THE JOURNAL OF BIOL.OGICAL CHEMISTRY Vol. 265, No. 14, Issue of May 15, pp. 8317~8321,199O 0 1990 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S. A.

Identification and Characterization of a Mutation in the Dihydrofolate Reductase Gene from the Methotrexate-resistant Chinese Hamster Ovary Cell Line Pro-3 MtxRII1*

(Received for publication, November 10, 1989)

Adam P. Dicker& Matthias Volkenandta, Barry I. Schweitzer, Debabrata Banerjee, and Joseph R. Bertinoll From the Cornell University Graduate School of Medical Sciences and the Laboratory of Molecular Pharmacology, Memorial Sloan-Kettering Cancer Center, New York, New York 10021

A methotrexate-resistant Chinese hamster ovary cell line (Pro-3 MtxR”‘), resistant due to a low-level ampli- fied, altered target enzyme, dihydrofolate reductase (DHFR), has been characterized on the molecular level. The cDNA and coding regions of all six DHFR exons were amplified in vitro using Taq polymerase and directly sequenced. Analysis of the Pro-3 MtxR”’ DHFR cDNA demonstrated a C + T base transition at nucleotide 67 that results in the substitution of phen- ylalanine for leucine at residue 22 and the loss of a BsaI site in the Pro-3 MtxR”’ cDNA. This mutation results in a decreased binding of methotrexate to the altered enzyme. Molecular modeling of Leuz2 + Phe supports the concept of the importance of Leuz2 in the active site of the enzyme and indicates that replace- ment with phenylalanine will decrease the binding of methotrexate.

The enzyme dihydrofolate reductase (DHFR,’ 5,6,7,8-tet- rahydrofolate: NADP’ oxidoreductase, EC 1.5.1.3) catalyzes the NADPH-dependent reduction of 7,8-dihydrofolate to 5,6,7,%tetrahydrofolate, an essential carrier of one-carbon units in the biosynthesis of thymidylate, purine nucleotides, and methyl compounds. DHFR is the target enzyme for a number of pharmacological agents; for example, the DHFR inhibitors trimethoprim, pyrimethamine, and methotrexate (MTX) are widely used in the treatment of bacterial infec- tions, malaria, and cancer, respectively.

Amplification of the DHFR gene with a proportional in- crease in protein has been shown to be a common mechanism of resistance in cultured tumor cells grown in the presence of increasing concentrations of MTX (l-7). In a majority of such cell lines, the overproduced enzyme is biochemically

* This work was supported in part by United States Public Health Service Grant CA 08010, American Cancer Society Grant BC-561C, and the Brookdale Foundation. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

$ William Morris Fellow in the Cornell University Medical College/ Sloan-Kettering Institute M.D.-Ph.D. program.

§ Supported by Deutsche Forschungsgemeinschaft Grant Vo 415/ l-l.

7 American Cancer Society Professor. To whom correspondence should be addressed: 601 Rockefeller Research Lab., Sloan-Kettering Inst., Box 78, 1275 York Ave., New York, NY 10021. Tel.: 212-639- 8230,8235; Fax: 212-639-2767.

1 The abbreviations used are: DHFR, dihydrofolate reductase; CHO, Chinese hamster ovary; MTX, methotrexate; PCR, polymerase chain reaction.

indistinguishable from the enzyme in cells which are sensitive to the drug. Several cell lines have been described, however, in which the amplified DHFR genes code for an enzyme with a reduced affinity for MTX. For example, Haber et al. (5) demonstrated that the DHFR in the highly MTX-resistant mouse cell line 3T6-R400 is amplified and altered, with a 240- fold reduction in MTX binding affinity. Subsequently, it was shown (8) that the altered properties of the enzyme in 3T6- R400 cells are due to an arginine substitution for the leucine at residue 22. X-ray crystallographic studies (9) have shown that this leucine is located in the active site of the mouse DHFR and makes a hydrophobic interaction with bound MTX. It has also been established (10,ll) that amplified and altered DHFRs are associated with MTX resistance in several Chinese hamster lung cell lines. The first altered human DHFR to have its mutation identified at the molecular level was found and characterized in the MTX-resistant human colon adenocarcinoma cell line HCT-8R4 (12). Although the DHFR gene in HCT-8R4 cells is amplified only 25-fold, the cells can grow in the presence of MTX at a concentration that is lO,OOO-fold higher than the concentration which is tolerated by the parental cell line. Analysis of the nucleotide sequence from the DHFR cDNA from HCT-8R4 cells revealed that the phenylalanine at residue 31, which makes a hydro- phobic interaction with bound ligands in the active site, had been mutated to a serine. Subsequent site-directed mutagen- esis studies (13) demonstrated that this mutation lowers the affinity of the human DHFR for MTX by a factor of 100. In this study, we report the identification of a mutation in the DHFR gene from a MTX-resistant CHO cell line, Pro-3 MtxR”’ (referred to as MtxR”‘), originally described by Flintoff et al. (14,15). This cell line was developed by selection of cells expressing low levels of an altered DHFR with increasing concentrations of MTX; MtxR”’ cells express higher levels of this altered enzyme. We have amplified in vitro both genomic DNA and transcripts of the DHFR gene from both the Pro-3 cell line (the parental line) and the MtxR”’ subline using the polymerase chain reaction. Direct DNA sequencing of the amplified material revealed a phenylalanine substitution for leucine at residue 22.

EXPERIMENTAL PROCEDURES

Materials-Reagents for mRNA isolation and cDNA synthesis were obtained from Invitrogen (San Diego, CA). RNase-free silicon- ized tubes were obtained from National Scientific (San Rafael, CA). TaqI DNA polymerase was obtained from Perkin-Elmer/Cetus In- struments (Norwalk, CT) or Stratagene (San Diego, CA). Agarose was obtained from FMC (Rockland, ME). Centricon 100 microcon- centrators were obtained from Amicon Corp. (Danvers, MA). Re- agents for DNA sequencing were obtained from United States Bio-

8317

by guest on Novem

ber 25, 2020http://w

ww

.jbc.org/D

ownloaded from

Altered DHFR Gene in the CHO Pro-3 MtXR”’ Cell Line

chemical Corp. (Cleveland, OH). The restriction enzyme BsaI was a gift from New England Biolabs, Inc. (Beverly, MA). MTX was a gift from Dr. Harriet Kiltie (Lederle Laboratories).

Cell Lines and Cultures-The Chinese hamster ovary cell lines Pro-3 and Mtxs”’ (16) were a gift from Dr. Wayne Flintoff (University of Western Ontario, London, Ontario, Canada). Cells were grown as monolayers in RPMI-1640 medium supplemented with 10% fetal bovine serum.

Inhibition Kinetics--K, values for the tight binding inhibitors MTX and trimetrexate and the weak binding inhibitor trimethoprim were determined as described by Appleman et al. (17). After correction for blank rates (i.e. no enzyme), the data were fit by nonlinear least- squares regression to equations for tight binding inhibitors (computer fitting program generously provided by Dr. James Appleman, St. Jude’s Children Research Hospital, Memphis, TN) and competitive inhibitors as described by Appleman et &(17).

Nucleic Acid Isolation-Genomic DNA was isolated bv the method described by Higuchi (18). mRNA was isolated by the method of Badley et al. (19).

First Strand cDNA Synthesis-Approximately 100 ng of mRNA was used for first strand cDNA synthesis in a 50-~1 reverse transcrip- tion reaction in RNase-free siliconized tubes. First strand cDNA synthesis with chemical denaturation using methyl mercury hydrox- ide was based on the work of Payvar and Schimke (20). To the RNA, 6 PI of 0.1 M methyl mercury hydroxide was added, and the mixture was incubated at room temperature for 7 min. 3.1 ~1 of 0.7 M fl- mercaptoethanol was added to titrate the methyl mercury hydroxide, and the mixture was incubated for 5 min at room temperature. 300 ng of primer CH03’, 20 units of placental ribonuclease inhibitor, reverse transcription buffer, deoxynucleotide triphosphates to a final concentration of 25 mM, and 10 units of reverse transcriptase were added, and the mixture was incubated at 42 “C for 1 h.

Synthetic Oligonucleotides-Oligonucleotides were synthesized “trityl-off” by the solid-phase triester method in an Applied Biosys- terns Model 380 DNA synthesizer. Reaction products were cleaved and deprotected by standard protocols. Oligonucleotide primers for the PCR and DNA sequencing were similar to those described by Carothers et al. (21). Primers whose names end in A (e.g. EXlA) anneal to the 5’.region of the noncoding strand of the CHO DHFR gene, and primers whose names end in B anneal to the 3’-region of the coding strand. Primers for exon amplification are labeled EX, with the number corresponding to the respective exon. Primer CH03’ was used for first strand cDNA synthesis in conjunction with CH05’ for amplification. All primers are written from 5’ + 3’: EXlA, cgccaaacttgggggaagca; EXlB, gccaagtgctcgacccgatt; EXSA, cctgtta- acgcagtgtttctc; EXPB, cccacgggagacttcgcact; EX3A, caatggtatcttgcc- tgtgtatgaca; EX3B, agatctgttttcttgtggtg; EX4A, atcagattacctgactagtat; EX4B, gataatgtgctgcttcctgt; EX5A, aatcttctagtctctttgtctttcaacatgg- gttaa; EX5B, cttctgtaattagtctctaa; EXGA, aagtcatgtgtcttcaatggg; EXGB, agaataactcatagatctaa; CH03’, gaacttgaagtcaatcagcaagtatctt; and CH05’, caaacttgggggaagca.

In Vitro DNA Amplification-Genomic DNA or DNA from first strand cDNA synthesis was used as template for amplification using the Thermus aquaticus (TuqI) heat-stable DNA polymerase as de- scribed previously (22,23). Generally, one-fifth of the cDNA reaction (10 ~1) or 1 pg of genomic DNA was used. Amplifications were performed in siliconized tubes in a 50-~1 solution containing 50 mM potassium chloride, 10 mM Tris, pH 8.4, 2.5 mM magnesium chloride, 300 ng of each primer, a 200 PM-concentration of each deoxyribonu- cleotide trinhosnhate (dATP. dCTP. TTP. and dGTP). 10 ug of gelatin/ml,&and 4 units’of TaGI DNA’polymkrase. The samples’ were overlaid with 50 ~1 of mineral oil to prevent condensation and were subjected to 30 cycles of amplification. The cycling reaction was performed in a programmable heat block (DNA Thermal Cycler, Perkin-Elmer/Cetus Instruments) set to heat the samples to 94 “C for 1 min. to cool them to 53 “C over 1 min, and to heat them to 73 “C for 1 min. The PCR products were analyzed by nondenaturing agarose gel electrophoresis. Approximately 10% of the amplification reaction was electrophoresed on a 1.5% Tris/borate/EDTA-agarose gel in the presence of ethidium bromide.

Generation of Single-stranded DNA via Asymmetric PCR-If the majority of the PCR product analyzed by gel electrophoresis was distinct (one band, no smear, total yield of 100 ng to 20 pg), it was washed three times with 2 ml of Hz0 in a Centricon 100. Approxi- mately one-tenth of the dialyzed material was used as a template for the asymmetric PCR with a 150 ratio of primers (6:300 ng). The asymmetric PCR temperatures and times were identical to those of the symmetric PCR. If multiple bands from the initial PCR reaction

were present, the band of interest was excised from the agarose gel and “GeneCleaned” (Bio-101, La Jolla, CA).

Manual Direct DNA Sequencing-The asymmetric PCR product was washed three times with 2 ml of H20 in a Centricon 100, and approximately 20% of the eluate was used for direct manual sequenc- __ ing. DNA sequencing was done by the dideoxy chain termination sequencing method (24) using a modified bacteriophage T7 DNA polymerase (25) as described (26).

RESULTS

In Vitro Amplification and DNA Sequencing of DHFR Gene and Transcript-In uitro amplification of the entire peptide coding region of the CHO DHFR cDNA for both cell lines is shown in Fig. 1 (lower). The primers used for amplification of the cDNA anneal to the 5’- and 3’-untranslated regions of the transcript and do not overlap with the translated region. In addition, genomic DNA was specifically amplified for the six DHFR exons for both cell lines. The amplification product was verified by direct DNA sequence analysis. All TaqI DNA amplification reactions were run with controls to ensure that no contaminating templates were introduced from unintended sources.

Because of the greater ease in sequencing single-stranded DNA, we have taken advantage of the “asymmetric PCR technique” (27) after performing a conventional amplification reaction. Two mutations were found: a C + T transition at nucleotide 67, resulting in the substitution of phenylalanine for leucine at codon 22 (Fig. 1, upper; and Fig. 2), and a C + G transition at nucleotide 434, resulting in the substitution of serine for threonine. This was confirmed on the genomic level by amplifying and directly sequencing the respective exons (Fig. 3). Silent mutations were noted and are listed in Fig. 4.

Demonstration of Loss of BsaI Site in DHFR cDNA Mtx “” Cell Line-The mutation at nucleotide 67 causes a loss of the recognition site for the restriction enzyme BsaI. Genomic

codon # 19 20 21 22 23 24

ma I

Pro -3 AAC GGA GAC CTT CCC TGG LW

protein Am Gly ASP 1 Pro Trp Phe

Mtx “” AAC GGA GAC TTT CCC TGG

FIG. 1. Nonde Iectrophoresis of in vi- tro amplified cDNAs. The CHO cDNA was selectively amplified by the PCR to give a 600-base pair fragment (lanes I and 2). This was then digested with BsaI (an isoschizomer of PpaI (lanes 3 and 4); sequence recognition site is shown upper), which cuts the wild-type cDNA between nucleotides 62 and 67. The result of the C + T transition is the loss of the BsaI site in the Mtxk”’ cell line. Lane M contains 0.5 fig of phage 4x174 DNA digested with Hue111 used as a size marker. Lanes I and 3 represent the amplified product of the CHO Pro-3 DHFR cDNA; lanes 2 and 4 represent the amplified product obtained from the Mtxs” DHFR cDNA.

by guest on Novem

ber 25, 2020http://w

ww

.jbc.org/D

ownloaded from

Altered DHFR Gene in the CHO Pro-3 MtXH”’ Cell Line

i

5’ A C G T A C T

Pro -3

FIG. 2. Direct DNA Sequencing of CHO Pro-3 and MtxRu’ cDNAs. mRNA from cells was reverse-transcribed and amplified in citra using symmetric and asymmetric PCRs. A single point mutation is seen at nucleotide 67 (C + T), resulting in the substitution of phenylalanine for leucine. Sequence analysis indicated that this base transition results in the loss of a BsaI site in Mtxs”’ cells, which was confirmed by restriction digests (see Fig. 1).

3’

C T T C (“3 C A G 4

A C c T A C G T

Pro -3 MtxR”’

FIG. 3. Direct DNA sequencing of CHO Pro-3 and Mtxa”’ genomic DNAs. Amplification in vitro of the coding region of exon 1 was accomplished using symmetric and asymmetric PCRs. A single point mutation is seen at nucleotide 67 (C -+ T), resulting in the substitution of phenylalanine for leucine.

DNA from both cell lines was poorly digested by this enzyme, and Southern detection was not successful. In vitro amplified Pro-3 cDNA was efficiently cut with BsaI (Fig. 1, lane 3). The amplified 600.base pair fragment was cleaved by the restric- tion enzyme to give a faster migrating product. In contrast, the MtxR1” cDNA was not cut by BsaI (Fig. 1, lane 4).

Binding Kinetics for Mtx R”’ Cell Line-The MTX K, for the MtxR1” enzyme (0.19 nM) was determined by measuring the steady-state reaction velocity as a function of inhibitor concentration. The data were fit by nonlinear least-squares regression to equations for tight binding inhibitors which take into account the depletion of free inhibitor when the concen- trations of inhibitor and enzyme are of the same magnitude (17). A value of 0.5 pM was determined for the dihydrofolate Km for the MtxR”’ cell line (data not shown) and was used in the above fitting routine. Although an exact MTX K, for the parental Pro-3 CHO cell line has not been determined, MTX K, values for wild-type mammalian DHFRs, when determined in a manner similar to the one used in this study, have consistently been found to be in the single picomolar range (17, 28, 29). It is reasonable to conclude therefore that the MtxR1” DHFR binds MTX approximately loo-fold less tightly than does the wild-type enzyme.

DISCUSSION

In 1976 and 1980, Flintoff et al. (14, 15) described a series of CHO cell lines which were resistant to MTX. Studies with crude extracts from Class I cells suggested that resistance was due to a mutated DHFR with altered MTX binding properties. Class III cells were derived from Class I cells by another round of selection in an increased concentration of MTX and ap- parently had increased levels of the altered enzyme found in Class I cells. The DHFR gene in Class III cells was amplified approximately 5-17-fold and had no major rearrangements as detected by restriction digest and Southern blotting (16). Although the MtxR1” cell line is similar to other cell lines

FIG. 4. Nucleotide and deduced amino acid sequences of MtxR”’ cDNA. The sequences of homologous amino acids from wild- type mouse (35, 36) and human (35) DHFRs are aligned for compar- ison. The nucleotide sequence (written above the sequence) is num- bered such that the first base of the ATG start codon is base 1, whereas the first amino acid in the protein (amino acid sequence numbered on the side) is considered to be the valine residue found immediately after the initiating methionine (32). Diamonds indicate intron/exon junctions and their corresponding locations on the pro- tein. Arrows indicate bases at which mutations produced amino acid substitutions. In addition to the two mutations noted at positions 67 and 434, sequences were identical to those published by Melera et al. (11) and Carothers et al. (21) with the following exceptions. In MtxR”‘, at positions 66, 148,493,502, and 513 are C, C, G, T, and G instead of T, T, A, C, and A for the Chinese hamster lung pDHFR A3-35 DHFR cDNA and at positions 27 and 171 are C and C instead of G and T for wild-type Chinese hamster ovary cells, respectively.

which have undergone stepwise selection in increasing con- centrations of MTX (amplification of DHFR on the DNA, RNA, and protein levels), the level of resistance does not reflect the degree of DHFR amplification. Most cell lines which have exhibited a degree of MTX resistance similar to that of MtxR1” cells have been found to have a much greater level of gene amplification (loo-200-fold), suggesting that MtxR1” cells are highly resistant to MTX by more than just gene amplification. Subsequently, studies were carried out on purified DHFRs from MTX-sensitive Class I and III resistant cells; these studies demonstrated that DHFRs from Class I and III cells were indeed indentical and had a lowered affinity for MTX. We have also found that the MtxR”’ DHFR has significantly higher values for the kinetic inhibition constants (Ki) for MTX as well as the antifolates trimetrexate and trimethoprim (data not shown) than wild-type mammalian DHFRs; other catalytic properties of the MtxR”’ enzyme ap- pear to be relatively unchanged (data not shown). It is inter- esting to note that the K, for the MtxK”’ DHFR phenylalanine 22 mutant (0.19 nM) is nearly identical to the Ki values obtained for a human DHFR with a serine mutation at residue

by guest on Novem

ber 25, 2020http://w

ww

.jbc.org/D

ownloaded from

FIG. 5. Molecular modeling of dihydrofolate reductase ac- 5. Haber, D. A., Beverley, S. M., Kiely, M. L., and Schimke, R. T. -

tive site at leucine 22. Graphics were displayed on an Evans & (1981) J. Biol. Chcm. 256, 9501-9510 Southerland PS300 system. MTX and its van der Waals surface are 6. Srimatkandada, S., Medina. W. D., Cashmore, A. R., Wh.yte, W., shown in red and folate in \.el/ow. Engel, D., Moroson, B. A., France, C. T., Dube, S. K., and

Bertino, J. R. (1983) Biochemistry 22, 5774-5781 31 that is also associated with a MTX-resistant phenot.ype 7. Milhrandt, J. D., Heintz, N. H., White, W. C.. Rothman, S. M., (12, 13). and Hamlin, J. L. (1981) Proc. Nat/. Acad. Sci. U. S. A. 78,

In vitro amplification of the DHFR cDNA and exons and 6043-6047

direct DNA sequencing confirmed that the high degree of 8. Simonsen, C. C., and Levinson, A. D. (1983) Proc. Natl. Acad.

MTX resistance exhibited by MtxR”’ cells was due to expres- Sci. L: S. A. 80, 2495-2499

sion of an altered DHFR. Direct DNA sequencing of the 9. Stammers, D. K., Champness, J. N., Beddell, C. R., Dann, ,J. G.,

DHFR gene from Mtxk”’ Eliopoulos, E., Geddes, A. <J., Ogg, D., and North, A. C. (1987)

cells on both the mRNA and ge- FEBS L&t. 218,178-184 nomic levels revealed t.wo differences from the nucleotide 10. Melera, P. W., Davide, J. P., and Oen, H. (1988) J. Biol. Chem. sequence previously reported for the coding region of the 263, 1978-1990

CHO lune DHFR (11). These differences are the substitution 11. Melera, P. W., Davide, .J. P., Hession. C. A., and Scotto, K. W.

of serine for threonine at residue 144 and the substitution of (1984) Mol. Cell. Biol. 4, 38-48

phenylalanine for leucine at residue 22. Several pieces of 12. Srimatkandada, S., Schweitzer. B. I., Moroson, B. A., Dube, S.,

and Bertino, J. R. (1989) J. Biol. Chem. 264,3524-3528 evidence suggest that the mutation at residue 22 is solely 13. Schweit.zer, B. I.? Srimatkandada, S., Gritsman, H., Sheridan, R., responsible for the altered properties of the DHFR in Mtx”“’ Venkataraghavan, R. B., and Bertino, d. R. (1989) J. Biol. cells. First, the serine mutation at residue 144 was also found Chem. 264,20786-X0795 in the DHFR gene of the parental MTX-sensitive Pro-3 cell 14. Flintoff, W. F., and Essani, K. (1980) Biochemistn, 19, 4321-

line. Second, in the x-ray structures of all vertebrate DHFRs 4327

determined to date, the side chain of residue 144 is not located 15. Flintoff, W. F., Davidson, S. V., and Siminovitch, L. (1976)

Somatic CeI1 (Tenet. 2, 245-261 in either the NADPH- or folate-binding site; in contrast, 16. Flintoff, W. F., Weber, M. K., Nagainis, C. R., Essani, A. K., leucine 22 is located in the folate-binding site, interacts hy- Robertson, D., and Salser, W. (1982) Mol. Cell. Biol. 2, 275- drophobically with bound inhibitors, and is conserved in all “85

sequenced vertebrate DHFRs (30, 31). Finally, mutations at 17. Appleman, J. R.. Beard, W. A., Delcamp, T. .J., Prendergast, N.

leucine 22 have been previously reported to be associated with .J., Freisheim, J. H., and Blakley, R. L. (1989) J. Biol. Chem.

MTX resistance in mammalian cells. As mentioned previ- 264, “625-2633

18. Higuchi, R. (1989) in PCR Technology (Erlich, H. A., ed) pp. 31- ously, an arginine mutation at residue 22 in the mouse DHFR 38. Stockton Press, New York produced a 240-fold increase in t,he MTX &. It is int.eresting 19. Badley, J. E.. Bishop, G. A.. St. John, T., and Frelinger, J. A.

to note that another phenylalanine mutation at residue 22 (1988) Hiotechrtiyues 6, 114-116

was found in the DHFR from a completely different Chinese 20. Payvar, F., and Schimke, R. T. (1979) J. Biol. C’h.em. 254, 7636-

hamster cell line; this enzyme was reported to have a 20-fold 7642

higher Is,, for MTX than enzyme from drug-sensitive-cells 21. Carothers, A. M.. Steigerwalt, R. W., Urlaub, G., Chasin, L. A.,

and Grunberger, D. (1989) J. Mol. Rio/. 208, 417-428 (11). The conservative threonine - serine change could be “2. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi,

8320 Altered DHFR Gene in. the CHO Pro-3 MtX”“’ Cell Line

accounted for by t.issue differences in the two cell lines. Fig. 5a shows a three-dimensional model of the active site

of the human DHFR, this model was constructed as previously described (13). A comparison of this model with the recently published structure of the murine DHFR (9) also reveals a high degree of homology between these t.wo structures. As shown Fig. 5, the side chain of leucine 22 makes contact with the van der Waals surface of bound MTX; a similar contact is seen in the published structures of the chicken, mouse, and human enzymes, indicating a highly conserved hydrophobic interaction between the enzyme and the bound ligand (9, 32- 34). Fig. 56 shows a model of the enzyme in which the leucine (white) and phenylalanine (green) are superimposed at residue 22. It can be seen in this view that the side chain of phenyl- alanine protrudes into and overlaps with the van der Waals surface of bound MTX. A steric clash of this sort would presumably raise the energy of the interaction and weaken the binding of the ligand.

Ackmu~ladgments-We would like to thank Drs. Gail Urlaub and Larry Chasin for their advice and assistance and Drs. Robert Sheridan and Rengachari Venkataraghavan for their help with the molecular graphics.

REFERENCES

1. Alt. F. W., Kellems, R. E., Bertino, J. R., and Schimke. R. T. (1978) <J. Viol. Chem. 253, 1357-1370

2. Dolnick, B. J., Berenson, R. .J., Bertino, J. R., Kaufman, R. J., Nunberg, J. H., and Schimke, R. T. (1979) J. Cell Eiol. 83, 394-400

3. Melera, F. W., Lewis, J. A., Biedler. J. L., and Hession, C. (1980) J. Biol. Chem. 255, 7024-7028

4. Bostock, C. .J.. and Tyler Smith, C. (1981) J. Mol. Rio/. 153, 219-236

by guest on Novem

ber 25, 2020http://w

ww

.jbc.org/D

ownloaded from

Altered DHFR Gene in the CHO Pro-3 MtXR”’ Cell Line 8321

R., Horn, G. T., Mullis, K. B., and Erlich, H. A. (1988) Science 239,487-491

23. Mullis, K., Faloona, F., Scharf, S., Saiki, R., Horn, G., and Erlich, H. (1986) Cold Spring Harbor Symp. Quant. Biol. 51,263-273

24. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. N&l. Acad. Sci. U. S. A. 74,5463-5467

25. Tabor, S., and Richardson, C. C. (1987) Proc. Natl. Acad. Sci. U. S. A. 84,4767-4771

26. Dicker, A. P., Volkenandt, M., Adamo, A., Barreda, C., and Bertino, J. R. (1989) Biotechniques 7,830-838

27. Gyllensten, U. B., and Erlich, H. A. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 7652-7656

28. Jackson, R. C., and Niethammer, D. (1977) Eur. J. Cancer 13, 567-575

29. Thillet, J., Absil, J., Stone, S. R., and Pictet, R. (1988) J. Biol. Chem. 263,12500-12508

30. Matthews, D. A., Alden, R. A., Bolin, J. T., Freer, S. T., Hamlin,

R., Xuong, N., Kraut, J., Poe, M., Williams, M., and Hoogsteen, K. (1977) Science 197, 452-455

31. Blakley, R. L. (1984) in Folates and Pterins (Blakley, R. A., and Benkovic, S. J., eds) pp. 191-254, John Wiley & Sons, New York

32. Volz, K. W., Matthews, D. A., Alden, R. A., Freer, S. T., Hansch, C., Kaufman, B. T., and Kraut, J. (1982) J. Biol. Chem. 257, 2528-2536

33. Matthews, D. A., Bolin, J. T., Burridge, J. M., Filman, D. J., Volz, K. W., Kaufman, B. T., Beddell, C. R., Champness, J. N., Stammers, D. K., and Kraut, J. (1985) J. Biol. Chem. 260, 381-391

34. Oefner, C., D’Arcy, A., and Winkler, F. K. (1988) Eur. J. Biochem. 174,377-385

35. Nunberg, J. H., Kaufman, R. J., Chang, A. C., Cohen, S. N., and Schimke, R. T. (1980) Cell 19,355-364

36. Crouse, G. F., Simonsen, C. C., McEwan, R. N., and Schimke, R. T. (1982) J. Biol. Chem. 257,7887-7897

by guest on Novem

ber 25, 2020http://w

ww

.jbc.org/D

ownloaded from

A P Dicker, M Volkenandt, B I Schweitzer, D Banerjee and J R BertinoMtxRIII.

gene from the methotrexate-resistant Chinese hamster ovary cell line Pro-3 Identification and characterization of a mutation in the dihydrofolate reductase

1990, 265:8317-8321.J. Biol. Chem. 

  http://www.jbc.org/content/265/14/8317Access the most updated version of this article at

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/265/14/8317.full.html#ref-list-1

This article cites 0 references, 0 of which can be accessed free at

by guest on Novem

ber 25, 2020http://w

ww

.jbc.org/D

ownloaded from