Vol. 172, No. 3

Identification, Cloning, and Characterization of the Escherichia colisohA Gene, a Suppressor of the htrA (degP) Null Phenotype

LISA BAIRD* AND COSTA GEORGOPOULOSDepartment of Cellular, Viral and Molecular Biology, University of Utah School of Medicine, Salt Lake City, Utah 84132

Received 25 August 1989/Accepted 27 November 1989

Two extragenic suppressors which allow temperature-sensitive htrA mutant Escherichia coli bacteria to growat 42°C and simultaneously acquire a cold-sensitive phenotype at 30°C were isolated. The cold-sensitivephenotype exhibited by one of the mutants was used to clone the corresponding wild-type copy of the suppressorgene. This was done through complementation with a mini-mu plasmid E. coli DNA library, by selection forcolonies which were no longer cold sensitive, at 30°C. The cloned suppressor gene was shown to complementthe cold-sensitive phenotype of both suppressor mutations. It was mapped to 68 min on the E. coli chromosomethrough hybridization to the Kohara library of overlapping X transducing bacteriophages, which covers theentire E. coli chromosome. The complementing gene was further subcloned on an 830-base-pair (bp) DNAfragment. DNA sequencing revealed the presence of an open reading frame (ORF) of 333 bp which couldencode a protein of 12,359 Mr. Subcloning of various DNA fragments from within this 830-bp DNA fragmentsuggests that this ORF is most likely responsible for suppression of the cold-sensitive phenotype of the htrAsuppressor bacteria. By using a T7 polymerase system to overproduce plasmid-encoded proteins, a protein ofapproximately 12,000 Mr was produced by this cloned DNA fragment. This ORF defines a previouslyundiscovered gene in E. coli, called sohA (suppressor of htrA).

Escherichia coli can grow over a wide temperaturerange-from 10 to 49°C (16). However, abruptly increasingthe temperature to above 40°C results in the accelerated rateof synthesis of a number of proteins, collectively known as

the heat shock proteins (for a review, see reference 17). Thegenes that encode the heat shock proteins are dispersedthroughout the chromosome, and the functions of most ofthese genes are not understood well. All classical heat shockgenes are members of the Cr32 heat shock regulon, becausetheir transcription is positively regulated by the product ofthe rpoH (htpR, hin) gene, the F32 subunit ofRNA polymer-ase (8, 17).

Recently, a new heat shock gene, htrA, that is essential forE. coli growth at temperatures above 42°C has been identi-fied (13). This gene was identified because mini-TnJO inser-tions in it result in bacterial inviability at temperatures above42°C (Ts- phenotype). The htrA gene has been mapped to3.5 min on the E. coli chromosome (13) and has been shownto encode a 51,000-Mr polypeptide which is processed to a

stable 48,000-Mr form (14). Interestingly, unlike other heatshock genes, the htrA gene is not under (r32 regulation, but ithas been shown to be positively regulated by a new u factorknown as aE (uF24) (5, 14). The only other promoter known tobe read by CuE is the P3 promoter of rpoH (5, 6), which ismost active at 50°C.The htrA gene has been shown to be identical to the degP

gene of E. coli (13; K. Strauch and J. Beckwith, personalcommunication). The degP gene was originally identified, byTnS insertional mutagenesis, as a mutant which fails to breakdown an unstable periplasmic fusion protein (21). Furtherstudies showed that the degP gene maps to 3.5 min andencodes a protein of approximately 52,000 Mr, which isprocessed to a 50,OOMr form, and that null mutations in thegene result in a Ts- phenotype in certain backgrounds, i.e.,lpp+ or strains expressing abnormal periplasmic proteins(22). DNA sequence analysis has revealed that the htrA and

* Corresponding author.

degP genes are identical (Strauch and Beckwith, personalcommunication).Other than the observation that the htrA (degP) gene

seems to encode, or regulate, a periplasmic protease that isrequired at high temperatures, the function of the htrA geneproduct is not understood very well. To better understandthe function of the htrA (degP) gene, we isolated extragenicsuppressors that restore growth at 42°C to bacteria thatpossess a null mutation in the htrA gene. We chose to studybacteria with suppressor mutations that result in the new

phenotype of cold sensitivity (Cs-), since this new pheno-type could be used to clone the wild-type copy of thesuppressor gene through complementation. Here we de-scribe the isolation and characterization of one of these Cs-suppressors of htrA. This suppressor is a previously undis-covered gene in E. coli which we call sohA (suppressor ofhtrA).

(This work was submitted by L.B. as a partial fulfillmentof the requirements for an M.S. degree at the University ofUtah.)

MATERIALS AND METHODS

Bacterial strains, plasmids, and bacteriophages. Bacterialstrains and plasmids are described in Table 1. Mu Apr phagefrom our collection was used to lysogenize the Cs- suppres-sor strains prior to infection with the Mu dII4042 (mini-Mu)phage library. Strains CAG12072, CAG12153, andCAG12071 were kindly provided by Mitchell Singer, Depart-ment of Bacteriology, University of Wisconsin-Madison.Transducing phage T4GT7 was used as described by Wilsonet al. (26).

Media. All strains were grown on L agar plates or in Lbroth (2). Media were supplemented with the followingantibiotics when necessary: ampicillin (50 ,ug/ml), chloram-phenicol (25 jig/ml), and streptomycin (50 p.g/ml). The low-sulfur minimal medium containing glucose plus amino acidsused for radiolabeling proteins has been described previ-

1587

JOURNAL OF BACTERIOLOGY, Mar. 1990, p. 1587-15940021-9193/90/031587-08$02.00/0Copyright © 1990, American Society for Microbiology

on July 5, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

1588 BAIRD AND GEORGOPOULOS

TABLE 1. Strains and Plasmids

Strain or plasmid Genotype or description Source or reference

B178 W3110 galE sup' Our collectionBL20 B178 htrA63 (Ts-) 13CG1205 B178 htrA63 sup* (Ts' Cs-)za?::TnS This workCG1206 B178 htrA63 sup* (Ts' Cs-)za?::TnS This workLB209 CG1205 htrA+ (Ts' Cs-)za?::TnS This workCAG12072 MG1655 zgj-203::TnJO 19CAG12153 MG1655 zha-6::TnJO 19CAG12071 MG1655 zhb-3082::TnJO 19DH5ot F- 480dlacZAM15 A(lacZYA-argF)

U169 recAl endAl hsdRJ7 (rK-, mK+)supE44 X- thi-1 gyrA relAl Our collection

Mu dII4042 High-copy-number plasmid; Cmr mini-Mu replicon for in vivo cloning 7pGB2 Low-copy-number vector; Strr 4pSP6/T719 Multiple-copy vector; Apr Bethesda Research LaboratoriespBluescript KS (+/-) Multiple-copy Apr vector with T7 promoter reading into the polylinker StratagenepBluescript SK (+/-) Same as pBluescript KS (+/-) but with the polylinker in inverted orientation StratagenepGP1-2 Knr plasmid encoding T7 RNA polymerase under c1857 control 23

ously (20). The composition and use of Bochner plates havebeen described previously (3).

Isolation of cold-sensitive suppressors of htrA63. An over-night culture of BL20 was grown in L broth at 30°C.Approximately 108 bacteria were plated on an L agar plate,which was incubated overnight at 42°C. The next day,colonies that grew (approximate frequency, 10-6) werepicked and streaked on two L agar plates. One plate wasincubated at 30°C, and the other was incubated at 42°C.Clones that became Ts' (able to grow well at 42°C) and Cs-(unable to grow at 30°C) simultaneously were pursued. TheCs- suppressor strains of htrA63 described in this work wereindependent isolates.

Cloning of cold-sensitive suppressor genes. The wild-typecopy of the corresponding suppressor gene was cloned byusing the mini-mu plasmid in vivo cloning technique (7).First, Cs- bacteria were lysogenized with Mu, by infectingwith Mu Apr phage and plating on L agar containing ampi-cillin at 42°C. Apr lysogens were then infected with a MudII4042 (mini-Mu) phage library, as described by Groismanand Casadaban (7). The Mu replicon Mu dII4042 was con-structed by incorporating a plasmid replicon into a Mubacteriophage element (7). Plasmid Mu dII4042 carries aCmr marker, so Cmr colonies which were able to grow at30°C (Cs') were selected. Such transformants should con-tain a wild-type copy of the suppressor gene on a Cmrmini-mu plasmid. Plasmid DNA was then isolated from theseCs' colonies, and the DNA was retransformed into the Cs-bacteria to verify that the cloned gene indeed gave 100% Cs'transformants. Plasmid DNA isolation was done by thealkaline lysis method of Maniatis et al. (15), and DNAtransformations were done as described by Alexander et al.(1).DNA subcloning. All DNA subcloning procedures were

done essentially as described by Maniatis et al. (15). Restric-tion enzymes and T4 DNA ligase were purchased from NewEngland BioLabs, Inc. (Beverly, Mass.) and Bethesda Re-search Laboratories, Inc. (Gaithersburg, Md.), respectively,and were used according to the specifications of the manu-facturer. DNA fragments for subcloning were purified fromagarose with Geneclean (Bio 101) according to the specifi-cations of the manufacturer. Throughout the entire DNAcloning and subcloning procedure, parallel transformationswere carried out with vector DNA alone as a control. When

subcloning into the pBluescript vectors (Stratagene, Inc., LaJolla, Calif.), white colonies on plates containing ampicillinplus X-Gal (5-bromo-4-chloro-3-indolyl-p-D-galactoside)were selected and plasmid DNA was isolated and mapped byrestriction enzyme digestion to verify that the proper insertwas present in each recombinant plasmid.Mapping. The Kohara library of overlapping A transducing

phages (10), which covers the entire E. coli chromosome wasused to map the cloned suppressor gene by DNA hybridiza-tion, as described by Lipinska et al. (13). Briefly, each of the476 overlapping X transducing phages was spotted on an Lagar plate that had been seeded with a lawn of E. coli B178,and the plate was incubated overnight at 37°C to allow phagegrowth. Plaque lifts were then made onto Hybond N nylonmembrane ifiters (Amersham Corp., Arlington Heights, Ill.),according to the specifications of the manufacturer. Theseplaque lifts were probed with subcloned plasmid DNA whichhad been labeled by nick translation (15) with [32P]dCTP(3,000 Ci/mmol; Dupont, NEN Research Products, Boston,Mass.), essentially as described by Wahl et al. (25).

Identification of plasmid-encoded proteins. Sodium dodecylsulfate-polyacrylamide gel electrophoresis of proteins wasdone essentially by the method of Laemmli (11) on 12.5%polyacrylamide gels. Two-dimensional gel electrophoresiswas done by the protocol of O'Farrell et al. (18) as modifiedby Tilly et al. (24). Selective radiolabeling of plasmid-encoded proteins was achieved by using a T7 polymeraseexpression system. Plasmids pBluescript KS (+/-) andpBluescript SK (+/-) (Strategene), which are identicalexcept for the orientations of their polylinkers with respectto a T7 promoter, were used to detect the protein(s) encodedby the 830-base-pair (bp) DNA fragment which could reversethe Cs- phenotype of strains CG1205 and CG1206. This830-bp DNA fragment was cloned into the PstI and EcoRIsites of both plasmids as a directed DNA fragment. Theseplasmids were then transformed into DH5a bacteria alreadycontaining the plasmid pGP1-2(23), which encodes T7 RNApolymerase under c1857 control, and Apr Knr transformantswere selected at 30°C. Cultures from single colonies weregrown in L broth plus ampicillin and kanamycin at 30°C to anoptical density at 590 nm of 0.30. Cells (2 ml) were centri-fuged, washed once with 5 ml of minimal medium, andresuspended in 1 ml of minimal medium supplemented withglucose and amino acids (without methionine and cysteine).

J. BACTERIOL.

on July 5, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

htrA (degP) EXTRAGENIC SUPPRESSOR 1589

Cells were grown with shaking at 30°C for 60 min and thenshifted to 42°C for 15 min. Rifampin (Sigma Chemical Co.,St. Louis, Mo.) was added at a final concentration of 200,ug/ml, and the culture was kept at 42°C for an additional 10min. The culture was shifted to 30°C for 20 min and subse-quently pulsed with [35S]methionine (-1,000 Ci/mmol; ICNRadiochemicals, Irvine, Calif.) at a final concentration of 125mCi/ml for 5 min at 300C.To make the heat shock extract of wild-type B178 bacte-

ria, strain B178 was grown in minimal medium supplementedwith glucose and amino acids (without methionine andcysteine) at 30°C to an optical density at 590 nm of 0.30. Halfof the culture was shifted to 430C, and the other half waskept at 30°C for 5 min. Both cultures were then pulsed with[35S]methionine at a final concentration of 125 mCi/ml for 3min. All cell extracts were electrophoresed on two-dimen-sional gels as described above. Gels were dried and exposedto Dupont Cronex film.DNA sequencing. All DNA sequencing was done with the

Sequenase system (U.S. Biochemical Corp., Cleveland,Ohio) according to the specifications of the manufacturer.Universal, reverse, and KS primers were purchased fromStratagene. Double-stranded plasmid DNA was isolated bythe alkaline lysis method of Maniatis et al. (15). This DNAwas then purified through CsCl or was prepared from a"clean" plasmid miniprep by phenol-chloroform extractiononce, ammonium acetate precipitation once, and then etha-nol plus ammonium acetate precipitation twice. Such cleanminiprep DNA preparations were shown to be good sub-strates in the double-stranded DNA sequencing reactions.

RESULTS

Cloning, subcloning, and mapping of the suppressor gene.Extragenic suppressors, which allow htrA mutant bacteria togrow at 42°C and simultaneously become unable to grow at30°C, were isolated and cloned by the strategy shown in Fig.1. Complementation analysis was carried out with varioushtrA Cs- suppressor strains. At least three complementationgroups were identified, and in this work we describe thecharacterization of one of these groups, the independentlyisolated strains CG1205 and CG1206. Mini-Mu plasmidp1205-4 is able to reverse the Cs- phenotype of both of thesestrains. The severity of the Cs- phenotype, as well as theability to suppress the Ts- phenotype caused by the htrAmutation, is very different for these two suppressor strains(Fig. 2). Strain CG1205 is somewhat leaky in its coldsensitivity, whereas strain CG1206 exhibits a very cold-sensitive phenotype at 30°C (Fig. 2A).Plasmid pLB27, which consists of a 4.8-kbp Sau3A DNA

fragment in the BamHI site of vector pGB2 (4), was sub-cloned from mini-mu plasmid p1205-4 on the basis of itsability to reverse the Cs- phenotype of both CG1205 andCG1206 bacteria. To map the location of the suppressor geneon the E. coli chromosome, the 4.8-kbp DNA insert in vectorpGB2 was removed by digestion with Sall and SmaI, whichdigest on either side of the BamHI site within the pGB2polylinker, and was used to probe filters containing plaque-lifted DNA from each of the overlapping A transducingphages in the Kohara library. Positive hybridization wasobtained with A transducing phages 6B5 (515) and 20F4 (516)(Fig. 3). The bacterial DNA inserts in these two phages arelocated at approximately 68 min (physical coordinate, 3,340kbp).The library of Singer et al. ofTnJO and TnlOkan insertions

(19), located at approximately 1-min intervals around the E.

CmRmini mu

htrAC3 htrA63 h1rA63

sup~~~~~~~~~~uXUP~~~~supX supX

300 + 300° 300 +

420 - 420 + 420 ?

FIG. 1. Strategy for cloning cold-sensitive extragenic suppres-sors of htrA63. (I) htrA63 bacteria are Ts- (unable to grow at 42°C)and Cs+ (able to grow at 30°C). (II) A culture of htrA63 bacteria wasplated on an L agar plate and incubated at 42°C. Colonies whichsurvived at 42°C (Ts+) were screened for those which simulta-neously became unable to grow at 30°C (Cs-). These Ts+ Cs-colonies presumably have acquired a mutation (*) in a gene (supX)that allowed them to survive at 42°C but then made them unable togrow well at 30°C. (III) The wild-type copy of the supX* Cs-suppressor gene was cloned with the mini-mu plasmid in vivocloning system (7). This was done by infection with a mini-Mu phageCmr E. coli DNA library and selection at 30°C for Cmr Cs, colonies.When the wild-type copy of the suppressor gene is present on thehigh-copy-number mini-Mu plasmid, the bacteria may or may notsimultaneously recover the Ts- phenotype. This depends onwhether the suppressor mutation is dominant over its wild-typeallele and also on the functional relationship between htrA and thesuppressor gene.

coli chromosome, was used to demonstrate that the locationof the cold-sensitive mutation in strain CG1205 correspondsto the location of the cloned suppressor gene in plasmidpLB27. Strain CG1205 is Tetr, because of a mini-TnJOinsertion in the htrA gene at 3.5 min, and is also Knr, becauseof a TnlOkan insertion near the optA gene. Therefore, to usethe library of Singer et al., it was necessary to cure strainCG1205 of its Tetr. To do this, a cosmid containing the htrAwild-type gene (14) was transformed into strain CG1205.These bacteria were then plated on Bochner plates (3).Bochner plates contain fusaric acid, which is toxic to Tetrbacteria; thus, only Tets bacteria can grow on them. Presum-ably, in this case, Tets bacteria have recombined the Tetrmini-TnJO element in the chromosomal htrA gene onto thecosmid containing the wild-type htrA gene, with subsequentsegregation of this Tetr mini-TnJO-containing cosmid out ofthe bacteria. Strain LB209 is a Tets strain isolated by thisstrategy which is still Cs-. Next, LB209 bacteria wereinfected with T4GT7 phage grown on strain CAG12072,CAG12153, or CAG12071 from the library of Singer et al.Strains CAG12072, CAG12153, and CAG12071 contain TnWOmarkers at 68.75, 70, and 70.75 min, respectively. Thesestrains were chosen from the library because their TnWOmarkers are near 68 min, which is where the insert in pLB27maps (Fig. 3). Tetr colonies at 42°C were selected andsubsequently screened for a Cs' phenotype at 30°C. If thesuppressor mutation is located near 68 min, a Cs' phenotypeshould cotransduce with the TnWO markers in the 68-minregion, whereas if the suppressor mutation is located else-where on the E. coli chromosome, no Cs' colonies shouldbe found among the Tetr transductants. Cs' colonies wereindeed found, at a frequency of 78% for the TnWO marker at68.75 min in strain CAG12072 and at a frequency of 56% forthe TnWO marker at 70 min in strain CAG12153. No Cs'colonies were found in the case of the TnWO marker at 70.75min in strain CAG12071. Thus, the location of the suppres-sor mutation corresponds to the 68-min region of the E. coli

VOL. 172, 1990

on July 5, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

1590 BAIRD AND GEORGOPOULOS

A1'

Iu .1as

co

.01,0 30 60 90 120

minutes

B10

..01

0 30 60 90 120minutes

FIG. 2. Growth curves of parental strain B178 (El), the htrA63strain (*), and suppressor strains CG1205 (U) and CG1206 ( *). (A)Growth curves at 30°C. L broth cultures of B178 and htrA63 bacteriawere grown continuously at 30°C. L broth cultures of CG1205 andCG1206 bacteria were grown at 43°C and shifted to 30°C at timezero. (B) Growth curves at 43°C. L broth cultures of B178 andhtrA63 bacteria were grown at 30°C and shifted to 43°C at time zero.L broth cultures of CG1205 and CG1206 bacteria were growncontinuously at 43°C. OD, Optical density.

chromosome and the cotransduction frequencies are consis-tent with the mutation being located at approximately 68min.The 4.8-kbp Sall-SmaI DNA insert in plasmid pLB27,

which carries the suppressor gene, was moved to the high-copy-number plasmid pSP6/T719 to yield plasmid pLB192.Plasmid pLB192 still suppresses the Cs- phenotype of

FIG. 3. Localization of the sohA gene on the E. coli physicalmap. A plaque lift of each of the overlapping A transducing phagesin the Kohara library (10) was probed with plasmid pLB27 DNAradiolabeled by nick translation. Hybridization was observed with Xphages 6B5 (515) and 20F4 (516) (O) carrying bacterial DNA insertslocated at 68 min (physical coordinate, 3,340 kbp). The region of theE. coli physical map around k phages 6B5 (515) and 20F4 (516) isshown, with the region of the restriction map which matches therestriction map of the 830-bp DNA insert in plasmid pLB290indicated (a). The numbers at the top are the physical coordinatesin kilobase pairs. The restriction map of this region is shown belowthe physical coordinates for the following eight enzymes: BamHI(top row), Hindlll (row 2), EcoRI (row 3), EcoRV (row 4), BglI (row5), KpnI (row 6), PstI (row 7), and PvuII (row 8).

strains CG1205 and CG1206 very well and does not seem tobe detrimental to bacterial growth. Various DNA fragmentsfrom this plasmid were further subcloned into the pBlue-script KS (+/-) vector (Fig. 4). An EcoRI-PstI DNA frag-ment of only 830 bp, plasmid pLB290, was still able to fullycomplement the Cs- phenotype of both CG1205 and CG1206bacteria. By reducing the insert to a 550-bp EcoRI-EcoRVDNA fragment, plasmid pLB298, some complementing ac-tivity was lost. By further reducing the insert to a 400-bpPvuII-EcoRV DNA fragment, plasmid pLB305, or an evensmaller 250-bp HindIII-EcoRV DNA fragment, plasmidpLB310, complementing activity was further reduced butwas not entirely lost. A 500-bp HindIII-PstI DNA fragment,plasmid pLB333, complemented just as well as the entire850-bp original subclone. Each of these complementingplasmids contains all or part of an open reading frame (ORF)which is predicted from the DNA sequence (see below).The growth kinetics of CG1206 bacteria transformed with

J. BACTERIOL.

on July 5, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

htrA (degP) EXTRAGENIC SUPPRESSOR 1591

-100 a

pL nl92 III ..L.I 4.I

X -u XWI

a *

A1

1OOObp

8 vtt4

100 bpability to

complement+++

++

R1con'U

pLB308

pLB310 I

pLB311

pLB333 ++

FIG. 4. Restriction map of the E. coli DNA fragment, located at68 min, which reverses the Cs- phenotype of CG1205 and CG1206bacteria. The top horizontal bar represents the restriction map of the4.8-kp Sall-SmaI DNA insert in pSP6tT719, which is plasmidpLB192. The EcoRI, KpnI, and PstI restriction sites at the two endsof the DNA fragment are from the vector pSP6/T719 polylinker. The830-bp KpnI-PstI DNA fragment was further subcloned into thepBluescript KS (+/-) vector, and its restriction map is enlarged andshown below the plasmid pLB192 map. The inserts of varioussubclones, also in pBluescript KS (+/-), are represented by heavyhorizontal bars with the subclone name to the left of each bar. Theability of each plasmid to complement the Cs- phenotype of CG1205and CG1206 bacteria is indicated to the right of each bar by + + +(wild-type level), + + (good, but not wild-type level), + (fair), or -

(no complementation). The arrow below the restriction map indi-cates the ORF of 111 amino acids that was found in the sequencedfragment (Fig. 7).

some of these plasmids were monitored at 30 and 43°C. At30°C, CG1206 bacteria carrying plasmid pLB290 or pLB333grew almost as well as wild-type B178 bacteria (Fig. 5A). At43°C, CG1206 bacteria carrying either plasmid lysed in amanner similar to that of htrA mutant bacteria (Fig. 5B).Thus, the Ts- phenotype of the original htrA mutation wasrestored when the wild-type copy of the suppressor gene waspresent on a high-copy-number plasmid, as evidenced bylysis of the cultures approximately 30 to 45 min after the shiftto 43°C (Fig. 5B).

Identification of the suppressor polypeptide. In order toidentify the protein(s) produced by the putative suppressorgene, the 830-bp EcoRI-PstI DNA fragment in vector pBlue-script KS (+/-), plasmid pLB290, was cloned into thepBluescript SK (+/-) vector to yield plasmid pLB291.These two plasmids possess a T7 promoter transcribing intothe polylinker, which is in the opposite orientation in KS(+/-) than in SK (+/-) because the polylinker has beeninverted. Proteins under T7 polymerase control can beselectively produced by inhibiting E. coli RNA polymerasetranscription through the addition of the antibiotic rifampin.This experiment was carried out with DH5ot bacteria trans-formed with either plasmid pLB290 or pLB291. A smallprotein (10,000 to 14,000 Mr) was overproduced in theextract from cells carrying plasmid pLB291 (Fig. 6B); thisprotein was absent in a control extract from cells carryingthe pBluescript SK (+/-) vector alone (Fig. 6A). The

.010 30 60 90 120

minutes

B10

o1

.

0 .01

0 30 60 90 120minutes

FIG. 5. Growth curves of CG1206 bacteria carrying plasmidspLB290 or pLB333. B178 (El), htrA63 strain (*), and CG1206 (M)cultures were grown as described in the legend to Fig. 2. Cultures ofCG1206(pLB290) (*) and CG1206(pLB333) (M) bacteria were grownin L broth plus ampicillin (50 ±g/ml) continuously at 30°C (A) or

shifted to 43°C (B) at time zero. OD, Optical density.

inserted DNA in plasmid pLB291 was transcribed from theT7 promoter of vector pBluescript SK (+/-) in the directionfrom the EcoRI site to the PstI site. No proteins were

overproduced in the extract from cells carrying plasmidpLB290 (data not shown), in which the inserted DNA was

transcribed from the T7 promoter of vector pBluescript KS(+/-) in the direction from the PstI site to the EcoRI site. Totest whether the small protein encoded by this 830-bp DNAfragment might be a heat shock protein, an extract from cellscarrying plasmid pLB291 was mixed with a heat shockextract from wild-type B178 cells (see Materials and Meth-

pLB290

pLB298

pLB305

A lls

VOL. 172, 1990

- -T

tfl 1-

on July 5, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

1592 BAIRD AND GEORGOPOULOS

FIG. 6. Two-dimensional sodium dodecyl sulfate-polyacry-lamide gel electrophoresis of extracts from cells carrying plasmidpLB291. Cell extracts were separated by electrophoresis as de-scribed in Materials and Methods. Proteins were radiolabeled with[35S]methionine by using the T7 polymerase system to selectivelylabel plasmid proteins (see Materials and Methods). In each case,the acidic end of the gel is on the right. (A) Extract from cellscarrying vector pBluescript SK (+/-) alone. (B) Extract from cellscarrying plasmid pLB291 [pBluescript SK (+/-) plus 830-bp EcoRI-PstI DNA fragment]. The arrow in panel B points to the location ofthe protein which is present in the extract from cells carryingplasmid pLB291 but which is absent in the extract from cellscarrying vector pBluescript SK (+/-) alone.

ods) and the mixture, as well as each extract alone, waselectrophoresed on a two-dimensional gel. The position ofthe small protein overproduced in the plasmid pLB291extract did not correspond to the position of any proteinshown to be induced in a wild-type B178 extract after a 3-minshift to 43°C (data not shown).Sequencing of the suppressor gene. The 830-bp DNA insert

in plasmid pLB290 was sequenced, and the entire DNAsequence is shown in Fig. 7. An ORF which could encode aprotein of 111 amino acids with a predicted Mr of 12,359 ispresent from nucleotides 378 to 710. The predicted Mr isconsistent with the mobility of the protein produced underT7 polymerase control from bacteria carrying plasmidpLB291 (Fig. 6B). Furthermore, the direction of transcrip-tion of the ORF is the same as that from the T7 promoter inplasmid pLB291. The ability of the various plasmids tocomplement the Cs- phenotype of CG1205 and CG1206bacteria is also consistent with the idea that this ORF isnecessary for the suppression, since plasmid pLB333 con-tains this ORF on a 500-bp HindIII-Pstl DNA fragment with

1 GGACCGTCATTAAAATGGCAACCCGCACCGAGCTGGCGAACCGCTGGTTTGATTTAATGG

63 ATATTAATGCGGGCACCATCGCTACCGGCGAAGAAACTATTGAAGAGGTGGGCTGGAAGTTGT

126 TCCACTTTATTCTCGACGTCGCCAGCGGGAAGAAGAAAACCTTCTCGGATCAATGGGGGCTGCPvuII

189 ATAACfAIGCGGTGTTTAACCCGGCACCGGTGACCTGATTTCTTTTGGAACGTCCCTCGC

252 AAAACATGGCCTTAGTGCCATGTTTTTATTGTTTAAAGCCCCCACGTCCATTAATAATGCATT

315 TGCATTACCTTAGTTCAAG-TTTAATTTGAGCAGAAAACAGGCTGTAAAAGGCAGTGAATCS.D.

378 ATG CCC GCT AAT GCT CGC TCT CAC GCT GTA CTG ACC ACT GAA TCA AAGMet Pro Ala Asn Ala Arg Ser His Ala Val Leu Thr Thr Glu Ser Lys

426 GTC ACG ATA CGC GGA CAA ACA ACT ATC CCC GCG CCA GTG CGT GAG GCCVal Thr Ile Arg Gly Gln Thr Thr Ile Pro Ala Pro Val Arg Glu Ala

474 TTA AAA CTG AAG CCA GGC CAG GAC AGC ATT CAT TAC GAA ATT CTG_ CLeu Lys Leu Lys Pro Gly Gln Asp Ser Ile His Tyr Glu Ile Leu Pro

BglI522 GGT GG CAA GTA TTT ATG TGC CGA CTG GGA GAT GAA CAG GAG GAT CAT

Gly Gly Gln Val Phe Met Cys Arg Leu Gly Asp Glu Gln Glu Asp His

ZcoRV570 ACT ATG AAT GCA TTT TTG CGT TTT CTG GAT GCA QT ATC CAG AAC AAC

Thr Met Asn Ala Phe Leu Arg Phe Leu Asp Ala Asp Ile Gln Asn Asn

618 CCG CAM AAA ACT CGT CCA TTC AAC ATT CAA CAA GGA AAG AAA CTT GTCPro Gln Lys Thr Arg Pro Phe Asn Ile Gln Gln Gly Lys Lys Leu Val

666 GCT GGC ATG GAC GTC AAC ATT GAT GAT GAG ATT GGC GAC GAC GAA TAAAla Gly Met Asp Val Asn Ile Asp Asp Glu Ile Gly Asp Asp Glu

714 TGGATTTTCCACAAAGGTTAATGGTTGGGCGCTATATGCTCATCCCTGTTTTCAGGAAACCTSall

777 ACGACGCTTTAGTTGCCGMAGTCGAGACATTAAAGGGAAGATCCGIWA

FIG. 7. Nucleotide sequence (GenBank accession no. M30178)of the 830-bp DNA fragment in plasmid pLB290. The nucleotidesequence is shown with the pertinent restriction sites underlined andindicated above the sequence. The number of the first base pair ineach line is shown at the left. The ORF (bp 378 to 710) is translatedbelow the sequence. The -10 and -35 elements of a potential a"7Opromoter are indicated by asterisks. A potential Shine-Dalgarno(S.D.) translational start region, which is present from bp -10 to-13, is also underlined.

very minimal sequences to either side and fully complementsthe Cs- phenotype of CG1205 and CG1206 mutant bacteria(Fig. 4 and 5). Subclones that reduce this ORF to 232 bp(pLB298, pLB305, and pLB310) lose some complementingability. Other DNA sequences, upstream of the HindIlI sitein plasmid pLB333, may play an important role in geneexpression, possibly as promoter sequences, since removingthem, as in plasmid pLB305, also affects complementingability. This reduction of complementing ability due to theloss of putative promoter sequences is probably not seen inplasmid pLB333 because the lacZ promoter of vector pBlue-script KS (+/-) is transcribing in the same direction as theORF.

DISCUSSION

Mini-TnJO insertions in the htrA gene result in a Ts-phenotype. Other workers have found that the Ts- pheno-type of htrA mutant bacteria is present only in certainbackgrounds, i.e., lpp+ (lipoprotein) bacteria or in strainsexpressing abnormal periplasmic proteins (22). In cells withthe mutation causing lipoprotein deficiency lpp-5508 (9),periplasmic proteins are released into the medium and theTs- phenotype of htrA mutant bacteria is reduced. Thus, theTs- phenotype in a Ipp+ background may be due to anaccumulation of toxic protein(s) which is normally degradedby the htrA gene product at high temperatures or to a failureto degrade protein(s) which is normally labile at high tem-peratures and which interferes with normal cellular pro-

J. BACTERIOL.

on July 5, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

VOL. 172, 1990 htrA (degP) EXTRAGENIC SUPPRESSOR 1593

cesses when present in high amounts. The hypothesis thatthe Ts- phenotype is relieved in a lpp mutant strain becausethe toxic protein(s) is able to diffuse through the membranehas been proposed (22).To better understand the function of the htrA gene, we

chose to study and characterize extragenic suppressorswhich reverse the Ts- phenotype of bacteria with a nullmutation in the htrA gene. One can hypothesize many waysby which the proteolytic defect in htrA mutant bacteria couldbe relieved. Extragenic suppressors could involve (i) alteringthe specificity or increasing the production of another pro-tease that can now take over the function of the htrA geneproduct; (ii) eliminating the production of toxic protein(s)which accumulates in the absence of the htrA protein; or (iii)altering a membrane protein to allow leakage of toxic pro-tein(s), analogous to the lpp-5508 mutation. We chose topursue suppressors that reverse the Ts- phenotype of htrAmutant bacteria and simultaneously acquire a new Cs-phenotype, since this new phenotype could be used to easilyclone the wild-type copy of the suppressor gene throughcomplementation. Mini-mu plasmid in vivo cloning (7) wasused to obtain plasmids that could complement the Cs-phenotype of various htrA suppressor strains. At least threecomplementation groups were found, and in this paper wedescribe the characterization of one of these suppressors. Inunpublished experiments, one complementation group wasmapped to the glnS (glutaminyl-tRNA synthetase) gene (27),which charges glutamine tRNA with its corresponding aminoacid, and another complementation group was mapped to thedrpA gene, whose product has been implicated in RNA, andpossibly DNA, synthesis (12). The third complementationgroup maps to a previously undiscovered gene in E. coli,sohA (suppressor of htrA), which we subcloned and se-quenced.The sohA gene is located at approximately 68 min on the

E. coli chromosome. The location of the Cs- mutation onthe E. coli chromosome has also been demonstrated tocorrespond to the location of the cloned sohA gene at 68 min.In addition, when the wild-type sohA gene is present on ahigh-copy-number plasmid, the Ts- phenotype caused bythe original htrA mutation is restored in strain CG1206 (Fig.5B), demonstrating the sohA+ is dominant over the sohAmutation when present on a multicopy plasmid. This resto-ration of the Ts- phenotype suggests that the sohA gene isindeed the bona fide suppressor gene and not another genethat simply suppresses the Cs- phenotype because of itspresence on a high-copy-number plasmid.The sohA gene was cloned on an 830-bp fragment, and

subsequent DNA sequencing revealed the presence of anORF of 333 bp which could encode a protein of 12,359 Mr.Subcloning of various DNA fragments within this 830-bpDNA fragment suggests that this ORF is most likely respon-sible for suppression of the Cs- phenotype of CG1205 andCG1206 mutant bacteria (Fig. 4) (see Results).The mechanism of suppression of the Ts- phenotype of

htrA mutant bacteria by a mutation within this gene is notknown. A search of the GenBank catalog ofDNA sequencesrevealed no significant homology between this ORF and anyother known DNA sequence. The predicted amino acidsequence for the sohA gene product was also compared withtranslated GenBank sequences, and again, no significantsimilarity to any protein sequence was found. This gene doesnot appear to be under heat shock regulation, and no leadersequence or potential transmembrane-spanning sequencesare predicted for its product, making it unlikely that it islocalized to the periplasm or either membrane.

The Ts- phenotype of htrA mutant bacteria appears to bemore severe on rich media than on minimal media containingglucose plus amino acids (13). This reduction of the Ts-phenotype on minimal media may be due to a slower growthrate. The mechanism of suppression of the Ts- phenotype ofhtrA bacteria by a mutation in the sohA gene may be also dueto a nonspecific decrease in growth rate that enables htrAbacteria to slowly compensate for the missing function. J.Beckwith and his collaborators have shown that a general-ized decrease in protein synthesis nonspecifically compen-sates for a reduced ability to transport proteins (J. Beckwith,personal communication). Suppressor CG1206 bacteria growvery slowly at 43°C (Fig. 2B); hence, it is possible thatsuppression of the Ts- phenotype in strain CG1206 is due toa slower growth rate. However, CG1205 bacteria grow fairlyrapidly at 43°C (Fig. 2B), making a reduction in growth rateless likely to be the cause of suppression. Alternatively, thedecrease in growth rate may not have to be substantial forthis type of suppression to occur. The fact that two of eightindependently isolated Cs- extragenic suppressors of thehtrA mutation map in the sohA gene suggests that a morespecific mechanism of suppression may be operating. How-ever, more extensive characterization of the sohA gene isneeded to determine its precise role in this suppression.

ACKNOWLEDGMENT

This work was supported by Public Health Service grant A121029from the National Institutes of Health.

LITERATURE CITED1. Alexander, D. C., T. D. McKnight, and B. G. Williams. 1984. A

simplified and efficient vector-primer cDNA cloning. Gene31:79-89.

2. Ang, D., G. N. Chandrasekhar, M. Zylicz, and C. Georgopoulos.1986. Escherichia coli grpE gene codes for heat shock proteinB25.3, essential for both X DNA replication at all temperaturesand host growth at high temperature. J. Bacteriol. 167:25-29.

3. Bochner, B., H.-C. Huang, G. Schieven, and B. N. Ames. 1980.Positive selection for loss of tetracycline resistance. J. Bacte-riol. 143:926-933.

4. Churchward, G., D. Belin, and Y. Nagamine. 1984. A pSC101-derived plasmid which shows no sequence homology to othercommonly used cloning vectors. Gene 31:165-171.

5. Erickson, J. W., and C. A. Gross. 1989. Identification of the aEsubunit of Escherichia coli RNA polymerase; a second alterna-tive sigma involved in high temperature gene expression. GenesDev. 3:1462-1471.

6. Erickson, J. W., V. Vaughn, W. A. Walter, F. C. Neidhardt, andC. A. Gross. 1987. Regulation of the promoters and transcriptsof rpoH, the Escherichia coli heat shock regulatory gene. GenesDev. 1:419-432.

7. Groisman, E., and M. J. Casadaban. 1986. Mini-mu bacterio-phage with plasmid replicons for in vivo cloning and lac genefusing. J. Bacteriol. 168:357-364.

8. Grossman, A. D., J. W. Erickson, and C. A. Gross. 1984. ThehtpR gene product of E. coli is a sigma factor for heat shockpromoters. Cell 38:383-390.

9. Hirota, Y., H. Suzuki, Y. Nishimura, and S. Yasuda. 1977. Onthe process of cellular division in Escherichia coli: a mutant ofE. coli lacking a murein-lipoprotein. Proc. Natl. Acad. Sci. USA74:1417-1420.

10. Kohara, Y., K. Akiyama, and K. Isono. 1987. The physical mapof the whole E. coli chromosome: application of a new strategyfor rapid analysis and sorting of a large genomic library. Cell50:495-508.

11. Laemmli, U. K. 1970. Cleavage of structural proteins during theassembly of the head of bacteriophage T4. Nature (London)227:680-685.

12. Lech, K. F., C. H. Lee, R. R. Isberg, and M. Syvanen. 1985.

on July 5, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

1594 BAIRD AND GEORGOPOULOS J. BACTERIOL.

New gene in Escherichia coli K-12 (drpA): does its product playa role in RNA synthesis? J. Bacteriol. 162:117-123.

13. Lipinska, B., 0. Fayet, L. Baird, and C. Georgopoulos. 1989.Identification, characterization, and mapping of the Escherichiacoli htrA gene, whose product is essential for bacterial growthonly at elevated temperatures. J. Bacteriol. 171:1574-1584.

14. Lipinska, B., S. Sharma, and C. Georgopoulos. 1989. Sequenceanalysis and regulation of the htrA gene of Escherichia coli: aor32-independent mechanism of heat-inducible transcription. Nu-cleic Acids Res. 16:10053-10067.

15. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

16. Neidhardt, F. C., and R. A. VanBogelen. 1987. Heat shockresponse, p. 1334-1345. In F. C. Neidhardt, J. L. Ingraham,K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger(ed.), Escherichia coli and Salmonella typhimurium: cellularand molecular biology, vol. 2. American Society for Microbiol-ogy, Washington, D.C.

17. Neidhardt, F. C., R. A. VanBogelen, and V. Vaughn. 1984. Thegenetics and regulation of heat-shock proteins. Annu. Rev.Genet. 18:295-329.

18. O'Farrell, P. Z., H. M. Goodman, and P. H. O'Farrell. 1977.High resolution two-dimensional electrophoresis of basic aswell as acidic proteins. Cell 12:1133-1142.

19. Singer, M., T. A. Baker, G. Schnitzler, S. M. Deischel, M. Goel,W. Dove, K. J. Jaacks, D. Grossman, J. W. Erickson, and C. A.Gross. 1989. A collection of strains containing genetically linkedalternating antibiotic resistance elements for genetic mapping ofEscherichia coli. Microbiol. Rev. 53:1-24.

20. Spence, J., and C. Georgopoulos. 1989. Purification and proper-ties of the Escherichia coli heat shock protein, HtpG. J. Biol.Chem. 264:4398-4403.

21. Strauch, K. L., and J. Beckwith. 1988. An Escherichia colimutation preventing degradation of abnormal periplasmic pro-teins. Proc. Natl. Acad. Sci. USA 85:1576-1580.

22. Strauch, K. L., K. Johnson, and J. Beckwith. 1989. Characteri-zation of degP, a gene required for proteolysis in the cellenvelope and essential for growth of Escherichia coli at hightemperature. J. Bacteriol. 171:2689-2696.

23. Tabor, S., and C. C. Richardson. 1985. A bacteriophage T7RNA polymerase/promoter system for controlled exclusiveexpression of specific genes. Proc. Natl. Acad. Sci. USA82:1074-1078.

24. Tilly, K., H. Murialdo, and C. Georgopoulos. 1981. Identifica-tion of a second Escherichia coli groE gene whose product isnecessary for bacteriophage morphogenesis. Proc. Natl. Acad.Sci. USA 78:1629-1633.

25. Wahl, G. M., M. Stern, and G. Stark. 1979. Efficient transfer oflarge DNA fragments from agarose gels to diazobenzyloxymeth-yl-paper and rapid hybridization by using dextran sulfate. Proc.Natl. Acad. Sci. USA 76:3683-3687.

26. Wilson, G. G., K. K. Y. Young, G. J. Edlin, and W. Konigsberg.1979. High frequency generalized transduction by bacterio-phage T4. Nature (London) 280:80-82.

27. Yamao, F., H. Inokuchi, A. Cheung, H. Ozeki, and D. Soi. 1982.Escherichia coli glutaminyl-tRNA synthetase. I. Isolation andDNA sequence of the gInS gene. J. Biol. Chem. 257:11639-11643.

on July 5, 2020 by guesthttp://jb.asm

.org/D

ownloaded from