a novel treatment approach for

cancer based on delivery of low and safe levels of 27.12 MHz radiofrequency

(RF) electromagnetic fields (EMF), which are amplitude-modulated (AM) at

tumor-specific frequencies.5-7 Treatment is administered at home daily with a

portable device for three hours based on published dose response experiments.6

The TheraBionic® device is connected to a spoon-shaped antenna, which is

placed on the anterior part of the patient’s tongue and results in AM RF EMF

delivery to the whole body, from the head to the extremities as the body becomes

an extension of the antenna. While there are some similarities between the

TheraBionic® and the Optune® devices, e.g. both result in disruption of the mitotic

spindle,6,8 there are also notable differences: 1) TheraBionic® is a systemic

treatment as the whole body becomes an extension of the antenna; Optune® is a

localized treatment restricted to the body areas on which electrodes are placed,

137

2) TheraBionic® delivers 27.12 MHz radiofrequency electromagnetic fields, which

are amplitude-modulated at multiple tumor-specific frequencies ranging from 1

Hz to 100 kHz and results in electric fields of less than 35 V/m applied three

hours per day;6 Optune® delivers electric fields of 100-200 V/m modulated at a

single frequency ranging from 100-300 kHz applied 18 hours per day.6

Treatment with tumor-specific AM RF EMF as a monotherapy has been

shown to yield both complete and partial responses in patients with advanced

hepatocellular carcinoma treated with hepatocellular carcinoma-specific

modulation frequencies and in patient with stage IV breast cancer treated with

breast-cancer specific modulation frequencies. Objective tumor shrinkage has

been documented in the liver, bone, and adrenal gland thus demonstrating

systemic antitumor effects.5,9 No side effects other than grade 1 fatigue and

grade 1 mucositis have been reported in two clinical trials that included 69

patients, even after more than seven years of continuous daily treatment.5,9,10

This work aims to study the mechanism(s) underlying anti-tumor action in

vitro and, in vivo, with a GBM mouse model using systems that faithfully replicate

the levels of exposure delivered by the TheraBionic® device in patients.6,11

Treatment with AM RF EMF is emerging as a low risk novel approach for the

treatment of cancer. These results suggest the existence of a molecular

mechanism capable of mediating the antitumor effects of tumor-specific

frequencies, a major new concept in cancer medicine. These findings provide

support for the pioneering idea that systemic administration of AM RF EMF by

138

means of buccal delivery is a precision medicine approach based on tumor-

specific frequencies.

Results

The GBM cell line U-251, as well as two low passage GBM explant cells

(BTCOE-4536 and BTCOE-4795), which were developed by the Wake Forest

Brain Tumor Center of Excellence (BTCOE), were exposed to 27.12 MHz RF

EMF amplitude-modulated at GBM-specific frequencies using exposure systems

designed to replicate treatment at human exposure levels, i.e. at a Specific

Absorption Rate of 0.03 and 0.40 W/kg. Cells were exposed daily for 3 hours for

a total of 7 days for all experiments. As shown in Fig. 1, the proliferation of U-

251, BTCOE 4795 and BTCOE 4536 cell lines was decreased by 19% (N = 10; p

= 0.0018), 14.5% (N = 10; p = 0.0431) and 23% (N = 4; p = 0.0348) following

exposure to GBM-specific AM RF EMF.

To further investigate the decrease in proliferative inhibition, we assessed

the impact on stem-like cells and found that the tumor sphere-forming ability of

the U-251 and BTCOE-4795 cell lines was inhibited by 48.0% (N = 6; p = 0.0040)

and 31.7% (N = 6; p = 0.0002) following exposure to GBM-specific AM RF EMF

(Fig. 2). These results are indicative that the glioma stem-like cells may be even

more sensitive to AM RF EMF than more differentiated ones

To begin to comprehensively investigate the mechanism of action of GBM

specific AM RF EMF in GBM cells we performed RNA-seq of GBM U-251 cells.

RNA-seq data analysis identified the Mitotic Roles of Polo-Like Kinase pathway

as the prime target of GBM-specific AM RF EMF (Fig. 3). Polo-Like

139

kinases (PLKs) are regulatory serine/threonine kinases of the cell cycle involved

in mitotic entry, mitotic exit, spindle formation, cytokinesis, and meiosis.13

Five of the differentially-expressed genes of this canonical pathway were

validated by qRT-PCR: Abnormal Spindle Microtubule Assemble (ASPM), Polo-

Like Kinase 1 & 4 (PLK1 & PLK4), Centrosomal Protein 152 (CEP 152) and

Cyclin B1 (CCNB1) which had an increase in fold change of 1.69, 1.89, 1.61,

1.18 and 1.72 respectively, as identified by RNA-seq (Table 1). qRT-PCR

validation of the target genes confirmed highly significant RNA-seq differential

expression: ASPM, 429% increased expression (N = 18; p = 4.809x10-04), PLK1,

965% increased expression (N = 18; p = 2.932x10-06), PLK4, 997% increased

expression (N = 15; p = 2.343x10-17), CEP152, 276% increased expression (N =

18; p = 1.790x10-5) and Cyclin B1, 1916% increased expression (N = 18; p =

1.004x10-08) (Fig 4).

Given the previously observed disruption of the mitotic spindle in

hepatocellular carcinoma cells upon exposure to HCC specific AM RF EMF6 and

the impact of ASPM, PLK1 and PLK4 on mitotic spindle formation, we

hypothesized that GBM-specific AM RF EMF might disrupt the mitotic spindle of

GBM cells. Mitotic spindles were identified as either proceeding normally,

questionably or abnormally in U-251 cells and were assessed blindly by two

investigators. As shown in Fig. 5, GBM-specific AM RF EMF exposure resulted in

disruption of the mitotic spindle of U-251 cells. Thus, we demonstrate for the first

time the effect of AM RF EMF on the mitotic processes in GBM cells.

https://en.wikipedia.org/wiki/Kinase

https://en.wikipedia.org/wiki/Cell_cycle

140

Preliminary in vivo data shows there was a statistically significant

decrease in intensity for the EMF treated group (p = 0.04) at day 4. There was

no change in the SHAM group (p = 0.16). Both SHAM (N = 17) and EMF (N =

17) groups had identical levels of intensity at baseline (p = 0.84) but the EMF

group was significantly lower at day 4 (p = 0.03). (Fig 6.)

The family of a female patient residing in Italy with recurrent GBM

requested compassionate use of the TheraBionic® device. Briefly, the patient

was a 38-year-old woman who was diagnosed with gliosarcoma with

components of glioblastoma in April 2014. She underwent resection of the tumor

and received treatment with radiation therapy and temozolomide. She was

subsequently treated with nivolumab, then bevacizumab and fotemustine. She

was also on a ketogenic diet. As seen in Fig. 7, the patient had progression of

disease prior to initiation of treatment with GBM-specific AM RF EMF.

Treatment with the TheraBionic device programmed to administer GBM-specific

frequencies was initiated on July 4, 2016. At the follow up visit on August 5 the

patient’s spouse reported improvement in word recognition. He also reported that

the patient was able to dance at a party, a significant functional improvement.

However, she complained of persistent left upper and lower extremity weakness.

As shown on Fig. 8, the scan taken on the 8th of August, 2016 demonstrated a

decreased intensity and amount of enhancement as compared with the initial

scan taken the 20th of June, 2016.

The left temporal enhancing mass demonstrates a much less solid

enhancement pattern over a somewhat larger area and is difficult to measure.

141

The left parietal enhancing mass has increased in size but shows much more

heterogeneous pattern of more ill-defined enhancement. The findings are

suggestive of treatment effect rather than tumor progression. Treatment was

stopped after three months because of intracranial bleeding felt to be unrelated

to the AM RF EMF treatment. The patient expired the 22nd of November, 2016.


We have shown that AM RF EMF significantly suppress the growth of

three different GBM cell lines. We also found that AM RF EMF disrupts the

mitotic spindle of U-251 GBM cells and blocks the growth of GSCs. The net

result is a decrease in cell proliferation and potentially suppression of self-

renewal of GSC. Our preliminary data also shows that that treatment with GBM-

specific AM RF EMF may yield clinical response in patients with recurrent GBM.

Despite the promising data the exact mechanism underlying this growth

suppression is not fully understood. We currently postulate that AM RF EMF

block the growth of GBM cells by modulation of the Polo-Like kinase pathway as

several key genes of the pathway are differentially expressed following exposure

to GBM-specific AM RF EMF, specifically, CEP-152 and PLK-4. Moreover, the

modulation of the Polo-Like Kinase pathway is directly linked to disruption of the

mitotic spindle of GBM cells following AM RF EMF exposure.

To further examine this hypothesis, we examined the structural biology of

centrioles and their biogenesis. CEP-152 and PLK-4 are vitally important to the

genesis of centrioles where CEP-152 recruitment, leads to PLK-4 scaffold

switching and the repositioning of PLK-4, leading to the completion of the

daughter centriole in the G1 phase of mitosis. Based off our RNA-seq data

142

(Table 1) and the noted increase in mitotic spindle disruption (Fig 5.), the

overexpression of CEP152 and PLK-4, or potentially the suppression of the

degradation of PLK-4, can lead to an increase in the number of centrioles and

hence each mother centriole will be able to nucleate more than one daughter

centriole at a time leading to disruption of the mitotic mechanism (Figure 9).14,15

Moreover, published data has shown that modulation to PLK-4 expression can

cause distress in mitotic fidelity.16-19 While our data has shown that mitotic

spindle disruption is indeed occurring in the U-251 cell line, we have yet to show

this trend in the two BTCOE cell lines and that this is also the causative agent for

inhibition of GSC.

Our future directions include, mitotic spindle microscopy of BTCOE cell

lines, completion of the U251 mouse model, expanding our understanding of the

genomic signatures by examining the two BTCOE cell lines via RNA-seq and

other possible genomic strategies (microRNA-seq, copy number variation, etc…)

and identifying the potential role of Ca2+ in GBM-specific AM RF EMF as we have

previously identified the T-type voltage gated calcium channel as a necessary

mediator of HCC-specific AM RF EMF (unpublished data). Successful completion

of these future directions may provide novel actionable pathways and targets in

GBM.

143





3 hours every day. At day 7, cells were washed, [3H]thymidine (Amersham) was



[3H ] thymidine incorporation was measured using a Beckman Coulter

scintillation counter. Statistics and graphs were generated with Graphpad Prism.

AM RF EMF exposure in vitro: Treatment of patients with intrabuccally-

administered AM RF EMF results in whole body mean SAR ranging from 0.2 to 1

mW/kg, with peak spatial SAR over 1g ranging from 150 to 350 mW/kg. Cell lines

were exposed to 27.12 MHz radiofrequency electromagnetic fields using

exposure systems designed to replicate in vivo exposure levels. Experiments

were conducted at an SAR of 0.03 and 0.4 W/kg. Cells were exposed for three

hours daily, seven days in a row. Cells were exposed to tumor-specific

modulation frequencies that were previously identified in patients with a

diagnosis GBM or no treatment (SHAM).

Sphere-forming assay: Cells were plated (200 cells/well) in 96-well ultra-

low attachment plates (Corning) with DMEM/F12 supplemented with 2% B27

(Invitrogen), 20 ng/ml EGF (Sigma Aldrich), and 4 μg/ml insulin (Sigma-Aldrich).

The number of spheres was counted at day 7, and data were represented as the

means ± SEM.

144

Cell lines: U-251, BTCOE 4536, and BTCOE-4795 cell lines were

provided by the Debinski Laboratory and the Brain Tumor Center of Excellence.

Firefly Luciferase transfection: Bioluminescence Reporter (EF1a-

Luciferase (firefly)-2A-RFP (bsd)) luciferase tagging kit was from GenTarget Inc.

catalog number (LVP439). Blasticidin (25ug/mL-U251 cells) used as the antibiotic

selecting agent.

In Vivo: All mouse procedures were approved by Wake Forest

Institutional Animal Care and Use Committee. Intracranial injections: animals

were anesthetized with an i.p. injection of a mixture of ketamine (50-75 mg/kg

body weight), and xylazine (5-7.5 mg/kg). Hair on the mouse will be remove

using clippers followed by shaving with a razor. Mice were positioned into a Kopf

stereotactic frame. With the mouse secured in the frame we swabbed the

forehead (between eyes back to ears) with betadine via sterilized cotton swab,

and then used a scalpel to make a 5-6 mm caudal-rostral incision slightly to the

right of midline while stretching skin with thumb and forefinger while avoiding the

prefrontal sinus. We then used the wood end of cotton swab to scrape away

fascial tissues covering the skull, and dry the skull well with the cotton end to

help locate midline and coronal sutures. With the mouse secured and

anesthetized we drilled a 0.45mm Burr hole placed 1.5-2 mm to the right of the

midline suture and 1mm anterior to the coronal suture, and 5uL of cell

suspension was injected 2.5mm deep in the right cerebral hemisphere at a rate

of 1 uL/min. A sterile 25 gauge needle was attached to the syringe. One minute

after injection was completed and needle removed we applied a small amount of

145

bone wax to occlude the hole. After occlusion of the burr hole the tissue was

sutured together. Mice that failed to recover or that died within the first 24hrs

were deemed surgical/anesthesia failures and were necropsied to determine

whether inoculum placement was correctly performed. Animals that became

moribund were euthanized and necropsied.

Bioluminescence imaging: Caliper IVIS1100 Imaging system was used

for bioluminescent imaging (BLI) and tracking of intracranial tumors and cell

lines. This instrument is part of the Cell and Viral Vector Laboratory (CVVL)

shared resource at Wake Forest Baptist Medical Center.

Confocal laser scanning microscopy of mitotic spindles: Cells

undergoing mitosis were imaged using an Olympus FV1200 SPECTRAL Laser

scanning confocal microscope with an Olympus IX83 inverted platform (Olympus,

Tokyo, Japan). For imaging experiments, U251 cells were grown in sterile 35mm

optical glass bottom cell culture dishes (ibidi μ-Dish, Cat#81156, ibidi USA, Inc.,

Fitchburg, WI). U251 cells were initially plated at a concentration of 5,000 cells

per mL in 3mL of media. Once the cells were given 8-18 hours to attach to the

cover glass, they were exposed to RF EMF exposure 3 hours a day for 7

consecutive days. Following RF EMF exposure, indirect immunofluorescent

microscopy was used to compare the cells receiving GBM-specific modulation

frequencies with cells not receiving any exposure (Aurora A/AIK (1G4) Rabbit

mAb #4718, Cell Signaling Technology Inc., Danvers, MA; Goat anti-Rabbit IgG

(H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 594, A-11012,

146

ThermoFisher Scientific, Waltham, MA; SlowFade® Diamond Antifade Mountant

with DAPI, Catalog# S36964, ThermoFisher Scientific, Waltham, MA).

Gene expression analysis: RNA extraction from cells was performed

using RNeasy Mini Kit (QIAGEN). qRT-PCR was performed using a Roche

LightCycler II and 1-Step Brilliant II SYBR Green qRT-PCR master mix kit

(Agilent Technologies). Data for qRT-PCR were expressed as mean ± SEM, and

statistical differences between groups were calculated by a 2-tailed Student t-

test.

The Cancer Genomics Shared Resource: RNA-sequencing: Was

performed by the Cancer Genomics Shared Resource Core. RNA was purified

from cells using the miRNA mini kit from Qiagen. RNA integrity (RIN) was

determined by electrophoretic tracing using an Agilent Bioanalyzer. RNA-seq

libraries were constructed for samples (RIN >8.0) using the Illumina TruSeq

Stranded Total RNA kit with Ribo-Zero rRNA depletion. Indexed libraries were

sequenced using an Illumina NextSeq 500 DNA sequencer programmed for

150x150 nt paired end reads, generating >50 million reads per sample with

>75% of sequences achieving >Q30 Phred quality score. This sequencing depth

and quality are optimal for analysis of differentially expressed genes (DEGs) and

allele-specific gene expression, and read lengths are sufficient to detect splice

variations, gene fusions, and long noncoding RNAs (lncRNAs). RNA-seq Data

Analysis: Read alignment was performed using the STAR sequence aligner, and

gene counts determined using featureCounts software. Differential gene

expression will be analyzed using DESeq2 software. Six replicates per

147

experimental condition were performed, and all experimental conditions prepared

in the same experiment, to have sufficient power to detect DEGs at each time

point using DESeq2.25 Significant DEGs will be conservatively defined as p<0.05

after adjustment for false discovery. DEGs will be analyzed for significant

enrichment of biological pathways and signaling networks using Ingenuity

Pathway Analysis (IPA), Causal Network Analysis and Upstream Regulator

Tools, and DAVID software. The Cancer Genomics Shared Resource services

are supported by the Comprehensive Cancer Center of Wake Forest Baptist

Medical Center, NCI CCSG P30CA012197 grant.

PCR Primers and Machine protocol:

ASPM-Forward primer: 5’ GAG AGA GAG AAA GCT GCA AGA A 3’

ASPM-Reverse primer: 5’ GAA TGA CGA GTG CTG CAT TAA C 3’

CEP 152-Forward primer: 5’ CAG CAG CTC TTT GAG GCT TAT 3’

CEP 152-Reverse primer: 5’ CAC AGC AGT CAC CTC CTT ATT C 3’

CYCLIN B1-Forward primer: 5’ GAT GCA GAA GAT GGA GCT GAT 3’

CYCLIN B1-Reverse primer: 5’ TCC CGA CCC AGT AGG TAT TT 3’

PLK 1-Forward primer: 5’ CAG CAA GTG GGT GGA CTA TT 3’

PLK 1-Reverse primer: 5’ GTA GAG GAT GAG GCG TGT TG 3’

PLK 4-Forward primer: 5’ TCA AGC ACT CTC CAA TCA TCT T 3’

PLK 4-Reverse primer: 5’ CAA ACC ACT GTT GTA CGG TTT C 3’

GAPDH-Forward primer: 5’ TGC ACC ACC AAC TGC TTA GC 3’

GAPDH-Reverse primer: 5’ GGC ATG GAC TGT GGT CAT GAG 3’

148

Protocol: 1 cycle for 30 min at 50C, 1 cycle for 10 min at 95C, 40 x (30 sec

at 95C / 1 minute at 60C), Rest at 4C

GBM Patient information: 38 year-old woman with IDH1 and IDH2 wt,

EGFRvIII negative recurrent GBM s/p temozolomide, radiation therapy, ketogenic

diet, nivolumab, bevacizumab, and fotemustine. The patient had progression of

disease prior to initiation of treatment with GBM-specific AM RF EMF. Baseline

imaging occurred March 2016 and progression of disease was noted June 2016.

Patient began compassionate treatment July 4th, 2016.

149

References


J. Clin. 66, 7-30, doi:10.3322/caac.21332 (2016).

2 Stupp, R. et al. Radiotherapy plus Concomitant and Adjuvant

Temozolomide for Glioblastoma. The New England Journal of Medicine 352,

987-996 (2005).

3 Stupp, R., Taillibert, S., Kanner, A. A. & et al. Maintenance therapy with

tumor-treating fields plus temozolomide vs temozolomide alone for glioblastoma:

A randomized clinical trial. JAMA 314, 2535-2543, doi:10.1001/jama.2015.16669

(2015).

4 Gourd, E. Tumour-treating fields complement glioblastoma treatment. The

Lancet Oncology, doi:10.1016/S1470-2045(18)30088-3.




CR 28, 51, doi:10.1186/1756-9966-28-51 (2009).




7 Pasche, B. et al. in Bioelectromagnetic and Subtle Energy Medicine (ed

P.J. Rosch) Ch. 27, 299-305 (CRC Press, 2015).

8 Kirson, E. D. et al. Disruption of Cancer Cell Replication by Alternating

Electric Fields. Cancer Research 64, 3288-3295 (2004).


150


very low levels of amplitude-modulated electromagnetic fields. Br J Cancer 105,

640-648 (2011).

10 Zimmerman, J. W. et al. Targeted treatment of cancer with radiofrequency

electromagnetic fields amplitude-modulated at tumor-specific frequencies.

Chinese journal of cancer 32, 573-581,


11 Capstick, M., Gong, Y., Pasche, B. & Kuster, N. An HF exposure system

for mice with improved efficiency. Bioelectromagnetics 37, 223-233,

doi:10.1002/bem.21969 (2016).

12 IEEE. IEEE Standards for Safety Levels with Respect to Human Exposure

to Radio Frequency Electromagnetic Fields, 3 kHz to 300 GHz, IEEE C95.1-

2005. (Institute of Electrical and Electronics Engineers, New York, 2006).

13 Barr, F. A., Sillje, H. H. W. & Nigg, E. A. Polo-like kinases and the

orchestration of cell division. Nat Rev Mol Cell Biol 5, 429-441 (2004).

14 Park, S.-Y. et al. Molecular basis for unidirectional scaffold switching of

human Plk4 in centriole biogenesis. Nature Structural &Amp; Molecular Biology

21, 696, doi:10.1038/nsmb.2846

https://www.nature.com/articles/nsmb.2846#supplementary-information (2014).

15 Bettencourt-Dias, M., Hildebrandt, F., Pellman, D., Woods, G. & Godinho,

S. A. Centrosomes and cilia in human disease. Trends in Genetics 27, 307-315,

doi:https://doi.org/10.1016/j.tig.2011.05.004 (2011).


https://www.nature.com/articles/nsmb.2846#supplementary-information

https://doi.org/10.1016/j.tig.2011.05.004

151

16 Swallow, C. J., Ko, M. A., Siddiqui, N. U., Hudson, J. W. & Dennis, J. W.

Sak/Plk4 and mitotic fidelity. Oncogene 24, 306, doi:10.1038/sj.onc.1208275

(2005).

17 Kleylein-Sohn, J. et al. Plk4-Induced Centriole Biogenesis in Human Cells.

Developmental cell 13, 190-202, doi:https://doi.org/10.1016/j.devcel.2007.07.002

(2007).

18 Habedanck, R., Stierhof, Y.-D., Wilkinson, C. J. & Nigg, E. A. The Polo

kinase Plk4 functions in centriole duplication. Nature Cell Biology 7, 1140,

doi:10.1038/ncb1320 https://www.nature.com/articles/ncb1320#supplementary-

information (2005).

19 Ko, M. A. et al. PLK4 haploinsufficiency causes mitotic infidelity and

carcinogensis. Nature Genetics 37 883-888, doi:10.1038/ng1605 (2005).

https://doi.org/10.1016/j.devcel.2007.07.002

https://www.nature.com/articles/ncb1320#supplementary-information

https://www.nature.com/articles/ncb1320#supplementary-information

152


Figure 1 a-c. Tritiated Thymidine incorporation proliferation assay in three GBM cell lines and explants exposed to GBM-specific AM RF EMF for three hours daily for seven days.

153

Figure 2a & b. Neurosphere formation assay in a GBM cell line and a GBM explant exposed to GBM-specific AM RF EMF for three hours daily for seven days.

154

Figure 3. The Mitotic Roles of Polo-Like Kinase Pathway. The Polo-Like Kinases are essential cell-cycle regulators as they are heavily involved in centriole biogenesis and therefore important in multiple phases of cell division.

155

Figure 4. qRT-PCR validation of five differentially-expressed genes from the canonical pathway Mitotic Roles of Polo-Like Kinase. Abnormal Spindle Microtubule Assemble (ASPM), Polo-Like Kinase 1 & 4 (PLK1 & PLK4), Centrosomal Protein 152 (CEP 152) and Cyclin B1 (CCNB1) which had an increase in fold change of 1.69, 1.89, 1.61, 1.18 and 1.72 respectively. qRT-PCR validation of the target genes confirmed highly significant RNA-seq differential expression: ASPM, 429% increased expression (N = 18; T-test p = 4.809x10-04), PLK1, 965% increased expression (N = 18; T-test p = 2.932x10-06), PLK4, 997% increased expression (N = 15; T-test p = 2.343x10-17), CEP152, 276% increased expression (N = 18; T-test p = 1.790x10-5) and Cyclin B1, 1916% increased expression (N = 18; T-test p = 1.004x10-08).

156

Figure 5 a - c. AM RF EMF disrupt the mitotic spindle of GBM cells. U-251 cells were exposed to 27.12 MHz RF EMF amplitude-modulated at GBM specific frequencies three hours daily for seven days. a. Mitotic spindle visualization and quantification by two blinded, independent investigators revealed that AM RF EMF treated cells exhibit higher number of mitotic spindle disruption events than control cells. b. There were significantly more Questionable+Abnormal events among AM RF EMF treated cells (71.43%) than among untreated cells (12.82%), T-test p = 0.0013. c. Analysis restricted to Abnormal versus Normal events showed that AM RF EMF treated cells exhibit a higher frequency of Abnormal events (19.05%) than untreated cells (2.56%), T-test p = 0.0478.

157

Figure 6. GBM-specific AM RF EMF inhibit U-251 GBM cells in vivo. U-251-LUC GBM cells were intracranially implanted in NOD SCID mice and imaged for luciferase intensity seven days post-implantation. Treatment with GBM-specific AM RF EMF or SHAM was initiated the following day. Tumor growth was monitored by bioluminescence imaging (N = 17 / group). Panel shows representative bioluminescence intensity for both groups. There was a statistically significant decrease in intensity for the EMF treated group (T-test p = 0.04) at day 4. There was no change in the SHAM group (T-test p = 0.16). Both SHAM and EMF groups had identical levels of intensity at baseline (T-test p = 0.84) but the EMF group was significantly lower at day 4 (T-test p = 0.03).

158

Figure 7. 38 year-old woman with IDH1 and IDH2 wt, EGFRvIII negative recurrent GBM s/p temozolomide, radiation therapy, ketogenic diet, nivolumab, bevacizumab, and fotemustine. The patient had progression of disease prior to initiation of treatment with GBM-specific AM RF EMF. Baseline imaging occurred March 2016 and progression of disease was noted June 2016. Patient began compassionate treatment July 4th, 2016.

159

Figure 8. 38 year-old woman with IDH1 and IDH2 wt, EGFRvIII negative recurrent GBM: The patient received compassionate treatment with TheraBionic device and had follow up imaging August, 18th 2016. The patient showed a decreased intensity and amount of enhancement. The left temporal enhancing mass demonstrates a much less solid enhancement pattern over a somewhat larger area and is difficult to measure. The left parietal enhancing mass has increased in size but shows much more heterogeneous pattern of more ill-defined enhancement. The findings are suggestive of treatment effect rather than tumor progression. Treatment was stopped after three months because of intracranial bleeding felt to be unrelated to the AM RF EMF treatment. The patient expired on 11/22/16.

160

Figure 9. Schematic diagrams illustrating Centriole Biogenesis14,15. a. PLK-4 triggers centriole biogenesis when it is recruited to the centrosome by CEP152. b. Mechanism by which CEP152 recruits PLK-4 from Cep192-PLK4 complex and repositions PLK-4 at the outer boundary of a newly forming CEP152 ring structure.

161

Table 1. Differentially expressed genes identified by RNA-seq analysis of U-251 cells exposed to GBM-specific AM RF EMF for three hours daily for seven days. Abnormal Spindle Microtubule Assemble (ASPM), Polo-Like Kinase 1 & 4 (PLK1 & PLK4), Centrosomal Protein 152 (CEP 152) and Cyclin B1 (CCNB1) had increases in fold-change of 1.69, 1.89, 1.61, 1.18 and 1.72, respectively.

162

APPENDIX e: Testing the specific response of individual cell lines, from

multiple cancer models, to tumor-specific amplitude modulated

radiofrequency electromagnetic fields

Experimental design was conceived and analyzed by Boris C. Pasche and Hugo

Jimenez. Data Generation / Collection was performed by Hugo Jimenez and Minghui Wang

163

Introduction

We have previously demonstrated proliferative inhibition in malignant

cancer cell lines, from two different cancer models (HCC and Breast cancer)

treated with their respective cancer-specific AM RF EMF sets1. In order to

expand our understanding of the cancer-specific AM RF EMF phenomena we

sought to determine what cell lines, obtained from various cancer models, would

be optimal for experimental testing. We examined a number of cell lines from

various cancer types exposed to their respective cancer-specific AM RF EMF.

Results

Cell lines from the Hepatocellular carcinoma model, SNU-387, SNU-423

and SNU-475 failed to demonstrate proliferative inhibition to HCC-specific AM RF

EMF (T-test; p > 0.05) (figures 1, 2 and 3). Pancreatic cancer cell line BXPC3

failed to demonstrate proliferative inhibition (T-test; p > 0.05) BxPC3 (figure 4) to

Pancreatic-specific AM RF EMF while the PANC-1 cell line did show 11.3%

growth inhibition (T-test; p = 0.01) (figure 5). Prostate cancer cell lines LNCAP

and PC-3 both failed to demonstrate proliferative inhibition to Prostate-specific

AM RF EMF (T-test; p > 0.05) (figure 6 and 7).


This study is ongoing as a number of cell lines still require repeat testing

to confirm results, and new cells lines are added to the list of potential

candidates.

164









counter. Statistics and graphs were generated with Graphpad Prism or Microsoft

Excel.

Cell lines: HCC cell lines SNU-387 (CRL-2237), SNU-423 (CRL-2238)

and SNU-475 (CRL-2236) were purchased from ATCC. Pancreatic cell lines and

PANC-1 were gifts provided by the Buchsbaum lab from the University of

Alabama-Birmingham. Prostate cell lines PC-3 and LNCAP were gifts provided

by the Yang lab from the University of Alabama-Birmingham.


radiofrequency electromagnetic fields at an SAR of 30 and 400 mW/kg. Cells

were exposed for three hours daily, seven days in a row. Cells were exposed to

tumor-specific modulation frequencies that were previously identified in patients

with a diagnosis of HCC, a diagnosis of pancreatic cancer, a diagnosis of

prostate cancer, and to modulation frequencies never identified in patients with a

diagnosis of cancer (RCF) or no treatment (SHAM).

165

References




166


Figure 1. HCC Cell line SNU-387. N=6 per group. Experiment performed only once. T-test p = 0.3882

167

Figure 2. HCC Cell line SNU-423. N=6 per group. Experiment performed only once. T-test p = 0.5182

168

Figure 3. HCC Cell line SNU-475. N = 6 per group. Experiment performed only once. T-test p = 0.2475

169

Figure 4. Pancreatic Cell line BxPC3. N=12 per group. Experiment performed only once. [F(2,33) = 20.02, p < 0.0001]; SHAM vs. RCF p = 0.0016, SHAM vs. PANC p < 0.0001, RCF vs. PANC p = 0.0470

170

Figure 5. Pancreatic cell line PANC-1 seeded at 5000 cells/well (N = 12). 11.30% inhibition; T-test p value 0.01. Control group is RCF.

171

Figure 6. Prostate cell line LNCAP. N = 6/group; 5000 cells/well. [F (2,15) = 0.2829, p = 0.9722]; SHAM vs. RCF p = 0.9972, SHAM vs. PROSTATE p = 0.9858, RCF vs. PROSTATE p = 0.9708, Experiment was repeated twice.

172

Figure 7. Prostate cell line PC-3. N = 12, 5000 cells/well. [F (2, 330 = 2.125, p = 0.1355]; SHAM vs. RCF p = 0.2927, SHAM vs. PROSTATE p = 0.8994, RCF vs. PROSTATE p = 0.1372. Experiment was repeated three times.

173

APPENDIX f: The combined use of anti-mitochondrial metabolism agent,

lipoate derivative CPI-613, and hepatocellular carcinoma-specific

amplitude-modulated radiofrequency electromagnetic fields on Huh-7 cells

Experimental design was conceived and analyzed by Boris C. Pasche, Tim Pardee and Hugo Jimenez. Data Generation / Collection was performed by


174

Introduction

PDH is a key mitochondrial enzyme acting as the entry point for pyruvate

into the tricarboxylic acid (TCA) cycle, generating cellular energy and

biosynthetic precursors. PDH and its regulatory kinase, PDK, have significantly

altered activity in cancer cells.1 In cancer cells energy is generated by shunting

pyruvate away from PDH and the TCA cycle and driving it to LDH and anaerobic

glycolysis (the Warburg effect). Yet, cancer cells still require TCA intermediaries

(PDH) for biosynthesis of lipids, nucleic acids, etc. Hence, the activity of

mitochondrial PDH is a necessary mediator of malignant cell function and since

lipoate is a necessary catalytic cofactor for PDH, and other mitochondrial

enzymes, CPI-613 is a prime candidate to disrupt malignant cell activity.1,2

The anti-mitochondrial metabolism agent, CPI-613, activates lipoate-

sensitive pyruvate dehydrogenase (PDH) kinase (PDK) which phosphorylates

three specific phosphoserines on lactate dehydrogenase (LDH).1 In turn, the

phosphorylation inhibits LDH, suppressing mitochondrial ATP production and

leading to cell death.1,3

CPI-613 exhibits anti-cancer activity across multiple cancer types since

mitochondrial function is necessary for multiple tumor types.1 Moreover, our

unpublished data indicate that HCC-specific AM RF EMF’s anti-cancer activity

occurs by modulating Ca2+ influx via the T-type VGCC (Cav 3.2 isoform)

channels. Hence, we hypothesize that the sustained (3 hours) EMF treatment

with HCC-specific AM RF EMF could affect the metabolic rate of cancer cells and

in turn have an additive or synergic interaction with CPI-613.

175

Results

We determined the optimal concentration of CPI-613 by performing an

IC50 experiment at two different time points (48 and 72hours) (Figure 1a).

Results show 100uM dosage of CPI-613, for 48 hours, would be the optimal

concentration to combine with HCC-specific AM RF EMF as that concentration

caused minimal inhibitive of proliferation, and would therefore provide time for

HCC-specific AM RF EMF to complete its 7-day treatment cycle (Figure 1b & c).

The resulting data (Figure 2a & b) did not show any indication that the addition

of CPI-613 to HCC-specific AM RF EMF, in this treatment design, had any

significant additional antiproliferative effect when combined with HCC-specific

AM RF EMF.




decade.4,5 Despite the recent approval of additional second-line treatment

modalities (regorafenib and nivolumab) the outcome of patients with advanced

hepatocellular carcinoma remains poor and new therapeutic approaches are

sorely needed.6 Hence, it would be of significant value to continue to investigate

other treatment combinations such as CPI-613 + HCC-specific AM RF EMF in

tandem for the entirety of the 7-day treatment session. This experiment is still

ongoing. However, clinical evidence suggests that CPI-613 is most efficacious

when combined with chemotherapy agents that bind albumin.7,8 CPI 613 single

agent activity is modest and current evidence suggests that AM RF EMF have

little in common with chemotherapy with respect to mechanism of action.

176




previously described.9 Briefly, cells were treated with the frequencies for 7 days,

3 hours every day. At day 7, cells were washed, [3H]thymidine (Amersham) was



[3H ] thymidine incorporation was measured using the Beckman Coulter

scintillation counter. Statistics and graphs were generated with Graphpad Prism.


radiofrequency electromagnetic fields using exposure systems designed to

replicate clinical exposure levels. Experiments were conducted at an SAR of 30

and 400 mW/kg. Cells were exposed for three hours daily, seven days in a row.

Cells were exposed to tumor-specific modulation frequencies that were

previously identified in patients with a diagnosis HCC or no treatment (SHAM).

Experiments are ongoing.

CPI-613: This agent is a lipoate analog, first-in-class agent that targets

mitochondrial metabolism. We cultured Huh-7 cells with CPI-613 (100uM) for 48

consecutive hours (i.e. first 48 hours of the 7-day treatment cycle had CPI-613

and EMF exposure occurring in tandem). The remaining 5 days, without the CPI-

613 incubation, would continue with HCC-specific AM RF EMF treatment only.

Huh-7 cells were treated at 20,000/well.

177

References

1 Lycan, T. W. et al. A Phase II Clinical Trial of CPI-613 in Patients with

Relapsed or Refractory Small Cell Lung Carcinoma. PloS one 11, e0164244,

doi:10.1371/journal.pone.0164244 (2016).

2 DeBerardinis, R. J., Lum, J. J., Hatzivassiliou, G. & Thompson, C. B. The

biology of cancer: metabolic reprogramming fuels cell growth and proliferation.

Cell metabolism 7, 11-20, doi:10.1016/j.cmet.2007.10.002 (2008).

3 Zachar, Z. et al. Non-redox-active lipoate derivates disrupt cancer cell

mitochondrial metabolism and are potent anticancer agents in vivo. J Mol Med

(Berl) 89, 1137-1148, doi:10.1007/s00109-011-0785-8 (2011).


J. Clin. 67, 7-30, doi:10.3322/caac.21387 (2017).



doi:10.3322/caac.21402 (2017).


patients with unresectable hepatocellular carcinoma: a randomised phase 3 non-

inferiority trial. Lancet, doi:10.1016/S0140-6736(18)30207-1 (2018).

7 Alistar, A. et al. Safety and tolerability of the first-in-class agent CPI-613 in

combination with modified FOLFIRINOX in patients with metastatic pancreatic

cancer: a single-centre, open-label, dose-escalation, phase 1 trial. The lancet

oncology, doi:10.1016/S1470-2045(17)30314-5.

8 Pardee, T. S. et al. A Phase I Study of the First-in-Class Antimitochondrial

Metabolism Agent, CPI-613, in Patients with Advanced Hematologic

178

Malignancies. Clin. Cancer Res. 20, 5255-5264, doi:10.1158/1078-0432.ccr-14-

1019 (2014).


modulation frequencies. British journal of cancer 106, 307-313 (2012).

179


Figure 1. IC50 experiments with Huh-7 cells. a. Proliferative inhibition of Huh-7 cells treated for 48 or 72 hours at multiple concentrations of CPI-613. b. 48 hour comparison of no treatment (N = 4) vs CPI-613 (100uM) (N = 6); T-test p-value < 0.0001. c. 72 hour comparison of no treatment (N = 6) vs CPI-613 (100uM) (N = 4); T-test p-value = 0.1336. a.

0 1 0 0 2 0 0 3 0 0 4 0 0 5 0 0 6 0 0

0

5 0 0 0 0

1 0 0 0 0 0

1 5 0 0 0 0

2 0 0 0 0 0

C P I-6 1 3 (u M )

3H

Th

ym

idin

e I

nc

orp

ora

tio

n (

CP

M)

4 8 h rs

7 2 h rs

b. c.

0100

0

2 0 0 0 0

4 0 0 0 0

6 0 0 0 0

8 0 0 0 0

1 0 0 0 0 0

C P I-6 1 3 (u M )

3H

Th

ym

idin

e I

nc

orp

ora

tio

n (

CP

M)

*

0100

0

5 0 0 0 0

1 0 0 0 0 0

1 5 0 0 0 0

2 0 0 0 0 0

C P I-6 1 3 (u M )

3H

Th

ym

idin

e I

nc

orp

ora

tio

n (

CP

M)

N S

180

Figure 2. 48 hours CPI-613 + HCC-specific AM RF EMF experiment Huh-7 cells. a. CPI-613+EMF compared to vehicle control; [F (3, 18) = 20.17, p < 0.0001. b. Repeat experiment of CPI-613+EMF compared to vehicle control; [F (3, 17) = 2.791, p < 0.0720. a.

SH

AM

+D

MS

O

EM

F+D

MS

O

SH

AM

+C

PI-

613

EM

F+ C

PI-

613

0

5 0 0 0 0 0

1 0 0 0 0 0 03

H T

hy

mid

ine

In

co

rp

ora

tio

n (

CP

M)

b.

SH

AM

+D

MS

O

EM

F+D

MS

O

SH

AM

+C

PI-

613

EM

F+ C

PI-

613

0

5 0 0 0 0 0

1 0 0 0 0 0 0

3H

Th

ym

idin

e I

nc

orp

ora

tio

n (

CP

M)

181

APPENDIX g: Determination of frequency bandwidths for effective

Hepatocellular Carcinoma specific-amplitude-modulated radiofrequency

electromagnetic fields treatment.

Experimental design was conceived and analyzed by Boris C. Pasche, Carl F Blackman and Hugo Jimenez. Data Generation / Collection was performed by


182

Introduction

The concept of an interaction of a weak EMF with a living organism has

existed in the Bioelectromagnetics field for decades. One of the earliest

examples by Hamer in 1968 showed that low level, low frequency electric fields

could affect human reaction time1. Additionally, Bawin et al. in 1978 studying

radiofrequency (RF) effects on chick brains and later expanded upon by

Blackman et al., discovered that calcium transport is profoundly affected only

when RF is amplitude-modulated (AM) at specific extremely low frequencies

(ELF).2-8 Liboff proposed a detailed Cyclotron Resonance model that could

explain the results reported by Blackman9. Briefly, the Cyclotron Resonance

model proposed that certain ionic species and even some enzymes will follow a

circular or well-defined helical pathway under the influence of a “Resonant

Frequency” determined by a static magnetic field(s) (Figure 1).9

Cancer-specific AM frequencies were identified in patients that had a

diagnosis of cancer and exhibited biofeedback upon exposure to specific AM

frequency.10,11 The biofeedback responses were identified at very discrete AM

frequencies with some of those frequencies showing resolution down to the

1/1000th of a hertz.11 With the discovery that such narrow-band AM frequencies

can produce the biofeedback response in human subjects, we performed tests to

determine the bandwidth of the effective frequencies in laboratory tests using two

human cancer cell lines.

183

Results

Using the Huh-7 and Hep3B cell lines we exposed cells to HCC-specific

frequencies that were altered by adding 1.0, 0.1, 0.01, or 0.001 Hz to each

frequency in the base AM frequency set. As seen in Table 1 and 2, the data is

not yet complete and no discernable trend can be interpreted as of March 2018.


With the discovery of extremely precise cancer-specific AM RF EMF

reactions in patients, it is probably that the EMF is resonating very precise

“structure(s)” in the cell that elicit the cancer-related response(s). Such

“structure(s)” may very well be “antenna-like” receptors capable of

demodulating/interpreting the cancer-specific AM RF EMFs. To further explore

this concept, we will use frequency sets that are slightly offset from the effective

target frequencies to establish the frequency precision necessary to cause the

cancer cell response limits, i.e., the “efficacy windows”. This information can

have significant bearing on developing further clinical understanding of the

underlying bases for effective results.

We have yet to complete experiments needed to identify AM frequency

bandwidths; experiments are still ongoing. After completion of the initial,

“additive frequencies,” to the base frequency set, we plan to “reduce frequencies”

from the base set by the same amounts, for a series of increments (1.0Hz, 0.1

Hz, 0.01 Hz, 0.001Hz) in order to identify the “shape” and “robustness” of the

frequency set on both sides of the discrete frequency set, which was initially

determined from the responses of patients with particular cancers.

184









counter. Statistics and graphs were generated with Graphpad Prism and

Microsoft Excel.

HCC-specific AM RF EMF frequency set: Cell lines were exposed to

27.12 MHz radiofrequency electromagnetic fields at an SAR of 0.03 W/kg. We

then created 4 frequency shift sets by adding 1Hz, 0.1Hz, 0.01Hz, and 0.001Hz

to the base HCC-specific modulation frequency set.

AM RF EMF exposure in vitro: Cell lines were exposed to AM-

modulated 27.12 MHz radiofrequency electromagnetic fields at an SAR of 0.03

W/kg. Cells were exposed for three hours daily, seven days in a row.

Experiments are ongoing.

185

References

1 Hamer, J. R. Effects of Low Level, Low Frequency Electric Fields on

Human Reaction Time. Communications in Behavioral Biology 2, 217-222

(1968).

2 Bawin, S. M., Adey, W. R. & Sabbot, I. M. Ionic factors in release of

45Ca2+ from chicken cerebral tissue by electromagnetic fields. Proceedings of

the National Academy of Sciences of the United States of America 75, 6314-

6318 (1978).

3 Blackman, C. F. et al. Induction of calcium-ion efflux from brain tissue by

radiofrequency radiation: effect of sample number and modulation frequency on

the power-density window. Bioelectromagnetics 1, 35-43 (1980).

4 Joines, W. T. & Blackman, C. F. Power density, field intensity, and carrier

frequency determinants of RF-energy-induced calcium-ion efflux from brain

tissue. Bioelectromagnetics 1, 271-275 (1980).

5 Joines, W. T., Blackman, C. F. & Hollis, M. A. Broadening of the RF

power-density window for calcium-ion efflux from brain tissue. IEEE transactions

on bio-medical engineering 28, 568-573, doi:10.1109/tbme.1981.324829 (1981).

6 Blackman, C. F., Benane, S. G., Kinney, L. S., Joines, W. T. & House, D.

E. Effects of ELF fields on calcium-ion efflux from brain tissue in vitro. Radiat Res

92, 510-520 (1982).

7 Blackman, C. F., Benane, S. G., House, D. E. & Joines, W. T. Effects of

ELF (1-120 Hz) and modulated (50 Hz) RF fields on the efflux of calcium ions

from brain tissue in vitro. Bioelectromagnetics 6, 1-11 (1985).

186

8 Blackman, C. F., Benane, S. G., Rabinowitz, J. R., House, D. E. & Joines,

W. T. A role for the magnetic field in the radiation-induced efflux of calcium ions

from brain tissue in vitro. Bioelectromagnetics 6, 327-337 (1985).

9 Liboff, A. R. Geomagnetic cyclotron resonance in living cells. Journal of

Biological Physics 13, 99-102, doi:10.1007/bf01878387 (1985).



640-648 (2011).




CR 28, 51, doi:10.1186/1756-9966-28-51 (2009).





187


Figure 1. Liboff cyclotron resonance diagram9

188

Table 1. Huh-7 +Hz shift

Huh-7 Internal Control 1Hz 0.1Hz 0.01Hz

1/1/2017 GOOD ↓ NS

2/8/2017 GOOD

↑

3/2/2017 GOOD

↓ ↓

3/24/2017 GOOD

↓ ↓

10/25/2017 GOOD

NS NS

11/24/2017 GOOD

NS NS

189

Table 2. Hep3B +Hz shift

Hep3B Internal Control 0.1Hz 0.01Hz

11/1/2017 GOOD NS ↓

11/14/2017 GOOD NS NS

190

APPENDIX h: Inducible mouse model of hepatocellular carcinoma and

species specificity of hepatocellular carcinoma-specific amplitude-

modulated radiofrequency electromagnetic fields

Experimental design was conceived and analyzed by Boris C. Pasche, Carl F Blackman and Hugo Jimenez. Data Generation / Collection was performed by

Hugo Jimenez and Minghui Wang. Mouse model was provided by our collaborator Anja Runge PhD

191

Introduction

Anja Runge, PhD of the German Cancer Research Center recognized the

need for tumor models that faithfully mimic the progression of human

Hepatocellular carcinoma tumors and their response to therapy1. To address the

issue of limited HCC mouse models, Runge et al. developed and validated an

inducible model of hepatocarcinogenesis in adult mice.1 This model replicated

the clinical vascular growth of HCC and responded well to first line treatment,

Sorafenib, thus it was a viable model to test our HCC-specific AM RF EMF

treatment. Hence, we contacted Dr. Runge and obtained the mouse model for a

pilot study.

Results

Using the iAST inducible mouse model, we established tumors following

the published inducible procedure1 and treated with mice with HCC-specific AM

RF EMF and found no therapeutic response after 5 weeks of continuous

treatment (Figure 1).


The negative results of the mouse model has raised questions about the

ability of the human derived HCC-specific AM RF EMF to target tumors of mouse

origin2. Hence, it may be possible that tumors that are entirely of mouse origin

may not be able to “respond” to human HCC-specific AM RF EMF. To prevent a

misuse of time and materials, we will no longer investigate cell cancer models of

mouse origin. The cancer-specific frequencies were identified through

examination of patients with a diagnosis of cancer. Based on these results and

other unpublished results using a mouse model of breast cancer, it appears that

192

our current objectives would be better utilized focusing on cell models that would

more accurately represent the human condition, rather than pursuing the issue of

cross-species reactivity2-4. We also hypothesize that tumor-specific frequencies

may well be species specific.

193


Magnetic Resonance Imaging (7T MRI): Mouse imaging was

accomplished at Wake Forest Baptist Medical Center’s Translational Imaging

Program. Briefly, mice were induced and maintained in a twilight state via

Isoflurane inhalation (1-3%), at which point mice were imaged.

Inducible model of Hepatocellular Carcinoma: Transgenic mice

expressing the hepatocyte-specific albumin promoter, a loxP-flanked stop

cassette, and the SV40 large T-antigen (iAST)1 were used in this study. Initially,

iAST mice were tail vein injected with a 100uL bolus containing 1x109 PFU of

iCre adenovirus (Vector Biolabs). Nine weeks after induction mice had fully

formed Hepatocellular Carcinoma1. Post 9-weeks we performed Magnetic

Resonance (MR) imaging to verify presence of tumors. Once tumors were

verified we began treatment with human-derived, tumor-specific frequencies and

followed up with MR imaging two weeks later. iAST mice were a gift from our

collaborators (Anja Runge) at the German Cancer Research Center.

PCR Primers and protocol:

iAST Forward primer: GGACAAACCACAACTAGAATGCAGTG

iAST REVERSE primer: CAGAGCAGAATTGTGGAGTGGAAA

Machine protocol: 1x 95°C for 5 min, 35 x (95°C for 40 seconds / 60°C for

30 seconds / 72°C for 1 min), 1 x 72°C for 10 minutes followed by 4°C. The PCR

product is 475bp.

194

References

1 Runge, A. et al. An Inducible Hepatocellular Carcinoma Model for

Preclinical Evaluation of Antiangiogenic Therapy in Adult Mice. Cancer Research

74, 4157-4169, doi:10.1158/0008-5472.can-13-2311 (2014).




CR 28, 51, doi:10.1186/1756-9966-28-51 (2009).



640-648 (2011).





195


Figure 1. Representative MRI scans of iAST mice treated as a function of time (or three hours daily) with HCC-specific AM RF EMF (N = 4). a. Mouse I.D. 011. Negative control. No tumor growth identified after MR imaging. b. Mouse I.D. 007. Multiple nodule present in liver. Mouse started tumor-specific AM RF EMF after imaging. c. Mouse I.D. 007. Two weeks after initial MRI scans the images show progression of tumors. d. Mouse I.D. 007. Five weeks after initial MRI scans, the image shows continued tumor progression.

196

CURRICULUM VITAE

HUGO JIMENEZ PhD Candidate

Department of Cancer Biology Wake Forest School of Medicine

(708) 870-7659 [email protected]

Campus Address: Department of Cancer Biology Suite: NRC 441 Wake Forest University School of Medicine Winston-Salem, NC. 27157 Education: 2014-Present PhD, Cancer Biology Wake Forest University School of Medicine Winston-Salem, NC. 27157 Mentor: Boris C. Pasche, M.D., PhD 2011-2014 PhD, Cancer Biology University of Alabama-Birmingham Birmingham, AL. 35205 Mentor: Boris C. Pasche, M.D., PhD 2008-2010 Master’s in Clinical Laboratory Sciences Rush University Medical Center Chicago, IL. 60612 2003-2008 Bachelor’s degree in Biology Benedictine University Lisle, IL. 60532 Research Experience: 2011-2018 PhD Student Mentor: Boris C. Pasche, M.D., PhD 2009-2010 Masters Graduate Student Mentor: Kent Christopherson, PhD Positions and Honors Honors: 2013 Travel Award to BioEM conference, Thessaloniki, Greece


197

2010 Associate Member of Rush University Cancer Center, Rush University, Chicago, Illinois 2010 Outstanding Teaching Assistant, Rush University, Chicago, Illinois 2010 Chairman’s Award, Rush University, Chicago, Illinois Positions and Employment 2012-2013 Student member of admissions committee, UAB, Birmingham, Alabama 2010 Research Assistant II, Tumor Immunology laboratory, Rush Medical Center, Chicago, Illinois 2010 Teaching Assistant, Rush University, Chicago, Illinois 2009-2010 Laboratory Assistant, Rush Pathology Laboratory, Chicago, Illinois 2008-2010 Student member of ASCLS 2007-2008 Physics Grader, Benedictine University, Lisle, Illinois 2006-2008 Teacher Laboratory Assistant, Benedictine University, Lisle, Illinois Other Experience and Professional Memberships 2014-2015 Technology Commercialization Internship, Wake Forest Innovations, Wake Forest University, Winston-Salem, North Carolina 2013- The Bioelectromagnetic Society, BEMS 2012- American Association for Cancer Research, AACR 2011- Member of Academy for Future Science Faculty, Northwestern University, Chicago, IL 2009-2010 Clinical Rotations, University of Chicago, Chicago, Illinois 2009-2010 Clinical Rotations, Rush University, Chicago, Illinois Bibliography: Book Chapters 1. Pasche B, Jimenez H, Zimmerman J, Pennison M, Wang M, Posey J, Forero-Torres A, Carpenter JT, Brezovich I, Blackstock AW, Costa FP and Barbault A. (2015) Systemic Treatment of Cancer with Low and Safe Levels of Radiofrequency Electromagnetic Fields Amplitude-Modulated at Tumor-Specific Frequencies. In P. J. Rosch, (Ed.) Bioelectromagnetic and Subtle Energy Medicine (pp. 299-303). 2nd ed. London, England: CRC Press

198

Review Articles 1. Jimenez H, Blackman C, Lesser G, Debinski W, Chan M, Sharma S, Watabe K, Lo H, Thomas A, Godwin D, Blackstock W, Mudry A, Posey J, O’Connor R, Brezovich I, Bonin K, Kim-Shapiro D, Barbault A and Pasche B. (2018) Use of Non-Ionizing Electromagnetic Fields for the Treatment of Cancer. 2018 Jan; 23: 284-297. 2. Pasche B, Pennison MJ, Jimenez H, Wang M. (2014). TGFBR1 and cancer susceptibility. Transactions of the American Clinical and Climatological Association. 2014, 125: 300-312. 3. Pasche B, Wang M, Pennison M, Jimenez H. (2014). Prevention and Treatment of Cancer with Aspirin: Where do we stand? Seminars in Oncology. 2014 Jun; 41(3): 397-401. 4. Zimmerman JW, Jimenez H, Pennison MJ, Brezovich I, Morgan D, Mudry A, Costa FP, Barabult A & Pasche B. (2013) Targeted treatment of cancer with radiofrequency electromagnetic fields amplitude-modulated at tumor-specific frequencies. Chinese Journal of Cancer. 2013 Nov; 32(11): 573-81. PMID: 24206915 Research Articles 1. Ahmad I, Jimenez H, Yaacob NS, & Yusuf N. (2012) Tualang Honey Protects Keratinocytes from Ultraviolet Radiation-Induced Inflammation and DNA Damage. Photochemistry and Photobiology. 2012 Sep-Oct; 88(5): 1198-204. PMID: PMC3375347 Conferences Attended 2018 -GI ASCO, San Francisco, California 2016 -BioEM, Ghent,Belgium -Society for NeuroOncology, Scottsdale, Arizona 2015 -ASCO, Chicago, Illinois -BioEM, Pacific Grove, California 2014 -Alliance for Clinical Trials in Radiation Oncology, Chicago, Illinois 2013 -BioEM Thessaloniki, Greece -ASCI/AAP, Chicago, Illinois

IDENTIFICATION OF Cav 3.2 T-TYPE VOLTAGE GATED CALCIUM ...

Documents

Transcript of IDENTIFICATION OF Cav 3.2 T-TYPE VOLTAGE GATED CALCIUM ...