ICAR Networking Project on “Application of Microorganisms ...
Transcript of ICAR Networking Project on “Application of Microorganisms ...
Indian Council of Agricultural ResearchNATIONAL BUREAU OF AGRICULTURALLY
IMPORTANT MICROORGANISMS
Understanding and conserving our national heritage of agriculturally impor tant microorganisms
je°^erÙe ke=âef<e GheÙeesieer met#cepeerJe yÙetjesYeejleerÙe ke=âef<e DevegmebOeeve heefj<eo
Annual Report 2010-11Jeeef<e&keâ ØeefleJesove 2010-11
Nodal Centre of AMAAS
ICAR Networking Project on “Application of Microorganisms inAgriculture and Allied Sectors”
Published by
Dilip K. AroraNational Coordinator AMAAS and Director, NBAIM, Mau
Compiled & Edited by
Alok K. SrivastavaSenior Scientist, NBAIM, MauSudheer KumarSenior Scientist, NBAIM, MauD. P. SinghSenior Scientist, NBAIM, MauMahesh S. YandigeriSenior Scientist, NBAIM, MauRenuSenior Scientist, NBAIM, Mau
Secretarial Assistance
Rakesh KumarManish Kumar JainAnchal Kumar Srivastava
Copyright © All rights reserved. No part of this report shall be reproduced or transmitted in any form by
print, microfilm or any other means without written permission of the Director, NBAIM
Contents
Diversity analysis of Bacillus and Bacillus-derived genera in the Indo-Gangetic plains of India
Development of diagnostic kit (PCR based) for the identification of soil microbe (Bacillus and Pseudomonas)
Diversity analysis of microbes in extreme conditions
Diversity of actinomycetes from Indo-gangetic plain
Mapping, assessment of the geographical distribution and in vitro conservation of agriculturally important microorganisms for the Western Ghats of India
Diversity of agriculturally important microorganisms in the Western Ghats of Kerala
Isolation, purification, identification and molecular assessment of microbial diversity from selected districts of Indo – Gangetic Plain
Agriculturally important microorganisms from soils of rice-based cropping system from agro-ecological zones of east coast of India
Microbial diversity analysis from different brackishwater system of East Coast of India
Isolation of microorganisms from fermented dairy foods and sequencing of 16S rDNA for strain identification.
Strengthening, authentication and exploitation of mushroom biodiversity at the National Mushroom Repository for Human welfare
Exploring bacterial diversity in Kutch eco-region of gujarat for agricultural and industrial applications
Isolation and characterization of Flavobacterium species from fish and aquatic environment
Exploration and screening of rainfed ecosystem microbial diversity
Diversity of diazotrophic bacteria in arid zone soil under extreme environments
PI : Dilip K. AroraNational Bureau of Agriculturally Important Microorganisms, Mau
PI : Dilip K. AroraNational Bureau of Agriculturally Important Microorganisms, Mau
PI : Dilip K. AroraCo-PI :National Bureau of Agriculturally Important Microorganisms, Mau
Alok K. Srivastava, Sudheer Kumar, Mahesh Yandigeri
PI : Dilip K. AroraCo-PI : Mahesh YandigeriNational Bureau of Agriculturally Important Microorganisms, Mau
PI : Dr. A. R. AlagawadiCo-PI : P. U. Krishnaraj, K. S. Jagadeesh, R. Vasudeva Department of Agricultural Microbiology, UAS, Dharwad
PI : D. GirijaCo-PI : Sally K. Mathew, K. Surendra GopalKerala Agricultural University, Kerala
PI : L. C. RaiDepartment of Botany, Banaras Hindu University, Varanasi
PI : T. K. AdhyaCo-PI : T. K. DangarCentral Rice Research Institute, Cuttack
PI : T. C. SantiagoCo-PIs : N. Kalaimani, S. V. AlavandiCentral Institute of Brackishwater Aquaculture, Chennai
PI : Dinesh KumarNational Bureau of Animal Genetic Resources, Near GT Road, Karnal-132001
PI : R. C. UpadhyayNational Research Centre for Mushroom, Solan, H. P.
PI : K. K. PalCo PIs : R. DeyDirectorate of Groundnut Research, Junagadh, Gujarat
PI : Gaurav RathoreNational Bureau of Fish Genetic Resources, Lucknow
PI : Kiran SinghMaulana Azad National Institute of Technology, Bhopal
PI : Rajesh GeraCo PI : Kamlesh Kukreja Department of Microbiology, CCSHAU, Hisar, Haryana
Preface
Executive Summary
AMAAS : Themes
1.
2.
3.
Project wise Significant Achievements for the Year 2010-11
Theme : Microbial Diversity and Identification
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
1
2
4
7
7
8
8
11
12
13
14
16
17
18
20
21
22
23
Biodiversity, characterization and conservation of cyanobacteria of Indo-Burma Biodiversity hotspots (NE Zone of India) for harnessing of value added products
Exploitation of plant growth promoting rhizobacteria for sustainable agriculture
Exploration and screening of fungal diversity in North-East India and their applications in agriculture
Exploration of plant pathogenic and antagonistic microbial resources associated with vegetable and spice crops of Andaman and Nicobar Islands
Mapping, assessment of geographical distribution and in vitro conservation of agriculturally important microorganisms of the Western Ghats
Isolation and characterization of microorganisms from fresh water ecosystems
Diversity analysis of diazotrophic bacteria from wheat cropping system of different agroclimatic zones of Punjab
Microbial diversity and identification: fish microbes
Diversity, genetic improvement and cultivation of the medicinal mushroom Reishi (Ganoderma lucidum)
Diversity of lactic acid bacteria in fermented food and dairy products from food and dairy units located in Southern Rajasthan
Development of a library of putative probionts from freshwater environment belonging to the group lactic acid bacteria for application in freshwater aquaculture system
PI : O. N. TiwariCo PI : Sunil S. ThoratInstitute of Bioresources and Sustainable Development, Imphal, Manipur
PI : Ashok KumarCo PIs : M. B. Tyagi, R. P. SinhaSchool of Biotechnology, Banaras Hindu University, Varanasi
PI : Bhim Pratap SinghDepartment of Biotechnology, Mizoram University, Aizawl, Mizoram
PI : Krishna KumarCentral Agricultural Research Institute, Port Blair, Andaman & Nicobar Islands
PI : D. RadhakrishnaCo-PI : B. C. MalleshaUniversity of Agricultural Sciences, GKVK, Bangalore
PI : N. K. MaitiCo-PI : Sri Prakash MohantyCentral Institute of Freshwater Aquaculture, Bhubaneswar, Orissa
PI : S. K. GosalCo-PIs : G. S. Saroa, Yogesh VikalPunjab Agricultural University, Ludhiana, Punjab
PI : Imelda JosephCentral Marine Fisheries Research Institute, Ernakulam, Cochin, Kerala
PI : R.D. RaiCo-PI : Ranjeet Ranjan KumarDivision of Biochemistry, Indian Agricultural Research Institute, New Delhi
PI : R. SrinivasanCo PIs : P. Subramanian, N. S. RathoreCollege of Dairy and Food Science Technology, Maharana Pratap University of Agriculture and Technology, Udaipur, Rajasthan
PI : Sri Prakash MohantyCo PI : N. K. MaitiCentral Institute of Freshwater Aquaculture, Bhubaneswar, Orissa
Exploration and screening of bacteria diversity in North-East India and its potential application in biocontrol
Collection, identification and characterization of microbial diversity of North Bengal
PI : Ratul SaikiaCo PI : T. C. BoraBiotechnology Division, North East Institute of Science & Technology (CSIR), Jorhat, Assam
PI : B. N. ChakrabortyCo PI : U. ChakrabortyUniversity of North Bengal, Darjeeling, West Bengal
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
25
25
27
29
30
31
32
33
34
35
36
38
38
39
Exploration, collection and characterization of some agriculturally important biocontrol agents suitable for disease management
Evaluation of endophytic fungus for growth promotion and biocontrol
PI : Dilip K. AroraCo-PIs : Alok K. Srivastava, Sudheer KumarNational Bureau of Agriculturally Important Microorganisms, Mau
PI : Alok K. Srivastava Co-PI : Sudheer KumarNational Bureau of Agriculturally Important Microorganisms, Mau
Theme :Nutrient Management, Biocontrol and PGPR
33.
34.
35.
41
42
43
Exploration and screening of microbial diversity of Bihar and their potential application
PI : V. K. ShahiCo PIs : Dayaram, Subodh K. SinhaRajendra Agricultural University, Samastipur, Bihar
Biocontrol of soil borne plant pathogen and growth promotion in vegetable crops
PI : Sudheer KumarCo PI : Alok K. SrivastavaNational Bureau of Agriculturally Important Microorganisms, Mau
Development of a cold tolerant phosphate solubilizing cacterial (PSB) inoculant
Development and application of PGPR formulations for growth Improvement and disease suppression in coconut and cocoa
Microbial control of insect pests
Developing PGPR consortia for enhanced crop and soil productivity of rice -wheat cropping system
Structural and functional dynamics of the microbial isolates in biogeochemical cycling of C, N, P and S in rice ecosystem
Nutrient dynamics and carbon sequestration in plant mycorrhizal systems
Harnessing agriculturally beneficial microorganisms for production and protection of sorghum and rice
Important diseases and pests of sunflower, safflower and castor
Isolation, identification, evaluation and exploitation of microorganisms for management of important plant pathogens and having PGPR potential for vegetable crops
Bioprospecting for viticulturally important microorganisms
Isolation and development of plant growth promoting organisms from high biodiversity region for tropical tuber crops
Development of a library putative probionts from marine environment belonging to the genus Pseudomonas,
Micrococcus and Bacillus for application in mariculture systems
Plant growth promoting rhizobacteria (PGPR) for chickpea and pigeonpea
Microbial phosphorus transformations in inland open waters
PI : Pankaj K. MishraCo PI : K. JeevanandanVivekananda Parvatiya Krishi Anusandhan Sansthan, Almora
PI : M. AnandarajCo PI : R. Dinesh, A. Kumar, N. K. Leela Indian Institute of Spices Research, Calicut, Kerala
PI : George V. ThomasCo PIs : Alka Gupta, Murali Gopal, R. Chandra MohananCentral Plantation Crops Research Institute, Kudlu P.O., Kasaragod, Kerala
PI : B. RamanujamCo PI : S. Sriram National Bureau of Agriculturally Important Insects, Bangalore
PI : LataCo PI : Radha PrasannaIndian Agricultural Research Institute, New Delhi
PI : T. K. AdhyaCo PI : P. BhattacharyyaCentral Rice Research Institute, Cuttack
PI : K. S. SubramanianCo PI : M. ThangarajuTamil Nadu Agricultural University, Coimbatore
PI : S. GopalakrishnanCo PI : G. V. Ranga RaoInternational Crops Research Institute for Semi-Arid Tropics, Patancheru, A. P.
PI : R. D. Prasad Co PIs : M. A. Raoof, M. Santha Lakshmi Prasad, P. S. Vimala Devi Directorate of Oilseeds Research, Rajendranagar, Hyderabad
PI : M. LoganathanCo PIs : S. Saha, A. B. RaiIndian Institute of Vegetable Research, Varanasi
PI : Indu S. Sawant Co PI : S. D. SawantNational Research Centre for Grapes, Pune
PI : M. L. JeevaCo PI : Susan John K., R. S. Misra, S. S. VeenaCentral Tuber Crops Research Institute, Sreekariyam, Thiruvananthapuram
PI : K. K. VijayanCo PIs : Subhadeep Ghosh, Kajal ChakrabortyCentral Marine Fisheries Research Institute, Cochin, Kerala
PI : Mohan SinghCo PI : R. G. ChaudharyIndian Institute of Pulses Research, Kanpur
PI : Sanjib Kumar MannaCo PIs : Srikanta Samanta Central Inland Fisheries Research Institute (ICAR), Barrackpore, Kolkata
Application of AIMs for nutrient management & plant growth promotion in rainfed agro-ecosystems
PI : Suseelendra Desai Co PI : Minakshi GroverCentral Research Institute for Dryland Agriculture, Hyderabad
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
44
45
46
47
49
50
52
53
55
56
57
58
59
60
62
63
64
65
Isolation, identification, evaluation and exploitation of PGPR for spices
Improving yields and nutrient uptake of selected crops through microbial inoculants in vertisols of Central India
PI : D. L. N. RaoCo PI : M. C. MannaIndian Institute of Soil Science, Nabi Bagh, Bhopal
Basic and applied investigations on endophytic microorganisms in horticultural crops
PI : P. ThomasCo PI : M. Krishna ReddyIndian Institute of Horticultural Research, Bangalore
Harnessing arbuscular mycorrrhizae for biofertilization in horticultural crops
PI : George V. ThomasCo PIs : Alka Gupta, Murali Gopal, R. ChandraMohanan, Alok K. Srivastva, S. K. Singh, V. B.
Patel, Anil K. Sharma, Sukhada Mohandas, V. V. Sulladmat, P. Panneerselvam, R. Thangavelu, K. K. Kumar, Rajesh Kumar
Central Plantation Crops Research Institute, Kasaragod, Kerala
Assessing structural and functional shifts in soil microbial communities of paper mill effluent contaminated soils and utilization of microflora for crop growth promotion in these soil
Bioremediation of polycyclic aromatic hydrocarbons (PAH) through microbial consortia
Genotyping and isolation of sphingomonads from HCH contaminated agricultural soils and theirapplication in bioremediation
Refinement in indoor compost technology for white button mushroom using thermophilic organisms
Optimization of parameters for utilization of paddy straw, kinnow pulp and pea pods for production of cellulases, ethanol and feed supplements
Bioremediation of commonly used pesticides in tropical rice ecosystem
Development of bacterial consortia for bio-processing agricultural wastes and bioremediation of aquaculture effluents
Microbial bioremediation of wastewater for heavy metals
Bioremediation of effluents from shrimp farms
Assessment of nisin production in selected strains of LAB and market acceptability
Fermented products from fruits, vegetables and Cereals
Utilization of fruit processing waste for obtaining value added products through fermentation
PI : Dilip K. AroraCo PI : K.K. MeenaNational Bureau of Agriculturally Important Microorganisms, Mau
PI : LataCo PI : Anju Arora, Shashi Bala SinghIndian Agricultural Research Institute, New Delhi
PI : Rup LalDepartment of Zoology, University of Delhi, Delhi
PI : B. VijayDirectorate of Mushroom Research, Chambaghat, Solan
PI : H. S. OberoiCo PIs : V. K. Bhargav, Pranita JaiswalCentral Institute of Post- Harvest Engineering and Technology, Ludhiana
PI : T. K. AdhyaCo PI : T. K. DangarCentral Rice Research Institute, Cuttack
PI : C. S. PurushothamanCo PIs : P. K. Pandey, A. VennilaCentral Institute of Fisheries Education, Mumbai
PI : P. K. Joshi Co-PI : L. BatraCentral Soil Salinity Research Institute, Karnal
PI : S. V. AlavandiCo PIs : T. C. Santiago, N. Kalaimani, K. K. VijayanCentral Institute of Brackishwater Aquaculture, Chennai
PI : Sudhir SinghCo PI : Major SinghIndian Institute of Vegetable Research, Varanasi
PI : S. GunasekaranCo PIs : R. Murugesan, K. Vijila, S. KarthikeyanTamil Nadu Agricultural University, Coimbatore
PI : Neelima GargCo PI : M. Muthukumar Central Institute for Subtropical Horticulture, Lucknow
Theme : Microbial Management of Agrowaste, Bioremediation, Microbes in Post Harvest and Processing
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
69
70
71
72
73
75
77
78
79
80
82
83
Development of microbial consortium for alleviation of salt and drought stress for growth and yield of wheat
PI : Dilip K. AroraCo- PI : Kamlesh Kumar MeenaNational Bureau of Agriculturally Important Microorganisms, Mau
Theme: Microbial Management of Abiotic Stress
67.
68.
69.
86
87
88
54. 67
Utilization of actinomycetes to alleviate salt and drought stress in cereal crops
PI : Mahesh YandigeriCo- PI : Kamlesh Kumar MeenaNational Bureau of Agriculturally Important Microorganisms, Mau
Isolation, inventorization and field assessment of agriculturally important microorganisms in the stress ecosystems of Karnataka
PI : A. R. AlagawadiCo PIs : P. U. Krishnaraj, K. S. Jagadeesh, S. G. PatilUniversity of Agricultural Sciences, Dharwad
Complete genome sequencing of Mesorhizobium ciceri Ca 181
Genomic studies of uncultivated N fixing communities from 2
Uttarakhand
Structural Genomics of Mesorhizobium ciceri Ca 181
Genome analysis of the nitrogen-fixing symbiotic bacteriam Mesorhizobium ciceri
Functional genomic analysis of plant growth promoting rhizobacteria (PGPR) fluorescent Pseudomonads
Structural Genomics of Mesorhizobium ciceri Ca181
Mining for genes involved in the production of fungicidal compounds in Anabaena strains
LPSomics : Characterization of lipolysaccharide (LPS) biosynthetic gene clusters in xanthomonad pathogens of plants
Cloning and characterization of insecticidal crystal protein (cry)
gene from the local isolates of Bacillus thuringiensis
PI : Dilip K. AroraCo- PI : Alok K. SrivastavaNational Bureau of Agriculturally Important Microorganisms, Mau
PI : Reeta GoelG. B. Pant University of Agri. and Tech., Pantnagar
PI : Major SinghIndian Institute of Vegetable Research, Varanasi
PI : K.V.BhatCo PI : A. B. Gaikwad, Rakesh SinghNBPGR, Pusa Campus, New Delhi
PI : P. GunasekharanCo PI : K. ManoharanMadurai Kamaraj University, Madurai
PI : N. K. SinghCo PI : KanikaNational Research Centre on Plant Biotechnology, New Delhi
PI : Radha PrasannaCo PI : N. K. SinghIndian Agricultural Research Institute, New Delhi
PI : Ramesh V. SontiCo PI : Hitendra Kumar PatelCentre for Cellular and Molecular Biology, Hyderabad
PI : R. AsokanCo PI : Pious ThomasIndian Institute of Horticultural Research, Bangalore
Theme: Microbial Genomics
72.
73.
74.
75.
76.
77.
78.
79.
80.
93
94
95
96
97
98
99
100
101
Microbial Genomic Resource Repository
Theme: Human Resource Development
PI : Dilip K. AroraCo PIs : Alok K. Srivastava, Sudheer Kumar, Mahesh Yandigeri, K. K. Meena
National Bureau of Agriculturally Important Microorganisms, Mau
Theme: Microbial Genomic Resource Repository
Development of microorganism consortium to alleviate abiotic stresses like drought, high temperature and salinity in millets
Development of a bacterial consortium to alleviate cold stress
PI : Minakshi GroverCo PI : S. K. YadavCentral Research Institute for Dryland Agriculture, Santoshnagar, Hyderabad
PI : Pankaj K. MishraCo PI : K. JeevanandanVivekananda Parvatiya Krishi Anusandhan Sansthan, Almora
70.
71.
81.
82.
83.
90
91
103
105PI : Dilip K. AroraNational Bureau of Agriculturally Important Microorganisms, Mau
Name of the PIs working at different AMAAS Centers
Name of the Institute/ Project Directorate/ SAU Coordinating the Project
107
10884.
Of all the necessities of the human being, access to food has
remained central to every civilization. Ensuring the sufficient
production of food for all has remained one of the major
challenges before the farmers, scientists, policymakers and all the
stakeholders in the country in the twenty first century. The major
efforts during the past few decades are made in the development
of new high yielding crop varieties with enhanced disease and
pest resistance, greater drought and salt tolerance and better
nutritional value through the introduction of desirable traits
either by conventional breeding or genetic modification. These
efforts have remained focus on breeding of superior genotypes
and optimization of production technology. Even in these days of
modernization in the field of agricultural sciences, what is less
appreciated and less well understood is the pervasive influence
that other microbes have on plant health and growth in enhancing
stress tolerance, providing disease resistance, aiding nutrient
availability and uptake to the soil and promoting biodiversity. A
greater understanding of how plants and soil microbes live
together and benefit each other can therefore, provide new
strategies to improve plant productivity while helping to protect
the environment and maintain global biodiversity.
as many of them are the key players in the
improvement of the ecosystem while many are the causal agents
of serious plant diseases which further lower crop production
and food quality.
Besides
all the important services microbial communities provide, their
role has largely been ignored in the near past.
Microorganisms can play a pivotal role in solving many of
the problems of modern agriculture and can be equally beneficial
for human health, food, environment and poverty alleviation.
They are vital living components of the biodiversity on the earth
that can contribute to valued ecological services and economics of
any country
They are fundamentally important for
ecosystem functioning, nutrient recycling, breaking down
complex animal and plant residues in the soil and thus releasing
essential nutrients for plant growth. They form beneficial
mutualistic relationships with various plants, for example,
nitrogen-fixing rhizobia with leguminous plants and mycorrhiza
with forest trees. They can be harnessed for producing valuable
drugs, being used as biocontrol agents for pests and pathogens as
well as in breaking-down and detoxification of wastes. Microbes
are therefore, a key living component crucial for the ecological
harmony, ecosystem function, agricultural sustainability,
environmental wellness and human and livestock health.
This is why the task
of identification, characterization and judicious exploitation of
microbial diversity and its long-term conservation and
preservation should be the national priority for any country for
creation of sound health, wealth and societal goodness.
Microbial communities, being the most vital part of the
ecosystem function, should be managed very carefully. In nature,
microbes exist in diverse communities in the soil, air and water
1
and with and within (endosymbiotic conditions) plants. Even
with the most modern scientific approaches, we are able to
explore only <1% of the total existing microbial population on the
earth and rest is still a great challenge for us. Within this known
population, huge number of microbes are of agricultural
importance and their role beneath the soil and with the plants can
not be ignored. A first hand great task therefore, is to conserve and
make the native communities flourish in agro-ecosystem by
making the agricultural practices favourable for their growth and
proliferation which can only be done at the farmer's level who are
the major stakeholders. The conservation and management of
microbial communities in the soils is a biggest challenge before all
the stakeholders i.e. the scientists, extension workers and farmers.
This cannot be achieved without a proper well managed plan
regarding the cropping patterns, application of farm inputs and
knowledge about the native population and methods to
regenerate native microbial population. On the other hands,
scientific efforts are also required to find out and explore as much
possible microbes from the nature as can be, identify and
characterize their potentialities in agriculture and finally
conserving them for the future needs because, once lost from a
habitat, a microbe cannot again be reinstated in the natural soil.
Culture collections and genomic repositories are therefore, are
going to play a major role in conserving the most vital, tiny, often
unseen, silent but most productive living natural entities e.g. the
microbes.
“Application of Microorganisms in Agriculture and Allied
Sectors” (AMAAS) is among the most enthusiastic project of
ICAR that has initiated and strengthened the R&D efforts on
various microbe-based technologies for increasing crop
production, enhancing agrowaste usage, managing abiotic
stresses, controlling important insect pests and post harvest of
crops biologically and conserving and maintaining the real
natural wealth of the soils and other habitats i.e. the microbes.
During the past 4 years, it has also strengthened and diversified
research in the area of microbial diversity & identification,
genomics, microbial genomic repository and human resource
development in the country.
I would like to extend my sincere thanks to Dr. S. Ayyappan,
Secretary (DARE) and Director General (ICAR), Dr. S. K. Dutta,
DDG (CS) and Dr T. P Rajendran, ADG (PP) for their consistence
encouragement and valuable guidance in shaping this network
project. My sincere appreciations are also to all the Principal
Investigators and Co-investigators working at different centers
because of their outstanding efforts in making this project a big
success. The funding for this project by the Council (ICAR) is
being duly acknowledged.
Prof. Dilip K. AroraNational Coordinator AMAAS Project
Preface
AMAAS - Annual Report 2010-11
Executive Summary
Microbial communities in agriculture have very wide range
of roles to play in ecosystem management and sustainable crop
production. Their potentials can be as wide as plant health
promotion, soil nutritional balance, ecosystem function to control
of biotic and abiotic stresses increased nutrients availability and
acceleration of decomposition of organic materials and
bioremediation in order to improve crop production and
maintain sound environment for crop production. Microbial
communities also contribute in sustainable agriculture and rural
livelihood in direct or indirect manner because their presence is a
positive indicator and index of soil health and ecosystem
wellbeing. Environmental stresses such as heavy metals,
hazardous agrochemicals in the soils and water decrease
microbial diversity and therefore, contribute in structural changes
of microbial communities. In the rhizosphere, microbial
communities are reported to alleviate the salinity or drought
stress by different mechanisms and protect plants from injury,
and insect and pathogenic attack.
Majority of microbes are also associated with plants and
animals, not only as pathogens but as associative organisms as
well that mutually benefit each other. Such associations are under
strict scientific investigation in these days to get answers about
significance of the multitrophic interactions with plants and
animals and survival and performance under a given ecological
niche. The kind of interactions within the microbes and their hosts
and non-hosts and within the biotic communities and abiotic
components represent a classical ecological relationship
constitutes the basis of cooperative and constitutive livelihood in
the natures that leads to benefits in many cases but to losses in
others. The associations of microbes with the hosts and other
habitats are critical determinants for many issues related to the
quality of the ecological success, impact of environment, global
climate change, production of greenhouse gases, quality of
human, plant and animal health, and finally loss or gain in
agricultural productivity and food.
Microorganisms have great potentials to degrade and
detoxify synthetic chemicals contaminants like petroleum
products, xenobiotics including PAHs and PCBs, pesticides,
heavy metals and are therefore, utilized in bioremediation and
cleaning environmental pollution. Their ability to withstand
high-end biotic and abiotic stresses successfully as compared to
plants has made them an excellent source for various genes that
can be used to develop transgenic crop plants. The enormous
functional diversity lying with the microbes across the country
needs to be deciphered and utilized to interweave microbes in
agriculture and allied sectors. It is therefore, necessary to explore,
preserve, conserve and utilize the unique microbial flora in the
country that has fulfilled with the emergence of a centrally funded
project AMAAS for fulfilling food and nutritional needs, clean
environment and improved soil health for sustainable
production.
Microbial genomics nowadays is the backbone of every
molecular research and development programs and is an
emerging field that tends to uncover many unknown facts hidden
in the biological systems and potential applications of unseen
living majority. Great success of genome sequencing can be
witnessed from the day to day update of the knowledge on
microbial genomics that has allowed to open other avenues where
we can derive genomic information from the multitudes of
uncultivable prokaryotic species and complex microbial
populations that exist in nature. The identification of new genes
from indigenous microbes will help in development of transgenic
crops tolerant to abiotic and biotic stress.
Enormous efforts in biotechnological intervention to effect
genetic enhancement have necessitated the provision of genes,
promoters, markers, libraries in the form of DNA sequences. With
the need for provision of DNA material for molecular genetic
research, Genomic Resources Banks have valid reasons for
existence. A common repository enables researchers to access
genomic resources generated at any laboratory to facilitate
efficient use of these resources in agricultural research. The
resources in question include (i) BAC, YAC, PAC clone set from
sequencing projects; (ii) a collection of vectors contributed by
researchers; (iii) promoter DNA-fragments fused to the reporter
genes; (iv) RFLP probes for various bacteria; (v) cDNA libraries;
(vi) EST libraries; (vii) expression plasmids including binary
vectors; (viii) cloned DNA from microbes. These may also include
resources procured from external sources through mutually
agreed benefit sharing mechanisms. The Microbial Genomic
Resource Centre is created to assemble, manage as well as
generate the basic resources to meet the requirements of
anticipatory transgenic research programmes in microbes.
The major objectives of the Network project are:
· Deciphering the structural and functional diversity of
agriculturally important microorganisms and to develop
“microbial map” of the country.
· Improving nutrient use efficiency through microbial
interventions for sustainable crop production and
maintenance of soil health.
· Characterization of plant growth promoting rhizobacteria
and to develop bioconsortium for enhanced growth and
yield of important crop plants.
· Formulation of microbe or microbe-based preparations for
biocontrol of phytopathogens, insect pests and weeds.
· Development of microbe-based technologies for agrowaste
management and biodegradation for sustainable crop
production.
· Harnessing microbial activities for bioremediation of organic
and inorganic environmental pollutants.
AMAAS - Annual Report 2010-11
2
· Management of abiotic stresses using microorganisms.
· Development of microbe mediated processes for product
development and value addition in agriculture.
· Diagnostic kits for the identification of important plant
pathogens, fish and animal pathogens.
· Post harvest technology for the important fish species of
India.
· Diversity of ruminanat microorganisms and their utilization.
· Unraveling microbial genomics for its utilization in
agriculture and industry.
· Collection of DNA materials from microorganisms and other
relevant organisms which result from the various molecular
research programmes.
· Acquisition of gene constructs from various sources.
· Value addition to the genomic resources.
· Characterization, validation and conservation of microbial
genomic resources.
· Production/multiplication and quality control for
distribution.
· Exchange of the genomic resources under a material transfer
agreement (MTA).
· Development of a user friendly web-based information
system for microbial genomic resources.
· Human resource development in microbe conservation and
utilization.
1. Microbial diversity and identification
2. Nutrient management, PGPR and biocontrol
3. Agrowaste management, bioremediation and microbes in
post harvest & processing
4. Microbial management of abiotic stress
5. Microbial genomics
6. Microbial Genomic Resource Repository
7. Human Resource Development
The network project has 7 components:
3
AMAAS : Themes
Theme 1: Microbial Diversity and Identification
General Objectives of the theme “Microbial Diversity and Identification”
1. Microbial diversity analysis from various ecoregions/exotic
environments.
2. Identification of microorganisms using conventional and
molecular techniques.
3. Application of some important microbes in agriculture and
allied sectors for enhancing food productivity.
Sub-Thematic Areas in the Microbial Diversity and Identification Component
1. Analysis of microbial diversity in terrestrial ecosystem.
2. Diversity in aquatic ecosystem.
3. Diversity in fermented dairy products.
4. Diagnostic kits for plant pathogens, soil microbes, fish
microbes and animal microbes.
Sub Theme I: Microbial diversity in terrestrial ecosystem
Objectives
1. Western Himalayas, cold arid-eco-region.
2. Western plain, Kachchh and part of Kathiawar peninsula, hot
arid eco-region.
3. Karnataka plateau (Rayalaseema as inclusion), hot arid with
deep loamy and clayey mixed red and black soils, low to
medium awc and lgp 60-90 days.
4. Northern plain and central highlands including Aravallis,
hot semi-arid eco-region.
5. Central highlands (Malwa), Gujrat plain and Kathiawar
peninsuala, semi-arid eco region.
6. Deccan plateau, hot semi-arid eco-region.
7. Deccan plateau (Telangana) and Eastern Ghats, hot semi-arid
eco-region.
8. Eastern Ghats and Tamilnadu uplands and Deccan
(Karnataka) plateau, hot semi-arid eco-region.
9. Northern plain, hot subhumid (dry) eco-region.
10. Central highlands (Malwa and Bundelkhand), hot subhumid
(dry) eco-region.
11. Moderately to gently sloping Chattisgarh/Mahanadi basin,
hot moist/dry subhumid transitional with deep loamy to
clayey red and yellow soils, medium awc lgp 150-180 days.
12. Eastern plateau (Chhotanagpur) and Eastern Ghats, hot
subhumid eco-region.
13. Eastern plain, hot subhumid (moist) eco-region.
14. Western Himalaya, warm subhumid (to humid with
inclusion of perhumid) eco-region.
15. Assam and Bengal plain, hot subhumid to humid (inclusion
of perhumid) eco-region.
16. Eastern Himalayas, warm perhumid eco-region.
17. North Eastern hills (Purvanchal), warm perhumid eco-
region.
18. Eastern coastal plain, hot subhumid to semi-arid eco-region.
19. Western Ghats and coastal plain, hot humid-per humid eco-
region.
20. Islands of Andaman-Nicobar and Lakshadweep, hot humid
to perhumid island eco-region.
Sub Theme II: Microbial diversity in aquatic ecosystem
Objectives
1. To study the culturable microbial diversity of aquatic
animals from different aquaculture systems.
2. To screen, characterize, identify microorganisms from
diverse aquatic environments such as sea, high altitude lakes
and other water bodies with properties such as salinity
tolerance, cold tolerance, decomposition of resistant organic
material as a source of novel genes and compounds.
3. To isolate, characterize and document microbes for
bioremediation of pesticides, heavy metal contamination
and organic load in aquatic environment.
Sub Theme III: Microbial diversity of dairy products
Objectives
1. Microbial diversity in Indian fermented dairy foods (Dahi,
Lassi, Shrikhand, Misthi, Dahi and Cheese).
2. Molecular typing of new isolates/ available NCDC cultures.
3. Screening of microorganisms for novel probiotic/functional
properties and their application.
Sub Theme IV: Diagnostic kits for plant pathogens and soil microbes
Objectives
1. To isolate, characterize, evaluate plant pathogens
(Phytophthora, Fusarium) soil microbes (Bacillus), animal
microbes and fish microbes.
2. To study the genetic diversity of microbes obtained from
different crops.
3. To develop rapid diagnostic kits for plant pathogens, soil,
animal and fish microbes.
General Objectives of the Sub Theme: Nutrient Management
1. To study the culturable microbial diversity of soils from
different agro-ecological sub-regions, production systems
and land use practices, including stressed ecosystems.
2. To characterize the isolated microorganisms for their
nutrient mobilization (N, P, Micronutrients).
3. To evaluate establishment of strains, particularly in mixed
cropping systems and select strains for multiple crops and
geographical locations.
4. To standardize methods for mass multiplication and identify
appropriate delivery systems and improve the formulations,
quality, shelf life of the above bio-agents with superior
delivery systems.
5. To carry out multi-location testing for evaluation of the
promising formulations.
6. To make multiple-repositories of isolated strains of
microorganisms.
Theme 2: Nutrient Management, PGPR, Antagonists, Biocontrol Agent and Disease Management
AMAAS - Annual Report 2010-11
4
General Objectives of the Sub Theme: Plant Growth Promoting Rhizobacteria
1. To isolate, characterize, evaluate and utilize rhizobacteria
and their primary and secondary metabolites specific for
growth promotion and pathogen suppression.
2. To assess the ecological plasticity of strains particularly in
mixed cropping systems and identification of strains for
multiple crops and geographical locations.
3. To study the rhizobacteria mediated induced systemic
resistance in crop and adopting this for crop management.
4. To study the mechanism of rhizobacteria induced growth
promotion in crop plants.
5. To develop bioconsortium of geographically, phenotypically
and genotypically distinct rhizobacterial strains and
standardize methods for mass multiplication and develop
appropriate delivery systems.
General Objectives of the Sub Theme: Antagonists, Biocontrol Agent and Disease Management
1. To isolate and characterize antagonistic organisms from
diverse ago-climatic/cropping systems in India for pest and
disease management.
2. To screen potential isolates against major soil/ seed/air
borne plant pathogens, nematodes and insect pests of
important crops.
3. To identify strains with broad host range or specific to a
group of plant pathogens and insect pests and develop
improved strains by molecular interventions.
4. To study of different mechanisms like biochemical and
molecular interaction between promising antagonists
against pathogens/pests.
5. To develop formulations suitable for various delivery
systems and their evaluation against target pests.
6. To establish mass production facility for identified bioagents.
General Objectives of sub theme: Microbial Management of Agro waste
1. Isolation, identification and characterization of
microorganisms from various selected agro, industrial and
urban wastes.
2. Development of microbial consortia for rapid degradation
and effective utilization of selected waste.
3. Production of value added products like bio-fuels, enzymes
and mushroom using selected agro, urban and industrial
wastes.
4. To assess the impact of organicwaste application in
agriculture on shifts in soil microbial community structure
and function in relation to soil physiochemical properties.
General Objectives of sub theme: Bioremediation
1. Develop an understanding of the structural and functional
diversity analysis of microbial communities and their
dynamics in response to normal environmental variation
and novel anthropogenic stresses.
2. Determine the biochemical mechanisms, including
enzymatic pathways, involved in aerobic and anaerobic
degradation of pollutants.
3. Expand understanding of microbial genetics as a basis for
enhancing the capabilities of microorganisms to degrade
Theme 3: Microbial Management of Agro waste, Bioremediation, Microbes in Post Harvest and Processing
pollutants.
4. Conduct microcosm/mesocosm studies of new
bioremediation techniques to determine in a cost-effective
manner whether they are likely to work in the field, and
establish dedicated sites where long-term field research on
bioremediation technologies can be conducted.
5. Develop, test, and evaluate innovative biotechnologies, such
as biosensors, for monitoring bioremediation in situ; models
for the biological processes at work in bioremediation and
reliable, uniform methods for assessing the efficacy of
bioremediation technologies; establish a culture collection
for bioremediation purposes.
General Objectives of sub theme: Microbes in Post Harvest & Processing
1. Development of fermented products from fruits, vegetables
and cereals.
2. Value addition of pulses, millets and horticultural produces
through microbial fermentation
3. Biopreservation of vegetables for extension of shelf life and
control of spoilage in processed products.
4. Assessment of microbial contamination and safety of
agricultural produce.
General Objectives of the theme: Microbial management of abiotic stress
1. Isolation of microorganisms from rhizotic zones of cereal
crops (wheat and millets) grown under stress conditions of
salt, drought and extreme temperatures.
2. Selection of bacteria capable of growing under stress
conditions of salt, drought and extreme temperatures.
3. Evaluation of the selected organisms in the rhizosphere of
wheat and millets (phytotron studies).
4. Biochemical characterization of selected microorganisms.
5. Development of consortium of microorganisms that can
alleviate the effect of drought, salinity and extreme
temperature.
6. Field evaluation of consortium of microorganisms for
improvement of wheat, rice and millets under stress
conditions.
Sub themes in Microbial Genomics
1. Structural Genomics
2. Functional Genomics
Sub theme: Structural Genomics:
Genome analysis of the nitrogen-fixing symbiotic bacterium Mesorhizobium ciceri.
Overall Objective of structural genomics
1. Complete genome sequencing of Mesorhizobium ciceri strain
Ca181 with genome size of 8Mb.
Overall Objective of functional genomics
1. Isolation of genes and their alleles for abiotic and biotic stress
tolerance from isolates of Pseudomonas flourescens,
Arthrobacter globiformis, marine bacteria and through
metagenomes.
2. Sequence determination of the isolated genes.
3. Functional validation of selected alleles in microbes and
model plants.
Theme 4: Management of Abiotic Stress
Theme 5: Microbial Genomics
5
AMAAS - Annual Report 2010-11
Theme 6: Microbial Genomic Resource Repository
Mandate of MGRR Network will be as follows:
1. To coordinate assemblage, conservation, quality control and
validation of the microbial genomic resources to facilitate
their optimal exploitation and utilization.
2. To act as a single window system for import and exchange of
microbial genomic resources and facilitate protection of
related IPR issues.
3. To conduct and promote basic, strategic, applied and
anticipatory research for development and management of
microbial genomic resources.
The major objectives of the proposed MGRR Network:
1. Collection of DNA materials from microorganisms and other
relevant organisms which result from various molecular
genetics and genomics research programmes.
2. Acquisition of gene constructs from various sources.
3. Value addition to the genomic resources.
4. Characterization, validation and conservation of microbial
genomic resources.
5. Production/multiplication and quality control for
distribution.
6. Exchange of the genomic resources under a material transfer
agreement (MTA).
7. Development of a user friendly web-based information
system for microbial genomic resources.
8. Human resource development.
Objectives:
1. To train scientists/researchers/technicians/farmers for the
exploration and application of microorganisms in
agriculture.
Theme 7: Human Resource Development
AMAAS - Annual Report 2010-11
6
Project wise Significant Achievements for the Year 2010-11
Diversity analysis of Bacillus and Bacillus-derived genera in the Indo-Gangetic plains of India
PI : Dilip K. AroraNational Bureau of Agriculturally Important Microorganisms, Mau
Rationale
The country's most productive Indo-Gangetic Alluvial Plain,
covers one-forth (86 mha) of the total area and produces three-
forth of the total food grains, especially rice-wheat. During the last
four decades, the wheat production has no doubt increased 6
times and that of rice 2.5 times, but the present scenario suggests
declining trend in rice as well as wheat productivity. The objective
of the present investigation was to understand the
microbiological reasons for the decline in the agricultural
productivity and species richness of Bacillus in this region.
Objectives
· To isolate and characterize the soil microbes (Bacillus).
· Biochemical characterization of the isolates with respect to
the PGP traits.
· Molecular characterization including ARDRA with three
restriction enzymes.
· Sequencing of the isolates.
Significant Achievements
· A total of 245 isolates were Bacillus from the soils of Trans
(Punjab) and Central IGP (U.P) regions. These isolates were
screened for various PGP traits i.e., Indole Acetic Acid
production (IAA), phosphate solubilization and siderophore
production.
· 20.5% of the isolates from Central IGP region were found to
produce siderophores, whereas from Trans IGP region, a
total of 22.5% isolates showed siderophores production.
· IAA production without any precursors was observed for
both Central and Trans IGP regions. 74% and 52% of the
isolates from Kanpur and Saharanpur regions (Central IGP)
showed IAA production. Higher quantity of IAA ranging
from 1200µg/mg to 600 µg/mg of protein was recorded;
whereas, from Punjab region (Trans IGP) only 16% isolates
were IAA producers.
· 8% and 20% phosphate solubilizing Bacillus from
Saharanpur and Kanpur belt (Central IGP) were recorded
respectively. Punjab region showed only 6% of the isolates as
phosphate solubilizers.
· Molecular characterization of Central and Trans IGP region
isolates by using PRA analysis of 16S rRNA with three
restriction enzymes showed great diversity among the
isolates in IGP regions. On the basis of the hypothesis given
earlier (previous annual report), we predict that the large
number of the isolates are Bacillus-derived genera.
· Some of the isolates from the major cluster have been
sequenced and they have been identified as Lysinibacills
fusiformis (EU430993.1), Paucisalibacillus globulus
(EU430986.1), Brevibacillus parabrevis, Bacillus humi, Bacillus
clausii, Bacillus farraginis, Bacillus arbutinivorans, Pontibacillus
sp., Bacillus casamancensis, Bacillus oleronius (EU430987),
Bacillus circulans (EU430989).
Conclusion
In this region we have found that, though there is a great
diversity among the isolates isolates having insignificant PGP
activity dominate. This dominance is more in Trans IGP region
where the use of chemical fertilizer was more than the Central IGP
region.
RFLP analysis of 16S rDNA with AluI and Hae IIIrestriction enzymes respectively.
Development of diagnostic kit (PCR based) for the identification of soil microbe (Bacillus and Pseudomonas)
PI : Dilip K. AroraNational Bureau of Agriculturally Important Microorganisms, Mau
Rationale
The genus Bacillus is a large, heterogeneous group of Gram
positive, aerobic, endospore forming, rod shaped bacteria.
Several approaches based on phenotypic or genotypic characters
have been proposed to classify Bacillus sp. Further
characterization at the genotypic and phenotypic levels of
selected Bacillus species have led to the creation of several new
genera like Alicyclobacillus, Paenibacillus, Brevibacillus,
7
AMAAS - Annual Report 2010-11
Theme: Microbial Diversity and IdentificationTheme: Microbial Diversity and Identification
Alignment of 16S rDNA sequences of Bacillus, Bacillusderived genera and Bacillus related genera.
Dot Blot hybridization of designed probe for the identification0of Bacillus (at 64.4 C, probe showed hybridization signal for Bacillus
16S rDNA samples and negative results with Pseudomonas andfungal samples).
Virgibacillus, Geobacillus, Filobacillus, Jeotgalibacillus,
Aneurinibacillus, Gracibacillus and Marinibacillus. There are more
than 200 species of Bacillus and it is difficult to identify the species
of Bacillus on morphological, cultural and biochemical methods.
Diagnostics based on molecular techniques could be employed to
distinguish Bacillus species and Bacillus derived genera.
Objectives
· To isolate and characterize the soil microbes (Bacillus and
Pseudomonas)
· To develop rapid diagnostic kits for identification of soil
microbes.
Significant Achievements
· Amplification of 220 bp region of 16S rDNA with nested
primer pair followed by sequencing helped in the
identification of Bacillus species and Bacillus derived genera.
· Small hypervariable region contain all the information for
delineation of the species.
· Complete 16S rDNA and 220 bp fragment were amplified
from 20 different species of Bacillus. All the sequences were
BLAST searched and identical identity of the species was
obtained from either sequencing complete or partial
sequencing.
· Another approach was also used to design the probe for
identification of genus Bacillus. An oligonucleotide probe for
identification of genus Bacillus was designed from the
internal conserved regions of 16S rDNA following alignment
of 16S rDNA sequences of Bacillus, Bacillus derived genera
and Bacillus related genera. The probe is non-radioactively
labeled and is validated for its sensitivity and specificity.
Conclusion
An oligonucleotide 50 mer probe were designed for the
identification of genus Bacillus from the internal conserved
regions of 16S rDNA following alignment of 16S rDNA sequences
of Bacillus, Bacillus derived genera and Bacillus related genera. The
probe is non-radioactively labeled and is validated with 0annealing temperature of 64.4 C, the probe showed hybridization
signal for Bacillus 16S rDNA samples and negative results with
Pseudomonas and fungal samples.
Papers published from AMAAS work
S. Vardhan, R. Kaushik, A. K. Saxena, D. K. Arora, 2010.
Restriction analysis and partial sequencing of the 16S rRNA gene
as index for rapid identification of Bacillus species. Antonie van
Leeuwenhoek. DOI 10.1007/s10482-010-9487-4.
Diversity analysis of microbes in extreme conditions
PI : Dilip K. AroraCo-PI :National Bureau of Agriculturally Important Microorganisms, Mau
Alok K. Srivastava, Sudheer Kumar, Mahesh Yandigeri
Rationale
Microbial diversity encompasses a spectrum of microscopic
organisms including bacteria, fungi, algae and protozoa. An
estimated 50 percent of all living protoplasm on Earth is
microbial. There may be 1.5 million species of fungi yet only 5%
are described; as many as one million species of bacteria may exist,
but only about 5000 have been described in the last century. A
gram of typical soil contains about billion bacteria, but only 1
percent can be successfully grown (cultured) in the laboratory.
Fewer than 5% of all microbial species have been discovered and
named – even less is known about the diversity within those
species. India is the home of billions of microbes, many of which
are found nowhere else in the world. Microorganisms represent
the richest gamut of molecular and chemical diversity in nature,
as they comprise the most diverse forms of life. Over the period of
time, they abound in all kind of habitats viz., with extreme of pH,
salinity and water stress, temperature etc. Interest in the
exploration of microbial diversity has been spurred by the fact
that microbes are essential for life since they perform numerous
functions essential for the biosphere that includes nutrient cycling
and environment detoxification. In India it is even more relevant
due to our enormous wealth of available biodiversity. Therefore
continued research is needed to describe and protect the
unexplored resources for the preservation of natural ecosystems
and future benefits of mankind.
AMAAS - Annual Report 2010-11
8
Objectives
· Survey and collection of soil and water samples from
extreme climates.
· Isolation of microorganisms employing different media and
screening for high or low temperature tolerance, salt
tolerance, acidic or alkaline pH.
· To look for the production of enzymes protease, amylase,
xylanases and cellulases.
· Molecular characterization of bacteria through PCR
amplification of ribosomal genes, (16S r DNA and 16-23S
rDNA).
· DNA sequencing and identification of novel extremophilic
microorganisms.
Significant Achievements
· Aerobic, thrermophilic bacteria were isolated and
characterized from water and sediment samples collected
from, Yumthang and Yumesamdong hot spring India having
pH 6.5.
· The total number of microorganisms in the sediment and 3 −1water samples was found to be 2x10 cfu ml .
· 53 morphotypes selected, all could grow at temperature 45°C
and 11 at 65°C.
· Combined dendrogram based on ARDRA analysis revealed
the existence of 22 clusters among the isolates.
· A total of 53 thermophilic bacteria (growing at 45–65°C)
exhibiting distinct colony characteristics were isolated,
pur i f ied and subjected for fur ther molecular
characterization. PCR amplification followed by restriction
analysis of 16S rDNA gene, clustered the isolates into 22
groups. All these isolates were grouped into five different
classes: β-Proteobacteria, Firmicutes and Actinobacteria.
· Extracellular enzyme activity of all the isolates was assayed
and it was observed that out of 22 representative strains, 12
showed one or more enzyme activity (protease, amylase, ° °cellulase and xylanase) either at 45 C and (or) 65 C.
Conclusion
Yumthang and Yumesamdong hot springs are located in the
state of Sikkim, India. Amongst samples, water samples showed
higher TVC as compared to sediment samples. The isolates
possessed varies enzyme activities and displayed higher
structural and functional diversity. Thus these isolates will find
their utility in agricultural or industrial view point. Their
diversity will be a tool to identify novel isolate in the near future.
Papers published from AMAAS work
· Harmesh Sahay, Surendra Singh, Rajeev Kaushik, Anil K.
Saxena & Dilip K. Arora (2010).Characterization of
halophilic bacteria from environmental samples of Pulicat
brackish water lake, India (Accepted in Biologia).
Seminar, Symposia and Conferences attended
· Harmesh Sahay, Surendra Singh Anil K. Saxena and D.K.
Arora (2011) Diversity assessment and industrial application
of thermophilic bacteria from Manikaran Hot spring, India
Poster presentation in the symposium on "Genomics and
Biodiversity" at CCMB as part of 15th ADNAT Convention
from 23-25th February 2011.
· Harmesh Sahay, R. Kaushik, S. Singh, A. K. Saxena, D.K.
Arora (2010) Culturable Diversity of Psychrophilic Bacteria
from Gurudongmar lake, India International Conference on
Aquatic Microbiology (Status, Challenges and
Opportunities) at CAS in Marine Biology, Faculty of Marine
Sciences, Annamalai University, Parangipettai during
September 2 – 4, 2010.
Neighbor-joining tree showing the phylogenetic relationships between culturable bacterial 16S rRNA gene sequences from Yumthang and Yumesamdong hot spring and closely related sequences from the GenBank database.
Diversity of actinomycetes from Indo-gangetic plain
PI : Dilip K. AroraCo-PI : Mahesh YandigeriNational Bureau of Agriculturally Important Microorganisms, Mau
Rationale
Majority of the actinomycetes are free living, saprophytic
bacteria found widely distributed in soil, water and with plants as
colonizers. Actinomycetes can be isolated from soil, water and
plant material. In soil, they are involved in the decomposition and
mineralization cycles with the production of extracellular
enzymes such as cellulases, chitinases, and lignin peroxidases.
Many species of actinomycteres produce a wide variety of
secondary metabolites, including antihelminthic compounds,
antitumour agents and antibiotics which have been exploited in
medicine and agriculture to cure various ailments. In India,
Indogangetic plain (IGP) is considered to be most fertile ecoregion
with wheat-rice cropping system being most prevalent. However,
over the years there has been decline in fertility and productivity
in these plains. Microbes are known to influence the crop
rhizosphere by production of various metabolites and nutrients.
9
AMAAS - Annual Report 2010-11
Hence, this project has been formulated to isolate, utilize and
conserve actinomycetes diversity of IGP in order to exploit the
actinomycetes for sustainable agriculture.
Objectives
· Isolation, characterization and identification of
actinomycetes from Indo-gangetic plains.
· Molecular analysis of actinomycetes diversity in
Indogangetic plains.
· Functional characterization of isolated strains using
BIOLOG microbial identification system and conventional
biochemical methods.
Significant Achievements
· A total of 238 colonies of Streptomycetes were isolated from
different regions of IGP, among which 145 isolates showing
wide variation in the colony morphology were chosen for
further studies. The population count of Streptomycetes -2 -2 -1varied from 14×10 to 32 ×10 g soil .
· Genus Streptomyces was tentatively identified by the
morphological characterization using aerial mycelial colour,
substrate mycelial colour, pigments, and spore chain
arrangements such as rectiflexibles (RF), retinaculaparti
(RA), or straight chain (Scanning Electron Microscopy).
· PGP activity of all the isolates revealed that a total of 57.2%
were ammonia producers, 8% siderophore producers and
34.4% of phosphate solubilizers. All Streptomycetes isolates
were assayed for salinity tolerance (2, 4, 6, and 8% NaCl),
antimicrobial assay (>15 mm inhibition zone) against
Macrophomina phaseolina, Rhizoctonia solani, Fusarium ciceri
and Bacillus subtilis.
· A total of 40 isolates were chosen as representatives based on
RFLP clustering at >70% similarity level. Identification was
based on percentage similarity (>97% compared NCBI) & by
BLAST homology. Further phylogenetic analysis of 40
representatives was carried out for their similarity to known
actinobacteria aligned together with the sequences available
in public databases (Genbank, NCBI).
· Among the representative isolates, N53 although showed
96% sequence similarity to S. albogriseolus and may be a new
species of Streptomycetes. Morphological as well biochemical
characterization of N53 isolate when compared with type
strain S. albogriseolus (DSM 40003), did not reveal significant
differences.
Conclusion
In conclusion, these results provided further evidence that
species diversity of actinobacteria is higher in Indo-Gangetic
Plains of India. Also, these had promising potential for plant
growth promoting attributes. The culturable Streptomycetes,
isolated from IGP regions in the India were clustered into three
groups. The isolation of culturable actinobacteria has contributed
to our knowledge of diversity and population structure of
actinoacteria from India's most fertile regions and further
increased the information of actinobacteria available for the plant
growth promoting attributes. Further isolate N53 from this study
seemed to be new species and needs to be validated by
DNA–DNA hybridization, (%) GC content as well as FAME
analysis for its identification up to species level.
Papers published from AMAAS work
· Arvind K. Yadav, Alok K. Srivastava, Mahesh S. Yandigeri,
Sudhanshu K. Kashyap, Dinesh R. Modi and Dilip K. Arora
(2010) Characterization of indigenous copper-resistant
Streptomycetes from chickpea (Cicer arietinum L.) fields,
Annals of Microbiology 60: 605-614.
· Nityanand Malviya, Arvind K. Yadav, Mahesh S. Yandigeri
and Dilip K. Arora (2010)Diversity of culturable
Streptomycetes from wheat cropping system of fertile
regions of Indo-Gangetic Plains, India. World Journal of
Microbiology and Biotechnology. DOI 10.1007/s11274-010-
0612-3.
· Arvind K. Yadav, S. Vardhan, Rakesh Kumar, Nityanand
Malviya, D.R. Modi, A.K.Srivastava, A.K. Saxena and Arora
D.K. (2010) Thermostable α-amylase: Purification,
Production and Optimization from Streptomyces spp.
Procedings of National Academy of Sciences, Section B, Volume
80, Part III.
Books
· Mahesh S. Yandigeri, Dilip K. Arora and Arvind K. Yadav
(2010) 'Synoptical Keys for Identification of Streptomyces
Genera' published by National Bureau of Agriculturally
Important Microorganisms (NBAIM), Kushmaur, Mau Nath
Bhanjan (U.P.), India (ISBN: 978-81-909892-0-6).
AMAAS - Annual Report 2010-11
10
Scanning Electron Microscopy (SEM) of actinobacterial isolates isolated from IGP, India, showing variations in spore chain morphology.
NJ phylogenetic tree of full 16S rRNA sequences from selected isolates.
Book Chapters
· Mahesh Yandigeri, Sukumar Mesapogu, Arvind Yadav and
D. K. Arora (2010). Microbial Culture Banks: Custodian of
Real Natural Wealth. In: Souvenir of National Conference on
Biodiversity, Development and Poverty Alleviation on the ndoccasion of International Day for Biological Diversity (22
May 2010), H. B. Singh, R.J. Srivastava, D. P. Singh, B. K.
Sarma and R.K. Dubey (Eds.), Uttar Pradesh State
Biodiversity Board, Lucknow, pp. 34-39.
Seminar, Symposia and Conferences attended
· Nityanand M., Yadav A. K., Divya S., Shrivastava P.,
Yandigeri M.S. and Arora D.K (2010). Genotypic diversity of
actinomycetes from Indogangetic plain of India. In:
International Conference on Aquatic Microbiology (Status,
Challenges and Opportunities) to be held at CAS in Marine
Biology, Faculty of Marine Sciences, Annamalai University,
Parangipettai during September 2 – 4, 2010, Book of
Abstracts, p. 117.
· Yadav A. K., Nityanand M., Divya S., Yandigeri M.S., Modi
D. R. and Arora D.K. (2010). Genotypic diversity of
actinobacteria from subglacial Himalayan psychrophillic
lake (Pangong), India. In: International Conference on
Aquatic Microbiology (Status, Challenges and
Opportunities) held at CAS in Marine Biology, Faculty of
Marine Sciences, Annamalai University, Parangipettai
during September 2 – 4, 2010, Book of Abstracts, pp.117-118.
Mapping, assessment of the geographical distribution and in vitro conservation of agriculturallyimportant microorganisms for the Western Ghats of India
PI : Dr. A. R. AlagawadiCo-PI : P. U. Krishnaraj, K. S. Jagadeesh, R. Vasudeva Department of Agricultural Microbiology, UAS, Dharwad
Rationale
Biological diversity is of fundamental importance to the
functioning of all natural and human-engineered ecosystems.
Microorganisms play central role in the ecosystem functioning,
biogeochemical cycling and biodegradation etc. Hotspots are
recognized on the basis of the presence of greatest number of
endemic species. Therefore, at the global level hotspots are the
areas of high conservation priority because if unique species are
lost they can never be replaced. The two major hotspots in the
present scenario of India's biodiversity are the Western Ghats and
the North-eastern region. The Western Ghats are known to be
tectonically active and an uplifted region. It has been reported that
approximately 17% of a set of 2500 species are likely to be
microbial in this region. The high biodiversity of this region
therefore, may be due to large nutrients the volcanism brought in,
the relatively higher thermal gradients along this belt and widely
varying elevations.
Exploration, evaluation and exploitation of microbial
diversity are essential for scientific, industrial and social
development. In India, it is even more relevant due to our
enormous wealth of available biodiversity. The vast microbial
diversity of the natural world, combined with ingenious methods
to access the diversity, can provide us with a bountiful source of
new and valuable products. Therefore, continued research is
needed to describe and protect the unexplored resources for the
preservation of natural ecosystems and the future benefit of
mankind.
Objectives
· I so la t ion , enumerat ion , charac ter iza t ion , and
inventorization of AIMs (N fixers, P-solubilizers, VAM, 2
PGPRs, fluorescent pseudomonads, chitin decomposers,
cellulose and lignin degraders) along the Western Ghats and
identification of potential isolates.
· Assessing the geographical distribution and developing
thematic maps for the above groups of organisms.
· Assessing the functional potentials of each group of
organisms for use in agriculture and the molecular diversity
of a key selected species.
· Setting up the culture bank of the potential isolates under
each group and deposit with the NBAIM.
· Setting up the Western Ghats region specific data base on the
population and diversity of AIMs.
Significant Achievements
· During April 2010 to March 2011, 54 grids (12.5 km x 12.5 km,
each grid) in the central Western Ghats were covered for
sampling with an achievement of almost 90% of the targeted
area for the year.
· A total of 375 samples including 54 composite soil samples,
177 root samples of 73 plant species, 55 leaf samples, 13 leaf
litter samples, 15 decaying wood samples, 35 mushroom
samples, and 26 termite mound samples were collected and
used for isolation of AIMs.
· The total number of isolates obtained from these samples is
1143 including 310 Azotobacter, 88 Azospirillum, 287
Beijerinckia, 188 phospahte solubilizers, 92 lignin degraders,
134 fluorescent pseudomonads and 44 pink pigmented
facultative methylotrophs (PPFM). All the isolates have been
purified and preserved for further analyses.
· Based on morphological, biochemical and physiological
characteristics of 335 fluorescent pseudomonads, 116 were
tentatively identified as Pseudomonas fluorescens, 20 as P.
cichori, 39 as P. putida and 160 as P. aeruginosa. Similarly, out
of 94 PSB isolates 40 belonged to Pseudomonas, 13 to Bacillus, 8
each to Alcaligens and Enterococcus, 6 to Acetobacter, 4 to
Gluconobacter, 3 each to Aminobacter and Rhizomonas, 2 each to
Acenitobacter and Phenylobacterium and one each to
Acetobacterium, Azomonas, Flavomonas, Flavobacterium and Xanthomonas.
· Based on the results of 16S rDNA sequencing and its
Nucleotide-nucleotide BLAST (blastn) analysis, out of 18
isolates analyzed, 4 showed closest affiliation to A.
chroococcum; 1 to A. vinelandii; 2 each to Enterobacter cloacae
and E. ludwigii, 1 each to Pseudomonas fluorescens,
Pseudomonas sp., Bacillus subtilis, Novasphingobium sp.,
Enterobacter aerogenes, Serratia sp., Pantoea agglumerans,
Acinetobacter baumanii and Kluyvera cryocrescens. All the 18
11
AMAAS - Annual Report 2010-11
Grids for sampling forisolation of AIM's
Isolation of Lignin degradingfungi on Phenyl red (PR) medium
Antifungal activity of fluorescent pseudomonadisolates on different fungal pathogens
sequences were deposited to NCBI using Sequin software
and Accession numbers issued were HQ153105 to HQ153114
and JF513187 to JF513194. These AIMs have been deposited
with NBAIM.
· The amount of N fixed by 473 nitrogen fixers has been 2
quantified. While Azotobacter isolates fixed 7.72 to 29.75 mg
N, Azospirillum isolates fixed 6.86 to 13.15 mg and Beijerinckia
isolates fixed 2.9 to 11.7 mg N/g carbon source utilized.
· Out of 2632 isolates (111 Azospirillum, 1131 Azotobacter, 459
PSB and 157 fluorescent pseudomonads) tested for IAA and
GA production, 821 (76 Azospirillum, 373 Azotobacter, 162
Beijerinckia, 134 PSB and 76 fluorescent pseudomonads) were
found to produce both IAA and GA. The amounts of IAA
and GA produced by the AIMs ranged from 0.2 to 51.8 mg
and 0.5 to 318.4 μg/ L broth.
· 210 PSB isolates were examined for their ability to solubilize
TCP. They showed TCP solubilization in the range of 1.13 –
18.76%. Out of 72 fluorescent pseudomonads 21 showed TCP
solubilization which was in the range of 0.83 – 4.12%.
· The inhibitory activity of 204 fluorescent pseudomonads
against five fungal plant pathogens viz., Alternaria carthami,
Fusarium oxysporum f. sp. carthami, Sclerotium rolfsii,
Rhizoctonia bataticola and Pyricularia oryzae was also tested
under in vitro conditions. Out of 204 isolates, 46 inhibited all
the five pathogens; 34 inhibited 4 pathogens; 25 isolates
inhibited 3 pathogens; 29 isolates inhibited 2 pathogens.
· Out of 200 lignin degrading fungi tested for ligninase
isoenzyme activity, four isolates were found to produce
higher amounts of both poly phenol oxidase (PPO) and
laccase enzymes and one isolate showed higher activity for
PPO as well as Mn-peroxidase.
Conclusion
Collection of samples from the central Western ghat regions
of Karnataka gave an ample opportunity to isolate more and more
diverse group of microorganisms of agricultural importance.
Looking at the functional diversity of the isolates, some of them
were found to fix higher amounts of N , higher P-solubilization 2
activity, PGPS production, production of lignin degrading
enzymes and biocontrol activity. From this study, it can be
concluded that, isolates obtained were more and more diverse in
terms of their functions and identity which in turn reflects the
diversity of the central Western Ghat regions of Karnataka.
Papers published from AMAAS work
Alagawadi, A.R., Lande, A., Kadawadkar, S., Sunkad, S.,
Doddagoudar, C.K. and Krishnaraj, P.U. (2011), Agriculturally
important traits of fluorescent pseudomonads of Western ghats.
National symposium on “Microbial Diversity and its Applications in
Agriculture, Industry and Health” held at ICAR complex for Goa thfrom 4-5 March 2011. pp.29.
Diversity of agriculturally important microorganisms in the Western Ghats of Kerala
PI : D. GirijaCo-PI : Sally K. Mathew, K. Surendra GopalKerala Agricultural University, Kerala
Rationale
Western Ghat region is one of the hot spots of biodiversity.
Diversity has been well documented in the case of plants and
small animals. However, the microbial diversity has not been
systematically assessed. Large amount of diversity is expected in
this region because of the undisturbed nature. Tools for
identification include conventional methods like morphological,
cultural and biochemical characterization and also molecular
methods like 16S rRNA sequencing. The diversity among each
group of microorganism is assessed by advanced molecular tools
like Rep-PCR. This even helps to document the diversity within
each species. A thematic map will developed at the end of the
project, which will depict this diversity. The project will finally
help the nation to assess the diversity of agriculturally important
microorganisms and to conserve this diversity.
Objectives
· Isolation, enumeration & characterization of AIMs (N fixers, 2
P-solubilizers, fluorescent pseudomonads, Trichoderma,
chitin, cellulose & lignin degraders) in the Western Ghats of
Kerala.
· Assess geographical distribution and develop thematic maps
for AIMs.
· Assess functional potentials of each group of organism for
use in agriculture.
· Set up culture bank of potential isolates & deposit with the
NBAIM.
· Set up database on the population and diversity of AIMs in
the Western Ghats.
AMAAS - Annual Report 2010-11
12
Significant Achievements
· Soil and leaf samples from 18 grids Aryankavu, Achan Kovil
and thenmala forest range of Kollam district and Nilambur
range of Malappuram district.
· A total of 35 N fixing bacteria, 85 P-solubilizers, 9 P.
fluorescens, 25 cellulose degraders, 19 lignin degraders and 9
Trichoderma and 8 P solubilising fungi were isolated.
· Twenty two endophytes, 14 phylloplane bacteria and 5
phylloplane fungi were isolated.
· P solubilisation ranged from 30µg/ml to 120µg/ml. The
maximum amount of soluble P (120 µg/ml) was in the case of
Bacillus sp. and this was also supported by pH drop in the
broth in 20 days.
· 12 P solubilising and 3 N fixing bacterial isolates produced
IAA. K2P3 produced a maximum of 62.0µg/ml, 14 P
solubilising and 3 N fixing isolates produced siderophore, 19
isolates are good ammonifiers.
· Five P solubilising isolates were found to produce cellulose,
nine isolates degrade lignin and produce clear zones, Five
isolates degrade both lignin and cellulose in in vitro.
· 5 P solubilising and 7 N fixing bacterial isolates could
produce protease
· Seven cellulose degrading bacterial isolates solubilize
inorganic phosphate in vitro.
· 17 isolates degrade lignin also. Four P. fluorescens isolate
Cellulose Degrading Bacteria P solubiliser bacteria
solubilise inorganic P and 2 isolates produce IAA.
· Endophytic and phyllosphere bacteria exhibited
antagonistic activity against plant pathogen. Ten bacterial
isolateswere efficient against Rhizoctonia solani, three isolates
against Xanthomonas campestris, and nine against Sclerotium rolfsi.
· 26 isolates identified by 16S rRNA sequencing & deposited in
NCBI.
Conclusion:
The surveyed area exhibited a great diversity of AIMs. The
bacterial isolates obtained in this region showed multibeneficial
characteristics and the bacteria producing IAA showed P
solubilisation activity also. The endophytic and phylloplane
bacterial isolates exhibited very good antagonistic activity against
plant pathogenic microbes. Isolated some very good lignin and
cellulose degrading bacterial isolates obtained could be exploited
for agro waste management. Some of the tested isolates could
exhibit more than three or four beneficial traits, which may
promote plant growth directly or indirectly and the identification
of the best isolates is in progress.
Seminar, Symposia and Conferences attended
· National Symposium on Waste management: Experiences
and strategies at college of Horticulture, Kerala Agricultural
University, Thrissur from 5-7, January 2011.st· 51 Annual Conference of the Association of Microbiologist
of India at Ranchi from December 14-17, 2010.
Isolation, purification, identification and molecular assessment of microbial diversity from selecteddistricts of Indo – Gangetic Plain
PI : L. C. RaiDepartment of Botany, Banaras Hindu University, Varanasi
Rationale
Cyanobacteria are the first photoautotrophs that have been
attracting attention of the scientific community due to their
evolutionary significance and nitrogen fixing ability. The
importance of these organisms increases in areas with paddy as
the staple diet, as they are important contributors to the nitrogen
economy of the rice fields. This prokaryotic group is also known to
help in preventing soil erosion and maintaining the water holding
capacity of the soil. It is one of the least available nutrient and
becoming the major limiting factor for crop productivity,
especially in the lowland acidic and alkaline soils of India. To
overcome the phosphorus limitation farmers are overusing
chemical fertilizers but the available phosphorus (~80%) of these
fertilizers is also getting precipitated soon after application and
thereby contributing negative impacts on to soil microflora,
leading to distortion of the soil nutritional balance. As a
consequence of frequent chemical fertilizer use and weathering of
rocks, soils contain considerable amount of insoluble phosphorus,
unavailable to the plants. Phosphate solubilizing microorganisms
are the better options to increase the phosphorus availability in an
eco-friendly manner. Phosphate solubilzing bacteria (PSBs) are
not only making locked phosphorus availability but also enhance
the crop productivity and plant growth. However, both
biodiversity conservation and the taxonomy of these important
13
AMAAS - Annual Report 2010-11
microbes still need to be worked out. The rationale behind this
project is to explore the cyanobacterial and PSBs diversity using
16S RNA gene as a molecular marker and to conserve them. The
paddy fields of Indo-Gangetic plain spanning Eastern UP and
Western Bihar are being targeted for sample collection,
cyanobacterial diversity assessment and soil analysis.
Objective
· Survey and collection of soil and cyanobacterial samples
from selected districts of Indo-Gangetic plain like Chandauli,
Mirzapur, Varanasi, Allahabad, Ghazipur, Ballia, Arrah, and
Patna over different time frames and study of selected
physicochemical properties of these soil samples.
· Isolation, purification, and molecular characterization of
nitrogen fixing cyanobacteria and phosphate solubilizing
bacteria from the collected samples.
· Assessment of biodiversity of N -fixing cyanobacteria and 2
phosphate solubilizing bacteria from different soil types
using molecular techniques.
· Deposition of characterized/ identified organisms to
NBAIM.
Significant Achievements
· A total of ten nitrogen fixing cyanobacteria have been
isolated, purified and identified as Nostoc sp. LCRNK6,
Nostoc sp. LCRNK9, Calothrix sp. LCRNK10, Nostoc sp.
LCRNK11, Calothrix sp. LCRNK12, Calothrix sp. LCRNK13,
Tolypothrix sp. LCRNK14, Tolypothrix sp. LCRNK15, Nostoc
sp. LCRNK16 and Nostoc sp. LCRNK17. Their partial 16S
rDNA sequences have been deposited in the GenBank
database.
16S rRNA gene profiling of the amplified metagenome on denaturing gradient polyacrylamide gel.
· A total of twenty five phosphate solubilizing bacteria were
isolated, purified and characterized from different soils
samples. All these isolates were identified by 16S rRNA gene
sequence comparison and their sequences were submitted in
the GenBank database. Further all isolates were
characterized for quantitative phosphate solubilization on
NBRIP medium at 30°C and initial pH 7.0. The quantitative
estimation of phosphate solubilization showed that Pantoea
sp. has the highest capacity of phosphate solubilization.
· Culture independent analysis of phosphate solubilzing
bacterial biodiversity was initiated using denaturing
gradient gel electrophoresis. The total metagenome
extracted from the six soil samples was purified and
amplified using GC clamped 16S rRNA gene primers. The
amplified metagenome profiling was carried out on 40-60%
denaturing concentration of polyacrylamide gel. The bands
showing difference in mobility were marked with arrows
and excised for further amplification and then sequencing.
· Excised DGGE bands were reamplified purified and are
under process of sequencing.
· Culture independent cynabacterial diversity was also
assessed using DGGE and 40 bands were excised,
reamplified and sequenced. Their sequences have been
submitted in the GenBank database.
Conclusion
Results obtained from this study suggest that Nostoc was the
dominant cyanobacterium in the studied paddy fields whereas
Enterobacter and Acinetobacter sp. were dominant phosphate
solubilizers in the paddy fields. Further from the intensity of
DGGE bands it is evident that only selected bacteria play major
role in phosphate solubilization.
Papers published from AMAAS work
· Kumar, A., Bhargava, P. and Rai, L. C. (2010) Isolation and
molecular characterization of phosphate solubilizing
Enterobacter and Exiguobacterium species from paddy fields of
Eastern Uttar Pradesh, India. African Journal of Microbiology
Research 4, 820-829.
Seminar, Symposia and Conferences attended
· International Symposium on Phycol. Res., Botany, Banaras
Hindu University, Varanasi, 25-27 Feb, 2010.
· International Symposium on Soil Metagenomics,
Braunschwing, Germany, 8-10th Dec, 2010.
· International Symposium on Recent Advances in Cross-
disciplinary Microbiology: Avenues and Challenges, Dept.
of Biotechnology, BIT, Mesra, Ranchi, 14-17 Dec, 2010.
Agriculturally important microorganisms from soils of rice-based cropping system from agro-ecological zonesof east coast of India
PI : T. K. AdhyaCo-PI : T. K. DangarCentral Rice Research Institute, Cuttack
Rationale
Studying microbial community structures in soil systems is
virtually very difficult. Several cultivation studies to characterize
bacterial inhabitants of rice paddy soils have been performed.
However, it is not clear how successful such studies have been in
characterizing bacterial communities. It has been estimated that
the portion of microbial diversity that has been obtained in pure
culture by conventional plating methods, amounts to only 0.1 to
1% of the total diversity. Similarly, attempts to cultivate the
AMAAS - Annual Report 2010-11
14
bacteria in soils typically yield culturable cell numbers that are
less than 5% (usually less than 1%) of the total microscopically
countable cell numbers. It is easier to deal with enrichment
cultures selected for fast-growing bacteria with high growth
yields and also for the bacteria that are best adapted to the growth
medium used for cultivation. Unfortunately, this presents a
skewed picture of the microbial diversity as that from the
naturally existing. Such inadequacies have favored the use of
cultivation-independent molecular approaches to investigate the
microbial diversity in natural ecosystems. Efforts have been made
to combine both molecular and cultivation techniques to
investigate the numerically dominant members of the bacterial
community in anoxic rice soils. Thus, while use of different
analytical techniques is still in the initial evaluation and
assessment stage for defining the microbial diversity of flooded
rice soils, it is becoming increasingly clear that a combinational
approach using traditional cultivation techniques, biochemical
approaches and molecular applications will help in unraveling
the complexity of microbial dynamics and succession of flooded
rice soils.
Objectives
· I so la t ion , character izat ion , ident i f i ca t ion and
inventorization of agriculturally important microorganisms
in pure culture from soils of different agro-ecological zones
of east coast of India.
· Explore and quantify the microbial diversity in soils and crop
rhizosphere in rice-based cropping system by cultivation-
based, proteogram and total DNA finger-printing analyses.
· Phylotyping of the isolated microbial species and
investigation on the molecular diversity through soil
(metagenomic) DNA analysis.
· Study the structural dynamicity of the microbial community
in the rice ecosystem by analysis of diversity indices.
· Characterization of functional diversity with reference to
growth promoting hormone and toxin production.
Significant Achievements
· Seven hundred thirty three bacteria were isolated from ten
soil samples of Arunpur, Chilika, Haripur, Humma,
Indrakhi (Orissa), Kalipatnam, K.P. Palem, Gondhi,
Shankaraguptam and Undi (Andhra Pradesh) using
different media.
· Out of which, 186 isolates produced IAA, 41 isolates
solubilized P and 70 isolates utilizing ACC as a sole source of
nitrogen.
· IAA production capability of isolates ranged between 18.71--1362.96 µM ml . The isolates from Indrakhi produced more
-1IAA i.e. 67.09-362.96 µM ml .
· The range of ACC deaminase activity was 76.80-1903.94 nM -1 -1α-ketobutyrate mg h . Higher ACC deaminase producing
bacteria was isolated from the Arunpur rice field soil.-1· Forty-two isolates which produce >50 µM ml IAA and 34
ACC deaminase were tested for ammonia, siderophore and
HCN production, P-solubilization and N fixation. 2
Siderophore, ammonia and HCN were produced by 28, 24
and 22 strains, respectively; 22 isolates solubilized P and 31
isolates fixed nitrogen.
· Ten isolates having multiple PGPR activities like IAA
production, ACC deaminase activity, siderophore and HCN
production were selected for further study. The isolates
tolerated 7-12% NaCl, growth temperature was 25-35°C and
pH5-7. Biochemically the organisms were highly variable.
· Ten isolates having both IAA and ACC deaminase activity
were selected for root elongation assay. Root lengths of
treated rice seedlings are 30–120% more than that of the
untreated seedlings. Chlorophyll a and b contents of the
treated seedlings also increased significantly over the
untreated seedlings.
· Three strains AR-ACC3, ANR-ACC2 and ANR-ACC3
having most promising effect in root elongation assay were
identified based on 16S rDNA sequencing for identification
and phylogeny as AR-ACC2 was most similar to
Microbacterium sp. K6-01; EF612295 and ANR-ACC2 was
most similar to Agromyces sp. 28-4; EU363710.
· Fifty-eight Bt isolates were bioassayed along with two
formulations against rice leaf folder (Cnaphalocrocis
medinalis) in the field during rabi and kharif seasons. Eight 6indigenous isolates were effective having LC 3.162 x 10 - 50
9 1.259 x 10 spore-crystals/ml. Three isolates were more 6 7 effective (LC about 3x10 - 5x10 spore-crystals/ml) than the 50
8 9 formulations (LC about3x10 - 10 spore-crystals/ml).50
· The 16S rRNA sequence identified most of the isolates as Bacillus thuringiensis.
· Sixteen Bt isolates showed intrinsic salt tolerant and grew in
presence of up to 18% NaCl. SOD, catalase, proline and
amino acids imparted intrinsic osmotic and anoxic stress
tolerance to the organisms.
· The cry and cyt genes of 16 Bt isolates were amplified with
different primers viz. cjl1/cjl2, cj4/cj5, v(-)/v(+), gral-
Growth enhancement oftreated seedlings.
Vigour of treated seedlings Enhanced root growth oftreated seedlings.
15
AMAAS - Annual Report 2010-11
nem(d)/gral-nem(r), gral-cyt(d)/gral-cyt(r), cry1AC1/cry1AC2,
cry3Aa1/cry3Aa2 and cry10Aa1/cry 10 Aa2.
· The cjl 1/cjl 2 primed amplicon sizes of TB 163, 263, 264, 266,
267 and 271 were 0.263, 0.368, 0.395, 0.474, 0.526 and 0.684 bp,
respectively. The cj4/cj5 primed amplicons were 0.039 and
0.020 bp of the TB 262 and 270, respectively. The TB 262, 263,
265, 266, 270 isolates possessed the v(-)/v(+) primed
sequences of 2.00, 2.00, 1.972, 1.945, 1.918 bp sizes,
respectively.
· The TB 261 genome had the gral-nem (d)/gral-nem(r) primed
location which produced 0.976 bp amplicons.
· The isolates TB 163, 261, 265, 268, 269, 270 and 272 possessed
the gral-cyt (d)/d gral-cyt (r) recognized dna which produced
the amplicons of 1.108, 1.108, 1.305, 1.043, 1.239, 1.217 and
1.418 bp, respectively.
· The genome of the isolates TB 160, 261, 262, 263, 264, 265, 266
and 270 could be amplified by cry1AC1/cry1AC2 primers.
· The isolates cry3Aa1/cry3Aa2 and cry10Aa1/cry 10 Aa2
primers produced different sizes of amplicons.
Conclusion:
Ten isolates isolated from Orrisa having both IAA and ACC
deaminase activity were selected for root elongation assay. Root
lengths of treated rice seedlings are 30–120% more than that of the
untreated seedlings. Chlorophyll a and b contents of the treated
seedlings also increased significantly over the untreated
seedlings. The 16S rRNA sequence identified most of the isolates
as Bacillus thuringiensis. The isolates cry3Aa1/cry3Aa2 and
cry10Aa1/cry 10 Aa2 primers produced different sizes of
amplicons.
Papers published from AMAAS work
· Dangar T.K., Babu Y.K., Das J. (2010). Population dynamics
of soil microbes and diversity of Bacillus thuringiensis in
agricultural and botanic garden soils of India. African Journal
of Biotechnology 9, 496-501.
Seminar, Symposia and Conferences attended
· Dangar TK, Das J and Adhya TK (2009). Diversity of Bacillus
thuringiensis in coastal saline rice soils. 7th Pacific Rim
conference on the biotechnology of Bacillus thuringiensis and
its environmental impact. 25-29 November 2009, NASC
complex, New Delhi, India. Abstract no. SI2710, p.12.
· Das J, Dangar TK and Adhya TK (2009). Functional diversity
and virulence of indigenous Bt against the rice leaf folder,
Cnaphalocrocis medinalis. National Conference on
Biodiversity Conservation and Management of thBioresources. 28-29 October, Department of Zoology,
Andhra University, Visakhapatnam, p.125, Abstract no. 92.
· Das J, Dangar TK and Adhya TK (2009). Evaluation for the cry
and cyt genes of Bacillus thuringiensis effective against the rice
pests. National Conference on Pest Biodiversity in Rice and
their Management under changed climate. 15-16 December
2009, CRRI, Cuttack, Orissa, India. Abs no. 18.
· Das J, Dangar TK. and Adhya TK (2009). Diversity and
distribution of cry/cyt genes of indigenous Bacillus ththuringiensis. 50 Annual Conference. Association of
microbiologists of India. 15-18 December 2009, NCL, Pune. p.
27, Abstract no. GM-182.
· Bal, H.B. and Adhya, T.K. (2009) Growth hormone
producing rhizobacteria from flooded rice fields of Orissa. In thProceedings 50 Annual Conference, Association of
Microbiologists of India, National Chemical Laboratory,
Pune, India.
Microbial diversity analysis from different brackishwater system of East Coast of India
PI : T. C. SantiagoCo-PIs : N. Kalaimani, S. V. AlavandiCentral Institute of Brackishwater Aquaculture, Chennai
Rationale
Brackishwater ecosystem is one of the ecosystems which
abound in microbial diversity. It harbors a diverse microbial
world, having diverse biological properties of its own. No
systematic approach has been made so far to collect and identify
the genetic diversity of these organisms from this milieu. This
project aims at addressing this issue by collecting the microbes
from different brackishwater ecosystems such as mangroves,
estuaries, salt pans, aquaculture environment and sundarban
areas of the country. This project will help in generating data on
the genetic molecular properties of these microbes and
identifying their biodiversity. This project will also help to
identify microbes with novel properties for example
bioremediation of polluted environment, probiotic properties to
control pathogenic bacteria etc. It is also envisaged that this
project will help in identifying various novel metabolites
exhibiting antibiotic and anti cancer properties which are of
significance in human health. Novel genes such as salt tolerant
genes, drought resistant genes which are of great significance to
agriculture can be isolated. This project will help in cataloguing
the bacteria with their genetic and molecular properties which
will protect the microbial biodiversity from bio piracy.
Objectives
· To isolate bacteria, actinomycetes and fungi from different
brackish water system of east coast of India
· Identification of the microbes isolated from different
brackish water ecosystem.
· To screen the economically important microbes, bioactive
microbes with special reference to antagonistic activity/
useful metabolites, from the microbial stock
· To evaluate and optimize the production parameters of the
economically important microbes
· To isolate economically important genes from the isolated
microbial stock.
· To standardize the expression of the economically important
genes using different vector systems.
· To establish a repository of these microbes with bioactive
potential for ex situ conservation of microbial biodiversity
and future biotechnological applications.
Significant Achievements
· The isochorismate isomerase gene was amplified from Vibrio
AMAAS - Annual Report 2010-11
16
alginolyticus and cloned in to pET32A vector system and
transformed in to E.coli DH5α. Over expressed by induction
of 1mM IPTG and over expressed proteins were confirmed
by SDS PAGE. Isochorismate isomerase, converts chorismic
acid to salicylic acid. Salicylic acid is a naturally occurring
plant metabolite that induces pathogenesis-related (PR)
proteins and triggers the systemic acquired response (SAR).
· The herbicide-resistant gene phosphoshikimate
carboxyvinyl trasnsferase was amplified from Vibrio
alginolyticus. The resulting 1281bp PCR purified fragments
was cloned in to pET32A vector system and transformed in to
E.coli DH5α.The recombinant plasmid was transformed into
E.coli BL21 expression host and was over expressed by
induction with 1mM IPTG.
· The complete ORF of α amylase gene was amplified from
Vibrio alginolyticus The total gene consists of 1380 bp. The
resulting 1380bp PCR purified fragment was then digested
with BamHI and Hind III and cloned in to pET32A vector
system and transformed in to E.coli DH5α. Amylase isolated
from bacteria, fungi, are used in textile industry as softening
agents for starched clothes its also used in bread making and
to break down complex sugars such as starch (found in flour)
into simple sugars.
· The complete ORF of lipase gene was amplified cloned and
expressed from Chromobacterium violaceum. The recombinant
protein was purified using Ni affinity column
chromatography. Lipase activity was estimation using
analyzer by quantitative kinetic determination method at
different parameters like various pH and temperature.
· The complete ORF of azurin gene was amplified from Vibrio
alginolyticus. The resulting 440bp PCR purified fragments
were cloned in to pET32A vector system and transformed in
to E.coli DH5α. The recombinant plasmid was transformed
into E.coli BL21 expression host and was over expressed by
induction with 1mM IPTG. The preliminary antiviral and
antitumor activity were studied.
· A total of 42 brackish water samples were analyzed for the
presence of Salmonella typhi and 14 samples were positive,
which indicates the high prevalence of salmonella. All the
isolates were conformed using biochemical and molecular
sero-typing a multiplex PCR method targeting four genes.
All the isolates were also confirmed with specific antisera
Molecular characterization of the isolates was done using
ERIC PCR and analysed using DNA Finger printing
software.
Conclusion
From non-pathogenic Vibrio alginolyticus which is
abundantly found in brackish water ecosystem. Agriculturally
important genes that impart herbicide resistant and pathogen
resistance to plants have been identified and the proteins have
been expressed. This study reveals that microbes present in
brackish water ecosystem can be exploited for betterment of
agriculture. The preliminary studies have shown that azurin
protein expressed by V. alginolyticus can be used for controlling
viruses that affect shrimp aquculture. 14 isolates of Salmonella
typhi have been grouped in to two major clusters with 60%
similarity.Similarity of ERIC-PCR fingerprints among S. typhi
strains isolated from widely separated geographical regions
revealed existence of a limited number of clonal groups. This is the
first study in India to use ERIC PCR for molecular
characterization Salmonella typhi from brackish water.
Seminar, Symposia and Conferences attended:
Ramakrishnan S, Singaravel R, Santiago T.C, Kalaimani N,
Alavandi S.V and Rajan J.J.S (2011) Prevalence And Molecular
Typing Of Vibrio Harveyi From Brackishwater Ecosystems of India
Proc: National seminar on recent trends in biological sciences.21-
22 Feb 2011.University of Madras. Chennai.
.
Isolation of microorganisms from fermented dairy foods and sequencing of 16S rDNA for strain identification.
PI : Dinesh KumarNational Bureau of Animal Genetic Resources, Near GT Road, Karnal-132001
Rationale
Fermented dairy foods such as cheese and curd have got global
nutritional values. India famous for its diverse language and food
habit has got a unique collection of indigenous dairy fermented
foods. In fermentation of such dairy foods Non Starter Lactic Acid
Bacteria (NSLAB) population play a great role to provide them a
decent aroma, flavour and texture. Lactic acid Bacteria population
present in such dairy foods is highly diverse. Microbial diversity
of such indigenous fermented dairy foods deserves attention,
identification and characterization of microbial populations from
such Dairy fermented foods prepared in India have not been
explored thus study is required to explore new dairy and
agriculture important microbes, characterize, classify and
preserve them for their bioprospecting. Hence the current study
has been focused on such dairy foods from different area of India
and study there microbial diversity.
Objectives
· To isolate microorganisms from fermented dairy foods.
· To characterize microorganisms on technological and
taxonomic parameters.
· To sequencing 16SrDNA for species identification.
17
AMAAS - Annual Report 2010-11
Significant Achievements
· The present study in year (2010-2011) was undertaken in
order to explore new strains of lactic acid bacteria involved in
fermentation of buffalo milk curd collected from Chilika
which has got a unique long shelf life. Its reported that it can
remain up to 7 days at room temperature.
· In current study Indigenous curd sample prepared from
buffalo milk were collected from Chilika (19°43′N 85°19′E)
region of Orissa.
· Chemical analysis of curd samples showed acidity of curd
significantly high 1.08 % lactic acid, pH 3.87 and sour in taste
and thicker in consistency.
· Whereas chemical study of milk shows pH: 6.59, Acidity: 0.09
% lactic acid, fat: 8.6 %, protein: 3.9%. Thicker consistency of
curd may be contributed by high fat content of the milk.
· Lactic acid bacteria were found to proliferate in curd sample 5 giving microbial count of 1.7 to 2.2 X 10 CFU/g of curd.
· By shelf life studies, it was found that the quality of curd
retained up to seven days which was clear by microbiological
analysis of curd in intervals.
· A total of 64 microbial isolates were isolated and from curd
and milk sample out of 64 isolates 18 were Lactobacillus, 13
Leuconostoc, 12 Lactococcus, 9 Streptococcus, and 12 Yeast.
· These tentative isolates were identified by phenotypic and
genotypic methods.
· Biochemical characterization, especially sugar fermentation
pattern was used as a phenotypic method for identification of
isolates.
· All Lactobacillus isolates were confirmed to be lactobacillus
by genus specific PCR with specific primer (Dubernet et al.,
2002). Lactococcus isolates identified on the basis of
biochemical tests were confirmed by PCR using gadB gene
targeted primers. Streptococcus thermophillus were
confirmed by PCR using Lac Z gene targeted PCR.
· Sequencing of 16S rRNA gene sequence was performed for
all these isolates.
· All cultures isolated and characterized have been preserved.
Conclusion
Curd sample collected from Chilika (Orissa) was found to
have better shelf life than normal curd. A diverse population of
microbes were screened from the curd sample consisting of Yeast,
Lactobacillus, Lactococcus, Leuconostoc and Streptococcus. These
isolates can be used as starter for making curd with better shelf
life.
Papers published from AMAAS work
Nanda DK, Tomar SK, Singh R, Mal G, Singh P, Arora DK,
Joshi BK, Kumar D (2011) Phenotypic and genotypic
characterization of Lactobacilli isolated from Camel Cheese
produced in India. International Journal of Dairy Technology (Wiley
Blackwell) Accepted.
Strengthening, authentication and exploitation of mushroom biodiversity at the National Mushroom Repositoryfor Human welfare
PI : R. C. UpadhyayNational Research Centre for Mushroom, Solan, H. P.
Rationale
India with a varied agro climate is endowed with a rich
fungal flora occurring in the hills, plains, deserts and costal
ecosystem of our country. Most of the earlier work on Indian fungi
has been concentrated on microfungi, particularly those causing
plant diseases. On fleshy fungi whatever work has been done by
earlier mycologists laid their emphasis only on taxonomic aspects.
In the changed scenario when the fleshy fungi are being exploited
for commercial cultivation, extraction of pharmaceuticals,
antibiotics, bioremediation and extraction of enzymes for
industries and applications of mycorrhizic fungi for afforestation,
it has become very much essential to make a concerted and
coordinated efforts at the national level to properly collect,
identify, culture and conserve these fast depleting national wealth
AMAAS - Annual Report 2010-11
18
not only in the form of dead herbarium specimens but as living
cultures in a national repository, where they may be scientifically
catalogued, classified, characterized using modern molecular
methods like RAPD, ITS and isozymes. These fungi will be
conserved for long durations and attempts will be made for
artificial domestication of unexploited mushrooms species. The
wealth of fleshy fungi collected and conserved under the project
will not only help to preserve and conserve the vast fungal
biodiversity of our country but will also make available to
researcher, industrialists and farmers for diversification of newer
mushroom species for cultivation, extraction of pharmaceuticals
and antibiotics, waste recycling and applications in establishing
forest seedlings in barren areas.
Objectives
· Collection of wild mushrooms from Jharkhand, Tripura,
Rajasthan and Himachal Pradesh.
· To obtain mycelial cultures from the collected specimens and
culture conservation in the Gene Bank of DMR, Solan and at
NBAIM, Mau.
· Complete description and identification of the specimens
using microscopic studies.
· Isolation of DNA from interesting specimens and molecular
studies especially ITS.
· Artificial domestication of unexploited indigenous wild
edible mushroom species.
· Screening of cultures for their different types of enzyme
production.
Significant Achievements
· During the surveys in the rainy season of 2010, total 111 wild
mushroom specimens were collected. In these collections we
found ectomycorrhizic, saprophytic, edible and some
medicinally important mushrooms from different forest
areas of, Jodhpur (Rajasthan), Ranchi (Jharkhand) Agartala
(Tripura) and Himachal Pradesh i.e., Khada Pathar, Chail,
Kufri, Narkanda .
· Important species include Leucocoprinus, Leucoagaricus,
Schizostoma, Limacella, Leucopaxillus, four spp. of
Termitomyces, Amanita pantherina, A. vaginatae etc.
· All the specimens are under identification upto species level.
· Efforts were made to isolate the culture of each specimen
immediately on different mycological media namely, Potato
Dextrose Agar & Malt Extract agar medium (2%) but only 60
cultures could be isolated. Remaining specimens were
mycorrhizic in nature and were difficult to culture. Plates
were incubated at 25°C for 6-10 days. Cultures were
examined for their purity and pure cultures so obtained were
stored at 4°C and in liquid paraffin.
· A new edible mushroom species i.e., Macrocybe giganteum
which is a tropical species, was successfully domesticated on
pasteurized wheat straw.
· Two wild mushroom strains Bjerkandera adusta and Lentinus
squarrosulus were selected for ligninolytic enzyme study.
· AAO is the main oxidases enzyme in B. adusta while laccase
plays important role in L. squarrosulus. MnP is the main
peroxidase enzyme in both varieties while LiP was not of
much significant.
· A new species of Limacella and Leucocprinus were collected
from Himachal pradesh which on examination seems to be a
new world record. The detailed molecular and anatomical
studies are in progress. Edible Termitomyces spp. (3 spp.),
Russulla sp. and Boletus species were collected from Ranchi.
· A new edible mushroom species ie Macrocybe giganteum
which is a tropical species, was successfully domesticated on
pasteurized wheat straw.
· Sixteen DNA sequences of Cantharellus spp have been
deposited in the NCBI which incldes five new species for the
world.
Conclusion
The project is aimed at collecting, identifying and storing
higher fungi in a number of states in India some of these fungi
have a commercial value because they can be cultivated and sold
on the local markets. At present mushroom growers in
developing countries need reliable cultures and spawn to
inoculate the substrate in their family type business. The
availablity of well managed (national or local) germplasm
collections is of great importance, both commercially and socially.
Also institutes that manage the germplasm collections may play
an important role in the maintenance of cultures, and
dissemination of knowledge. Since the project also aims at studies
on best methods for conservation and on the related problem of
genetic stability of species and strains. There is a great potential in
India to find new wild mushroom species so far not recorded from
the world.
Papers published from AMAAS work
· Deepika Kumari, R.C. Upadhyay and M. S. Reddy (2009).
New records of family Cantharellacae from India. Mushroom
Research 18(2): 47-50.
· Upadhyay, R.C. and Manjeet Singh (2010). Production of
edible mushrooms. In Karl Esser (ed.) Mycota – Industrial
A p p l i c a t i o n s X . S p r i n g e r P u b l i c a t i o n p p .
79-97.
· Astha Tripathi, R.C. Upadhyay and Surendra Singh (2010).
Variability in phenol tolerance by coremia forming Pleurotus
spp. on solid medium. Mushroom Research 19(1): 9-15.
19
AMAAS - Annual Report 2010-11
· Astha Tripathi, R.C. Upadhyay and Surendra Singh (2010).
Biodegradation of cbhlorophenols by white-rot fungi: A
review. Flora and Fauna 16(2): 157-165.
· Deepika Kumari, R.C. Upadhyay and M. S. Reddy (2010).
Nutritional composition of eighteen different wild
Cantharellus mushrooms collected from North-Western
Himalayan region of India. Food Science and Technology
International (Press).
· Deepika Kumari, R.C. Upadhyay and M. S. Reddy (2010).
Antioxidant Activity of three species of Wild Mushroom
Cantharellus Collected from North-Western Himalaya, India.
International Journal of Agriculture & Biology. (Press).
· Astha Tripathi, R.C. Upadhyay and Surendra Singh (2010).
Mineralization of mono-nitrophenols by Bjerkandera adusta
and Lentinus squarrosulus and their extracellular ligninolytic
enzymes. Journal of Basic Microbiology (Accepted).
Exploring bacterial diversity in Kutch eco-region of gujarat for agricultural and industrial applications
PI : K. K. PalCo PIs : R. DeyDirectorate of Groundnut Research, Junagadh, Gujarat
Rationale
The emerging issues of salinity, high temperature and
degradation of soil quality warrant management strategies to
preserve microbial diversity and to exploit the existing diversity
for enhancing crop productivity. The Kutch ecoregion of Gujarat
remains a source of novel organisms and genes thereof of
agricultural, industrial, pharmaceutical and therapeutic usage for
the microbiologists to explore due to prevalence of diverse harsh
environmental conditions like extreme temperatures, salinity,
and drought. Great diversity is also observed in the soil types and
the crops grown in the area. Thus, Kutch ecoregion is a hot spot of
diverse microbial population, especially the extremophiles,
which is relatively unexplored. Therefore, studying the microbial
diversity in this ecoregion for exploiting their use in agricultural,
industrial, and pharmaceutical industries is of utmost
importance.
The present project aims at exhaustive surveys, isolations,
identifications, molecular diversity, bioprospecting and
conserving the microbial diversity from various niches for
multiple societal benefits. Besides, the project envisages
identifying future strategies in developing efficient biofertilizer
packages for existing crops of Kutch ecoregion.
Objectives
· Survey, isolation and characterisation of important bacteria
and archaebacteria from salt affected areas and salterns of
Kutch eco-region of Gujarat
· Identification of potent salt tolerant strains of bacteria
suitable for groundnut cultivation in salt affected areas of
Kutch eco-region
· To study the diversity of representative groups of salt
tolerant bacteria obtained from salt affected areas and
salterns of Kutch eco-region
· Exploring source of novel gene(s), if any, of agricultural and
industrial importance from diverse extremophiles with
special emphasis on biocontrol, salt tolerance, bioactive
peptides, industrial enzymes, etc.
· Mapping, cataloguing, and preservation of isolated and
identified bacteria in National Repository.
Significant Achievements
· Quantified plant growth promoting traits of important
PGPR isolates. Quantification of phosphate solubilization
and IAA production indicated that Enterobacter sp. R29 and
Pantoea dispersa R5 were most potent in tri-calcium
thphosphate solubilization after 9 day of incubation and
solubilized 29.97 and 34.22 mg of phosphorus/mg protein
and there was decrease in pH of the medium from 7.2 in
control to 4.99 and 4.33, respectively.
· To ascertain the presence of novel genus and species among
the 23 different isolates of archaea of the tentative genera
Halorubrum, Haloferax, Haloarcula, Natrinema and Haloarcheon
studied so far, patterns of total intracellular proteins, polar
lipids, GC content, electron microscopy and minimum
requirements of NaCl for initation of growth have been
studied. The minimum NaCl requirement for growth of the
present pool of archaea was 10%. The intracellular anions
and cations accumulated during the growth of these archaea,
from 10% NaCl to 35% NaCl were determined in Ion
Chromatograph. It was found that with increase in NaCl
concentration, there was gradual increase in accumulation of
both NaCl and KCl with molar ratio of K: Na from 1:1 in
lower concentration of osmolarity to 4:1 at the highest
osmolarity.
· Identified 16 archaea on the basis of near complete 16S rDNA
sequencing into the possible genus of Haloferax, Natrinema,
Halorubrum, Haloarcula and unidentified Haloarcheon species
and thus possibility of obtaining new genus and species was
found as similarity with the existing 16S rDNA ranged
between 95-99%. The phylogenetic relationship, studied on
the basis of new 16S rDNA sequence data, divided the 16
isolates into 5 major clusters and 10 sub-clusters.
· The diversity of the archaea present at saturated NaCl
concentration (35%) has been determined. A separate cluster
has been identified for the present isolates among the
existing database of genus and species of archaea at NCBI.
· New nodulating and nitrogen fixing organisms have been
identified as Enterobacter sp. R29 and Pantoea dispersa R5 by
near complete 16S rDNAs (1486 bp) sequences.
· DGGE conditions optimized for studying the different
microbial community in the natural and man-made salt pans
at saturated NaCl conditions.
· DDRT-PCR conditions optimized for isolation of transcripts
responsible for imparting tolerance to NaCl at different level
of osmolarity in Haloferax volcanii H1.
· Application of salt tolerant fluorescent pseudomonads and
Pantoea dispersa has been found to alleviate salt stress in
plants by modulating enzymes involved in reducing the
AMAAS - Annual Report 2010-11
20
impact of reactive oxygen species in groundnut.
Application of salt tolerant fluorescent pseudomonads and
Pantoea dispersa has been found to alleviate salt stress in plants by
modulating enzymes involved in reducing the impact of reactive
oxygen species in groundnut.
Conclusion
Papers published from AMAAS work
Thomas, M., Pal, K. K., Dey, R., and Dave, S. R. (2010).
Biodiversity of Extreme Haloarchaea in Salterns of the Little and thGreater Rann of Kachchh in India. 8 International Congress on
thExtremophiles held at Azores, Portugal from 12-16 September,
2010.
Phylogenetic relationship of the present archaea with the known genera and species of archaea.
Phylogenetic relationship among 16 archaebacteria generated using near complete 16S rDNAsequencing.
Isolation and characterization of Flavobacterium species from fish and aquatic environment
PI : Gaurav RathoreNational Bureau of Fish Genetic Resources, Lucknow
Rationale
Bacterial diversity screening is an active area of research as it
provides inexhaustible data, which can be used for the purpose of
developing products for the pharmaceutical, agricultural,
chemical processing and industrial markets. Knowledge on the
biodiversity of crucial aquatic ecological areas would yield a
better understanding of their community composition, spatial
relationship among organisms, nature of the operating
biochemical cycles and the mechanism of the existing energy
balance. These would provide a framework for the conservation
and sustainable development of ecosystems. Till date very limited
and isolated efforts were made to tapping of microbial diversity
and identification of aquatic environment. Flavobacterium spp. is
an important genus that is widely distributed in soil and
freshwater habitats where they decompose organic matter.
Several species are pathogenic to freshwater fish (F. columnare, F.
psychrophilum, F. branchiophilum) or isolated from diseased
freshwater fish (F. johnsonie, F. hydatis, F. succinicans). Members of
Flavobacterium are important producers of extracellular proteases
as virulence factors and several enzymes that hydrolyse casein
and gelatin. They also have the ability to degrade polysaccarides
such as starch, pectin, chitin, laminarin, alginate, xylan, carboxy
methyl cellulose and are also agarolytic. Some species can
degrade complex acid polysaccharides such as chondroitin
sulphate and hyaluronic acid. Therefore, isolation and
characterization of Flavobacterium spp. is important for fish
disease diagnosis and health management. The aim of this study
was to isolate and characterize the Flavobacterium species and
other related yellow pigmented bacteria from fish, sediment and
pond water sample. All these samples were directly associated to
each other and would provide information for prevention of fish
diseases and help in health management. These species can be
utilized for other applications in agriculture and allied sector.
Objectives
· To isolate and characterize Flavobacterium species and related
microbes by conventional methods from diverse aquatic
ecosystem.
· To assess the diversity of Flavobacterium species and related
microbes by molecular methods.
· To develop sensitive and rapid method for detection of
Flavobacterium species by PCR.
· To identify and discriminate the Flavobacterium species
through fingerprinting techniques.
Significant Achievements
· Isolation of Flavobacterium columnare: A total 32 fish
samples showing disease symptoms were collected from
different fish farms and processed for bacterial isolation. All
the tested fish had gross lesions resembling columnaris
disease. Skin swabs were streaked aseptically or dilutions of
homogenized tissue were plated on cytophaga agar plates
containing 5μg/ml neomycin sulfate and 200 units/ml of
21
AMAAS - Annual Report 2010-11
0polymixin B. The plates were incubated at 25 C for 3-4 days to
obtain visible bacterial growth. Yellow to green colonies with
entire or rhizoid edges were selected for purification. The
purified isolates were initially subjected to Gram's staining,
catalase, oxidase, motility and O-F tests, and later to Griffin
method of screening for identification of F. columnare.
· F. columnare was isolated from the diseased Catla catla sample
and presumptive identification has been carried out basis of
five characteristics as described by Griffin (1992). The
colonies on Cytophaga agar were pale yellow, spreading
with rhizoid margins. The biochemical results indicate that
the isolate was flexirubin positive, congo red positive,
resistant to neomycin resistant, gelatinase positive and
chondroitinase positive.
· DNA isolation from F. columnare was done by the method
described by Marmur et al. (1961). Amplification of 16S
rRNA was done by universal primers to obtain approx 1500
bp amplicon. The PCR product was eluted from the gel and
cloned into cloning vector pTZ 57RT by TA cloning method.
· The cloned plasmid was sequenced using M13 primers to
obtain approx 1500 bp nucleotide sequence. The sequence
chromatogram was analysed by Bioedit software and the
resulting consensus sequences (~1500 bp) were compared
with those available in RDP 10 database by use of the SEQ
MATCH programme to determine 16S rRNA gene sequence
similarities with its nearest neighbors. The results revealed
identity of the isolate was approx 98% with Flavobacterium
columnare strain EK 28 (AB016515) and LP8 (Genbank
Accession No.AB015480).
· Amplification of Intergenic Spacer Region (ISR) of F.
columnare was done using primers (FIFPB5 and 23RR) to
obtain a PCR product size of ~750 bp. The PCR product was
eluted from the gel and cloned into cloning vector pTZ 57RT
by TA cloning method. The cloned plasmid was sequenced
using M13 primers to obtain approx 750 bp nucleotide
sequences. The sequence chromatogram was analysed by
Bioedit software and the resulting consensus sequences
(~750 bp) were compared with BLAST programme in NCBI
to determine ISR sequence similarities with its nearest
neighbors. The results revealed identity of the isolate was
more than 99% with Flavobacterium columnare strain EK 28
(AB016515) and LP8 (Genbank Accession No.AB015480).
Based on our biochemical and sequencing results, the isolate
has been confirmed to be F. columnare.
· Work was initiated on study of metagenomics from
sediments of fishponds. A total of 16 attempts were carried
out to isolate community DNA through commercially
available soil DNA isolation kit (Himedia). DNA was
successfully isolated from all the samples, however
amplification of eubacterial 16S rRNA was achieved only in
eight samples using universal eubacterial primers.
· Isolation of Protease producing bacteria from aquatic
environment: A total of 56 bacterial isolates collected from
different fish farms were screened for protease production
on skimmed milk agar plates. Out of these, nine isolates 0 0 0showed protease activity at 4 C, 20 C and 37 C. The protease
activity of these isolates was quantified and expressed in
units. These isolates were subjected to molecular
identification by 16S rDNA sequencing. The results showed
that the isolates belonged to genus i.e. Bacillus, Aeromonas and
Pseudomonas. Out the three, Bacillus group showed
maximum activity (14 units) followed by Aeromonas (8 units) 0at 37 C.
Conclusion
Flavobacterium columnare is an important pathogen causing
columnaris disease in fish. Cultivation of F. columnare is a difficult,
uncertain and time-consuming method from diseased fish. This
is because, columnaris disease is an epidermal disease and when
the cultivation is made from surfaces of diseased fish,
contamination can rarely be avoided. Therefore competitive and
opportunistic bacteria growing on the agar plate can inhibit the
growth of F. columnare. F. columnare was successfully isolated
from diseased fish Catla catla showing bacterial gill infection.
Presumptive identification was carried out on the basis of
biochemical characterization as well as molecular identification
through 16S rDNA sequencing. This isolate could serve as a
candidate for developing diagnostics or development of vaccine.
Exploration and screening of rainfed ecosystem microbial diversity
PI : Kiran SinghMaulana Azad National Institute of Technology, Bhopal
Rationale
Microbial diversity study has extensive use in estimating
phenotypic and genotypic diversity of phosphate solubilizing
and free living nitrogen fixing rhizobacteria of agricultural
importance. This study employed the combination of several
methodologies to examine genetic relationships among specific
groups of bacteria and to characterize strains at the species level
using molecular biotyping techniques. The 16S or small subunit
ribosomal RNA gene is useful for estimating evolutionary
relationships among bacteria because it is slowly evolved and the
gene product is both universally essential and functionally
conserved. The study provides a different level of perspective to
interpret the phenotypic and genotypic variations among
different species of bacteria and also provide phylogenetic
relativity. Soil microbial diversity is an important index of
agricultural productivity.
Objectives
· The DNA primers corresponding to naturally occurring
sequences of isolated bacteria's such as REP, ERIC, and BOX
elements will be used to demonstrate genetic relatedness and
their diversity in a variety of ecosystem.
· The detection of these effective microbial strains from
various other soil microbes will be helpful for farmers and
scientist to formulate effective microbial management
strategies and evaluation of genetically improved microbial
strains in field validation.
· The formulation of methods used for direct extraction and
AMAAS - Annual Report 2010-11
22
purification of DNA from soil/ infected plant parts together
with PCR amplification of the DNA.
· To monitor survival of microbial strain will be performed,
which cannot be detected by any conventional technique.
Significant Achievements
· Soil samples were collected from rhizospheric region of plant
like
different districts of Madhya Pradesh.
· On the basis of biochemical reaction strains of bacteria are
confirmed as P. aeroginosa, P. putida, P. flourosence and P.
streuzi and their phosphorus solubilization capacity were
studied.
· DNA isolation of 50 Pseudomonas isolates was done by
modified Murmur method (Murmur, 1963 ) with slight
modification and estimation of DNA was done by obtaining
the ratio of absorbance at 260 nm/280nm
· Melting temperature (Tm) (Jain 1998) and % of G+C (Rapley
1998) of Pseudomonas isolates was calculated.
· Genetic diversity of 50 Pseudomonas isolates was done by
16SrDNA-RFLP PCR,RAPD PCR and REP PCR. Restriction
enzyme digestion of the amplified 16SrDNA was done by 5
restriction enzymes namely Alu I, Taq I, Mob I, Hae III and
Hind III.
· RAPD analysis of Pseudomonas isolates was done by using 5
different RAPD primers OPK 20, OPK 10, OPK11, OPK15
and OPK13.
· REP PCR of all the Pseudomonas isolates was done with REP
Universal primer.
· The RFLP pattern, RAPD and REP profile of each isolate was
evaluated and data matrix is generated and dendrogram was
Glycine max, Cicer arietinum, Trigonella foenum graecum,
Cajanus cajan from
constructed using NTSYS PC software package (Rohlf, 1990).
· Ten strains of genus Azotobacter were isolated from Jabalpur,
Sehore, Raisen, Ujjain, Indore, Hoshangabad, Guna &
Bhopal districts of M.P., which are biochemically
characterized.
· Identification upto species level was done by adding
selective compound to liquid Jensen medium. (1). For A.
vinelandii L-Rhamnose, ethylene glycol, erythritol of D-
arabitol as C-source Alternatively 1.0% Na-benzoate or 0.1%
phenol are used to inhibit the growth of other species of
Azotobacter. (2). For A. beijerinckii – L-tartrate, o-
hydroxybenzoate, D-glucuronate or D-galactouronate and
pH of 6 favours the growth of this species. (3). A. chroococcum
is the most common species and needs no special
enrichment.
· Genetic diversity of 10 Azotobacter isolates was analyzed by
16S rDNA-PCR Using universal primers.
Conclusion
Fifty strains confirmed as Pseudomonas sp. were used for
microbial diversity study after biochemical characterization. The
size of DNA fragments using REP-PCR primer range between 200
to 1000 bp. The digestion of 16S rDNA with Hae III showed bands
between 200-800bp. Ten strains were confirmed as Azotobacter sp.
after biochemical characterization. After isolation of genomic
DNA, genotyping of the isolates was done by using molecular
method (16S rDNA). The isolated strains expressed pattern of
banding on 2% agarose gel using 16S rDNA -PCR method with
universal primers.
Seminar, Symposia and Conferences attended
National Conference at Maulana Azad National Institute of
Technology, Bhopal, Nov, 2010.
Diversity of diazotrophic bacteria in arid zone soil under extreme environments
PI : Rajesh GeraCo PI : Kamlesh Kukreja Department of Microbiology, CCSHAU, Hisar, Haryana
Rationale
Soil bacterial communities and the soil processes mediated
by bacteria are critical for ecosytem functioning and productivity
in arid lands. There is an urgent need to integrate the soil bacterial
community into our understanding of ecosystem interactions at a
scale relevant to the whole-plant, between-plant, and ecosystem
levels. Nitrogen and water are the two most limiting resources in
arid under rainfed ecosystem. Soil bacteria are responsible for all
nitrogen fixation in the soil, and they play essential roles in
nitrogen cycling in soil crusts and plant rhizospheres Nitrogen is
the limiting nutrient for crop growth in most developing
countries. Exploitation of biological N Fixation offers a unique 2
opportunity to harness nitrogen from the air. The promotion of
low-input agriculture over the last decades has sparked a great
interest in soil microorganisms able to increase soil fertility or to
stimulate plant nutrition and/or health. Knowledge of the
diazotrophic community structure and population dynamics
responsible for nitrogen fixation is important for agricultural
applications as well as for understanding the ecosystem
processes. The microorganisms associated with arid zone
cropping systems are well adapted to stress conditions.
Introduction of microorganisms which are not adapted to these
stress conditions fail to establish and do not survive giving little
benefits to host. Study on microbial diversity in different cropping
systems will identify the new genotypes suitable for different
hosts, soil type, management practices and cropping systems.
This will help to develop better bio-inoculants for arid zone crops.
Objectives
· To study the soil microbial diversity of nitrogen fixing
bacteria under extreme environments (high temperature,
low moisture, low nutrients and high salt concentration).
· To characterize the isolates for agriculturally useful traits like
nitrogen fixation, growth hormone production and as fungal
antagonists.
· To characterize the symbiotic nitrogen fixers for nodulation
and nitrogen fixation properties.
· To identify the specific populations associated with abiotic
variables and functions.
Significant Achievements
· Thirty four different isolates growing on Malate (7), Burk's
(7), Nfb (8), Doberiner (8) and LGI (4) media from 10 districts
23
AMAAS - Annual Report 2010-11
of Haryana showing important traits like ammonia
excretion, IAA & siderophore production and P-
solubilization from each phylogenetic group were tested for
plant growth parameters in cotton and pearl millet under pot
house condition vis-à-vis reference strain, Azotobacter
chroococcum (HT 54).
· Seven isolates (BK-2, MDb-15, LGI-4, LGI-19, NFB-22,
MNFB-23 and MNFB-24) isolated from arid and semi-arid
zones of Haryana and showing better performance in cotton
& pearl millet were identified as Sinorhizobium, Rhizobium
sp . , Agrobacter ium tumefac i ens , Rhizob ium e t l i ,
Stenotrophomonas maltophilia, Ralstonia sp. and Leptothrix
cholodnii, respectively, on the basis of partial 16SrDNA.
· Fifteen more soil samples mainly covering Panipat, Jind,
Karnal and Kurukshetra districts were subjected to viable
counts of diazotrophs varied from 5.30-7.40, 5.60-6.50, 6.30-
7.11, 7.30-8.78 and 5.90-7.70 log cfu/g soil on Malate,
Burk's, Doberiner, Nfb and LGI, media, respectively. The 89
new morphotypes thus obtained from the above 15 different
soil samples, out of which 27, 14, 17, 25 and 6 morphotypes
belonged to Malate, Burk's, Doberiner, Nfb and LGI media,
respectively and were added to already exiting 291
morphotypes.
· These morphotypes were also characterized for ammonia
excretion, IAA production, P-solubilization and siderophore
production.
· A total of 26 soil samples with EC varying from 1.04 to 21.00 -1dSm were collected from salt affected areas of Haryana at
the depth of 0-15; 15-30 cms and also from weed rhizosphere
growing on these saline soils.
· The viable counts of diazotrophs varied from 4.36-7.91, 3.07-
6.70, 3.20-6.23 and 3.28-6.17 log cfu/g soil on Soil extract,
Malate, Jensen's and Burk's media, respectively. A total of
234 morphotypes were obtained on the above media.
· The genomic DNA of all these morphotypes was isolated by
CTAB method and was amplified for nifH gene by using
degenerative primers, nifH for (5' – TAY GGN AAR GGN
GGH ATY GGY ATC -3') and nifH rev (5'- ATR TTR TTN
GCN GCR TAV ABB GCC ATC AT -3'). The amplified
product was of ~420 bp.
· The ARDRA analysis on the basis of different morphotypes
isolated from soils with varied EC (1-5, 6-10, 11-15 or 16-21 -1dSm ) growing on different media showed wide diversity
and divergence among these started at 70 or 71 per cent
similarity coefficient. However, increase in salinity resulted
in decrease in viable counts and thereby diversify among
themselves.
· The isolates from each phylogenetic group were
characterized for Gram staining, IAA production, P-
solubilization, ammonia excretion, NaCl tolerance and were
identified on the basis of partial 16S rDNA gene sequencing.
Most of the isolates showed 99-100% similarity with Agrobacterium, Sinorhizobium, Pseudomonas, Ensifer,
Rhizobium , Baci l lus , Paenibaci l lus , Streptomyces ,
Microbacterium, Stenotrophomonas species.
· The promising diazotrophs isolated from salt affected soil
showing 5 to 10% NaCl tolerance are submitted to NBAIM
centre.
· A total of 106 soil samples were collected from different arid
and semi arid zones of Haryana to study the diversity of
rhizobia nodulating Vicia faba. Sixty four rhizobial isolates
were isolated on YEMA medium from various soil samples
using trap plant Vicia faba.
· The genomic DNA of these isolates was amplified for nodC
and nifH gene using nodCF and nodCI and 19F and 407R nifH
gene primers, respectively. Although all the 64 isolates
showed nodC gene amplification, while only 50 isolates
showed nifH gene amplification.
Conclusion
Seven isolates ( BK-2, MDb-15, LGI-4, LGI-19, NFB-22,
MNFB-23 and MNFB-24) from arid and semi-arid zones of
Haryana showed better performance in both cotton & pearl millet
were identified as Sinorhizobium, Rhizobium sp., Agrobacterium tumefaciens, Rhizobium etli, Stenotrophomonas maltophilia, Ralstonia
sp. and Leptothrix cholodnii, respectively, on the basis of partial 16S
rDNA gene. Promising diazotrophs isolated from salt affected
soils showing 5 to 10% NaCl tolerance were characterized for
Gram staining, IAA production, P- solubilization and ammonia
excretion and were identified on the basis of partial 16S rDNA
gene sequencing. Most of the isolates showed 99-100% similarity
with Agrobacterium, Sinorhizobium, Pseudomonas, Ensifer,
Rhizobium, Bacillus, Paenibacillus, Streptomyces, Microbacterium,
Stenotrophomonas species and are also submitted to NBAIM
centre.
Seminar, Symposia and Conferences attended:
· Rajesh Gera, Meenu Walia, R.C. Anand and Sneh Goyal
(2010). Microbial Diversity of Nitrogen Fixing Bacteria in
Arid and Semi-Arid Zones of Haryana Soil. Paper presented stin 51 Annual Conference of AMI-2010 held at BIT, Mesra,
Ranchi, India from Dec. 14-17, 2010.
Isolation of Rhizobium nodulating Vicia faba using trap plant from the arid and semiarid zones of Haryana.
AMAAS - Annual Report 2010-11
24
Exploration and screening of microbial diversity of Bihar and their potential application
PI : V. K. ShahiCo PIs : Dayaram, Subodh K. SinhaRajendra Agricultural University, Samastipur, Bihar
Rationale
The diversity status of microorganism may be defined in
terms of variations in morphological, physiological and genetic
characteristics apart from habitat diversity. Microbial diversity is
fundamental to maintenance and conservation of genetic
resources. As we explore into different environments, the richness
of microbial diversity becomes more evident and it becomes
imperative to estimate, record ,and conserve the microbial
diversity. This will not only reveal the structural and functional
diversity of microorganism and develop microbial map of region
but also help to use genetic resources of the microbial world for
sustainable agriculture.
Objectives
· Collection, identification and conservation of agriculturally
important microbes from different agro-climatic zone of
Bihar.
· Characterization of germplasm to ensure broad-spectrum
genetic variability.
· Evaluation of potential strains for their use and development
of technology for mass multiplication.
Significant Achievements
· 90 soil samples were collected from Begusarai, Bhagalpur,
Lakhisarai, Gopalganj, Siwan and Munger districts of Bihar.
· 50 Rhizobium, 25 PSB and 31 Azotobacter strains were isolated
and their identification and characterization was done by
morphological and biochemical traits.
· Higher population density of Rhizobium was observed in
Bakla field in Munger and Begusarai districts. In Bhagalpur,
Lakhisarai & Gopalganj maximum population density of
Rhizobium was found in Lentil field. Maximum CFU of
Azotobacter and PSB were generally shown in Maize field.
· All Rhizobium isolates show the production of amylase,
cellulase, catalase and oxidase enzymes and found gelatinase
negative.
· Rhizobium, Azotobacter and PSB were screened for their plant
growth promoting traits like Indole Acetic Acid (IAA)
production and siderophore production. 83.2% of Rhizobium
isolates showed Indole acetic acid production while 100%
isolates of Azotobacter and PSB showed Indole acetic acid
production. 75% isolates of PSB and 15.5% of rhizobium
showed siderophore production. None of the Azotobacter
isolates recorded siderophore production.
Conclusion
A good number of Rhizobium (50), PSB (25) and Azotobacter
(31) strains were isolated and characterization was done by
morphological and biochemical traits. Out of these, only 83.2% of
Rhizobium isolates showed Indole acetic acid production while
100% isolates of Azotobacter and PSB show Indole acetic acid
production. 75% isolates of PSB and 15.5% of rhizobium show
siderophore production. None of the Azotobacter isolates showed
siderophore production in future they are used as plant growth
promoting rhizobacteria (PGPR).
Papers published from AMAAS work:
· Suchi Smita, Subodh K. Sinha, Dayaram and V.K. Shahi
(2010). Molecular Diversity of Rhizobia Strains Isolated from
Different Areas of Bihar. RAU J. Research (Accepted).
Seminar, Symposia and Conferences attended:
· Shahi V. K., Dayaram and Punya (2010): Morphological and
Biochemical characterization of Rhizobia. (Abstract).
International consortium of Biologist. p-64.
Exploration and screening of bacteria diversity in North-East India and its potential application in biocontrol
PI : Ratul SaikiaCo PI : T. C. BoraBiotechnology Division, North East Institute of Science & Technology (CSIR), Jorhat, Assam
Rationale
North Eastern Region of India is known for its rich
biodiversity and its un-tapped bioresources has been identified as
the Indo-Burma Mega Hot Spot by Conservation International.
Therefore, existence of agriculturally and industrially potential
microbial strains with diverse genetic resources cannot be ruled
out. It is well recognized that the diversity of microbial
communities in North-Eastern region remains unexplored and
uncharacterized. Very little has been done on exploration of these
vast genetic resources, not only to enrich the national gene pool,
but also to explore it for gainful purposes in the field of industrial,
agricultural and pharmaceutical sectors. Therefore, exploitation
of vast potentialities of rare, endemic and untapped microflora of
this region is much promising and very important also. The
microbes are identified as vital resources for extraction of newer
and important molecules of agricultural utility and also for
expression of new gene. Therefore, a systemic exploration,
exploitation, characterization and conservation of culturable and
unculturable microbial diversity in NE India will open up a new
opportunity to explore the vast potentialities of endemic
microflora of this hot zone (NE region) and also to preserve as a
precious asset of rare genetic resources of the country.
Objectives
· Collection of environmental samples (soil, water, plant,
decomposed matter etc) from different habitant of North-
East states of India.
· Isolation, purification and preservation of bacteria.
· Bacterial data base development for future uses.
· Screening of bacterial isolates for biocontrol.
25
AMAAS - Annual Report 2010-11
Protease assay in skimmilk agar plate
Fig. Phylogenetic tree of bacteria isolated from rhinodung based on 16S rDNA sequence.
· Characterization of potential isolates and diversity analysis.
Significant Achievements
· During the year (2010-11), soil and water samples were
collected from Barapani, Shillong (average latitude 1,496 m,
locates at 25 57 N, 91 88 E
Cherrapunji (25°30 N 91°70 E; altitute
26°75 N
94°22 E)
· A total of 100 bacteria and 87 Streptomyces sp. from soil
samples from Meghalaya were isolated. Out of the 87
º ' º ' ), Mawsynram (25º 18' N, 91º 35' E ,
altitude 1,400 m, annual rainfall 11,872 mm; temperature o11 C ) and ' ' 1484 m,
o rainfall 11,777 mm, temperature 10 C ) of Meghalaya and
also from few area of Brahmaputra river bank like –Dhodang
chapori, Bahbari and Garumara of Jorhat district ( '
' and Gibbon Wild Life Sanctury, Jorhat, Assam.
Streptomyces spp. 34 isolates were positive for protease
production.
· Fifty Streptomyces spp. isolated from Tawang were
investigated for antifungal activity against Fusarium
oxysporum and 5 isolates were found positive. Sequencing of
16S rDNA of these Streptomyces was done and sequences to
be submited to NCBI-Gene Bank.
· Out of the 50 isolates of Streptomyces spp. of Tawang three
showed chitinase gene amplification (Family 18 bacterial
glycosyl hydrolase). Characterization of the gene under
study. Moreover, two isolates showed keratin degrading
ability in chicken feather medium.
· Fifty fluorescent pseudomonads were screened for protease
production and 10 of them found to be positive and
produced alkaline protease. The eight highly protease
producing isolates were identified as Pseudomonas aeruginosa
by sequencing of 16S rDNA (NCBI accession no. HQ007938
to HQ007945). The molecular mass of the purified enzyme
was 32 kDa. The enzyme activity was inhibited by EDTA
established as their metallo-protease nature and the activity 2+ 2+ +of the enzymes were inhibited by Zn , Cu and Ni .
· We have submitted 24 bacterial 16S rDNA sequences to the
NCBI-Gene Bank (HM038234 to HM038237 and HM345959
to HM345971) which were isolated earlier from rhino's dung
of Kaziranga National Park, Assam. Out of these, two
bacterial strains viz., Achromobacter sp. KRD9 and Providencia
sp. KRD23 were positive in protease assay.
Conclusion
A good number of bacterial isolates have been screened for
antimicrobial activity and protease production assay, only very
few bacterial strains were found to be positive and some of them
showed antagonistic activity.
Papers published from AMAAS work
· R. Saikia, R. Sarma, A. Yadav, T. C. Bora, (2011) Genetic and
functional diversity among the antagonistic potential
fluorescent pseudomonads isolated from tea rhizosphere.
Current Microbiology, 62:434–444.
· R. Saikia, D. K. Gogoi, S. Majumder, A. Yadav, R. K. Sarma, T.
C. Bora, B. K. Gogoi (2010). Brevibacillus laterosporus strain
BPM3, a potential biocontrol agent isolated from a natural
hot water spring of Assam, India. Microbiological Research.
(online publish first).
· R. Debnath, R. K. Sarma, R. Saikia, T. C. Bora (2010).
Microbial diversity and bioprospecting. National Seminar on
Medicinal & Microbe Diversity & their Pharmaceuticals. 19-
21 Dec. 2010, Tezpur University, Tezpur, India. Pp. 27-33.
Seminar, Symposia and Conferences attended
· First Indian Biodiversity Congress (IBC 2010) organized by
CISSA and Kerala University, Thiruvananthapuram from th st27 to 31 December 2010.
AMAAS - Annual Report 2010-11
26
Collection, identification and characterization of microbial diversity of North Bengal
PI : B. N. ChakrabortyCo PI : U. ChakrabortyUniversity of North Bengal, Darjeeling, West Bengal
Rationale
Diverse microorganisms are essential to a sustainable biosphere.
Microbial diversity is the key to human survival and economic
well being and provides a huge reservoir of resources, which we
can utilize for our benefit. Therefore, continued research is needed
to describe and protect the unexplored resources for the
preservation of natural ecosystems and the future benefit of
mankind. India has a very enviable biodiversity. However, work
on microbial diversity has been limited and almost little or no
work has been done on the microbial diversity of the North-
Eastern Region. Hence a detailed study including mapping of
microbial diversity in the diverse regions of North East region is
very essential and needs to be incorporated in the study of overall
microbial diversity of India.
Objectives
· Isolation of microorganisms (fungi, bacteria and
actinomycetes) from soil (forest, agricultural and riverine)
and plant roots of six districts of North Bengal (Darjeeling,
Jalpaiguri, Cooch Behar, Uttar Dinajpur, Dakshin Dinajpur
and Malda).
· Screening of the isolates for their utilization as bioprotector
and biofertilizer.
· Extraction of Genomic DNA, molecular diversity analysis,
PCR-RFLP analysis of SSU rDNA for identification.
Significant Achievements
· Soil samples collected from rhizosphere of Cinnamomum o ocassia (N24 42'26.30'' E88 21'20'20.30”) , Citrus reticulata
o o(27 02'43.17”N 88 28'04.69”E) , Hevea brasiliensis o o(N26 42'57.23'' E88 21'24'39”) and Cucurbita moschata
o o(27 07'14.40''N 88 06'18.70''E) of Darjeeling districts of North
Bengal yielded 103 bacterial isolates, 22 fungal isolates.
Among them 15 isolates were phosphate solubilizers; 26
were chitin degraders whereas 10 showed siderophore
production; 26 showed protease activities; 31 showed
amylase activities and 5 isolates showed antifungal
activities.
· PCR amplification of rDNA gene of eight isolates of
Cordyceps sp. (a parasitic macro fungus) collected from oDarjeeling hills (N26 31'27.13' - E 87-59'-88.53') using ITS
s p e c i f i c u n i v e r s a l p r i m e r p a i r s I T S 1 -
C T G T A G G T G A A C C T G C G G a n d I T S 4 -
TCCTCCGCTTATTGATATGC yielded 400-800bp products.
Genetic relatedness among these isolates and other
saprophytic macro fungi when analyzed with four random
primers (BAS-359, OPA-4, OPD-6 and OPA1) showed
genetic diversity among the isolates with the formation of
two clusters. A total of 22 reproducible and scorable
polymorphic bands ranging from approximately 100bp to
2000bp were generated with these four primers, while
primer BAS-359 scored highest bands. Analysis of
dendrogram revealed that similarity coefficient ranged from
0.34 – 0.86.
· Biochemical characterization and scanning electron
microscopy of 11 isolates of Non-Streptomyces
Actinomycetes (NSA) were done. These isolates showed
antagonistic reaction against fungal pathogens (Sclerotium
rolfsii, Fusarium graminearum, Fusarium oxysporum and
Rhizoctonia solani) in dual culture and enhanced growth
promotion of Glycine max and Cicer arietinum.
· PCR amplification of rDNA gene of seven selected isolates
of Trichoderma collected from the rhizosphere of Citrus o oreticulata (27 02'43.17”N 88 28'04.69”E) and Cucurbita
o omoschata (27 07'14.40''N 88 06'18.70''E) of high altitude region
of Darjeeling hills which showed antagonistic reactions
against phytopathogens (Thanatephorus cucumeries,
Rhizoctonia solani, Fusarium solani, Sclerotium rolfsi, and
Macrophomina phaseolina ) using ITS specific universal primer
pairs ITS1- 5'GCGGAAGGATCATTACTGAG 3' and ITS-4 -
5' GGGTATCCCTACCTG ATCCG 3' yielded 600 bp
product and their PCR products were sequenced and
identified by BLASTn as T. harzianum, T. asperellum and T.
erinaceum and their phylogenetic diversity analysed using
MEGA4.1 software. These seven gene sequences of
Trichoderma isolates have been deposited (HQ265418,
HQ334993, HQ334994, HQ334995, HQ334996, HQ334997,
GQ995194) to the National Center for Biotechnology
Information (NCBI) GeneBank.
· Multiple sequence alignment of nineteen 18S rDNA gene
sequences of Trichoderma isolates (T. harzianum, T. asperellum
and T. erinaceum) was carried out in BIO EDIT software.
There were quite a number of gaps that were introduced
within the ITS-4 region which were closely related. The
evolutionary history was inferred using the UPGMA method
as well as the evolutionary distances were computed using
the Maximum Composite Likelihood method.
· DGGE analyses of 18S rDNA (320 bp with GC clamp) of
eight isolates of T. harzianum and seven isolates of phosphate
solubilizing fungi (PSF) were carried out by ampliflying the
region with the forward primer containing GC clamp at NS1
(5'-GTAGTCATATGCTTGTCTC-3') and GCfung (5'-
C G C C C G C C G C G C C C C G
CGCCCGGCCCGCCGCCCCCGCCCCATTCCCCG TTAC
CCGTTG-3'). Distinct band was formed for these isolates;
however separate bands formed in the gel was due to their
G+C variation in their ITS region of rDNA.
· Immunological formats of T. harzianum (NAIMCC-F-01965)
was developed for screening of biocontrol agent(s) directly
from soil using dot immunobinding assay, western blotting
and indirect immunofluorescence.
· A new potential plant growth promoting rhizobacteria
(PGPR) identified as Bacillus altitudinis (BRHS/P 22) isolated
from rice rhizosphere showed in vitro antagonistic activity
against Sclerotium rolfsii and Rhizoctonia solani. 16S rDNA
gene sequence (1352bp) has been deposited to Genebank
(Acc. No. HQ849482). This isolate also showed growth
promoting activity and plant (Phaseolus vulgaris) health
improvement in the field condition.
27
AMAAS - Annual Report 2010-11
Conclusion
A total of 103 bacterial isolates, 22 fungal isolates were
isolated from hill regions of Darjeeling. Among them 15 isolates
were phosphate solubilizers; 26 were chitin degraders whereas 10
showed siderophore production; 26 showed protease activities;
31 showed amylase activities and 5 isolates showed antifungal
activities. PCR amplified products of ITS region of genomic DNA
have been obtained by specific primers for identification of
microorganisms followed by DGGE analysis. Diversity of
selected PSFs, BCAs, bacteria and actinomycetes with different
RAPD markers have been analysed. rDNA gene sequence of
BCAs deposited to the National Center for Biotechnology
Information (NCBI) GeneBank and phylogenetic diversity have
been studied using bioinformatics tools.
Papers published from AMAAS work
· Chakraborty, B.N, Chakraborty, U., Saha, A, Dey, P.L and
Sunar, K. (2010) Evaluation of phosphate solubilizer from
soil of North Bengal and their diversity analysis. World
Journal of Agricultural Science 6 (2): 195-200
· Chakraborty, B.N, Chakraborty, U., Saha, A, Dey, P.L and
Sunar, K. (2010) Molecular characterization of Trichoderma
viride and Trichoderma harzianum isolated from soils of North
Bengal based on rDNA markers and analysis of their PCR-
RAPD profiles. Global Journal of Biochemistry and Biotechnology
5 (1): 55-61
· Chakraborty, B.N., Chakraborty, U., Dey, P.L.and Sunar, K.
(2010) Phylogenetic relationship of Trichoderma isolates of
North Bengal based on sequence analysis of ITS region of
rDNA Journal of Applied Science and Research 6(10):1477-1482.
· Chakraborty, B.N., Dey, P.L., Shankar, R., Adhikari, J. and
Lama, D. (2010) Genetic relatedness between some
saprophytic and parasitic macrofungi of Darjeeling hills.
NBU Journal of Plant Sciences,4 : 77-80
· Chakraborty, B.N., Chakraborty, U., Rai, K., Allay, S. and
Dey, P.L. (2011) Molecular detection of fungal pathogens of
Citrus reticulata grown in Darjeeling hills and their
management. Acta Horticulturae (In Press).
· Chakraborty, B.N., Chakraborty, U., Sunar,K. and Dey, P.L.
(2011) RAPD profile and rDNA sequence analysis of
Talaromyces flavus and Trichoderma species. Indian Jounrnal of
Biotechnology [In press].
Seminar, Symposia and Conferences attended
· National training on “Microbial identification and gene mining:
A bioinformatic approach” organized by NBAIM during
September, 01-10, 2010.
· National Symposium on, “Microbial diversity and Bio-
Prospecting” and North Zone Meet of Indian Society of
Mycology and Plant Pathology (ISMPP) organized by
Deparment of Botany, University of Jammu, during October
29-30, 2010
· International Conference on “Genomic Sciences-Recent
trends”, VII convention of Biotech Research Society, INDIA
(BRSI) and Indo-Italian Workshop on Industrial and
Pharmaceutical Biotechnology (IIWIPB) , organized by
Madhurai Kamraj University, during November 12-14,2010nd· 32 Annual Conference and Symposium on “Innovations in
Plant Pathology, Research and Human Resource Development”
organized by Junagarh Agricultural University and ISMPP,
during November 24-26, 2010.
· National Symposium on “Molecular Approaches for
Management of Fungal diseases of Crop Plants” organized by
Indian Institute of Horticultural Research, Bangalore, during
December 27 – 30, 2010
· International Conference on “Plant Science in Post Genomic
Era” organized by School of Life Sciences, Sambalpur
University, Orissa and The Society for Plant Physiology and
Biochemistry, New delhi during February 17-19, 2011.
Fig. Multiple sequence alignment of rDNA gene sequence [GU324073] of Talaromyces flavus (NAIMCC-F-01948) was also carried out with ex-type gene sequences obtained from NCBI gene bank using BIO EDIT software.
AMAAS - Annual Report 2010-11
28
Biodiversity, characterization and conservation of cyanobacteria of Indo-Burma Biodiversity hotspots (NE Zoneof India) for harnessing of value added products
PI : O. N. TiwariCo PI : Sunil S. ThoratInstitute of Bioresources and Sustainable Development, Imphal, Manipur
Rationale
The North East region (Arunachal Pradesh, Assam,
Meghalaya, Manipur, Mizoram, Nagaland, Sikkim and Tripura)
of India forms a distinctive part of the Indo Burma biodiversity thhotspot which ranks the 6 among the 34 biodiversity hotspots of
the world and is a prime one among the two identified for the
Indian sub continent. The region also falls in the bio geographic tri
junction of the India, the Himalaya and the oriental landmass.
Cyanobacteria are oxygenic photosynthetic prokaryotes
possessing the ability to synthesize Chlorophyll-a. On the basis
the most recent 16S rDNA sequence analysis, cyanobacteria are
closely related to the Gram negative bacteria. Cyanobacteria
occurs and predominant in the vast array of habitats by its several
general characters and other special adaptive features. Many
species tolerate a great range of environmental conditions,
including extremes that usually or often exclude eukaryotic algae.
It is presumed that cyanobacteria evolved in the Precambrian well
before the Paleozoic boundary, and this is borne out by the
existence of microfossils of the middle and late Proterozoic that
are nearly identical morphologically to some living
cyanobacteria. Order Oscillatoriales of class cyanobacteria are
filamentous cyanobacteria without heterocysts and akinetes. The
genera of the oscillatoriales are traditionally distinguished from
one another primarily on the basis of presence or absence of
sheath. In addition to type of sheaths, the appearance of the
filament, false branching, and the colour of cells (pigments) have
been used as generic characters. At the species level, the cell size,
constrictions at the cross walls, cellular inclusions (granulations)
and cell shape (especially of the terminal cells of the trichomes)
have been the main taxonomic criteria by the traditional method.
Cells which synthesize chlorophylls invariably accumulate
carotenoids also, which apparently exert a protective effect on the
green pigment. Structurally they are in the form of a polyene chain
which is sometimes terminated by rings. Carotenoids occur as
isomers, namely all Trans, 9-cis, 13-cis, 5-cis forms have important
functions in photosynthesis, nutrition, and protection against
photooxidative damage. β- carotene is the major carotenoid in
cyanobacteria. Since carotenoids are non-toxic, they are desirables
coloring agents in the food industry as well as vitamin A
precursors. Most of the carotenoids commercially available are
chemically synthesized but there is increasing demand for natural
carotenoids as nutritional supplements because synthetic
carotenoids are dominated by trans β-carotene and natural forms
have more cis forms. Furthermore, carotenoids are frequently
used in dietary additives for poultry and aquaculture farming.
Products of carotenoid degradation such as ionones, damascones
and damascenones are also important fragrance chemicals that
are used extensively in the perfumes and fragrance industry.
Objectives
· Survey and isolation of cyanobacteria from different
ecological habitats of NE region of India (Manipur,
Meghalaya, Tripura, Nagaland, Mizoram, Arunachal
Pradesh, Assam).
· Cataloguing and Identification of potential strains for
natural pigments and biofertilizer.
· Development of optimized protocol for enhanced
production of natural pigments.
Significant Achievements
· Fifty (50) cyanobacterial strains belonging to 16 genera were
isolated from different ecological habitats of Arunachal
Pradesh, India were screened and identified for biochemical
characterization for Chl-a, phycobiliproteins (phycocyanin,
phycoerythrin and allo-phycoerythrin) and carotenoids for
value additions.
· Ten cultures selected are further undergone for detailed
taxonomical characterization and evaluation of the pigments
and ammonia excretion were conducted.
Conclusion
Fifty (50) isolates biochemically characterized, the following
have been selected for extensive characterization on the basis of
better performance during course of investigation i.e. For Chl-a:
Anabaena fuellebornii BTA 87: (19.49 µg/ml); Plectonema sp.BTA
287: (18.05 µg/ml); Westiellopsis prolifica BTA 253: (10.63µg/ml).
For Carotenoid: Scytonema malaviyensis BTA 186: (69.16µg/ml);
Anabaena fuellebornii BTA 87: (63.11µg/ml); Nostoc utermohli BTA
210: (59.45 µg/ml). For Phycoerythrin: Anabaena sp. BTA 125:
(152.34 µg/ml); Anabaena variabilis BTA 69: (132.05 µg/ml);
Anabaena naviculoides. BTA 61: (102.49µg/ml). For Phycocyanin:
Anabaena fuellebornii BTA 87: (197.83 µg/ml); Lyngbya truncicola
BTA 184: (151.00 µg/ml); Anabaena doliolum BTA 99: (142.78
µg/ml). For Allo-phycocyanin: Anabaena fuellebornii BTA 87:
(94.51 µg/ml); Anabaena doliolum BTA 99: (57.03 µg/ml); Lyngbya
truncicola BTA 184: (53.20 µg/ml). Ten selected cultures from the
Plectonema nostocorumHigh chlorophyll-a content
Anabaena fuelleborniiHigh carotenoids content
Phormidium bohneri High phycocyanin content
Nostoc spongiaeformeHigh allo-phycocyanin content
29
AMAAS - Annual Report 2010-11
fresh water repository at IBSD, Imphal were taxonomically
characterized based on their morphology and habitats which
were collected from different ecological habitats of NE region of
India. Out of the ten cultures, Plectonema nostocorum BTA158 th (Chl-a =5.72 µg/ml of 30 day) Anabaena fuellebornii BTA125
th th(Carotenoid = 59.29 µg/ml 30 day; PE =152.34 µg/ml 30 day),
Phormidium bohneri BTA183 (PC=206.14 µg/ml of 15th day), thNostoc spongiaeforme BTA131 (APC=84.73µg/ml of 15 day),
Phormidium tenue BTA138 (144.75 µg/ml ammonia excretion of th30 day) were found to be the potential candidates for natural
dyes and for biofertilizers.
Papers published from AMAAS work:
· S. Deepa Devi, Oinam, Gunapati, Indrama Devi, Th., Oinam,
Avijeet Singh, Tiwari, O.N. and Sharma, G.D. (2010): Ecology
and Biodiversity of Cyanobacteria. Assam University Journal
of Science and Technology: Biological and Environmental
Sciences Vol. 5. N.1: 6-13.
· Tiwari, O.N., Oinam, Gunapati and S. Deepa Devi (2010):
Development of potential starter culture of cyanobacterial
Biofertilizer to the terraced rice culture with special emphasis
of North east region of India. Assam University Journal of
Science and Technology: Biological and Environmental
sciences Vol. 6. N.1: 7-12.
· S. Deepa Devi, Thingujam Indrama & Tiwari, O.N. (2010):
Biodiversity analysis and reproductive cultural behaviour of
cyanobacteria of North east region of India having acidic
properties. Jour. of Plant Repro. Biol 2: pp.127-135.
· Oinam, Gunapati, Ojit Singh, K., and Tiwari, O.N. (2010): On
account of morphological and biochemical characterization
of some heterocystous cyanobacteria (nostocalean) of NE
Region of India falling under Indo-Burma biodiversity
hotspots towards having acidic properties. Biosci. Biotech.
Res. Comm. Vol. (3) No. (1): 26-32.
Exploitation of plant growth promoting rhizobacteria for sustainable agriculture
PI : Ashok KumarCo PIs : M. B. Tyagi, R. P. SinhaSchool of Biotechnology, Banaras Hindu University, Varanasi
Objectives
· Screening and isolation of diazotrophic bacteria from
Northern Plain especially from rhizospheric soils.
· Assessment of metabolic diversity among various
rhizospheric diazotrophic bacteria for plant growth
promoting ability such as N fixation, ammonia excretion, 2
IAA and siderophore production and P solubilization.
· Molecular diversity analysis employing various molecular
biological techniques.
· 16S rDNA amplification and sequencing for identification of
selected important isolates.
· Selection of most efficient strain having combination of all
the beneficial characters for use as PGPR.
Significant Achievements
· Cyanide production by PGPR appears to be added feature
and such isolates may be exploited as biocontrol agent.
· Community studies based on DGGE showed significant
diversity in bacterial populations in the rhizospheric soils of
same site in different seasons although bacterial profile
showed close homology to the samples collected in the same
season from a selected site.
· Estimation of in situ nitrogenase activity and IAA production
demonstrated that inoculated or the native isolates present in
the rhizosphere indeed act as plant growth promoting agent.
Estimation of IAA production in situ seems to be a novel
finding and needs detailed study.
· Nine isolates namely, VA8S1, VB4S6, C7S2, J2S5, MK11S3,
M2S3, GS8S5, MK11S2 and V1S7 showed excellent ACC
deaminase activity and could be exploited to manage the
ethylene stress, provided that they establish colonization in
rhizosphere of crop plants.
· Altogether 65 efficient isolates have been fully characterized
and identified by full length (8) and partial (57) sequencing of
16S rDNA.
· Based on sequencing results isolates such as Acinetobacter sp.
(VA2S2) and Cronobacter turicensis (M2S10) seem to be new
additions to the existing literature on rhizospheric bacteria
from North India.
Conclusion
Cyanide producing PGPR were used as biocontrol agent in
present study. Out of 65, only 9 isolates namely, VA8S1, VB4S6,
C7S2, J2S5, MK11S3, M2S3, GS8S5, MK11S2 and V1S7 were
showed excellent ACC deaminase activity and could be exploited
to manage the ethylene stress, provided that they establish
colonization in rhizosphere of crop plants. Based on sequencing
results isolates such as Acinetobacter sp. (VA2S2) and Cronobacter
turicensis (M2S10) seem to be new additions to the existing
literature on rhizospheric bacteria from North India.
AMAAS - Annual Report 2010-11
30
Exploration and screening of fungal diversity in North-East India and their applications in agriculture
PI : Bhim Pratap SinghDepartment of Biotechnology, Mizoram University, Aizawl, Mizoram
Rationale
North East India, an important part of the Indo-Myanmar
biodiversity hotspot, supports some of the biologically richest
areas in the world, which affords it recognition as an area of global
importance. Today, the forest cover in this region is merely one
third of its geographical area, and the rate of habitat loss here is of
serious concern. Despite its importance, this region has remained
poorly explored, and all evidence suggests much of the region's
diversity is being lost without even being recorded. A serious
problem that hinders effective prioritisation and evaluation for
site-specific conservation attention is the lack of baseline
biological data. Till now, very limited and isolated efforts were
made to tapping of microbial diversity, identification, evaluation,
molecular characterization, bioprospecting and conserving them
for various applications from North-Eastern region of India. So, it
need to be explored, investigated and exploited the potential of
fungal population which are not only beautiful but also selfless.
Moreover, this area is yet to be explored for fungal potential. Due
to richness of microbial diversity, the microbes are identified as
vital resources for extraction of newer and important molecules of
agricultural utility and also for expression of new gene. Therefore,
a systemic exploration, exploitation, characterization and
conservation of culturable and unculturable microbial diversity in
NE India will open up a new opportunity to explore the vast
potentialities of endemic microflora of this hot zone (NE region)
and also to preserve as a precious asset of rare genetic resources of
the country.
Objectives
· Collection of environmental samples (soil, water, plant,
decomposed matter etc) from different habitts of North-
Eastern States of India.
· Morphological and biochemical characterization
(siderophore production, phosphate solubilisation,
extracellular enzyme production like amylase, protease,
chitinase, pectinase etc of isolated fungal isolates).
· Molecular identification of potential isolates by using ITS
and ITS-RFLP.
· Phylogenetic relationship analysis based on IGS and some
important metabolic genes like Translation Elongation
factors (TEF), endo phosphogalactsidase (endo-PG), beta-
tubulin etc.
· Development of methods for the mass formulation of
efficient isolates.
Significant Achievements
· Different environmental samples were collected from
different places of eight districts of Mizoram (Kolasib,
Aizawl, Mamit, Champhai, Serchip, Saiha, Lunglei, and
Lawngtlai) and all sample vials are being maintaining at 4°C.
· On the basis of morphological characters, a total 559 isolates
were selected from eight districts of Mizoram by using six
different media.
· Isolates were screened for the for phosphate solubilization
ability by using the specific medium. Out of 400 isolates
screened, 110 isolates showed phosphate solubilization with
varying zone diameter.
· Amplification of Internal Transcribed Spacers (ITS) was
carried out for the identification of fungi by using universal
primers.
· In total, 14 identified cultures have been deposited in
NBAIM culture collection, 31 sequences of ITS region have
been submitted to NCBI GenBank (HQ596902-HQ596925
and HQ658111-HQ658117).
· Amplification of IGS and some important metabolic genes
like Translation Elongation factors (TEF), endo
phosphogalactsidase (endo-PG), beta-tubulin is being
carried out from of the isolated organisms
· Sampling is completed from Assam.
Conclusion
In total 559 isolates were isolated from all the eight districts
of Mizoram. All isolates have been screened for the ability to
solubilise phosphorous. Molecular characterization by using
various genes is underway for the identification of isolated fungal
isolates. All the photographs of fungal isolates are kept in
digitized format. Identified cultures are being maintained on
slants and in mineral oil.
Seminar, Symposia and Conferences attended
· S. Kanakala, C. Lalmingmawia, Bhim Pratap Singh.
Exploration and Characterization of Culturable Fungal Spp.
From Mizoram State of North-East India –at national
symposium on “Molecular Approaches for Management of
Fungal Diseases of Crop Plants” at Indian Institute of
Horticulture Research. December 2010.
· Mr Kanakala, SRF, attended National training program on
“Microbial identification and Gene Mining: A bioinformatics
Approach” from September 1-10, 2010, at NBAIM, MAU, U.P.
View of a sample collection site. P-Solubilisation efficiency. ITS-RFLP pattern of some of the isolates.
31
AMAAS - Annual Report 2010-11
Exploration of plant pathogenic and antagonistic microbial resources associated with vegetableand spice crops of Andaman and Nicobar Islands
PI : Krishna KumarCentral Agricultural Research Institute, Port Blair, Andaman & Nicobar Islands
Rationale
Microorganisms constitute a huge and almost unexplained
reservoir of resources likely to provide innovative applications
useful to man. Because of its richness in overall species diversity,
India is recognized as one of the 12 mega diversity regions of the
world. Besides the recognized hot spots like Western Ghats and
Northeastern hill region in India, is endowed with other rich
biodiversity locales like Andaman and Nicobar Islands abode to
large unexplored microbial diversity. Therefore, existence of
agriculturally and industrially potential microbial strains with
diverse genetic resources cannot be ruled out in these regions. The
systemic exploration, exploitation, characterization and
conservation of culturable microbial diversity in Andaman and
Nicobar Islands, India will open up a new opportunity to explore
the vast potentialities of resident microflora of these regions and
also to preserve as a precious asset of rare genetic resources of the
country.
Objectives
· To isolate and characterize phyllosphere and soil borne plant
pathogens associated with vegetable crops and spices from
coastal agro-ecosystems of Andaman and Nicobar islands.
· To isolate and characterize antagonists (Pseudomonas spp.,
Bacillus spp. and Trichoderma spp.) associated with
rhizosphere of spices and vegetable crops.
· To evaluate in vitro the isolated antagonistic microorganisms
for their biocontrol and plant growth promoting properties.
· Molecular characterization and diversity analysis of isolated
plant pathogens and antagonistic microorganisms.
Significant Achievements
· A total of 22 Trichoderma spp isolated from Middle and North
Andaman and Hut Bay (6º to 14ºN and 92º to 94ºE) Islands
were characterized based on cultural, morphological and
antagonistic properties.
· Based on the cultural and morphological characterization the
isolates were classified into three section viz., Trichoderma
(clade: Rufa and Pachybasium A), Pachybasium B (clade:
Pachybasioides, Lutea, Virens and Lixii/Cataptron) and
Section Longibrachiatum. Under section Trichoderma three
species were identified as T. atroviride (5 nos), T. konigii (1), T.
hamatum (1). Under Pachybasium B Section six species were
identified as T. minutisporum (1), T. polysporum (1), T.
brevicompactum (1), T. virens (4), T. crassum (1) and T.
harzianum (1).
· In vitro antagonistic potential of Trichoderma spp showed
activity against R. solani (27.0%), Macrophomina sp (22.0%), S.
rolfsii (50.0%) and Fusarium sp (36.0%), respectively. Among
the isolates T. longibrachiatum and T. virens showed statically
good antagonistic activity against any of the three pathogens
tested.
· A total of 102 isolates were recovered from the site of Active
Volcano (Barren Island) (12º17'40.1 N; 93º50'54.5 E). These
isolates were studied for antagonistic, PGP, salt tolerance
and thermo-tolerant properties.
· Results revealed 10.8% isolates were grown up to 25% NaCl
(w/v) concentration and isolates BAN52, BAN88, BAN96
and BAN100 grown up to 30% NaCl (w/v) concentration,
20.6% of the isolates were showed thermotolerant properties
grown at 72ºC four isolates viz., BAN53, BAN74, BAN76 and
BAN92 were grown at 82ºC whereas, BAN53 was grown at
92ºC. In PGP, hydrolytic enzymes properties the isolates
showed positive to results to IAA (57.8%), siderophore
production (55.9%), phosphate solubilization (33.3%),
protease (41.2%), cellulase (23.5%), amylase (41.2%) and
lipase (25.5%), respectively.
· In antagonistic properties the isolates showed antagonistic
activity against S. rolfsii (14.7%), R. solani (19.6%) and
Macrophomina sp (29.4%). A total of 21 isolates (20.6%) were
showed all four properties viz., Antagonistic, PGP, salt
tolerant and thermo-tolerant properties. These isolates could
be used as bioinoculants in the extreme environments.
· Classical staining and biochemical properties showed most
of the isolates were belonged to Gram positive and belonged
to genus Bacillus spp. Further identification and confirmation
with Biolog and 16S rRNA gene sequence is in the process.
· Total 114 isolates from Middle and North Andaman Islands
were screened in vitro for their Plant Growth Promoting
(PGP) traits and hydrolytic enzymes.
· Isolates showed positive results to IAA (50.8%), phosphate
solubilization (58.6%) and siderophore (95.6%). All isolates
showed ammonia production whereas none of the isolates
showed HCN production. These isolates also produced cell
Barren Island(Active Volcano)
Antagonistic potential ofactive volcano isolates
Cellulase production byrhizobacteria
AMAAS - Annual Report 2010-11
32
wall degrading enzyme; amylase (63.7%), cellulase (51.7%),
lipase (22.4%), pectinase (13.1%), chitinase (26.7%) and
protease (81.8%) on agar plate method.
· The potential isolates were identified by using physiological
and biochemical method using Himedia kit and belonged to
the genus Pseudomonas sp., Enterobacter sp., and Bacillus sp.
Conclusion:
A total of 218 bacterial isolates and 22 Trichoderma isolates
were screened for antagonistic, plant growth promoting
properties and hydrolytic enzymes properties, showed only very
few bacterial strains have all the properties together. In this study
we also observed few bacterial isolates could tolerate up to 30%
NaCl (w/v) and more than 80ºC. We have stored the bacterial
isolates having novel properties.
Papers published from AMAAS work:
· Krishna Kumar, N. Amaresan, Someshwar Bhagat, K.
Madhuri and R.C. Srivastava. 2010. Isolation and
characterization of rhizobacteria associated with coastal
agricultural ecosystem of rhizosphere soils of cultivated
vegetable crops. World Journal of Microbiology and
Biotechnology (DOI 10.1007/s11274-010-0616-z).
· Krishna Kumar, N. Amaresan, Someshwar Bhagat, K.
Madhuri, P. Udayaraj and R.C. Srivastava. 2010. Genetic and
physiological relatedness of antagonistic Trichoderma isolates
against soil borne plant pathogenic fungi. Archives of
P h y t o p a t h o l o g y a n d P l a n t P r o t e c t i o n ( D O I
10.1080/03235408.2010.505362).
· Krishna Kumar, N. Amaresan, Someshwar Bhagat, K.
Madhuri and R.C. Srivastava. 2010. Unreported species of
Trichoderma isolated from tropical regions of Andaman and
Nicobar Islands in India. Journal of Mycology and Plant
Pathology. 40(3): 314-321.
· Krishna Kumar, Someshwar Bhagat, K. Madhuri, N.
Amaresan and R.C. Srivastava. 2010. Morphological and
Molecular Characterization of Colletotrichum species causing
Anthracnose disease in Bay Islands, India. Journal of Mycology
and Plant Pathology. 40(3): 322-330.
· Krishna Kumar, K. Madhuri N. Amaresan, Someshwar
Bhagat and R.C. Srivastava. 2010. First report of leaf
anthracnose caused by Colletotrichum gloeosporioides on egg
plant in Andaman and Nicobar Islands. Journal of Mycology
and Plant Pathology. 40(3): 464-466.
· Krishna Kumar, N. Amaresan, Someshwar Bhagat, K.
Madhuri and R.C. Srivastava. 2010. In vitro antagonistic
properties of some Trichoderma spp against root rot and foliar
pathogens. Indian Journal of Microbiology (Accepted-
Manuscript No. INJM-D-10-00171).
Seminar, Symposia and Conferences attendedth· 9 National Symposium on Crop Health Management for
Sustainable Agri-horticultural Cropping System held at
Central Agricultural Research Institute, Port Blair from 17-
19, Feb 2011.
Mapping, assessment of geographical distribution and in vitro conservation of agriculturally importantmicroorganisms of the Western Ghats
PI : D. RadhakrishnaCo-PI : B. C. MalleshaUniversity of Agricultural Sciences, GKVK, Bangalore
Rationale
The research work on microbial diversity and Identification
of Western Ghats has been carried out in the forest area situated in othe central region extending over the area 13.038 N latitude to
o10.883 N latitude, which includes the districts of Hassan, Kodagu,
Dakshinakannada and Chikmagalur. The grid system used for
soil sample collections from the forest regions. The grid, each of
6km area, covering districts of Hassan, Kodagu, Chikmagalur and
Dakshina Kannada forests. During this year forest soil samples
and other degrading wood samples were collected from different
forest regions covering Western Ghats of Kodagu district have
been surveyed and nearly 160 soil samples including decaying
wood and litter have been collected from different talukas.
Microorganisms have been isolated from these samples. Soil
microbial functional diversity determined based on the functional
properties namely, Lignin degrading microorganisms, Cellulose
degraders-Bacteria & Fungi, Chitin degraders, Vesicular
Arbuscular Mycorrhizae, phosphate solubilization, Fluorescent
pseudomonads. All the microbial isolates were evaluated for
there efficiency for different functional properties mainly,
nitrogen fixation, Phosphate solubilization, Plant growth
promotion biocontrol through plant bioassay and in vitro
analyses.
Objectives:
· Isolation, enumeration, characterization and inventorization
of AIM. (N fixers, P-solubilizers, VAM, PGPRs, fluorescent 2
pseudomonads, chitin decomposers, cellulose and lignin
degraders) along the central regions of Western Ghats in
Karnataka).
· Assess the geographical distribution and developing
thematic maps for the above groups of organisms.
· Assess the functional potentials of each group of organisms
for use in agriculture.
· Set up the culture bank of the potential isolates under each
group and deposit with the NBAIM.
· Set up the Western Ghats region specific database on the
population and diversity of AIMs.
Significant Achievements
• Samplings were done in different land use patterns of Hassan
forest region.
• Sixteen isolates of actinomycetes have been purified from
• Two bacterial isolates SAPSB1 and AEB1 that showed
efficient phosphate solubilisation activity on Pikovskaya's
Agar isolated and have been subjected to preliminary
characterization.
33
AMAAS - Annual Report 2010-11
Kenknight's Agar medium from rhizosphere soils of forest
plants.
• Higher density of actinomycetes was observed due to high
humus content.
• Nitrogen fixing bacteria showed different bacteria based on
the morphology which needs molecular confirmation about
the isolates .
• Quantitative variations observed with different media used,
reflecting the diverse population or media utilization.
• A lignocellulolytic basidiomycetous fungi was isolated from
decaying wood. These fungi grown in laboratory failed to
produce fruiting bodies on any of the substrates.
• Thirteen distinct yeast colony morphotypes were isolated
from phylloplanes of A. occidentale, M. indica and S.
kathalekanensis .
• In total 121 is isolates of nitrogen fixing bacteria, 84
Pseudomonads, 56 phosphate solubilising bacteria, 20 lignocellulose fungi, 10 actinomyceces, 12 Trichoderma sp., and 20 yeast have been conserved and preserved.
Conclusion
Microbial diversity in the kodagu forest area showed varied
distribution depending on the forest type. Bacterial and fungal
population was maximum in evergreen forests than the
deciduous type. Bacterial population showed different
morphotypes from the same sample when different carbon
sources used. Fungal extracts when applied to soil showed
stimulatory effect on beneficial soil microorganisms. Yeast
population characterized and its functional properties studied for
further applications. Degradative properties of the efficient
decomposing fungi assayed for utilization of phenols. And also
cellulose and pectins. Comparitive degradation potentials of
white rot fungal isolates determined by comparison of phenol
content released.
Map showing the locationof sampling sites
Morphotypes of nitrogen fixing bacteria
Fungal isolate HE2F efficientlignocellulolytic from forest litter
Isolation and characterization of microorganisms from fresh water ecosystems
PI : N. K. MaitiCo-PI : Sri Prakash MohantyCentral Institute of Freshwater Aquaculture, Bhubaneswar, Orissa
Rationale
The unit of biodiversity is the species, which may be defined
as “a group of related organisms that is distinguished from similar
groups by a constellation of significant genotypic, phenotypic and
ecological characteristics.” The living organisms which are
components of the Earth's biodiversity can be harnessed, to
produce or modify products or undertake specific tasks or
processes that are commonly beneficial to human society, or
generate useful substances. Today, a variety of microorganisms
are used in different industrial applications as producers of
antibiotics, enzymes, food colorings, flavorings, organic acids and
vitamins. The discovery of a new potential industrial application
of a microorganism depends to a large extent upon the discovery
of new types of microorganisms and their metabolites. Therefore,
by focusing on the isolation and screening of new and rare
bacteria and fungi the possibilities of discovering new products
can be increased. Antibiotics and microbial enzymes are very
important products of microorganisms. Most commercial
antibiotics are produced either by fungi or by bacteria. Also, the
microbial enzymes are mainly focused on production processes in
the food industry, on production of washing powders and
detergents, and applications in the textile manufacture. Also,
many other important applications include organic synthesis,
medical diagnostics and research activities. Various enzymes
produced by the microorganisms are lipases, proteases, α-
amylases, ligninases, cellulases, hemicellulases, etc., find a wide
scale application in different aspects of industrial microbiology.
Freshwater ecosystems represent a unique ecosystem and may
harbor novel microbial flora. Microorganisms present in soil play
an important role in nutrient solubilization, mobilization and
recycling. They have wide potentialities by controlling soil-borne
pathogens, increasing nutrients availability and accelerating
decomposition of organic materials, and are anticipated to
increase fish production as well as maintain sound environments
for fish production. Microorganisms have the ability to rapidly
adapt to varied environmental conditions and utilize new
substances they encounter as their sole source of carbon and
energy. The aim of the project is to understand microbial
AMAAS - Annual Report 2010-11
34
Orissa map showing sample (.)collection sites.
MspI digestion of 16S-rDNA PCR product ofammonia oxidizing bacteria.
Ammonia oxidising activity of bacterialisolates after 24 h incubation.
diversity in natural habitat.
Objectives
· To assess the microbial diversity from freshwater ecosystem.
· To assess the functional diversity of microorganisms isolated
from freshwater ecosystem.
· To find out the correlation between phenotypic and genomic
characteristics.
· To evaluate the comparative efficacy of molecular tests to
study the diversity of microorganisms.
Significant Achievements
· A total of 110 bacteria were isolated with different functional
types.-3· Load of different functional types were: Amylase- 1.2x10 to
-4 -3 -4 -31.4x10 , Cellulase-0.2x10 to 1.7x10 , Xylanase- 5x10 to -3 -3 -3 -3 -1.4x10 , Lecithinase- 2x10 to 6x10 , Protease-0.4x10 to 2x10
3 -3 -5, Zinc, Lead, Arsenic, Cobalt- 2.4x10 to 1.2x10 .
— 24 bacterial isolates showed resistance to 0.5mM methyl
parathion out of which 9 isolates degrade p-nitrophenol, a by
product of methyl parathion degradation pathway and
produces nitrite from p-nitrophenol.
— Kinetics of enzyme endoglucanase of three strains of Bacillus
subtilis was studied.
— Endoglucanase gene of three isolates of Bacillus subtilis were
cloned and sequenced in order to find out correlation
between gene sequence and enzyme activity.
— Twenty one ammonia oxidizing bacteria like P. aeruginosa,
Citrobacter spp., Morganella morganii, P. fluorescens, Alcaligens
feacilis and Prividencia vermicola were isolated, of which five
were having terminal denitrification activity, which reduces
nitrate to nitrite. In addition, these isolates were also positive
for cellulase, lipase, protease and phophatase and also grow
in presence of arsenate and arsenite.
— The enzymes associated with ammonia oxidation were
estimated and the all isolates were found to express
ammonium monooxygenase, nitrite reductase and nitrate
reductase enzymes in ammonium nitrate medium at
elevated level as compared to control.
— Genotyping of ammonia oxidizing bacteria were carried out
by16S PCR-RFLP.
— Nitrite reductase AMO genes were detected in the ammonia
oxidizing isolates by PCR.
— A total 40 arsenic resistant bacteria were isolated of which 39
isolates showed growth upto 200 mM of arsenate where as
in arsenite 18 isolates showed growth upto 100mM.
— In redox transformation assay 17 isolates reduced arsenate
and two isolates caused both reduction and oxidation.
— Reductase gene was identified in 21 isolates by PCR.
— From hot spring Bacillus licheniformis, Brevibacillus
limnophilus, Klebsiella pneumoniae. Paenibacillus popillae.
Leclercia spp., Pseudomonas aeruginosa were isolated which 0produce proteases and celluase enzymes at 45-55 C.
— 16S r DNA of 61 bacteria have been sequenced.
Conclusion
In freshwater ecosystems wide varieties of functional types
were present. The predominant functional types are multiple
heavy metal resistant bacteria, although other types were present
but their abundance are less. Nine methyl parathion degrading
bacteria which degrade methylparathion to nitrate are probably
promising candidates for bioremediation of pesticides. Higher
endoglucanase activity of Bacillus subtilis depends on presence of
certain amino acids in the gene. Several bacteria were isolated
from hot spring which grows in arsenate upto the concentration of
200Mm.
Diversity analysis of diazotrophic bacteria from wheat cropping system of different agroclimaticzones of Punjab
PI : S. K. GosalCo-PIs : G. S. Saroa, Yogesh VikalPunjab Agricultural University, Ludhiana, Punjab
Objectives
· To study the taxonomical and functional diversity for
diazotrophs in different agroclimatic regions of Punjab for
sustainable agriculture.
· Conservat ion of microbial divers i ty for their
commercial/genetically exploitation in future.
Significant Achievements
· A total of 180 diazotrophs were isolated from different
35
AMAAS - Annual Report 2010-11
agroclimatic regions. Fifty-five diazotrophs out of 180
isolates were found to solubilize phosphorus showing dual
activity.
· Forty eight isolates were found to be positive for Nif H in
Central Plain and twenty six from Flood plain region, using
two different Nif H primers (Nif H1 and Nif H2).
· At 40% similarity coefficient the isolates belonging to Central
plain region and flood plain region were grouped into two
major clusters and further in subgroups indicating that
genetic diversity exists for diazotrophic isolates in different
region of Punjab.
· Cultures were identified on partial 16S rRNA gene
sequencing and were identified as Stenotrophomonas
maltophilia, Bacillus amyloliquifaciens, Bacillus circulans,
Pseudomonas aeruginosa, Paenibacillus sp., Paenibacillus panacisoli, Azotobacter vinelandii, Paenibacillus amyloliticus,
Pseudomonas putida, and Bacillus subtilis.
· Paenibacillus amyloliticus was isolated from soil having pH 5.3
and higher ammonical nitrogen as 110 mg/kg whereas
Azotobacter vinelandii and Pseudomonas putida were isolated
from soil having high ammonical nitrogen 119 mg/kg.
· Identified cultures were tested for PGP activity under glass
house conditions using maize as host and Bacillus subtilis was
found to be the best in terms of plant growth parameters and
Pseudomonas putida in terms of nitrogen uptake.
Conclusion
A total of 180 diazotrophs were isolated from different
agroclimatic regions. Fifty-five diazotrophs out of 180 isolates
were found to solubilize phosphorus showing dual activity.
Cultures were identified on partial 16S rRNA gene sequencing
and were identified as Stenotrophomonas maltophilia, Bacillus
amyloliquifaciens, Bacillus circulans, Pseudomonas aeruginosa,
Paenibacillus sp., Paenibacillus panacisoli, Azotobacter vinelandii,
Paenibacillus amyloliticus, Pseudomonas putida, and Bacillus subtilis.
Paenibacillus amyloliticus was isolated from soil having pH 5.3 and
higher ammonical nitrogen as 110 mg/kg whereas Azotobacter
vinelandii and Pseudomonas putida were isolated from soil having
high ammonical nitrogen 119 mg/kg.
Pot experiment under glass houseconditions using maize as host.
PCR amplification using(a) Nif H1 (b) Nif H2 primers.
Phylogenetic tree of identifiedbacterial cultures.
Microbial diversity and identification: fish microbes
PI : Imelda JosephCentral Marine Fisheries Research Institute, Ernakulam, Cochin, Kerala
Rationale:
Prokaryotic microorganisms compromise a large portion of
the organic biomass of the world's ocean and play an important
role in essential biogeochemical cycles and food webs in this
ecosystem. In particular surface colonization by microorganisms
is ubiquitous in marine systems with a large proportion of
microbes occurring as complex communities. Often the negative
impacts of microorganisms on humanity occur at surfaces- be it
the surfaces of seafood (fish, oysters etc.) or fouling of ships' hulls.
However, despite their importance, comparatively little is known
about the phylogenetic composition of this complex microbial
population and the functional roles of their members. Living
surfaces are ideal system in which to explore colonization by
microorganisms because eukaryotes are subject to a constant
bombardment from the millions of microbial cells typically found
in a milliliter of seawater. Alternatively, disease-causing microbes
might already be present on fishes and their surroundings. So a
survey and analysis of bacteria associated with marine fish give an
indication of the environmental condition like water quality, feed
availability, productivity etc, or the presence of pathogens, which
may cause havoc to the system or to the consumers. Also many
associated bacterial strains find wide application in agriculture
and allied sectors based on their biochemical/ physiological
characteristics.
Objective:
· To screen bacterial groups from selected marine fish and
shellfish.
· To identify the selected groups by physiological and
biochemical tests.
· To identify microorganisms using ribosomal RNA gene
sequences.
· To develop 16S group probes for assessing the diversity of
bacterial groups.
Significant Achievements:
· Sample collection: Healthy live marine fish and shrimp
samples were collected from Karwar (N- 13°05.722'; E-
079°48.658') and Mangalore regions (N- 12°51.232'; E- 074°
50.012' & N- 13°20.808'; E- 074°42.083') of Karnataka,
Bhimavaram (N- 16°23.094'; E- 081°37.440') and
Visakhapatnam (N- 17° 41'42”; E- 083° 18'06”), Andhra
Pradesh and from Kochi, Kerala.
AMAAS - Annual Report 2010-11
36
Pigmented skin isolates fromMugil cephalus and Johnius sp.
Penicillin sensitivity (22 mm dia) expressed byan isolate from Liza macrolepis.
· Phenotypic characterization has been completed for 16
bacterial strains isolated from Malabar thryssa Thryssa
malabarica, Jew fish Nibea solado, Seven-finger threadfin
Polynemus heptadactylus, and Small-scale tongue sole
Cynoglossus microlepis from Calicut, Kerala. Vibrio spp. was
the dominant strain on skin, gills and viscera of the fishes.
Apart from Vibrio spp., the other isolates found in the viscera
were Pseudomonas and Staphylococcus spp.
· Phenotypic characterization for 43 bacterial strains from false
trevally Lactarius lactarius, Pugnose pony fish Secutor
insidiator, Croaker fish Johnius spp., Bloch's gizzard shad
Nematalosa nasus and Indian pompano Trachinotus mookalee,
from Site 1 at Karwar has been completed. Pseudomonas spp.
was the dominant isolate in the skin gills and viscera. Gills
also harboured Arthrobacter, Bacillus, Enterobacteriaceae ,
Microcoocus and Vibrio spp. Other isolates from the viscera
were Aeromonas, Arthrobacter and Vibrio spp.
· Phenotypic characterization completed for 5 bacterial strains
from large scale mullet Liza macrolepis, from Kochi, Kerala.
Bacillus spp. was the dominant strain on skin, gills and
viscera of the fish. Apart from Bacillus spp., the isolate found
in the skin was Micrococcus spp. and that in the gills was
Arthrobacter spp.
· Phenotypic characterization completed for 12 bacterial
strains, isolated from the skin, gills and gut of Milk fish
Chanos chanos and Mozambique tilapia Tilapia mossambica, 2
strains from the gut of live white-leg shrimp Litopeneaus
vannamei from Bhimavaram, Andhra Pradesh. Skin and gills
of the fishes harboured Pseudomonas and Arthrobacter spp.,
whereas isolate found in the viscera was Acinetobacter spp.
Enterobacteriaceae spp. was the only visceral isolate from
white-leg shrimp.
· Phenotypic characterization completed for 38 bacterial
strains, isolated from the skin, gills and gut of Silver ribbon
fish Lepturacanthus savala, Monocle bream Parascolopsis
aspinosa, Whipfin mojjara Gerres filamentosus, Indian scad
Decapterus russeli and Dusky finned bull's eye Priacanthus
hamrur, and for 5 bacterial strains from the gut of prawns,
Kadal shrimp Metapenaeus dobsoni and Speckled shrimp M.
monoceros from Site 1 at Mangalore. Micrococcus and
Pseudomonas spp. were the dominant strains on the skin and
gills. Other isolates on gill were Acinetobacter, Arthrobacter
and Moraxella spp. Viscera was dominated by Arthrobacter
spp. and other isolates were Micrococcus and Pseudomonas
spp. Acinetobacter and Bacillus spp. were the visceral isolates
of speckled shrimp and that of Kadal shrimp was
Pseudomonas spp.
· Phenotypic characterization has been completed for 31
bacterial strains, isolated from Red-filament threadfin bream
Nemipterus mesoprian, Flat-head grey mullet Mugil cephalus,
Croaker fish Johnius sp. and Lutkei's half-beak Hemiramphus
lutkei collected live from Site 2 at Mangalore. Pseudomonas
and Acinetobacter spp. were the dominant isolates of skin,
gills and viscera. Other isolates include Micrococcus spp. on
skin, Lactobacillus spp. on gills and Arthrobacter spp. in the
viscera.
· Twenty five bacterial cultures comprising halophilic,
pigmented, alkaliphilic, and heat tolerant strains were
identified using 16S rRNA sequence analysis.
· Eight bacterial cultures of different functional properties
were submitted to the nodal centre (NBAIM) along with their
passport data.
· Work in progress includes isolation of bacteria from
Visakhapatnam (AP) samples.
Conclusion:
During 2010-11, a total of 152 bacterial strains have been
isolated, of which 145 strains were from 21 marine finfish species
and 7 from 3 shrimp species. Study on functional diversity of the
bacterial isolates from different marine fishes and shrimp have
shown many of them to be halophilic, alkaliphilic, heat tolerant,
pigmented or fluorescent. Molecular characterization of 25 strains
having distinct functional properties was done and 8 different
strains along with their passport data have been submitted to
NBAIM culture collection.
Seminar, Symposia and Conferences attended:
· Susmitha, V., Imelda-Joseph and Anu-Mathew, 2011.
Isolation and characterization of extremely halophilic
bacteria Halomonas aquamarina and Halomonas marina from
trigger fish Abalistes spp. Presented in the International
Conference, Asian Pacific Aquaculture- 2011 at Kochi (17-20
January, 2011), Abstract No: 485.
· Anu-Mathew, Imelda-Joseph and Susmitha, V. 2011.
Characterization of Pseudomonads isolated from Indian
pompano Trachinotus mookalee. Presented in the International
Conference, Asian Pacific Aquaculture- 2011 at Kochi (17-20
January, 2011), Abstract No: 339.
37
AMAAS - Annual Report 2010-11
Diversity, genetic improvement and cultivation of the medicinal mushroom Reishi (Ganoderma lucidum)
PI : R.D. RaiCo-PI : Ranjeet Ranjan KumarDivision of Biochemistry, Indian Agricultural Research Institute, New Delhi
Rationale
Reish or Ling Zhi (Ganoderma lucidum) is therapeutically as
well as commercially the most important mushroom of the world;
global trade of this mushroom and its products has crossed 3bn $
mark and annual trade in India has been estimated at Rs. 500
crore. China with 70% share in the global trade has almost a
monopoly over this mushroom. With a view to exploiting this
mushroom for health as well as financial benefits, it was thought
important by the Indian Council of Agricultural Research to
develop technology for its production and a breakthrough in this
direction was achieved at the National Research Centre for
Mushroom, Solan. However, need was felt to strengthen the
program with respect to collecting, identifying and exploiting the
indigenous Ganoderma lucidum strains and small beginning was
made by launching a sub project on this mushroom, in the theme
Microbial Diversity of the ambitious AMAAS project of ICAR,
being coordinated by the NBAIM Mau. More than 100 species
have been described in the genus Ganoderma but with the latest
molecular tools about 30 species have been selected to be true ; rest
turned out to be synonyms. But academically, therapeutically as
well as commercially, Ganoderma lucidum is most important and
to the extent that even other species (G. tsugae, G. sinense) are
produced and marketed as G. lucidum. In view of the above, the
project aims at collecting, identifying and exploiting the
indigenous G. lucidum strains only; India, a predominantly
tropical and sub-topical country is rich in the Ganoderma
germplasm. Besides microbial diversity, refinement and
improvement in its production technology and understanding
the molecular mechanisms of its growth and fruiting have also
been proposed to be addressed to which may lead to finding
superior indigenous G. lucidum strains with respect to the health
and commercial benefits.
Objectives
· Molecular characterization of newly collected strains
· Preliminary yield trials
· Isolation of SSIs for genetic improvement from selected high
yielding strains
· Improvement in production technology – newer substrates,
supplements and improved cultural practices
Significant achievements
· One hundred and five specimens of Ganoderma spp. were
collected from Delhi,Haryana,Chandigarh and Himachal
Pradesh, out of which 25 yielded positive mycelium culture
· One highly sporulating strain was most significant collection
– Ganoderma spores are highly prized and have very big
market
· Five cultures were molecularly identified as G.lucidum based
on sequencing of 5.8s r DNA
· One strain turned out to be a true Ganoderma tsugae
· Oil palm bunch waste and coconut leaf rachis were found to
be the best substrates for the production of extracellular
degradative enzymes viz. laccase, lignin peroxidase (LiP), ++ Mn peroxidase (MnP) by G. lucidum
· Newer substrates namely sawdust of Jamun and Mahua
were tried for cultivation of G. lucidum but the yields were
significantly lower than that on mango sawdust
· However, no significant progress could be achieved in
germinating the spores of G. lucidum - addition of succinate
proved futile but presoaking (10h) followed by boiling (2
min) gave encouraging results.
Conclusion
North India is also a significant area for finding true
Ganoderma lucidum. Some very shining and highly sporulating
strains of G lucidum were collected. Mango sawdust + wheat bran
were the best substrates for production of G. lucidum. Coconut leaf
rachis and Oil palm bunch were also found to be the promising
substrates but the technology of their use needs further
investigation. Above mentioned substrates were found superior
for production of lignin modifying enzymes, namely laccase, ++lignin peroxidase and Mn peroxidase.
Paper published from AMAAS work:
· Rai, RD and Kumar, RR. (2011). Dynamic production of the
lignolytic enzymes during various stages of mycelial growth,
fruiting and development of Ganoderma lucidum. Int. J. Med
Mushroom (in press)
· Kumar Satish, Sharma, VP and Rai, RD (2009). Lassioderma
serricone Fabricius pest of dried Ganoderma spp. Mushroom
Res. 18(2): 91-92
Development of a library of putative probionts from freshwater environment belonging to the group lactic acidbacteria for application in freshwater aquaculture system
PI : Sri Prakash MohantyCo PI : N. K. MaitiCentral Institute of Freshwater Aquaculture, Bhubaneswar, Orissa
Rationale
Fish diseases are one of the major problems in the
aquaculture industry. Although vaccines are being developed
and commercially produced, there are limitations in using them
as a regular disease control measure. Unlike terrestrial animals,
there are inherent difficulties in vaccination of aquatic animals
like fish. The use of antibiotics to cure bacterial infection and
prevent fish mortality in aquaculture is becoming limited as
pathogens develop resistance to the drugs administered. Again,
beneficial bacterial flora are killed or inhibited by antibiotic
administration/application in ponds/water bodies, leading to
the felt necessity of finding alternate disease prevention methods
AMAAS - Annual Report 2010-11
38
such as exploring the use of non pathogenic bacteria as probiotic
agents. The use of commercial probiotics in fish and its efficacy
has been under scanner. Different investigators have reported
with various degree of success and failure on the use of such
probiotics as a formidable alternate to general vaccination. Hence,
there is possibility in finding native probiotics from
fish/freshwater aquaculture systems and employing them as fish
probiotics, as they are expected to well adapt the fish intestinal
environment and exhibit their action. Hence, the investigations
are being carried out with specific objectives, which will have
practical field utility, once the isolates are characterized and tested
under controlled conditions.
Objectives
· To isolate and identify Lactic acid bacteria (LAB) from
freshwater aquaculture system.
· To authenticate LAB isolates as potential probiotics through
controlled wet laboratory experimentations.
Significant Achievements
· Freshwater fish samples of Indian Major Carps were
collected from organized as well as unorganized aquaculture
sectors.
· Method was standardized for the isolation of lactic acid
bacteria from fish intestinal samples.
· 17 intestine samples were analyzed and 15 isolates were
presumed to be lactic acid bacteria.
· 16S partial rDNA sequencing was done for all 15 isolates and
six isolates were found belonging to the genus Lactobacillus
and one to genus Pediococcus.
Conclusion
The original title approved 'Development of a library of
Putative Probionts from marine environment belonging to the
genus Pseudomonas, Micrococcus and Bacillus for application in
marine system' was under review as CIFA, Bhubaneswar is a
Freshwater Aquaculture Research Institute. Consequently, the
title was modified as 'Development of a library of Putative
Probionts from Freshwater environment belonging to the group
Lactic acid bacteria for application in freshwater aquaculture
system' during the last review meeting in August 2010. Further
isolation of lactic acid bacteria from fish intestine are on and after
identifying, characterizing and putting them to different tests,
strains will be submitted to NBAIM.
Seminar, Symposia and Conferences attended
· Undergone Overseas training for three months to Auburn
University, Alabama, USA from 11 October 2010 to 10
Janvary 2011.
Diversity of lactic acid bacteria in fermented food and dairy products from food and dairy units located inSouthern Rajasthan
PI : R. SrinivasanCo PIs : P. Subramanian, N. S. RathoreCollege of Dairy and Food Science Technology, Maharana Pratap University of Agriculture and Technology, Udaipur, Rajasthan
Rationale
Rajasthan is India's largest state with population of 56 million
and a density of 165 persons per sq. kms. The state is characterized
by diverse terrain ranging from desert and semi-arid regions of
western Rajasthan to the greener belts east of the Aravalis and the
hilly tribal tracts in the south-east. More than 60 percent of the
state's area is desert with sparsely distributed population.
Agriculture is dependent on rainfall and failure of monsoon
causes severe drought and scarcity conditions. After agriculture,
cattle and other livestock are the most important sources of
livelihood in the state, especially for the poor. In the western
regions of the state, with limited farming potential, livestock
provides livelihood security. Animal husbandry is a more stable
source of livelihood than farming since it is less affected by failure
of rains than is agriculture. Animal husbandry contributes over
13% to the gross domestic product. Rajasthan with the highest
livestock population in India contributes nearly 40% of wool
production and 10% of all milk production in the country.
Rajasthan is being the third largest milk producing state in India.
It is with this background this study is being carried to obtain the
diversity of Lactic acid bacteria from southern parts of Rajasthan.
Objectives
· Survey and Isolation of Lactic Acid Bacteria (LAB) from
fermented food and dairy products from different food and
dairy units located at southern parts of Rajasthan.
· Characterization of the isolates using biochemical and
molecular methods.
· Identification of LAB up to species level using 16S rDNA
amplification and sequencing.
· Preservation of the cultures isolated and characterized and
submission to culture collection.
· Screening of the isolates for the production of bacteriocins
(like nisin, etc.) and other antimicrobial substances.
· Testing for their effect on different spoilage organisms
obtained from culture collection.
· Testing for their role in food preservation and
characterization of the selected isolates' antibacterial
compounds.
· Production of nisin and/or other antimicrobial compounds
at laboratory scale to study for scaling up purpose.
Significant Achievements
· Three survey works have been conducted to cover the entire
region of southern Rajasthan covering the latitude ranging
from 23º 30' N to 25º 56' N and longitude ranging from 71º 25'
E to 76º 33' E.
· A total of 675 samples like milk, curd, buttermilk were
collected from different possible sources viz., cow, buffalo,
goat, sheep, camel from various dairy units, individual
farmer's households.
· A total of 470 Lactic acid bacterial (LAB) isolates were
isolated by using selective media MRS and M17 at different
39
AMAAS - Annual Report 2010-11
Morphological studies: SEMview of Lactobacillus.
Screening for bacteriocin activityby LAB isolates
PCR amplification of 16S rDNAof LAB isolates
incubation temperatures viz., 30º, 37º and 45º C so as to obtain
all possible LAB isolates available from the samples.
· Biochemical characterization of LAB isolates was done for all
LAB isolates and tentatively identified up to species level
· Molecular characterization of LAB isolates viz. isolation of
genomic DNA, PCR amplification of 16S rDNA gene and
restriction of amplified DNA products using various
restriction enzymes viz. HaeIII, HindII, EcoRI and sequencing
16S rDNA gene of selected isolates is being carried out.
· Screening for bacteriocin production by the LAB isolates
against food spoilage/pathogenic organisms like
Staphylococcus aureus and Micrococcus luteus was done and 40
out of 470 isolates screened were showing antibacterial
activity.
· Five among 40 bacteriocin positive isolates were further
studied for their chemical nature (protein) to confirm the
antibacterial factor as bacteriocin, and tolerance to high
temperature up to 100ºC.
· A total of 60 yeast isolates which can utilize lactose were also
isolated by using selective medium.
· Yeast isolates were screened for their protease (rennin like
enzyme) production by curdling without acid production
and 9 isolates were found positive.
· Characterization of lactose utilizing yeast isolates is being
carried out using ITS amplification and restriction analysis.
Conclusion
A diverse lactic acid bacteria were isolated from fermented
food and dairy products from all possible sources like milk, butter
milk, curd from cow, buffalo, goat, sheep and camel.
Identification based on 16S rDNA revealed significant diversity
among lactic acid bacteria. Biochemical analysis revealed
bacteriocin production by majority of isolates. Which can be
utilised further to prevent food spoilage by pathogenic
organisms. Many yesat have potential in food industries because
of advantages of curdling of milk without acid production.
Seminar, Symposia and Conferences attended:
Participated in International Conference on 'Aquatic
Microbiology (Status, Challenges and Opportunities)' held on
September 2-4, 2010 at CAS in Marine Biology, Faculty of Marine
Sciences, Annamalai University, Parangipettai.
AMAAS - Annual Report 2010-11
40
Theme :Nutrient Management, Biocontrol and PGPR
Exploration, collection and characterization of some agriculturally important biocontrol agents suitable fordisease management
PI : D. K. AroraCo-PIs : Alok K. Srivastava, Sudheer KumarNational Bureau of Agriculturally Important Microorganisms, Mau
Rationale
Bacillus spp. is the best-characterized antagonistic bacterial
genus, and has become a paradigm organism of Gram-positive
bacteria. Bacillus spp. has many characteristics as an excellent
biocontrol agent, including the production of structurally diverse
antibiotics, formation of viable spores, promotion of plant
growth, and an ubiquitous presence in soil. Some of the well
documented characteristics of Bacillus spp. related to soil fertility
and plant nutrition optimization are the production of bacterial
phytohormones and/or the solubilization of mineral phosphates.
Additionally, strains of Bacillus have also paramount advantages
over other biocontrol bacteria in several manners such as they are
mostly soil inhabitants, capable of sporulation, easy to cultivate,
has long shelf life and some strains have been shown to increase
yields of various crops. The study of genotypic and phenotypic
diversity of Bacillus spp. and their plant growth-promoting
potential is important not only for understanding their ecological
role in the rhizosphere and the interaction with plants, but also for
a number of biotechnological applications. Moreover, there is
very limited knowledge regarding the biological suppression of
soilborne pathogens affecting chickpea by the application of
PGPR in India.
Objectives
· Selection of antagonists for pathogens (Fusarium spp.).
· Screening and selection of potential antagonistic isolates for
important field crops.
· Characterization of active principle responsible for
antagonisms.
· Dosage standardization and delivery system.
· Determination of shelf-life of formulations.
· Mass multiplication of antagonists.
· Field evaluation of potent bio control agents.
Significant Achievements
· A total 480 bacterial strains were obtained from the
rhizosphere of different crops from Indogangetic plain
regions (Mau, Varanasi, Lucknow and Kanpur) of India. All
the strains were tested against three plant pathogenic fungi
viz., Fusarium oxysporum f sp. ciceri (FOC race1) Fusarium
solani (FS) and Macrophomina phaseolina (MP) Out of them,
only fourteen bacterial strains (B-CK11, B-ML26, B-PV53, B-
CL94, B-PL125, B-MV146, B-WM77, B-MM208, B-WV249, B-
CV280, B-CM331, B-CL392, B-PK413 and B-PM444) showed
significant inhibitory effect on mycelial growth (>5mm
diameter) against all the three plant pathogenic fungi.
Similarly, culture filtrates of Bacillus spp. inhibited radial
colony growth of FOC race 1, FS and MP at varying degrees.
Strain B-CM331, B-TM444, and B-WM177 were the most
efficient antagonists and showed 38.33, 37.03 and 36.80 mm
inhibition zone against FOC race 1, respectively. Similar
trends were observed with other two pathogens. All potent
antagonistic bacteria viz. B-CK11, B-PV53, B-PL125, B-
WM177, B-MM208, B-CM331, B-PK413 and B-PM444 were
selected on the basis of this test for greenhouse evaluation
against chickpea wilt.
· The cluster analysis based on pair-wise coefficient similarity
with UPGMA of BOX-PCR resulted into seven distinct
Phylogenetic analysis of antagonistic strains of Bacillus based on nucleotide sequence of 16S rDNA.
41
AMAAS - Annual Report 2010-11
Evaluation of endophytic fungus for growth promotion and biocontrol
PI : Alok K. Srivastava Co-PI : Sudheer KumarNational Bureau of Agriculturally Important Microorganisms, Mau
genomic clusters and at 80% similarity coefficient generated
eight distinct BOX profiles.
· Based on 16S rRNA gene partial sequencing, similarity
values above 97% suggested that all strains viz. Lysinibacillus
fusiformis (B-CK11, B-CL9 and B-MV146), Lysinibacillus spp.
(B-ML26, B-WV249, and BRL392), Bacillus cereus (B-PV53 and
B-CV280), B. subtillus (B-RM 177, B-CM331 and B-TM444), B.
thuringiensis (B-TK433) and Bacillus spp. (B-PL125, B-
MM208) belongs to genus Bacillus and Bacillus derived
genera. Partial 16S rRNA gene sequences of the strains were
submitted to NCBI GeneBank under the code RSNPB 1 -14
and the following accessions were obtained: HM588141-154.
Conclusion
Bacillus strains with their multifunctional properties will
magnetize researchers in the field of biofertilization and
biological control. Present investigation revealed the genotypic
and functional diversity of Bacillus strains with innate potential of
mineralizing phosphate, plant growth promoting traits and
biocontrol properties. Knowledge generated on biodiversity of
Bacillus strains will be useful to design strategies to use these
strains as bioinoculants for the effective management of soilborne
pathogen affecting chickpea under field conditions.
Rationale
Endophytic fungi, residing almost ubiquitously inside the
fresh healthy tissue of plants, have been accepted as a big but
nearly untapped microbial reservoir that can be expected to
provide a wide variety of structurally unique and/or biologically
potent natural products. Fungal endophytes live within their host
plants without causing any apparent disease symptoms (Bacon et
al., 2000; Promputtha et al., 2005; Wang et al., 2005). Vegetable
crops constitute the main nutrient resources for more than two-
fifth of world's population providing food security to the growing
human population. Vegetable plants are attacked by many
diseases such as damping-off, wilt, root-rot disease caused by
various phytopathogens, which result in low yield and quality of
the crop (Kamath, 1982). Application of chemical fertilizer to
control the disease is not only very much effective, but also
hazardous to environment. In search for effective strategy for
disease management biological control is an eco-friendly
substitution to chemical fertilizers.
Objectives
· Isolation of endophytic fungus.
· Identification and characterization of endophytic fungus.
· Molecular characterization of endophytic fungus.
· Determine endophytic microbial diversity.
Significant Achievements
· Plant parts namely leaves and root from different vegetable
crops were collected from the field and examined for the
isolation of endophytic fungi.
· Total 110 isolates of endophytic fungi were isolated from
different plants from Indo-gangetic plains. The isolates were
maintained at 28±2°C.
· The isolates were characterized on the basis of morphology,
growth characteristics and production of various metabolites
including IAA, siderophore, ammonia, and HCN.
· The variability within the ITS amplified regions is being
investigated by restricting this fragment with restriction
enzyme MboI. However, no substantial polymorphic pattern
among the isolates was found by in ITS region with this
restriction enzyme on 2.5% agarose.
· The 550 bp ITS product of 12 isolates were further purified
and sequenced on ABI cycle sequencing using Sanger's
sequencing technique. The sequence was aligned using
BLASTn for identification and submitted to NCBI database.
· Enzymatic study of the identified endophytic cultures from
Indogangatic plain was carried out for protein assay, β
endoglucanase assay, proteinase and chitinase estimation.
· Endophytic cultures were checked for their ability to
enhance plant growth and biocontrol in tomato plant under
of pot experiment studies.
· After one month, plants were uprooted for measurement of
root length, shoot length, fresh and dry weight of shoot and
root for assessing the plant growth promotion in presence of
endophyte.
· Studies were carried out to establish endophytic nature of
fungi using plant leaves
Conclusion:
All endophytic cultures were isolated and identified by 18S
rRNA sequencing. All identified isolates have been characterized
on the basis of hydrolytic enzyme and they shows ability to
promote the plant growth in the greenhouse evaluation.
AMAAS - Annual Report 2010-11
42
Biocontrol of soil borne plant pathogen and growth promotion in vegetable crops
PI : Sudheer KumarCo PI : Alok K. SrivastavaNational Bureau of Agriculturally Important Microorganisms, Mau
Rationale
Among soil borne plant pathogen, fungi are considered
important plant pathogens, particularly members of the genera
Fusarium and Rhizoctonia which as they to infect a wide range of
vegetable crops including tomato, potato, cucumber, etc. The
control of these diseases is a big challenge as they form the
resistant structures like spores. At present, main focus is on the
exploitation of bacteria as biocontrol agent (BCAs) for the control
of these pathogens and reduce the use of chemical agents. These
PGPBs (plant growth promoting bacteria) colonize rhizosphere
and produce certain signaling molecules and sometime provoke
induce systemic resistance at the time of fungal invasion. So,
BCAs have disease control tendency with the growth promotion
in crops. The most commonly used antagonistic bacteria are
Bacillus and Pseudomonas species. Among them B. subtilis and B.
amyloliquefaciens are reported as potent biocontrol agents and
growth promoter in vegetable crop system.
Objective
· Isolation, identification and characterization of bacterial
biocontrol agents.
· Study the rhizospheric competence and factors affecting it.
· Isolation of signaling molecules involved in bacterial
biocontrol-pathogen interaction.
· Development of consortia of efficient isolates.
Significant Achievements
· Soil samples were collected from salt affected soil of IGP
region viz Lucknow, Kanpur, Allahabad, Mau and Varanasi.
Isolation of bacteria from soil samples was done by using
standard methods. A total of 150 bacteria were isolated and
evaluated against Fusarium oxysporum f. sp. lycopersici and
Rhizoctonia solani and a total of 38 antagonists were
identified.
· The bacterial isolates were also characterized for biochemical
traits like cellulose, siderophore, ammonia, HCN and
chitinase production. Molecular profiling and antibiotic
susceptibility tests were also carried out. In vitro
compatibility test showed compatibility among B-3, B-14, B-
101 and P-2 strains. HPLC chromatogram of bacterial
–pathogen interaction showed a vital role of B.subtilis as
biocontrol agent. Strain B-14 and B-101 having tendency for
forming biofilm were tested by EPS (Exopolysaccharide)
production and biofilm quantification by standard method.
Significant effect of biocontrol agent was also tested by
growth promotion and effective root colonization in
vegetable plants.
Conclusion
The strain B-14 and B-101 showed good biocontrol potential
with the rapid growth promotion in tomato. These isolates can be
formulated as consortia to control fungal pathogen at primary
level.
Biochemical profiling of isolates.
0
10
20
30
40
50
60
70
Chitinase , 7
Ammonia , 63
HCN , 14
Cellulose (CMC assay)
, 64
Siderophore , 32
Protease, 62
Sample Area (IGP region).
43
AMAAS - Annual Report 2010-11
Improving yields and nutrient uptake of selected crops through microbial inoculants in vertisols of Central India
PI : D. L. N. RaoCo PI : M. C. MannaIndian Institute of Soil Science, Nabi Bagh, Bhopal
Rationale
Research on microorganisms in vertisols, that have
improved nutrient cycling and plant growth promoting ability,
and are as well able to proliferate under low nutrient conditions,
withstand thermal, moisture and osmotic stresses are meager.
Soybean is the major crop but average grain yields of farmers are
only 1 t/ha. Rhizobial populations are low and there is no
information on the competitiveness of inoculant strains. Thus,
there is an enormous scope for developing effective, competitive
and `hardy' microbial consortia for improving nutrient bio-
availability and yields of crops under farmers field situations in
central India, particularly in Madhya Pradesh.
Objectives
· To study the culturable microbial diversity of vertisols for
selection of promising rhizobial and plant growth promoting
rhizobacterial strains for soybean, chickpea and wheat.
· To develop the best consortia of rhizosphere competent and
compatible strains of N fixers, P solubilizers, PGPR and PGP-
B for inoculation of above crops.
· To study the microbial interactions in the crop rhizosphere in
relation to CNP transformations and bio-availability of
nutrients.
· To test the best performing combination of inoculants for
soybean, chickpea and wheat in farmers fields.
· To make multiple-repositories of the elite strains of
microorganisms.
Significant Achievements
· A complete database of the most promising PGPR (50) and
rhizobia (58) for growth promotion of soybean, chickpea and
wheat in vertisols was prepared.
· 15 elite PGPR strains increased the soybean yield by 18% and
10 elite rhizobial strains increased the grain yield of soybean
by 15% in vertisol field in second year field trials.
· Based on 16S rDNA analysis, 23 PGPR were identified and
gene sequences deposited with NCBI.
· Early report of Lysinibacillus fusiformis as PGPR.
· New report of Dyella marensis as PGPR.
· First isolation of Staphylococcus succinus from soil and report
as PGPR.
· 5 PGPR were antagonistic to all three pathogenic fungi
studied viz., Fusarium oxysporium, Scelrotium rolfsii and
Rhizoctonia bataticola. Based on 16S rDNA homology these
were identified as Bacillus amyloliquefaciens, B. subtilis (3 no.)
and B. licheniformis. They showed early promise for checking
Fusarium wilt in ̀ sick plots' in vertisol field.
· 10 oligotrophic bacteria from rhizosphere soils and composts
identified that could survive in double distilled water for one
year. They belonged mostly to Bacillus sp. were as effective
as other PGPR for soybean, chickpea and wheat in vertisols.
· Diversity analysis of chickpea rhizobia in vertisols showed
that they fell into 3 clusters at 54 % level of similarity.
Diversity analysis based on utilization of carbohydrate
sources was more discriminatory as compared to Intrinsic
Antibiotic Resistance (IAR). The most effective strains (83%)
fell in the major cluster.
· The chickpea growing soils of Madhya Pradesh had
sufficient population of native rhizobia (MPN 1600- 4100
cells/g soil) showing the need for identifying competitive
strains from among the local isolates.
· Three effective rhizobial strains identified for chickpea in
vertisols that can increase yields by 25-40% and fix 32-52
kg/ha., of additional N over native rhizobia.
· Inoculation of Rhizobium and PGPR resulted in significant
increase in nodulation and yield of chickpea along with
improved soil health as evident from increased population of
free living, heterotrophic N fixers and acid phosphatase
activity in soil.
· Bradyrhizobium japonicum ISR-33 and PGPR-Bacillus
megaterium ISP-3 were supplied for mass production to
JNKVV Biofertilizer production centre, Jabalpur. 6,06,6766
inoculant packets were prepared with these strains and
supplied all over Madhya Pradesh since 2009.
Conclusion
Lysinibacillus fusiformis was the best performing PGPR for all
three crops viz., soybean, chickpea and wheat. Oligotrophic PGPR
belonged mostly to Bacillus sp. and were as effective as
copiotrophs for promoting plant growth. Rhizobial diversity
analysis based on utilization of carbohydrate sources was more
discriminatory as compared to intrinsic antibiotic resistance. The
chickpea growing vertisols had sufficient population of native
rhizobia showing the need for identifying competitive strains
from among the local isolates. Inoculation of Rhizobium and PGPR
besides improving nodulation and yield of chickpea, also
improved soil health as evident from increased population of free
living, heterotrophic N fixers and acid phosphatase activity in
soil.
Seminar, Symposia and Conferences attended
· Saxena, Megha, B. Saxena and Rao, D.L.N. (2010) Diversity of
oligotrophic plant growth promoting rhizobacteria in
vertisols. Presented at the 75th Annual Convention of Indian
Society of Soil Science, Bhopal, Nov. 14-17, 2010.
· Ansari, Parveen. G. and Rao, D.L.N. (2010) Diversity of
Chickpea Rhizobia in Vertisols of Central India. Presented at
the 75th Annual Convention of Indian Society of Soil Science,
Bhopal, Nov. 14-17, 2010.
· Ansari, Parveen. G. and Rao, D.L.N. (2010) Diversity of
Soybean Rhizobia in Indian Soils. Presented at the 51st
Association of Microbiologists of India Conference, Ranchi,
Dec. 14-17, 2010.
· Aparna, K., Rao, D.L.N. and Manna, M.C. (2010) Rhizobium
and PGPR inoculation influences soil microbial processes in
chickpea rhizosphere. Presented at the 75th Annual
Convention of Indian Society of Soil Science, Bhopal, Nov.
14-17, 2010.
AMAAS - Annual Report 2010-11
44
Application of AIMs for nutrient management & plant growth promotion in rainfed agro-ecosystems
PI : Suseelendra Desai Co PI : Minakshi GroverCentral Research Institute for Dryland Agriculture, Hyderabad
Rationale
The project is significant for rainfed agriculture as majority of
farmers growing rainfed crops use very little external nutrients in
view of the poor socio-economic base. The potential of
microorganisms to fill this gap has not been adequately
researched in the past. This critical gap can be bridged through a
well defined and focused technical programme which harnesses
the immense biodiversity of AIMS in rainfed agro ecosystem,
evaluate them and develop products based on consortium of
useful organisms. These products not only contribute to enhanced
nutrient availability and reduce cost of cultivation for the farmers,
but also can give a fillip to organic farming in rainfed areas which
is growing rapidly. Microbial products are key inputs in organic
production of crops, horticulture, agro-forestry and live stock
farming.
Objectives
· To study the culturable microbial diversity of soils from
different agro-ecological sub regions, production systems
and land use practices, including stressed ecosystems.
· To characterize the isolated microorganisms for their
nutrient mobilization (N, P micronutrients).
· To evaluate the establishment of isolates, particularly in
mixed cropping systems and select isolates for multiple
crops and geographical locations.
· To standardize methods for mass multiplication and identify
appropriate delivery systems and improve the formulations,
quality, shelf life of the above bio-agents with superior
delivery systems.
· To carry out multi-location testing for evaluation of the
promising formulations. To make multiple-repositories of
isolated isolates of microorganisms.
Significant Achievements
· B17 & B38 were superior to other strains (best among the
previous studies P1, P22, P28, P67, B38, B53, B93 & B105) in
the plant growth promotion of pigeonpea in field.
· P1 & P35 were superior to other strains (best among the
previous studies P22, P23, P17, B22, B39, B73, B87 & B98) in
the plant growth promotion of sorghum in field.
· B105+P17+Rhizobium formulation has shown good growth
promotion of pigeonpea in pots, when compared to
individual inoculations.
· B87+P17+Azospirillum formulation has shown good growth
promotion of sorghum in pots, when compared to single and
dual inoculations.
· Preliminary observation of low superoxide dismutase (SOD)
in P33 inoculated maize seedlings revealed that these plants
have low zinc deficiency due to higher uptake of zinc by ZSB
(P29, B61).
· B87, B105 & P17 were compatible with urea (1%, 2%, 5%),
murate of potash (1%, 2%, 5%), di-ammonium phosphate
(1%) and single super phosphate (1%).
· B87 & P17 were compatible with 2% di-ammonium
phosphate.
· P17 was compatible with fungicide Carbendazim 50%WP-
1%, Mancozeb 75% WP- 0.5%, Metaxyl 35% WP- 1%, Copper
oxy chloride 50% WP-0.5% and Captan 50% WP – 0.5%.
· B87 & B105 were compatable with fungicide Carbendazim
50%WP-0.25%, Mancozeb 75% WP- 0.25%, Metaxyl 35% WP-
0.75%, Copper oxy chloride 50% WP-0.25% and Captan 50%
WP – 0.75%.
Conclusion
Potential strains of Pseudomonas and Bacillus with plant
growth promoting ability and tolerance to chemical fertilizers and
fungicides have been identified under this sub-project and they
could be exploited as bioinoculants for enhanced yields of
sorghum and pigeonpea.
Seminar, Symposia and Conferences attended
· Praveen Kumar, G., Suseelendra Desai, Gopal Reddy and
B.Venkateswarlu (2011). Development of Talc Formulation
of a Drought Tolerant Pseudomonas putida strain for Plant
Growth Promotion and Integrated Nutrient Management in
Rainfed Crops of India Poster presented at 98th Indian
Science Congress, SRM University, Chennai, Jan 3-7, 2011.
· Praveen Kumar G., Kishore N., Mir Hassan Ahmed SK.,
Abdul Rasul, Suseelendra Desai, Gopal Reddy and
Venkateswarlu B. (2010). Evaluation of Fluorescent
Pseudomonas spp. with Single and Multiple PGPR Traits for
Plant Growth Promotion of Sorghum in Combination with
AM fungi. In: “Plant Growth Promotion by Rhizobacteria for
Sustainable Agriculture.” Scientific Publishers, New Delhi,
India. pp: 293-299, ISBN: 978-81-7233-660-8.
· Mir Hassan Ahmed SK., Suseelendra Desai, Venkateswar
Rao L., Praveen Kumar G., and Venkateswarlu B. (2010).
Evaluation of Bacillus spp. from rainfed agro-ecosystems for
plant growth promotion of Sorghum and Pigeonpea. In:
“Plant Growth Promotion by Rhizobacteria for Sustainable
Agriculture.” Scientific Publishers, New Delhi, India. pp: 71-
74, ISBN: 978-81-7233-660-8.Plant growth promotion of pigenpea, sorghum by
Pseudomonas strains and Bacillus strains.
45
AMAAS - Annual Report 2010-11
Development of a cold tolerant phosphate solubilizing cacterial (PSB) inoculant
PI : Pankaj K. MishraCo PI : K. JeevanandanVivekananda Parvatiya Krishi Anusandhan Sansthan, Almora
Rationale
Phosphorus is an essential plant nutrient making up 0.2% of
the plant dry weight. But insoluble phosphates that are not
available to the plant or microorganisms comprise nearly 95 to 99
percent of the total phosphates in the soil. Hence biologically
mediated solubilization of the insoluble phosphates holds the key
to meeting the P nutrition of crops. The soils of hilly regions of
Uttarakhand state are generally acidic in reaction with low native
P and high phosphorus fixing capacity, leading to low
productivity of major crops. During winters snowfall is quite
common in the upper reaches and the ground remains frozen for
varying periods. Due to this the soil temperature also dips and O averages from 2 to 10 C depending on the location. Such
extremities of temperature are deleterious to the survival and
functioning of most introduced mesophilic microorganisms.
Most of the PSB inoculants that have been developed so far are
from the plains where such extremities of temperature
(atmospheric and soil) do not exist. Therefore, it is imperative to
develop a PSB inoculant that would suit the environmental
conditions prevailing in the hills with major focus on cold
tolerance, since this largely determines the survival and function
of the inoculant.
Objectives
· To isolate PSB cultures from the rhizosphere of various hill
crops and screen them under in vitro cold conditions (4 and O 15 C) for their P solubilizing ability.
· To develop comprehensive biomarkers for the quality
control and field detection of the elite PSB strains.
· To evaluate various locally available low cost organic raw
material for use as a carrier material for the PSB inoculant,
and identify a suitable combination of efficient PSB culture(s)
and carrier material.
· To evaluate the performance of the PSB inoculant with
graded levels of P fertilization in select winter crops.
· To conduct large scale field demonstrations with the
developed bio- inoculant and commercialize the developed
technology.
Significant Achievements
· Locally available, accessible and inexpensive carrier material
[Kadiya (talc stone), deodar and cedarwood sawdust] were
used to develop a formulation, showed log CFU ranging
from 7.40 to 7.30, whereas, the standard carrier materials (Ca-
alginate beads, purified talc, charcoal and charcoal + soil)
showed log CFU in the range of 8.51 to 7.60 under
refrigerated and non- refrigerated condition after six months.
· Five promising Pseudomonas strains were subjected for rock
phosphate solubilization at three different temperature (4, o15, 28 C) and Pseudomonas strain CS11RP1 showed
maximum P solubilization (40.3 ppm) at 15ºC under shaking
condition.
· All the fourteen Pseudomonas strains showed the presence of
pqqC (568 bp) & pqqE (900bp) gene that play a major role in P
solubilization using glucose dehydrogenase metabolic
pathway.
· Three Pseudomonas spp. [Pseudomonas sp. CS11RP1,
Pseudomonas fragi CS11RH4, Pseudomonas poae NS12RH2(1)]
were evaluated with graded P level in lentil and all the strains
showed root colonization in the range of 6.1-7.4 log CFU at 60
DAS under pot condition.
· Eight bacterial consortium developed from five elite cold
tolerant P solubilizing strains were evaluated under pot
condition and significantly enhanced nutrient content (N, P,
K) of wheat (VL Gehun 804) upto 1.61, 1.26 and 1.64 folds
respectively at 60 DAS.
· In lentil, all the individual Pseudomonas strains in the
consortium showed root colonization in the range of 6.0 – 7.6
log cfu after 60 DAS.
· Inoculation with bacterial consortium significantly
enhanced nutrient parameters (shoot dry weight, shoot
length and root length by 2 folds, 1.3 folds & 1.65 folds,
respectively) and cold stress response (phenolics, proline,
starch, EC & relative water content) after 60 DAS under field
condition.
· In field condition four bacterial consortium enhanced P
content of wheat (VL Gehun 804) in the range of 11.1 to 33.3%
in stover and 17.2 to 31.0% in seed and significantly increased
wheat yield 16.9 to 39.4% over the uninoculated control.
· At various locations of Himachal Pradesh two potent
bacteria (RT5RP2 & RT6RP) showed significant increase in
yield of wheat (4.0-13.0%) & pea (26.6 -28.2%)
· On the basis of 16S rDNA sequencing strain CS RH was 11 4
identified as Pseudomonas fragi (GU220068) and was
deposited at NBAIM, Mau culture collection.
Conclusion
The standard and locally available low cost carrier material
were evaluated for the development of a carrier based
formulation and the shelf life of the bacterial inoculant was higher
in the Ca-alginate beads, purified talc, charcoal and charcoal + soil
after six months. The consortium was developed with the best
compatible cold tolerant Pseudomonas spp. and they were
evaluated on wheat and lentil under green house/field
condition. Bacterial consortia enhanced the nutrient uptake,
growth parameters, cold stress response and yield. A trial with
two potent cold tolerant P solubilizing bacteria (RT5RP2 &
RT6RP) were evaluated at various locations of Himachal Pradesh
showed significant enhacement in yield of wheat and pea. Thus,
the best consortium can be popularized among the farmers after
extensive multiple field trials.
Papers published from AMAAS work
· Govindan Selvakumar, Piyush Joshi, Preeti Suyal, Pankaj K.
Mishra, Gopal. K. Joshi, Jaideep K. Bisht, Jagdish C. Bhatt and
Hari S. Gupta (2010). Pseudomonas lurida M2RH3 (MTCC
9245) a psychrotolerant bacterium from the Uttarakhand
Himalayas solubilizes phosphorus and promotes plant
growth at low temperature. World Journal of Microbiology &
Technology, DOI 10.1007/s11274-010-0559-4 (Online
published).
· Selvakumar, G., S.Kundu, Piyush Joshi, Sehar Nazim,
AMAAS - Annual Report 2010-11
46
Isolation, identification, evaluation and exploitation of PGPR for spices
PI : M. AnandarajCo PI : R. Dinesh, A. Kumar, N. K. Leela Indian Institute of Spices Research, Calicut, Kerala
Rationale
One of the key factors which determine the success of bio-
mobilization of nutrients vis-à-vis growth promotion and yield of
crops is the efficiency and ecological fitness of the microbial
inoculants employed. No single strain isolated in wild form
would have all the traits required for satisfactory growth
promotion and biological control. A strain with multiple benefits
to crops plants by their growth promoting capacity and disease
suppressive ability seldom exists in soil. Alternative to this
paradox is the development of a consortium of compatible
microbial agents where each of the agriculturally important traits
is contributed by individual strains for overall crop management
through a single formulation. Such a formulation would solve the
problems of inconsistency in the field performance of microbial
inoculants due to lack of the ecological fitness of the organism
employed. A formulation of consortium with strains obtained
from varying agro-ecological regions would be preferred to
formulation with single strains. Such a rhizobacterial community
based formulation is expected to perform better than single
rhizobacterium based formulation for crop management. The aim
of the present project is to collect different native isolates of
rhizobacteria from black pepper and ginger growing areas and
study their role in plant growth promotion coupled with disease
control in comparison with the existing rhizobacterial strains used
in PGPR network.
Objectives
· Isolation, characterization, evaluation of microbes for
nutrition mobilization, growth promotion and biological
control.
· Screening isolates for the desirable characters.
· Studies on compatibility and ecological fitness and
development of consortium.
· Studies on rhizobacteria mediated induced systemic.
· Studies on mechanism of rhizobacteria mediated growth
promotion in crop plants.
Identification of Phosphate solubilizing gene (pqqC and pqqE) in cold tolerant bacterial strain.
A.D.Gupta and H.S.Gupta (2010). Growth promotion of
wheat seedlings by Exiguobacterium acetylicum 1P (MTCC
8707) a cold tolerant bacterial strain from the Uttarakhand
Himalayas. Indian Journal of Microbiology. 50: 50-56.
Seminar, Symposia and Conferences attended:
· Pankaj K. Mishra, Piyush Joshi, Preeti Suyal, G. Selvakumar,
J. K. Bisht and J.C. Bhatt (2010). Solubilization of inorganic
phosphate and plant growth promotion by Psychrotolerant
Pseudomonad from Uttarakhand Himalayas. 5th
Uttarakhand State Science Congress, Doon University,
Dehradun, Uttarakhand, 10-11th Nov, 2010.
· Pankaj K Mishra, Preeti Suyal, Piyush Joshi, K. Jeevanandan,
G K Joshi, J K Bisht1, J C Bhatt (2010). Performance
Evaluation of Psychrotolerant Mineral 'P' Solubilizing
Bacterial Consortia in Wheat Rhizosphere. 51st Annual
Conference of AMI, BITS Ranchi, Jharkhand,14-17 Dec,2010.
Significant Achievements
· In vivo evaluation of Rhizobacteria – Ginger: To confirm the
earlier result obtained from 2009-2010 study, the green house
evaluation of selected rhizobacterial strains were done in
ginger, for both biocontrol and growth promotion.
· Evaluation of strains for Biocontrol: A pot experiment with
six treatments and two replications (three pots) were
conducted at IISR, Chelavoor. Treatments included three
selected strains (GRB 35- Bacillus amyloliquifaciens, GRB 68-
Serratia marcesens and IISR 51-Pseudomonas) along with a
bactericide – Streptomycin and a fungicide - Metalaxyl
mancozeb and a control. Out of the two sets of experiment,
one set was for evaluation against Ralstonia and another for
Pythium. Ginger rhizomes were treated with 1% starch 10 -1solution containing bacterial suspensions (~ x 10 CFU mL )
for one hour, shade dried for 24 hours and planted @ two
rhizomes (25 g) per pot. The booster dose of rhizobacteria
was applied at three regular intervals, 30, 60 and 90 days after thplanting (DAP). The sprouting count was recorded on 30
DAP. Both the strains recorded more than 85% sprouting.
The pathogen was inoculated after one month of planting.
The disease incidence was recorded till 90 DAP. The
rhizobacterial strains, GRB 35 and GRB 68 recorded
significantly less disease incidence when compared to
control.
· Based on the field experiment conducted during 2009-2010,
Bacillus amyloliquifaciens (GRB 35) and Serratia marcescens
(GRB 68) were found to be effective for disease control and
plant growth promotion. A field experiment using these two
effective strains were repeated in IISR experimental farm at
Peruvannamuzhi with six treatments and two replications
(six bed replication). The treatments included two efficient
strains (GRB 35 and GRB 68), and an existing biocontrol
strain from IISR repository (IISR 51), two chemical control
(bactericide and fungicide) and an absolute control. Ginger
47
AMAAS - Annual Report 2010-11
Effect of rhizobacteria on sprouting in ginger. Disease percentage in ginger.
rhizomes were treated with rhizobacteria as mentioned
above and planted. The booster dose of rhizobacteria was
applied thrice during 30, 60 and 90 DAP. Sprouting was
recorded on 45 DAP and disease incidence was recording at
regular intervals. Both the isolates (GRB 35 and GRB 68)
recorded more than 75% sprouting compared to control. Soft
rot incidence was also significantly less (<10%) compared to
control. Ginger rhizome yield was recorded after the eighth
month. The rhizobacterial treatment recorded significantly
higher yield than control.
· A green house trial using variety Panniyur-1 of black pepper
was conducted using rhizobacterial strains in comparison
with Trichoderma harzianum (P26). The experiment was
conducted in a randomized complete block design with nine
treatments and six replications including an absolute control
and chemical control. Treatments included three
rhizobacterial isolates (BRB 21-Burkholderia, BRB 28-
Pseudomonas aeruginosa and BRB 49- Serratia marcescens),
promising isolates of Pseudomonas (IISR 6) and one
Trichoderma harzianum (P26) and their consortium (IISR 6 + P
26). The chemical treatment included metalaxyl-mancozeb @ -1
1.25g L . The growth parameters were recorded at monthly
intervals.
· A green house experiment on black pepper was conducted to
evaluate the selected strains for nutrient mobilization.
· The field efficacy of seven rhizobacterial isolates and three
other promising isolates are under evaluation for growth
promotion and biocontrol in the field. It is done in a complete
randomized block design containing 11 treatments with 15
replications at IISR Experimental Farm, Peruvannamuzhi.
The treatments include BRB 21, BRB 28, BRB 49, BRB 3, BRB
13, BRB 23, IISR 6 and a promising isolate T. harzianum (P 26)
along with a chemical control (Metalaxyl-mancozeb @
1.25g/L) and an absolute control. The growth parameters are
recorded at regular intervals.
· The antibiotic and biosurfactant production of the putative
isolates were tested to study the mechanism of biological
control. The bioassay of extracted antibiotics was performed
on PDA and King's B against various pathogens viz., Phytophthora capsici, Pythium myriotylum, Ralstonia
solanacearum, Colletotrichum and Aspergillus flauvs. The
selected isolates include GRB 35, GRB 68, GRB 70, BRB 3, BRB
13, and BRB 49. Cut shoot assay was performed with single
nodded cuttings of black pepper variety Karimunda to study
the inhibitory effect of the extract on P.capsici.
Conclusion
The rhizobacterial strains GRB 68(Serratia marcescens) and
GRB 35(Bacillus amyloliquefaciens) from ginger were found to
enhance the sprouting of rhizomes besides reducing the soft rot
and bacterial wilt in ginger. Three rhizobacterial isolates (BRB 3,
BRB 13 and BRB 23) from black pepper with different
combinations of NPK was found to promote the growth in black
pepper plants. These isolates have significantly enhanced the
levels of mineral N, Bray P and exchangeable K in soils. The
results on growth parameters revealed that the treatments 100% N
+ 100% P + 100% K+ BRB 3 and 100% N + 100% P + 100% K+ BRB
13 showed maximum height followed by 100% N + 100% P + 75%
K + BRB 3. Antibiotic obtained from GRB 68 was found to inhibit
Phytophthora capsici, Pythium myriotylum and Ralstonia
solanacearum.
Seminar, Symposia and Conferences attended
Bini, Y K, M. Anandaraj, A. Kumar R. Aravind and R.
Dinesh (2010). Isolation and characterization of rhizobacteria
from ginger (Zingiber officinale Rosc.) for biocontrol and growth
promotion. In: Indian Phytopathological Society (Southern Zone)
Symposium on “Changing plant disease scenario in relation to
climate change”, 28-29 October, IISR, Calicut.
AMAAS - Annual Report 2010-11
48
Development and application of PGPR formulations for growth Improvement and diseasesuppression in coconut and cocoa
PI : George V. ThomasCo PIs : Alka Gupta, Murali Gopal, R. Chandra MohananCentral Plantation Crops Research Institute, Kudlu P.O., Kasaragod, Kerala
Rationale
As there is enough evidence to confirm that coconut and
cocoa soils and roots favour the development of a highly diverse
beneficial microflora, carrying out a meticulous research under
the ICAR Network Project on AMAAS will lead to development
of critical microbial based technology that could improve the soil
health and fertility, suppress the undesirable pathogens, develop
strong immunity in plants leading to improved crop production
and protection of coconut and cacao. Based on the experience of
successful isolation of effective strains of diazotrophs, phosphate-
solubilizing microbes, PGPR's and the response obtained to
inoculation of biofertilizers, it could be predicted that commercial
viability of biofertilizers for coconut and cacao will be a reality in
the near future. The data on higher incidence of beneficial
microbes at lower doses of chemical fertilizers and in mixed
cropping and mixed farming systems should enable researchers
to make recommendations to farmers to derive maximum benefits
from biosources of nutrients by making alterations in agronomic
practices. Based on the experience on the incidence of high
diversity of new diazotrophs in root regions of coconut palm, it
would be worthwhile to undertake microbial community study at
molecular level. This should reveal the incidence of much higher
microbial biodiversity in these unique cropping systems, which
are dominating the coastal and in-land ecosystem. Intensification
of research efforts in this important area and developing PGPR
technology to achieve sustainability in plantation crops and
perennial based cropping systems is an important thrust area of
research. The PGPR associations, diversity and their impact on
the growth and productivity need to be understood to develop
effective biofertilizer formulations for field application. It is
imperative to identify a single organism or a group of organisms
(consortia) with broad spectrum of activities including plant
growth promotion and disease suppression in view of the
magnitude of biotic stress faced by the crops in real field
situations. In-depth studies on PGPRs with respect to their role
in nutrient management, survival bio-control potential and
persistence are needed for exploiting them in the perennial based
cropping systems. Synergistic growth effects could be derived by
the combined inoculation of function specific bacteria including
PGPRs, diazotrophs and P-mobilisers. Biofertilizer inoculants
when combined with organic inputs can deliver additional
benefits in terms of higher rate of survival and persistence of
bioinoculants in soil. Root (wilt) disease of coconut is a major
constraint affecting the productivity of coconut in Kerala, the
premier coconut growing state in the country. Leaf rot disease
appears super imposed on root (wilt) diseased palms. Application
of PGPR assumes greater significance in the biological control of
this disease. The overall rationale and significance of the project
therefore aims at harnessing the potential of agriculturally
important microorganisms available in plenty in the coconut and
cacao cropping systems for improving the crop production
capacity of these important plantation crops in an ecologically
sustainable manner acceptable to the farmers through the
development of low cost eco-technology.
Objectives
· To characterize PGPRs (rhizosphere soil dwelling and
endophytic) associated with coconut and cocoa grown in
different agro-climatic conditions
· To screen and select efficient rhizobacterial strains
possessing beneficial traits like production of IAA, HCN,
nitrogen fixation and phosphate solubilization.
· Development of mass multiplication techniques and
consortia formulations of compatible microorganisms.
· To evaluate the selected strains for growth promotion of
coconut and cocoa seedlings.
· To evaluate the biocontrol potential of the PGPR against stem
bleeding disease of coconut caused by Thielaviopsis paradoxa
and Phytophthora diseases of coconut and cocoa.
· To develop the PGPR based biofertilizer technology with
appropriate quality control measures.
Significant Achievements
· Experiments to study the growth promotion effects of 19
selected isolates were conducted in coconut and cocoa
seedlings. Statistically significant increase (significance at P
=0.05) over the control was observed in most of the growth
parameters. B. megaterium TSB 16 and B. megaterium TEB 2
isolated from the rhizosphere and roots of coconut palms,
respectively, growing in the Tumkur region of Karnataka
and endophytic Bacillus sp. HEB 10 obtained from HDMSCS,
CPCRI, Kerala were found to be the best plant growth
promoters in coconut seedlings. B. cereus ASB 3, isolated
from the rhizosphere of cocoa growing in Ambajipetta,
Andhra Pradesh, endophytic B. subtilis VEB 4 obtained from
Bacillus sp. VEB 17 Bacillus sp. CSB 8 B. subtilis PEB 2 Bacillus sp. CEB 9
49
AMAAS - Annual Report 2010-11
Vittal, Karnataka and rhizospheric B. subtilis CSB16, from
Coimbatore, Tamil Nadu were found to be the best plant
growth promoters in cocoa seedlings.
· Detailed studies of the plant growth promotion mechanisms
of all the 43 PGPRs were done. Among the 22 potent coconut
PGPRs, Bacillus sp. RSB 14 recorded the highest β - 1, 3-
glucanase activity (600 µg glu/min/mg protein) and
chitinase activity (135 µg NAG/h/mg protein). The
maximum production of salicylic acid was detected in P.
putida KnSF 208 (29.6 µg/ ml) and was found to be one of the
best phosphate solubilizer (164.7 μg/ml). Among the 21
selected cocoa PGPRs, B. licheniformis KGEB 16 exhibited
maximum P-solubilization (163.34µg/ml), B. subtilis PEB 2
recorded the highest chitinase activity (424.7µg NAG/h/mg
protein), B. subtilis ASB 12 recorded the highest β - 1, 3-
glucanase activity (89.36 µg glu/min/mg protein) and the
maximum production of salicylic acid was detected in
Pseudomonas sp. KGSF 20 (24.34µg/ ml).
· Experiments to study the stress responses of the selected
PGPR (22 coconut and 21 cocoa isolates) indicated that
Bacillus cereus ESB 15 isolated from the rhizosphere of 0coconut could tolerate a maximum temperature of 60 C and
NaCl concentration of 12 % when incorporated in Trypticase
Soy Agar (TSA) medium. Another Bacillus sp. RSB 14 from
coconut rhizosphere tolerated 12% NaCl concentration.
Serratia marcescens KiSII, isolated from rhizosphere of
coconut from Kidu, Karnataka could tolerate pH in the range
from 4.2 to 9.0 and P. putida KnSF 208, a rhizospheric isolate
of coconut from Kunnamkai, Kerala could tolerate pH from
5.2 to 9.0.
· Five Bacillus subtilis isolates (CSB 8, KGEB 10, PEB 2, PEB4
and VEB 17) from cocoa rhizosphere could tolerate a 0maximum temperature of 60 C and were able to grow on
TSA medium amended with 12% NaCl. Three Bacillus spp.
(B. subtilis CSB 16, B. subtilis CEB 9 and Bacillus sp. PS2 VEB 4)
from cocoa showed intrinsic resistance to 12% of NaCl in
TSA. The cocoa PGPR isolates Pseudomonas putida KDSF 23
and Pseudomonas sp. KDSF 7, isolated from Kidu, Karnataka
exhibited pH tolerance from 5.2 to 9.0.
Conclusion
A good no. of PGPR (43) were isolated from coconut and
cocoa seedlings. Only five Bacillus subtilis isolates (CSB 8, KGEB
10, PEB 2, PEB4 and VEB 17) from cocoa rhizosphere could 0tolerate a maximum temperature of 60 C and were able to grow
on TSA medium amended with 12% NaCl. Three Bacillus spp. (B.
subtilis CSB 16, B. subtilis CEB 9 and Bacillus sp. PS2 VEB 4) from
cocoa showed intrinsic resistance to 12% of NaCl in TSA. The
cocoa PGPR isolates Pseudomonas putida KDSF 23 and
Pseudomonas sp. KDSF 7, isolated from Kidu, Karnataka exhibited
pH tolerance ranging from 5.2 to 9.0.
Papers published from AMAAS work
· Litty Thomas, Alka Gupta, Murali Gopal, Priya George and
George V. Thomas. 2010. Plant growth promoting potential
of Bacillus spp. isolated from the rhizosphere of cocoa
(Theobroma cacao L.). Journal of Plantation Crops, 38 (2): 97-104.
Seminar, Symposia and Conferences attended
· Murali Gopal, Litty Thomas, Alka Gupta, Priya George and
George V. Thomas. 2011. Plant growth promoting
rhizobacteria (PGPR) for growth improvement in cocoa.
Paper presented during the Seminar on 'Strategies for
enhancing productivity of cocoa', CPCRI, RS, Vittal, Jan. 28-
29, 2011.
· Litty Thomas, Alka Gupta, Murali Gopal, Priya George and
George V. Thomas. 2010. Efficacy of rhizosphere Bacillus spp.
for growth promotion in Theobroma cacao L. seedlings. In thproceedings of the 19 Biennial symposium on plantation
crops PLACROSYM XIX, RRII, Kottayam, 7 -10 December
2010. pp. 143 -144.
· Priya George, Alka Gupta, Murali Gopal, Litty Thomas and
George V. Thomas. 2010. Screening and evaluation of
phosphate solubilizers from diverse group of bacteria
isolated from rhizosphere and roots of coconut palms (Cocos
nucifera L.) growing in different states of India. In
proceedings of International conference on “Coconut
Biodiversity for Prosperity”, CPCRI, Kasaragod, 25 – 28
October, 2010. pp.103.
· Priya George, Alka Gupta, Murali Gopal, Litty Thomas and
George V. Thomas. 2010. Plant growth promoting potential
of Serratia marcescens KiS II and Enterobacter cloacae RNF 267
isolated from the rhizosphere of coconut palm (Cocos nucifera
L.). In proceedings of International conference on “Coconut
Biodiversity for Prosperity”, CPCRI, Kasaragod, 25 – 28
October, 2010. pp. 83- 84.
Microbial control of insect pests
PI : B. RamanujamCo PI : S. Sriram National Bureau of Agriculturally Important Insects, Bangalore
Rationale
The project also envisage a good collection of germplasm of
entomofungal pathogens, which can be used for screening against
sucking pests of vegetables like, whiteflies, aphids, thrips, mealy
bugs, causing extensive damage to the crops. For control of
sucking insects, entomopathogenic fungi are the most
appropriate microbial bioagents as they infect the insects directly
by contact and do not require ingestion for infection. The chemical
insecticides sprays are not cost effective and also eliminate the
beneficial parasites and predators from these cropping systems.
Identifying promising candidate fungi against sucking pests,
development of mass production techniques for promising
candidate fungi, development of data bases of strains of
entomopathogenic and establishing culture repository of these
fungi are the main objectives of this project.
Objectives
· Germplasm collection of entomogenous fungi from insect
hosts for control of sucking pests of vegetable crops and
AMAAS - Annual Report 2010-11
50
Conidia in rice grains Harvested dry conidia Formulated spores in oil Emulsion
depositing of these fungi in NBAIM, Mau.
· Screening and identification of potential isolates of
entomogenous fungi against sucking pests of vegetable
crops (laboratory bioassay, glass house studies).
· Molecular characterization of promising isolates of
entomogenous fungi.
· Development of efficient mass production and formulation
techniques including oil-based formulations of promising
isolates of entomogenous fungi.
Significant Achievements
· Twenty one isolates of entomofungal pathogens belonging
to Beauveria bassiana (7 isolates), Metarhizium ansiopliae (7
isolates), Nomuraea rileyi (3 isolates), Lecanicillium lecanii (2
isolates), Ascheronia aleyrodis (1 isolates) and Paecilomyces
farinosus (1 isolate) were isolated from soils and insect hosts
from Gujarat, Meghalaya, Himachal Pradesh, Kerala and
Karnataka during 2010-11. Cultural and morphological
studies of these 21 isolates were conducted, isolate specific
characters were identified, spore and biomass production
was estimated.
· Bioassay studies conducted with B. bassiana, M. anisopliae and
L. lecanii indicated highest mortality of 35.0% with Bb-60
isolate and highest mycosis of 13.33% with Bb-56 isolate.
· The chitinolytic activity of 60 isolates of B. bassiana, 33 isolates
of M. anisopliae and 31 isolates of L. lecanii was studied by
subjecting the partially purified proteins from these isolates
to chitinolytic activity and measuring the release of reducing
saccharides from colloidal chitin spectrophotometricaly at
582 nm (A ). Highest chytinolytic activity was observed 582
with Bb-5a, Ma-4 and Vl-7 isolates.
· The toxic effects of partially purified toxic proteins of 60
isolates of B. bassiana and 35 isolates of M. anisopliae were
studied on first instar larvae of Spodoptera litura by diet
incorporation method at 1, 2.5 and 5% concentrations. The
highest mortality of 51% was observed with Ma-4 isolate.
· In order to develop oil formulations of promising isolates of
B. bassiana and M. anisopliae, nineteen combinations of oil
formulations were prepared with eight vegetable oils, four
emulsifiers and one stabilizer. The conidial germination (%)
of B. bassiana (Bb-5a) and M. anisopliae (Ma-4) was assessed
after 24 and 48 hrs of storage in the different oil formulations.
Among the 19 oil formulations tested, Soybean oil EAO,
Mineral oil EAO, Groundnut oil EAO and Sunflower oil EAO
showed higher conidial germination of B. bassiana (81-97% at
48 hrs) and M. anisopliae (85-94% at 48 hrs).
· Safety of twelve promising isolates of B. bassiana, M.
anisopliae and L. lecanii to the natural enemies of Aphis
craccivora viz., Micromus timidus and Cheilomenes
sexmaculata was tested by bioassay and found to be safe to
these predators, as no mycosis was observed on them
· Molecular characterization of 57 isolates Beauveria bassiana, 3
isolates of B. brongniartii, 35 isolates of Metarhizium ansipliae,
31 isolates of Lecanicillium lecanii and 6 isolates of Paecilomyces
spp. has been characterized by ITS sequencing and
phylogenetic analyses based on the neighbor-joining (NJ)
method. On the basis of BLAST analysis of the Internal
Transcribed Spacer (ITS), the ITS region of 57 isolates of B.
bassiana are similar to the sequence of the reference fungi, B.
bassiana (ARSEF 8150, 8170 and 8187), 3 isolates were
grouped with B. brongniartii (ARSEF2633 and 1070) (Fig.5).
The ITS region of 19 isolates of M. anisopliae were similar to
sequence of the reference fungi, M. anisopliae Var. anisopliae
(ARSEF442) and 16 isolates sequence were grouped with the
reference fungi M. anisopliae (ARSEF794, ART2455 and
KS0806). Among the 31 Lecanicillium isolates, the ITS region
of 15 isolates were similar to sequence of the reference fungi,
Lecanicillium lecanii (ARSEF 5491, 5126, 4065 and 4025), 2
isolates sequence were grouped with the reference fungi L.
muscarium (ARSEF 2323), 11 isolates were grouped with the
reference fungi L. attenuatum (CBS 170.76), 3 isolates were
grouped with the reference fungi L. longisporium (ARSEF
974). The ITS region of 3 isolates of Paecilomyces were similar
to sequence of reference fungi, Paecilomyces fumosoroseus
(ARSEF 4484, and 3590) and other 3 isolates were similar to
the sequence of reference fungi P. farinosus (SJL0909).
Conclusion
Under this project, 174 isolates of entomofungal pathogens
were isolated from insects and soils from different locations in
Karnataka, Andhra Pradesh, Tamilnadu, Kerala, Assam, West
Bengal, Himachal Pradesh and Gujarat. Studies on cultural
characters and ITS sequence of 60 isolates of B. bassiana, 3 isolates
of B. brongniarii, 35 isolates of M. anisopliae, 15 isolates of
Lecanicillum lecanii, 11 isolates of L. attenuatum, 3 isolates of L.
longisporum, 2 isolates of L. muscarium, 3 isolates of P.fumosoroseus
and 3 isolates of P. farinosous showed considerable variations with
regard to colony morphology, growth rate, spore production and
ITS sequence. Fast and highly sporulating isolates of these fungi
were identified. Based on laboratory bioassay studies, promising
isolates of B. bassiana, M. anisopliae, L. lecanii, P. fumosoroseus were
identified against sucking pests like, Aphis craccivora, Myzus
persicae and Bemisia tabaci. Studies are in progress with regard to
the development of oil formulations of these promising
entomopathogenic fungi and field evaluation.
51
AMAAS - Annual Report 2010-11
Developing PGPR consortia for enhanced crop and soil productivity of rice -wheat cropping system
PI : LataCo PI : Radha PrasannaIndian Agricultural Research Institute, New Delhi
Rationale
Rice and wheat represent the staple food for millions in our
country and the ecological significance of microorganisms is well
known, since centuries, as the inherent source of sustained
fertility of these soils. Despite the availability of a number of
publications on the role of different microorganisms in
rice/wheat fields, no focused approaches towards understanding
the interactions of the microorganism (native and inoculated)
with the rice/wheat roots or other flora/fauna in the rhizosphere
have been undertaken, for improving the efficiency of inoculants.
A better understanding of the plant-microbe interactions in this
ecological niche will go a long way in improving the efficiency of
these non-polluting inputs as biofertilizers. In recent years,
cyanobacteria have been recognized as valuable partners in plant
growth promoting associations, besides their emerging
importance as biocontrol agents. Cyanobacterial growth in rice
fields is known to play a critical role in the sustenance of fertility of
this ecosystem, and recent publications reveal their significance in
wheat crop. A growing and renewed interest in organic farming,
use of indigenous native technologies and environmental friendly
supplements in agriculture will necessarily lead to the increased
demand for microbial inoculants. The present proposal envisages
evaluating the less explored facets of microorganisms, i.e. tapping
their potential as valuable sources of metabolites and enhancing
their significant role of interactions of various prokaryotes, not
just as diazotrophs but from a wider perspective as valuable
partners in enhancing crop yields through development of plant
growth promoting associations or as biocontrol agents for the
sustainability of the rice-wheat cropping system.
Objectives
· To isolate and screen bacteria/cyanobacteria from the
rhizosphere soil samples of rice and wheat crop.
· To evaluate the effect of the selected set of strains on crop
yields and soil fertility.
· To develop a PGPR consortia for rice and wheat crop.
Significant Achievements
· Field based evaluation of a set of three cyanobacterial (CW1,
CW2, CW3 for wheat crop and CR1, CR2, CR3 for rice crop)
and three bacterial strains (PW1, PW5, PW7 for wheat crop
and PR3, PR7, PR10 for rice crop) inoculated alone and in
combination (involving a total of 9 for wheat and 8
treatments for rice) were undertaken on the basis of
promising results generated from wheat (Rabi 2009) and Rice
(Kharif 2009).
· A combination of CW1 and PW5 (T7) recorded highest grain
yield and harvest index along with basal application of ½
N+PK as well as microbial parameters followed by PW5 (T6)
in wheat crop (Rabi 2010) Analyses of micronutrients
showed that the treatment involving inoculation of PW5 (T6)
recorded highest value of Zn, besides a threefold increase in
Fe and Cu concentration.
· A combination of PR7, PR3 and CR1 (T7) along with basal
application of 2/3 N+PK, recorded highest grain yield and
plant biomass, as well as microbial parameters followed by
PR3+CR1+CR2 (T8) in rice crop (Kharif 2010).
· Soil microbiological parameters (DHA, FDA, Alkaline
phosphatase and microbial biomass) were observed to be
significantly higher in treatments with various combinations
of PGPR strains as compared to inoculation with individual
strains.
Conclusion
· Field based evaluation of a set of three cyanobacterial and
three bacterial strains inoculated alone and in combination
(including chemical fertilizer controls) revealed the
superiority of these strains in enhancing plant growth and
soil fertility parameters in wheat and rice crop.
· Treatments involving inoculation with both single strain and
multi-strain consortia enhanced wheat grain production,
harvest index, quality and yield, besides savings of N (40-
60Kg N/ha) and micronutrient enrichment.
· This study illustrates the promise of combination of bacterial
and cyanobacterial PGPR strains for effective integrated
nutrient management of wheat and rice crop.
Papers published from AMAAS work
· Nain, L., Rana, A., Joshi, M., Shrikrishna, J.D., Kumar, D.,
Shivay, Y.S., Paul, S. and Prasanna, R. (2010). Evaluation of
synergistic effects of bacterial and cyanobacterial strains as
biofertilizers for wheat. Plant and Soil 331:217-250.
· Mallappa, M., Prasanna, R., Partima, S., Nain, L. and Singh,
R. (2010). Developing PGPR consortia using novel genera-
Providencia and Alcaligenes along with cyanobacteria for
wheat. Archives of Agronomy and Soil Science (In Press).
· Rana, A., Saharan, B., Joshi, M., Prasanna, R., Kumar, K., and
Nain, L. (2011). Identification of multitrait PGPR isolates and
evaluating their potential as inoculants for wheat. Annals of
Microbiology (In Press).
AMAAS - Annual Report 2010-11
52
Structural and functional dynamics of the microbial isolates in biogeochemical cycling of C, N, P and S in riceecosystem
PI : T. K. AdhyaCo PI : P. BhattacharyyaCentral Rice Research Institute, Cuttack
Rationale
Rice, which plays a pivotal role in the food and nutritional
security of India, is preferentially grown under submerged
conditions due to positive response to modern agricultural
practices and better yield than in upland soils. The predominantly
anaerobic flooded soil conditions bring about alterations in soil
microbial colonization from aerobic conditions of an upland soil
to microaerophilic and facultative anaerobic microflora. These
microorganisms in the rice rhizosphere play an important role in
the biogeochemical cycling of several elements involving both
oxidation and reduction reactions. Thus cycling of C, N, P, S, Fe
and Zn is greatly influenced in the rice rhizosphere thereby
affecting the nutrient turnover for the growing rice crop. Cycling
of methane through production (methanogenesis) and its
oxidation (methanotrophy), cycling of nitrogen through
nitrification and denitrification, and cycling of sulfur through its
reduction and reoxidation are important microbially mediated
transformation in rice rhizosphere. Role of microorganisms in
providing mineral nutrients and transforming organic nutrients
into plant-available forms could be critical, especially in low
fertility ecosystem of tropical rice soils. Apart from influencing
and regulating the rate of organic matter decomposition, they are
inherently involved in N-transformation reactions including N -2
fixation and N-loss, oxidation-reduction processes, precipitation
and mobilization of Fe, clay mineral transformation and
alterations in surface charge characteristics as well as aggregation
in rice soils. These key soil processes affect and redeem nutrient
supply to rice roots, normalize the rhizosphere chemistry and
plant growth. Such interlinked biological functions explain the
dynamic interplay of microbial populations at community levels.
This further underlines the regulatory role played by microbial
communities and signifies the interactive credentials of
independent microbial groups in deriving the nutritional status
for the benefit of the plant.
Objectives
· Isolate agriculturally important microorganisms from rice
soils varying widely in physico-chemical properties.
· Explore and quantify the microbial diversity in rice soils by
cultivation-based, proteogram and total DNA finger-
printing analyses.
· Characterize the functional diversity analysis of the
microbial isolates in the biogeochemical cycling of C, N, P
and S and integrate them in the nutritional management of
rice ecosystem.
· Confirm efficacy of isolated microorganisms for nutrient
acquisition and maintenance of sustainability under rice
cultivation.
· Standardize methods of mass multiplication, improved
formulations and delivery systems particularly for rice
cultivation.
Significant Achievements
· Thirty three efficient heterotrophic nitrifiers were isolated
from CRRI, Canning, Talchua, Khola, Gupti and Ersama rice
field soils. Three of them viz., CRRI- 12 and CRRI- 14 and
Gupti G-10 have been identified by 16s rDNA sequencing as
Bacillus sp., Lysinibacillus sp. and Bacillus sp., respectively.
· Ten methanotrophs and methylotrophs were isolated from
soil samples of CRRI, Canning, Talchua, Khola, Gupti and
Ersama.
· Three isolates capable of utilizing methanol viz., CRRI- 24,
CRRI-21 and Ers-2 have been identified by 16s rDNA
sequencing as Sinorhizobium sp., Cupriavidus necator and
Sinorhizobium sp., respectively.
· Microbial population, structural and functional diversity in
terms of select enzymatic assay were studied after
application of compost followed by fertilizer (control, 40 kg -1 -1 -1N ha , 80 kg N ha , and 120 kg N ha ).
-1 -1· Microbial diversity was more in 80 kg N ha and 120 kg N ha -1than in control and 40 kg N ha .
· Furthermore, the population of the methanotrophs,
denitrifiers and ammonium oxidizers were more in 80 kg N -1 -1ha in comparison to 120 kg N ha , and the grain yield from
the fields treated with different levels of N fertilizer
increased compared to the control fields.-1· No significant yield difference was observed at 80 kg N ha
-1and 120 kg N ha , respectively suggesting that with proper
nutrient management the yield target of crop production can
be achieved without excessive fertilizer application.
· Dehydrogenase activity was maximum in 120 kg N/ha
treatment at the maximum tillering stage.
· FDA activity was maximum in 80 kg N/ha treatment at the
maximum tillering stage.
· Urease activity was maximum in 80 kg N/ha and 120 kg
N/ha treatment at the grain filling stage.
· Carbon dioxide (CO ) evolution from flooded rice field soils 2
amended with different concentration of nitrogen fertilizer
was estimated.
· Microbial population and diversity was studied in soils of
rice fields treated with different organic fertilizers in eight
combinations viz., farmyard manure (FYM), rice straw (RS),
dhaincha and Azolla at different stages of plant growth.
· Microbial diversity and population of heterotrophic
nitrifiers, free living nitrogen fixers and copiotrophic
bacteria were more in the field treated with 16 kg RS + 100 g
dhaincha, followed by field treated with 12 kg FYM + 100 g
dhaincha.
· At the initial stages of plant growth, microbial population
was more in the fields treated with 24 kg dry FYM and 100 g
dhaincha.
· Minimum microbial diversity and population was observed
in soil samples from fields treated with 12 kg FYM + Azolla
and control field.
· Combination of organic and inorganic fertilizers supported
more growth of nitrifiers, free-living nitrogen fixers,
53
AMAAS - Annual Report 2010-11
copiotrophs and oligotrophs than exclusively with inorganic
or organic fertilizers.
· Microbial population and diversity was also studied in soil of
rice fields treated with different inorganic fertilizers in eight
combinations viz., farm yard manure (FYM), rice straw (RS),
dhaincha (Sesbania aculeata) and Azolla at different stages of
plant growth.
· Microbial diversity and population were maximum at
panicle initiation and maximum tillering stages of plant
growth.
· Aerobic bacteria, heterotrophic nitrifiers, free living nitrogen
fixers and copiotrophic bacteria were more in the field
treated with RS (5.0 t/ha) + urea (60 kg N/ha), followed by
field treated with RS (2.5 t/ha) + dhaincha (60 kg/ha) and RS
(5.0 t/ha) + urea (30 kg N/ha).
· Oligotrophic bacteria were more in soil samples from fields
treated with urea (60 kg N/ha) and control field.
· Microbial population dynamics was studied at different
stages of plant growth in soil of rice, groundnut, maize, green
gram, cowpea and sesame in four different rotations viz., 1.
groundnut-rice, 2. greengram-rice-maize, 3. sesamum-rice
and 4. cowpea-rice-maize.
· Heterotrophic nitrifiers, free living nitrogen fixers and
copiotrophic bacteria were maximum in rotation 1, followed
by 2, 4 and 3. Rice in succession of groundnut and green gram
showed greater microbial diversity than cowpea and sesame.
· Microbial diversity was more in maize fields planted in
succession to green gram and rice than maize planted after
cowpea and rice.
· In groundnut fields, population of heterotrophic nitrifiers,
free-living nitrogen fixers and copiotrophic bacteria were
maximum at the pegging stage and pod formation stages of
growth.
· In case of green gram and sesame, population of
heterotrophic nitrifiers and free living nitrogen fixers were
maximum at the pod formation stage.
· The population of heterotrophic nitrifiers and free-living
nitrogen fixers were maximum at the sowing stage of cowpea
crop.
· Twenty seven P-solubilizing bacteria were isolated from the
rhizospheric rice soils of Balasore, Ganjam districts and
Chilka and their TCP solubilizing capacities were estimated.
The P-solubilization capacity of the organisms was 22-77
mg/l.
· The P-solubilizing organisms reduced pH of the medium. In
buffered medium, P-solubilization capacity of the bacteria
declined.
· The organisms were motile, Gram negative and catalase
positive rods. Other biochemical characters were variable.
· Except for four isolates, all others grew profusely on the
Jensen's agar plate which confirmed their nitrogen fixing
abilities.
· One isolate (Arunpur 7) tolerated up to 12% and all others
could grow up to 9% NaCl.
· Arunpur 7 isolate was further checked for its P-solubilizing
activity in presence of 12% NaCl. P-solubilization declined
gradually from 3% NaCl and stopped at 15% level.
· All of the twenty seven isolates produced IAA in the
laboratory, and Talsari 6, Talsari 7, Kashphala 7 and Chilika 5
were more efficient.
· Four of the P-solubilizers like Talsari 2, Talsari 3, Talsari 4
and Talsari 6 were efficient siderophore producers which
formed with 6-10 mm discoloration (orange) zones.
· None of the isolates produced HCN.
· The Talsari 4 isolate depicted a mixture of organic acids viz.,
D-gluconic acid, acetic acid, citric acid, maleic acid, malic
acid and tartaric acid in HPLC. Some unknown acids having
R between 2.1- 2.9, 8.1-8.9 and 9.01-9.7 were also detected.T
· In pot experiment, Bacillus megaterium supported growth in
presence of two out of the ten rock phosphates i.e. North
Carolina and Gafsa as the only P source, comparable to that
of single super phosphate (SSP).
· From Gafsa, P-uptake was 62.5% more than SSP at the
panicle initiation stage.
· Shoot and root length also increased significantly in both the
cases.
Conclusion
Thirty three efficient heterotrophic nitrifiers were isolated
from CRRI, Canning, Talchua, Khola, Gupti and Ersama rice field
soils. Three of them viz., CRRI- 12 and CRRI- 14 and Gupti G-10
have been identified by 16s rDNA sequencing as Bacillus sp.,
Lysinibacillus sp. and Bacillus sp., respectively. In pot experiment,
Bacillus megaterium supported growth in presence of two out of
the ten rock phosphates i.e. North Carolina and Gafsa as the only P
source, comparable to that of single super phosphate (SSP). Shoot
and root length also increased significantly in both the cases.
Phylogenetic tree of Isolate CRRI-24 (M3M).
AMAAS - Annual Report 2010-11
54
Nutrient dynamics and carbon sequestration in plant mycorrhizal systems
PI : K. S. SubramanianCo PI : M. ThangarajuTamil Nadu Agricultural University, Coimbatore
Rationale
Indian soils are highly diverse and exposed to a wide array
of crops, agro-climatic conditions and nutrient deficiencies. The
deficiency of Fe was found to be largest 26% in Sierozem of
Haryana followed by 18% in Tamil Nadu, 12% in Punjab and 8 to
9% in calcareous soil of Gujarat and Uttar Pradesh. Although iron
is an abundant element in most soils, its availability for plants can
be limiting, especially in soils with a basic pH. From an
agricultural point of view, iron deficiency is responsible for severe
losses owing to chlorosis, decreasing the yield and nutritional
value of the crops. Plants have evolved two main strategies to
cope with low iron availability. The first one, used by most plants,
but not by grasses, relies on the reduction of soluble iron (III)
chelates and subsequent uptake of iron (II) by root transporters.
By contrast, grasses have evolved a mechanism based on the
release of small molecules into the rhizosphere that efficiently
chelates iron (III), the phytosiderophores and subsequent iron
import by uptake of the iron (III) - phytosiderophore complexes
into root cells (Curie et al,. 2001). Iron is essential for chlorophyll
and protein formation, photosynthesis, electron transfer,
oxidation and reduction of nitrates and sulphates and other
enzyme activities. Iron deficiency causes interveinal chlorosis in
newly emerging young leaves due to reduced chlorophyll
synthesis resulting in poor growth and loss in yield. Chlorosis
caused by Fe deficiency is a phenomenon which is often observed
on alkaline soils with high bicarbonate content. Alkaline
conditions inhibit Fe uptake by counteracting the rhizosphere
acidification of the root. Besides high alkalinity, high nitrate levels
in the soil may also promote iron chlorosis (Hellal et. al., 2006).
Arbuscular mycorrhizal (AM) fungi are known to improve the
availability of nutrients especially phosphorus which moves to
the root surface by diffusion. In addition to P nutrition,
mycorrhizal symbiosis enhances absorption of relatively
immobile micronutrients such as Zn, B and Cu. However, it is
unclear whether mycorrhizal colonization is beneficial at varying
intensities of Zn deficiencies.
Objectives
· To examine the nutritional, physiological and biochemical
responses of host plants to mycorrhizal inoculation under
varying levels micronutrients (Zn, Fe) fertilization.
· Dual inoculation of VAM + Gluconacetobacter to promote Zn
nutrition in maize.
· Alleviation of Fe deficiency in Maize.
· To popularize VAM technology through Front Line
Demonstrations.
· Mycorrhizal symbiosis to economize water soluble
fertilizers in Sugarcane under drip-fertigation System.
Significant Achievements
· Mycorrhizal fungal colonization in maize significantly -1increased soil available Fe (M- 1.9; M+ 2.1 mg kg ) and Zn (M-
-14.16; M+ 4.50 mg kg ) in both calcareous and non-calcareous
soils. -3· Siderophore production in M+ plants (51.4 µmol cm hr)
-3were higher than M- plants (39.5 µmol cm hr) that facilitate
micronutrient availability in rhizosphere soil.
· Mycorrhizas can be used for bioforification of maize grains.
Increased availability of Fe & Zn in soil in combination with
enhanced concentrations in plants assisted M+ plants to
maintain higher micronutrient contents in grains (Fe M- 31.2, -1M+ 35.3; Zn M- 45.1, M+ 52.4 mg kg ).
· Interestingly, maize grains had 10-15% higher Fe & Zn
contents while anti-nutritional factor “phytic acid” had -1decreased (M- 1.13; M+ 1.07 mg g ). Overall, the data suggest
that mycorrhizal fungal inoculation assists in biofortification
in kernels with Fe and Zn besides circumventing the impact
of anti-nutritional factors.
· Dual inoculation of Gluconacetobacter with mycorrhizal
fungus (Glomus intraradices) was significantly increased the
availability of Zn. Water soluble and exchangeable (WSEX)
and organically bound (OC-Zn) zinc fractions were
increased either by combined inoculation or Zn fertilization.
The data suggest dual inoculation can match the crop
requirement of Zn completely.
· A field experiment was initiated to study the role of
mycorrhizal symbiosis to economize water soluble fertilizers
in sugarcane under drip-fertigation system. Treatments
consisted of five levels of water soluble fertilizers (100%,
75%, 50%, 25% RDF in the form of WSF) and one treatment
include 100% RDF in the form of conventional fertilizers and
two mycorrhizal treatments (with or without inoculation of
Glomus intraradices) replicated 4 times in a RBD. Nutritional,
physiological, biochemical, morphological plant parameters
and soil biochemical characteristics will be evaluated.
Conclusion
· Field experiments have unequivocally demonstrated that
mycorrhizal colonization improved the Fe and Zn
nutritional status of plants as a secondary consequence of
physiological, biochemical, nutritional and morphological
changes in the host plants. Overall, the data suggest that
mycorrhizal fungal inoculation assists in biofortification in
kernels with Fe and Zn besides circumventing the impact of
anti-nutritional factors
· Mycorrhiza inoculated maize plants produced grains with
low phytate content with higher phytase activity suggesting
suppression of anti-nutritional factor by the symbiosis
· Mycorrhizal colonization appears to alleviate Fe deficiency
in calcareous soils. The release of organic acids and
rhizosphere acidification favourably increased the Fe
availability.
· Inoculation of gluconacetobacter with mycorrhizal fungus
assists in Zn nutrition of maize.
· Mycorrhizal soil had improved biochemical changes that
favour the availability of Zn. Acid phosphatase activity
increased by 20-40% due to mycorrhizal colonization that
acidify the rhizosphere besides improving the availability of
Zn.
Papers published from AMAAS work
· Subramanian, K.S., and Bharathi, C. 2011. Boron nutrition
and mycorrhizal symbiosis. Poster presented at the
55
AMAAS - Annual Report 2010-11
“National seminar on Soil Health Improvement for
Enhancing Crop Produtivity. (Page No. 90).
· Subramanian, K.S., Bharathi, C. Vijayakumar, S and
Balakrishnan, N. 2011. Zinc nutrition in maize using
mycorrhizal symbiosis. Poster presented at the “National
seminar on Soil Health Improvement for Enhancing Crop
Productivity. (Page No. 91).
· Subramanian, K.S., and Balakrishnan, N. 2011.
Biofortification of Fe and Zn in maize grain using
mycorrhizal symbiosis. Poster presented at the “National
seminar on Soil Health Improvement for Enhancing Crop
Productivity. (Page No. 92).
· Subramanian, K.S., Vijayakumar, S and Balakrishnan, N.
2011. Dual inoculation of VAM and Glucanoacetobacter to
promote Zn nutrition in maize. Poster presented at the
“National seminar on Soil Health Improvement for
Enhancing Crop Productivity. (Page No. 93).
Harnessing agriculturally beneficial microorganisms for production and protection of sorghum and rice
PI : S. GopalakrishnanCo PI : G. V. Ranga RaoInternational Crops Research Institute for Semi-Arid Tropics, Patancheru, A. P.
Rationale
Interest in biological control of plant pathogens has been
stimulated in recent years by trends in agriculture towards
greater sustainability and public concern about the use of
hazardous pesticides. Microorganisms have the capability to
synthesize many different biologically active secondary
metabolites such as antibiotics, herbicides, pesticides, anti-
parasitic and enzymes like cellulase and xylanase in waste
treatment. Secondary metabolites from microbes, particularly
bacteria and actinomycetes, are known to supress various insects
pests and disease causing plant pathogenic microbes. Among the
bacteria Bacillus thuringiensis (Bt) is the most researched, and
focused on the toxins (cry toxins) its production, and extensively
used for managing many insects. Spinosad (a product of soil
actinomycete Saccharopolyspora spinosa; a mixture of spinosyn A
and spinosyn D as active ingredients) are known to kill many
insects including Helicoverpa armigera and pathogenic fungi
including Aspergillus flavus. Spinosad has become so popular that
it is now widely used by the organic farmers of Europe and
America to control major insect pests and diseases of many fruits
and vegetable crops. Role of actinomycetes in plant growth
promotion and biocontrol are getting new insights as better
alternative for sustainable agriculture production over agro-
chemicals. Microbial rich natural sources like composts and
organic amended rhizosphere soil samples can serve as an
excellent source for isolating novel active actinomycetes. Hence,
in the previous year, in the AMAAS project, 127 actinomycete
cultures were isolated from 27 different herbal compost.
Actinomycetes evaluation was continued this year also against
three plant pathogens of chickpea and sorghum viz., Fusarum
Influence of culture filtrates ofCAI-21, -26 and MMA-32 on FOC.
Influence of culture filtrates ofCAI-21, -26 and MMA-32 on S. rolfsii
When the 80% MeOH fraction was further fractionated, only one fraction (80-3%) was found to inhibit the FOC.
oxysporum f. sp. ciceri (FOC; causing wilt in chickpea), Sclerotium
rolfsi (causing collar rot in chickpea) and Macrophomina phaseolina
(causing charcoal rot in sorghum).
Objectives
· To identify and evaluate beneficial microorganisms in
relevant crop husbandry system(s) involving sorghum and
rice.
· Laboratory evaluation of traditional knowledge
products/protocols involving agriculturally beneficial
microorganisms.
· To submit promising access ions of benef ic ia l
microorganisms to NBAIM, after due evaluation and
characterization (including nomenclature using molecular
techniques).
Significant Achievements
· Twelve actinomycetes were demonstrated for their
antagonistic potential against FOC in the GH conditions as
well as wilt-sick field conditions.
· All the 12 isolates were identified by 16s rDNA gene
sequence analysis and submitted to NBAIM.
Conclusion
Twelve actinomycetes were demonstrated for their
antagonistic potential against FOC in the GH conditions as well as
wilt sick field conditions. All the 12 isolates were identified by 16s
rDNA gene sequence analysis and submitted to NBAIM.
Papers published from AMAAS work
· Gopalakrishnan S, Humayun P, Kiran BK, Kannan IGK,
Vidhya MS, Deepthi K and Rupela O. (2010). Evaluation of
AMAAS - Annual Report 2010-11
56
A B BA
Efficacy of PGPR isolate BS2 against Colletotrichum infection in cowpea under field conditions (A: untreated and B: PGPR BS2 treated).
Effect of PGPR consortium (BS2+T2-2) treated (B).
bacteria isolated from rice rhizosphere for biological control
of charcoal rot in sorghum caused by M. phaseolina. World
Journal of Microbiology and Biotechnology DOI 10.1007/s11274-
010-0579-0.
· Gopalakrishnan S, Kannan IGK, Alekhya G, Humayun P,
Meesala SV and Kanala D. (2010). Efficacy of Jatropha,
Annona and Parthenium biowash on Sclerotium rolfsii, FOC
and M. phaseolina pathogens of chickpea and sorghum.
African Journal of Biotechnology 9(47): 8048-8057.
· Gopalakrishnan S, Pande S, Sharma M, Humayun P, Kiran
BK, Sandeep D, Meesala SV and Kanala D. (2010).
Evaluation of actinomycete isolates obtained from herbal
vermicompost for the biological control of Fusarium wilt of
chickpea. Crop Protection (Accepted).
· Gopalakrishnan S. (2010). Factors responsible for higher
yields in SRI. SRI News Letter 2(1): 8-9.
Isolation, identification, evaluation and exploitation of microorganisms for management of importantplant pathogens and having PGPR potential for vegetable crops
PI : M. LoganathanCo PIs : S. Saha, A. B. RaiIndian Institute of Vegetable Research, Varanasi
Rationale
Tomato and cowpea are the important vegetable crops in
India and production of these crops is affected by both abiotic and
biotic factors. Among them, the diseases caused by fungal
pathogens are causing huge yield loss (2-90 %) in the vegetables.
Identification of certain microbes and utilize them for the
management of the diseases will be the suitable solution since
other means of management threatened the environment safety
and human and animal health. Very limited attempts have been
made in India to use of PGPR for the management of vegetable
diseases in India. Hence in this project, a focus was made to
increase the vegetable production and suppress the diseases
through PGPR in turn to maintain ecological balance.
Objective
· Exploitation of rhizospheric microorganisms for disease
suppression and growth promotion.
Significant Achievements
· Two potential isolates against wilt and collar rot of tomato
were identified as Bacillus amyloliquefaciens -BA1 (earlier
known as chilli 1) and B. subtilis -BS2 (earlier known as chilli
2) based 16S rDNA amplification and sequencing (Acc. No:
HQ021420 and HQ021418).
· In 2010-11, evaluation of potential PGPR against Fusarium
oxysporum f.sp. lycopersici (FOL) in tomato under field
conditions recorded consistent performance of BS2 as it
reduced the disease (56.8 %) and enhanced the yield (25.1 %).
· Among 6 selected PGPR tested against Colletotrichum
infection in cowpea under field conditions, the isolates viz.,
Ba1, Bs2, T2-7 and T2-2 were promising in reducing the leaf
spot infection and promoting the yield.
· Among different combination of consortium with potential
rhizobacterial isolates tested, a consortium partner of Bs2
with T2-2 or T2-7 found effective in reducing the wilt and
enhancing the growth of tomato under green house
conditions.
· Sensitivity/compatibility of selected PGPR isolates to
fungicides showed that all the PGPR isolates were
compatible with wide range of fungicides.
· Significant level of induction of defense related enzymes viz.,
phenylalanine ammonia lyase, peroxidases, polyphenol
oxidases and catalase was observed in PGPR treated plants
challenged with FOL pathogen.
Conclusion
Selected few potential PGPR isolates among 142 having both
growth promotion and disease suppression activities in tomato
and cowpea based on in vitro, greenhouse and field experiments.
These isolates can be further utilized for wide range of vegetable
crops for the effective disease management.
Papers published from AMAAS work:
· M. Loganathan, R. Garg, S. Saha and A.B. Rai. 2010. Selection
of antagonist rhizobacteria against soil born pathogens.
Journal of Mycopathological Research 48(1):68-71.
57
AMAAS - Annual Report 2010-11
Seminar, Symposia and Conferences attended:
· R. Garg, M. Loganathan, S. Saha, T.K. Bag, V.
Venkataravanappa and A.B. Rai. 2010. Non chemical
management of soil borne pathogens of vegetables through
Plant Growth Promoting Rhizobacteria (PGPR). In: National
Seminar on Ecological Strategies to save the Earth and the
Biotic Environment, held by Purvanchal University,
Varanasi, U.P., December 11-12, 2010.
· M. Loganathan, R. Garg, S. Saha, T.K. Bag, V.
Venkataravanappa and A.B. Rai. 2011. Efficient
management of soil borne pathogens of vegetables through
Plant Growth Promoting Rhizobacteria (PGPR). In:
Microbial Diversity and its applications in Health,
Agriculture and Industry held at ICAR Research Complex
for Goa, Mar 4-5, 2011.
Isolation and development of plant growth promoting organisms from high biodiversity region for tropical tuber crops
PI : M. L. JeevaCo PI : Susan John K., R. S. Misra, S. S. VeenaCentral Tuber Crops Research Institute, Sreekariyam, Thiruvananthapuram.
Rationale
The present project envisages the creation of an inventory of
the microbial diversity and to find out the highly potent microbial
strains for nutrient use efficiency (N fi×ers, phosphate solubilizers
and potassium solubilizers) and bio-control (against collar rot of
Amorphophallus) with a view to find its application under field
condition for use as a component of INM for biological nutrition
and as potent bio-control agents for use as a component of IDM. For
this, collection and identification of the most efficient fungal and
bacterial strains suited to tuber crops (cassava, sweet potato and
elephant foot yam) for different agro ecological regions for
different utilizations were envisaged. Application of the efficient
strains and their utilization in large scale for nutrient management
and biocontrol requires characterization, standardization of mass
production techniques and field level e×periments. This study
aims to determine the effects of microorganisms to assess the
productivity with the application of these inputs.
Objectives
· Molecular and physiological characterization of new efficient
isolates of K solubilizers and bio control agents.
· E×ploration of biochemical mechanism of K solubilization
and antagonism of potent strains as bio control agents.
· Standardization of mass multiplication methods of selected
strains
· Study of the compatibility of effective strains of bio fertilizer
and biocontrol agents to apply them in consortium.
· Agronomic evaluation of N, P and K efficiency of the selected
strains along with biocontrol agents in Amorphophallus to
substitute for NPK fertilizers and control of collar rot disease.
Significant Achievements
· Bioincoculants such as N fi×er (Bacillus cereus), P solubilizer
(Pantoea sp.), K solubilizer (Bacillus subtilis, Pseudomonas
fluorescens and Trichoderma) studied for their plant growth
promoting role (Indole acetic acid production, ammonia
production and hydrogen cyanide production) showed
significant production of Indole acetic acid and ammonia.
Only Pseudomonas fluorescens showed production of
Hydrogen Cyanide
· Effect of various stress conditions (temperature, salt
concentration and pH) on the growth of bioinoculants
revealed that all the bioinoculants could survive a 0temperature up to 50 C, salt concentration up to 2 %, and pH
up to 9. The K solubilizer, Bacillus subtilis showed remarkably
0increased tolerance up to temperature 65 C, pH range of 6-12
and salt conc. of 8%.
· A new P solubilizer has been identified as Bacillus megaterium -1with a solubilization capacity 199 µg g .
· Bioassay of five Trichoderma spp. (Tr8, Tr9, Tr10, Tr11, and
Tr14) selected by direct confrontation assay, to prevent rot
caused by Sclerotium rolfsii in the pseudostem of
Amorphophallus revealed Tr9 as the best isolate for the control
of rot .
· The minimum inhibitory concentration of ethyl acetate
e×tract of 30 day old culture of Tr9 was found to be 1.5µl.
· HPLC profile of the secondary metabolite (crude ethyl acetate
e×tract of culture filtrate) of Tr9 grown in the presence of
autoclaved mycelium and fresh mycelium of Sclerotium rolfsii,
and without any mycelium revealed the significant difference
in production of secondary metabolite with increased
production of certain compounds, reduced production of
some compounds and production of some additional
compounds in presence of mycelium.
· The potent isolate (Tr9) was identified as Hypocrea lixii, which
is the teleomorph of Trichoderma harzianum.
· The possibility of using cassava flesh as one of the cheapest
and easily available raw material for media preparation for
the mass cultivation of K solubilizing bacteria in a short span
of time was explored.
· When cheapest and easily available raw materials such as
cassava thippy, cassava seed oil, cassava leaf powder and
cawdust used for making the carrier based inoculum for the
effective storage of potent biofertilizer and biocontrol agent,
cassava thippy, cassava seed oil and saw dust gave better
survival for the bacteria while sawdust, cassava seed oil and
cassava leaf powder proved best for Trichoderma.
· Statistical analysis of the corm yield data indicated significant
effect of treatments on corm yield of elephant foot yam
wherein application of biofertilizers alone without chemical -1
fertilizers T1(31.768 tha ) was significantly inferior to all other
treatments, which were in turn were on par (NPK).
Conclusion
Characterization of all the bioinoculants on important plant
growth promoting activities showed significant ability in in vitro
conditions and they could also tolerate wide range of stress
conditions. Bioassay of Trichoderma spp. revealed the potent
activity of Tr9 against collar rot & this was identified as Hypocrea
AMAAS - Annual Report 2010-11
58
lixii, teleomorph of Trichoderma harzianum. The crude metabolite
showed inhibitory activity at a very low concentration &. HPLC
analysis of crude metabolite also indicated the presence of
additional compounds. This study could develop a best mass
multiplication medium for our potent K solubilizing bacteria using
one of the cheapest and easily available raw material cassava flesh.
Experiment for the preparation of effective carrier based inoculum
unveiled the role of cassava seed oil, cassava thippy, cassava leaf
powder and saw dust in upholding the viability of potent
biofertilizer and biocontrol agent. Application of NPK containing
biofertilizers along with Pseudomonas fluorescens and biocontrol
agent, Trichoderma in the Amorphophalus revealed the possibility of
substituting chemical fertilizer to the tune of 25- 75% level of the
recommended dose of N, P and K chemical fertilizer with our
potent bioinoculants.
Papers published from AMAAS work
· Anjanadevi, I.P., Susan John, K., Jeeva, M. L, Misra, R.S, and
Neetha Soma John. 2011. Potassium solubilizing bacteria and
its low cost mass multiplication technique. Abstract in
proceedings of the National Seminar on Climate Change and
Food Security: Challenges and Oppurtunities for Tuber crops” 20-
2 2 J a n u a r y 2 0 1 1 , C T C R I S r e e k a r i y a m ,
Thiruvananthapuram.pp.162
· Neetha Soma John, Anjanadevi, I.P, Jeeva, M.L., Misra, R.S.
and Susan John, K. 2011. Antifungal Potential of Trichoderma
spp. against Sclerotium rolfsii causing Collar Rot in
Amorphophallus: An in vitro Study, Abstract in proceedings of
the National seminar on Climatic Changes and Food Security:
Challenges and Oppurtunities for Tuber crops, 20-22 January
2011, CTCRI, Sreekariyam, Thiruvananthapuram, p. 43.
· Neetha Soma John, Anjanadevi I.P., Jeeva, M.L and Misra, R.
S. 2010. In vitro screening of antagonistic Trichoderma spp.
aganist the major pathogens of tropical crops. National symposium on “Molecular Approaches for Management of Fungal
Diseases of Crop Plants”. 27-30, December, 2010 Indian Institute
of Horticultural Research, Bangalore, p.148.
· Susan John, K., Neetha Soma John and I.P. Anjanadevi (2010).
Agronomic Investigation of new microbial isolates as thbiofertilizers for sweet potato grown in an Ultisol of India. XI
ESA (European Society of agronomy) Congress 'Agro 2010'. 29
August to 3 September 2010 Montpellier, France, p.167.
Seminar, Symposia and Conferences attendedth· XI ESA (European Society of agronomy) Congress 'Agro
2010' Montpellier, France, 29August to 3 September 2010.
· National symposium on “Molecular Approaches for
Management of Fungal Diseases of Crop Plants”, Indian
Institute of Horticultural Research, Bangalore, 27-30,
December, 2010.rd· 23 Kerala Science Congress, Centre for Earth Science,
Thiruvananthapuram, 29 -31 January 2011
· National seminar on Climatic Changes and Food Security:
Challenges and Oppurtunities for Tuber crops, CTCRI,
Thiruvananthapuram, 20-22 January 2011.
· Training course on “National Training on Molecular
Diagnosis for Pathogens Infecting Crop Plants” organised at
CTCRI, Thiruvananthapuram sponsored by NAIP, 16
February to 03 March 2011.
Plant growth promoting rhizobacteria (PGPR) for chickpea and pigeonpea
PI : Mohan SinghCo PI : R. G. ChaudharyIndian Institute of Pulses Research, Kanpur
Rationale
P G P R s a r e m i c r o o r g a n i s m s t h a t c o l o n i z e
rhizosphere/rhizoplane and produce certain bioactive molecules
such as antibiotics, antifungal compounds, siderophores, growth
hormones, etc. and also sometime induce systemic resistance
against number of pathogens. Large numbers of commercial
preparations of such microorganisms have been developed
successfully for different crops. PGPRs for pulses have also been
reported yet this technology has not been perfected for wide scale
adoption. Field responses to inoculation with PGPRs and
Rhizobium produce highly variable increase in crop yields
ranging from 0-40%. The uncertainty about beneficial responses
to inoculation stem out from the limited the understanding of
interaction(s) between PGPRs, Rhizobium, host, phytopathogens
and soils. Multi-strains inocula are proving more beneficial and
reported to produce field responses with greater degree of
confidence. However, this approach needs to be evaluated in
more number of crops and on wider scale.
Objectives
· Screening of microorganisms having potential to improve
nutrient use efficiency, disease suppression, growth and
yield of pigeonpea and chickpea.
· Developing consortium of PGPR for chickpea and
pigeonpea.
· Evaluating the field performance of PGPR consortium on
chickpea and pigeonpea.
Significant Achievements
· Second year of Field inoculation trial with PGPR strains in
chickpea confirmed that growth response to inoculation was
higher in soil containing higher organic carbon level (0.35%)
compared to low carbon content 0.20%. Majority of PGPR
strains for chickpea belong to Bacillus spp. Three PGPR
strains namely PSB 11, CP-11 and J-7 were Bacillus cereus and
one was identified to be Bacillus spp. One strain (PS 8)
belongs to Enterobacter cloaecea.
· In chickpea, inoculation with efficient strains improved
grain yield by 10 to 30% over uninoculated control.
· Second year of field trail with Pigeonpea UPAS 120, showed
that growth response to inoculation with PGPR was
noticeable only upto 45 days after germination. At harvest,
the grain yield under different treatments of PGPR and
uninoculated control was not different statistically due to
large coefficient of variation in the yield data.
59
AMAAS - Annual Report 2010-11
Effect of inoculation with PGPR strains on chickpea grain yield under field conditions in soil with different organic carbon content.
Pigeon pea roots endophytes belong to Bacillus cereus and Stenotrophomonas maltophilia These were distinct from the endophyte of chickpea root.
· Isolation of PGPR Strains: Endophytic microorganisms were
isolated from root, stem and leaves of Pigeonpea and
Chickpea using two different media, one N-free semi solid
and 1/10 Nutrient agar. Around 100 strains of different
microorganisms were isolated from different tissues and
media for further characterization.
· Biochemical characterization of endophytes Isolates: Isolated
strains were also subjected to various biochemical
characterization viz., Nitrate Reduction, Catalase & Oxidase,
Starch, Gelatin & Casein hydrolysis, Arginin Degradation,
Tween 80 hydrolysis, and IAA production, HCN
production, siderophore production and ammonia
production and their antagonistic activity with wilt
pathogen of pigeonpea and chickpea.
· Carbon sources utilization of these strains was carried out
using C-source like mannitol, arabinose, xylose, trehalose,
rhamnose, etc.
· Antibiotic profiling against penicillin, tetracycline,
streptomycin, chloroamphinicol, gentamycin and kanamcin, etc.
was carried out to differentiate these strains.
· Microbial Identification using FAME analysis revealed that
Chickpea roots and stem were primarily colonized by
Pseudomonas aeruginosa while chickpea leaves were
colonized by Photorhabdus luminescens as endophytic
microorganism.
· Pigeon pea roots endophytes belong to Bacillus cereus and
Stenotrophomonas maltophilia and were distinct from the
endophyte of chickpea roots.
· Sixteen endophytes were evaluated for their growth
promoting effects in pots filled with vermiculite and soil. Out
of 16 isolates, some efficient isolates were selected for further
testing in pots filled with unsterilized soil (5 kg/pot).
Endophyte showing growth promoting effects greater than
40% as compared to un-inoculated control were selected for
field evaluation in micro-plots.
Conclusion:
Beneficial growth response to inoculation with PGPR strains
belonging to B. creeus was confirmed under field experiment for
two years. Inoculation with PGPR increased grain yield from 10 to
30 % over uninoculated control. Growth response to inoculation
with PGPR depends upon soil organic carbon content. Higher the
organic carbon content greater is the response to inoculation.
Seeds, leaves, stem and roots of both chickpea and pigeonpea are
colonized by different bacteria. These endophytic bacteria were
isolated and characterized for various traits including antibiosis
against wilt pathogen. Chickpea roots and stem were primarily
colonized by Pseudomonas aeruginosa while chickpea leaves were
colonized by Photorhabdus luminescens as endophytic
microorganism. Pigeonpea roots endophytes belonged to Bacillus
cereus and Stenotrophomonas maltophilia and were distinct from the
endophyte of chickpea roots.
Important diseases and pests of sunflower, safflower and castor
PI : R. D. Prasad Co PIs : M. A. Raoof, M. Santha Lakshmi Prasad, P. S. Vimala Devi Directorate of Oilseeds Research, Rajendranagar, Hyderabad
Rationale
Several diseases and pests of castor, sunflower and safflower
limit the production and productivity. The soilborne pathogens
Fusarium oxysporum and its formae speciales, Macrophomina
phaseolina, Sclerotium, Sclerotinia and nematode species like
Rotylenchulus reniformis and foliar pathogens like leaf spots in
sunflower and safflower, Botrytis ricini gray rot of castor are
causing significant economic losses. Insect pests like Helicoverpa
armigera causing significant yield losses in most of the oilseed
crops. To avoid risks associated with use of chemical pesticide
alternate control tactics like biological methods are given
importance these days. Beneficial microbes have potential scope
in the management of biotic stress especially in oilseed crops that
are mostly grown under rainfed dry land conditions by resource
poor farmers. The fungi and bacteria used for control of variety of
plant diseases in India include Trichoderma and Gliocladoim
species, bacteria like Pseudomonas fluorescens and Bacillus spp.
Insect bioagents like Bacillus thuringiensis, Beauveria and
Metarhizium have been identified as potential candidates against
variety of insect pests. The success of biological control lies in
AMAAS - Annual Report 2010-11
60
selection of a single or consortia of microbes having broad host
range, development of formulations that retain viable
propagules for a year or two and suitable for different delivery
systems and finally timing of application of these biopesticides.
Objectives
· Screening of fungal and bacterial biological control agents in
vitro and in vivo against Botrytis ricini, Alternaria helianthi,
Macrophomina phaseolina, Sclerotium rolfsii, Rhizoctonia solani
and selection of potential agents with good biocontrol traits.
· Development of formulations of consortia of potential agents
for foliar application against selected diseases of castor,
sunflower and safflower and Bt plus Beauveria bassiana
against Helicoverpa armigera and Spodoptera litura larvae.
· Studying shelf life, persistence, phylloplane and rhizosphere
competence of potential formulations.
· Field-testing of the formulations against Botrytis grey rot in
castor, Alternaria blight in sunflower and H. armigera and S.
litura on sunflower crop for determination of the effective
field dose, persistence and safety to parasites/predators.
· To generate data and registration of potential agents for field
use.
Significant Achievements
· Trichoderma harzianum-Th4d (oil formulation 1ml/l),
Pseudomonas fluorescens-Pf2 (Talc formulation 5g/l) and
consortia oil formulation of Trichoderma harzianum-Th4d +
Trichoderma viride-Tv5 1ml/l were observed to be effective
against Alternaria leaf blight of sunflower and Botrytis grey
rot of castor with maximum disease reduction over pathogen
check (55-65%). Trichoderma harzianum-Th4d (oil formulation
1ml/l), consortium of Trichoderma harzianum-Th4d+
Trichoderma viride-Tv5 (oil formulation 1ml/l) and
Pseudomonas fluorescen-Pf2 (Talc formulation 5gm/l)
resulted in higher yield is 1604, 1634 and 1455 kg/ha,
respectively as compared to pathogen check (798 kg/ha) in
sunflower and 1870, 1880 and 1680kg/ha, respectively as
compared to pathogen check (866 kg/ha) in castor.
· Oil formulation of Trichoderma harzianum-Th4d @ 1ml/l and
consortia of oil formulation viz., Trichoderma harzianum-Th4d
+ Trichoderma viride-Tv5 @ 1ml/l showed better persistence
level of 7.61, 8.45 and 7.89 log cfu even after 15 days of
spraying and bacterial bioagent viz., Pseudomonas fluorescens-
Pf2 sprayed @ 10g/l also showed better persistence levels of
7.47 log cfu on leaves of sunflower. Trichoderma harzianum-
Th4d (oil formulation), consortia of Trichoderma harzianum-
Th4d+Trichoderma viride-Tv5 (oil formulation), and talc
formulation of Pseudomonas fluorescens-Pf2 showed high
population levels of 10.73, 10.71 and 9.45 log cfu, respectively
at 15 days interval on capsules of castor.
· In vivo screening of consortia Trichoderma viride-Tv2+
Trichoderma viride-Tv5, Trichoderma spp-T12 + Trichoderma
spp-T33, Trichoderma viride-Tv2+ Trichoderma harzianum-
Th4d and Trichoderma viride-Tv5+Trichoderma harzianum-
Th4d showed 80-95% reduction of Macrophomina root rot in
safflower.
· Trichoderma oil formulations retained viable propagules
between log cfu 9.91 to 9.54 at 360 days showing very good
shelf life.
· Multi location field trials were conducted at AICRP
sunflower centers at Raichur and Coimbatore. Trichoderma
harzianum- Th4d oil formulation applied at a rate of 1ml/l
showed 57.0% reduction of Alternaria leaf spot whereas
mancozeb recorded 37.0% reduction only under field
conditions at Raichur. At Coimbatore, Trichoderma
harzianum- Th4d @ 1ml/l (Oil formulation) showed 42.0%
disease reduction in Alternaria leaf spot of sunflower
compared to 44.0% reduction obtained with mancozeb at
Coimbatore.
· In field testing at Raichur using combination formulation of
Bt and B. bassiana against capitulum borer H. armigera on
sunflower, the larval incidence was completely lowered by 3
days after spray in plots sprayed with combination
formulation @ 2.5 and 3.0 g/l and spinosad 45 SC @ 1.0 ml/l
Seed Yield from the combination formulation @ 3.0 g/l was
at par with the spinosad treatment with 1208 and 1296 kg/ha
respectively while the yield in control plots was 732 kg/ha.
At Bangalore centre, combination formulation @ 3.0 g/l was
completely free from the larval population with 0.06
larvae/plant in profenofos and 0.1-0.2 larvae/plant in all
other treatments including the insecticide endosulfan. Seed
yield was highest in combination formulation treatments @
3.0 and 2.0 g/l with 2438 and 2344 kg/ha respectively and
lowest at 1736 kg/ha in control plots.
· Determination of LC of combination formulation against 10 50
days old H. armigera larvae: Studies were conducted against
10 days old larvae obtained from first generation culture
from field collected larvae. Combination formulation of Bt
and B. bassiana was superior to Bt used singly resulting in
higher kill of older larvae coupled with improved speed of
kill. (1). LC of combination formulation of Bt and B. bassiana 50
was 260 (containing 96.2 mg Bt) and 133 mg (containing 49.21
mg Bt) per 100 ml at 2 and 3 days after treatment respectively.
(2). LC of Bt alone as well as Bt standard was obtained only 50
at 3 days after treatment with values of 182 and 146 mg/100
ml respectively. The Bt requirement in the combination
formulation was thus lowered by 73 %. (3). Potency of Bt in
the combination formulation increased 3 fold. The potency of
combination formulation was found to be 34,000 IU/mg.
· Quantification of Bt toxin: The quantity of Cry1AC toxin in
the Bt (technical) ranged 0.5 – 0.6 mg/g.
Conclusion
IP disclosure on “PRODUCTION PROCESS FOR
IMPROVED YIELD OF TRICHODERMA HARZIANUM (Th4d)
BIOMASS” submitted to ITMU, DOR for processing and filing
patent. Two technologies viz., oil based formulation of T.
harzianum Th4d and, powder formulation of Pseudomonas
fluorescens Pf2 selected on the basis of their biocontrol potential
against Botrytis grey rot of castor and Alternaria blight of
sunflower are going to be commercialized by ITMU, DOR.
Trichoderma harzianum-Th4d (oil formulation, 1ml/l),
Pseudomonas fluorescens-Pf2 (Talc formulation, 5g/l) and consortia
oil formulation of Trichoderma harzianum-Th4d + Trichoderma
viride-Tv5, 1ml/l were effective against Alternaria leaf blight of
sunflower and Botrytis grey rot of castor with maximum disease
reduction over pathogen check (55-65%) and showed better
persistence. In shelf life studies, Trichoderma spp. oil formulations
retained viable propagules between log cfu 9.91 to 9.54 at 360
days. In field testing of combination formulation of Bt and B.
bassiana against capitulum borer H. armigera on sunflower, at
Raichur, the larval incidence was completely lowered by 3 days
61
AMAAS - Annual Report 2010-11
Bioprospecting for viticulturally important microorganisms
PI : Indu S. Sawant Co PI : S. D. SawantNational Research Centre for Grapes, Pune
Rationale
Grape (Vitis vinifera) suffers huge losses due downy mildew,
powdery mildew and anthracnose diseases. The first two are
caused by the biotrophic fungii - Plasmopara viticola and Uncinula
necator, respectively, while anthracnose is caused by the
facultative saprophyte Colletotrichum gloeosporioides. Growers
have to rely mainly on fungicides for management of the diseases,
as effective bio-control organisms are not available. Further, the
large number of pesticide sprays given for control of diseases
results in detection of their residues above the maximum
permissible limits (MRLs) at harvest. The aim of this project was to
identify vines with low incidence of the diseases and to isolate the
endophytic, phyllospheric and the rhizospheric micro-organisms
and test them for potential bio-control activity against the three
pathogens, as well as to identify micro-organisms which can be
used as a pre-harvest application for bio-degradation of the
pesticides.
Objectives
· To isolate micro-organisms from grapevines and check their
potential for bio-control of important diseases of grapes.
· To identify micro-organisms with potential for
biodegradation of pesticide residues in grapes.
Significant Achievements:
· The 25 bacterial isolates from total of 293 isolated from grape
shoot, leaf, root and rhizosphere selected on the basis of in
vitro evaluation, were evaluated for control of downy
mildew in pot trials. The pooled analysis of the three trials
indicated that 6 isolates viz., 171, 204 and 219 gave significant
reduction in PDI, followed by isolates 205, 209, 198 and 201.
· The same 25 bacterial isolates were also evaluated for control
of anthracnose in pot trials. The pooled analysis of the three
trials indicated that 16 isolates gave significant reduction in
PDI.
· Similarly these 25 bacterial isolates were also evaluated for
control of powdery mildew on infected detached leaves.
Isolates 38, 39 and 126 gave significant reduction in PDI.
· Thirty four Trichoderma isolates were evaluated for control of
powdery mildew on infected detached leaves. Fifteen
isolates gave significant reduction in PDI. Isolate T.
harzianum (NAIMCC 01741) and T. pseudokoningii (NAIMCC
01775) were most effective.
· All 34 Trichoderma isolates were screened in vitro against C.
gloeosporioides, and the most virulent ones were identified for
in vivo trials.
· 14 Trichoderma isolates were evaluated for control of downy
mildew and anthracnose diseases on infected detached
leaves. 2 isolates each were found effective in reducing PDI.
· All 34 Trichoderma isolates were evaluated in vitro for
biodegradation of the fungicide flusilazole used for control
of powdery mildew in grapes. 21 isolates could effectively
after spray in plots sprayed with combination formulation @ 2.5
and 3.0 g/l and spinosad 45 SC @ 1.0 ml/l.
Papers published from AMAAS work:
· R.D.Prasad, T. Navaneetha and M.A.Raoof. 2010. Efficacy of
biocontrol agents against Botrytis grey rot of castor under
field conditions. Journal of Oil seeds Research, 27: 243-245.
· T. Navaneetha, R.D.Prasad, M. A. Raoof and G. Srinivasa
Rao. 2010. Evaluation of consortia of Trichoderma spp.
against Botrytis gray rot of castor. Journal of Oil seeds Research,
27: 240-243.
· S. Chander Rao, R.D.Prasad and T. Navaneetha. 2010.
Evaluation of Trichoderma spp. against Botrytis grey rot of
castor. Journal of Oil seeds Research, 27: 238-239.
Seminar, Symposia and Conferences attended:th · 9 National Symposium on “Crop Health Management for
Sustainable Agri – Horticultural Cropping System” held at
Central Agricultural Research Institute, Port Blair, 17-19
February, 2011.
· National Symposium on “Research and Development in
castor: present status and future stratergies” at Directorate of
Oilseeds Research, Hyderabad, Oct., 22-23, 2010.
Bacterial isolate 204 effectiveagainst downy mildew.
Bacterial isolate 205 effectiveagainst downy mildew.
AMAAS - Annual Report 2010-11
62
degrade flusilazole from 0.5 ppm to less than 0.05 ppm (EU
MRL limit) within 15 days. Four of these 21 isolates provided
cent percent degradation. These isolates were selected for
further studies on rate of degradation and other
characteristics to select the most efficient ones for field trials.
Conclusion:
Bacterial isolates 6, 3 and 16 from the 25 isolates from grape
shoot, leaf, root and rhizosphere gave significant control of
downy mildew, powdery mildew and anthracnose diseases in in
vivo trials. Six isolates of Trichoderma, from the 34 isolates obtained
from NBAIM, gave significant control of downy mildew,
powdery mildew or anthracnose disease in in vivo trials. Of these
34 Trichoderma isolates, 21 could effectively degrade flusilazole.
Based on in vivo trials, 8 bacterial isolates and 6 isolates of
Trichoderma were selected for field evaluation for control of
anthracnose, downy mildew and powdery mildew diseases.
Twenty one Trichoderma isolates were selected for further in vitro
and in vivo evaluation.
Seminar, Symposia and Conferences attended:
· 4th Indian Horticulture Congress 2010 from 18-21
November, 2010, at New Delhi.
· National Symposium on Molecular Approaches for
Management of Fungal Diseases of Crop Plants from 27-30,
December, 2010 at IIHR, Bangalore.
· X Agricultural Science Congress from 10-12 Feb., 2011 at
NBFGR, Lucknow.
Development of a library putative probionts from marine environment belonging to the genus Pseudomonas,
Micrococcus and Bacillus for application in mariculture systems
PI : K. K. VijayanCo PIs : Subhadeep Ghosh, Kajal ChakrabortyCentral Marine Fisheries Research Institute, Cochin, Kerala
Rationale
Documentation of biodiversity of native aquatic microbes
viz., Pseudomonas, Bacillus and Micrococcus from marine ecosystem
and provide a depository of potential microbes for
biotechnological application. Development of protocols for
bioprocess technology for the commercial production of potential
microbial metabolite from useful microbes. Development of
microbial products for application in aquaculture,
pharmaceuticals and health. Development of human resource in
the areas of microbial diversity, microbial genetics, bioprocess
technology and microbial product development.
Objectives
· To screen and document microbial diversity and establish
useful marine resources with special reference to
Pseudomonas, Bacillus and Micrococcus.
· To evaluate microbes for secondary metabolites for use in
aquaculture
· To characterize, develop and optimize bioprocess
technology for potential microbial metabolites antagonistic
towards pathogenic bacteria.
· To purify the target molecules and elucidate structure/s of
the purified molecules.
· To develop microbial products and evaluate their efficiency
in commercial application.
· To establish library of bioactive microbes for the future
biotechnological exploitation.
Significant Achievements
· Samples collected and processed from the above mentioned
sites gave the yield of about 2920 cultivable isolates. Of which
45 isolated from sediment and water samples and 23 isolated
from seaweed possess a good antibacterial activity against
the test pathogens.
· Identification and characterization of the potential isolates
using biochemical method indicates that 9 belong to the
genus Pseudomonas and rest 59 belongs to the genus Bacillus.
16S rRNA sequence identification of the above confirmed the
same.
· On monitoring the bath challenge experiment against the
juveniles of maculata and seabass, the mortality has been
noticed in 24 hours. Except the fishes from control all fishes
died in 5 days confirming the virulence of test pathogens.
· Pseudomonas aeruginosa (P103) and Bacillus subtilis (BM1)
from mangrove sediment and Bacillus subtilis isolated from
Sargassam were chosen for isolation and characterization of
the compounds responsible for bioactivity.
· On standardization of growth medium for bioprospecting,
synthetic medium for Bacillus sp. and GA medium for
Pseudomonas sp. were showing good result.
· Temperature optimization using synthetic medium for
Bacillus sp. and GA medium for Pseudomonas sp. were
showing good result.
· The solvent extracts/purified fractions/compounds
prepared from the candidate Bacillus sp. gave ~ 19 mm
inhibition zone against Verticordia harveyii.
· The bioactive compounds obtained from Pseudomonas sp. on
spectroscopic analysis were found to be chromophore of
phenazine substitution and the auxochrome belong the
carboxyl ester moiety which is N-substituted methyl
octahydro-1-phenazinecarboxylate and propyl 2-oxoacetate.
· Work on formulation of microbial product has been initiated
using one candidate (Bacillus sp) with various carriers and
ligands under different physicochemical conditions.
· Duplicates of 11 cultures have been deposited in NBAIM
culture collection facility.
· Various solvent and aqueous extracts were prepared from
the experimental bacterial species (Bacillus subtilis) isolated
from seaweed, and were assayed against Aeromonas
hydrophilla and Vibrio spp. One of the fraction from this
bacteria was found to be active against Aeromonas hydrophilla
and Vibrio vulnificus strains (MTCC 1146 and MTCC1145)
producing inhibition zone of diameter of ~12 to 18 mm. The
fraction was separated using different solvent systems to
63
AMAAS - Annual Report 2010-11
yield five major compounds (F3 , F3 F3 F3 and F3 ) with R M N, O, P Q f
0.2-0.8.
Conclusion
From 9 sampling sites, about 2920 isolates of bacteria have
been isolated, and out of which 68 were found to possess good
antibacterial activity (> 15 mm inhibition zone) against
aquaculture pathogens. Forty bacteria have been selected for
primary screening having wide range of antibacterial potential
and subjected to various studies (viz., growth kinetics) and
characterized using biochemical and molecular methods. The
growth medium have been standardized for the both Bacillus and
Pseudomonas for optimum production of bioactive molecles. The
solvent extracts/purified fractions/compounds prepared from
the candidate Pseudomonas and Bacillus spp. registered > 19 mm
inhibition zone against pathogenic V. harveyii. Potential bacterial
strains (Bacillus- 2 no and Pseudomonas- 1 no) were bioprospected
to isolate antibacterial molecules, and the potential molecules
from Bacillus subtilis were found to possess conjugated carbonyl
moiety with hydroxylated derivative/ terpenoid/phenolic
skeleton; and the one identified as Pseudomonas was found to
possess N-substituted methyl octahydro-1-phenazinecarboxylate
and propyl 2-oxoacetate as antibacterial constituents. Work on
formulation of microbial product has been initiated using one
candidate strain (Bacillus sp.) with various carriers and ligands
under different physicochemical conditions.
Seminar, Symposia and Conferences attended
· Nair, A.V., Ghosh, S., Chakraborty, K., Chakraborty, R.D.,
and Vijayan, K.K. (2011). Isolation and identification of
potential probionts having Antimicrobial activity from south
west and south east coast of India. Conference paper
presented in Asian Pacific Aquaculture 2011, January 17-20,
2011, Le Méridien Resort and Convention Center, Kochi,
India, pp. 358.
· Thilakan, B., Chakraborty, K., Chakraborty, R.D., and
Vijayan, K.K. (2011). Bacillus subtilis MTCC 10403 isolated
from seaweed Sargassam longifolium as a potential source to
isolate antibacterial metabolites. Conference paper
presented in Asian Pacific Aquaculture 2011, January 17-20,
2011, Le Méridien Resort and Convention Center, Kochi,
India, pp. 574.
Microbial phosphorus transformations in inland open waters
PI : Sanjib Kumar MannaCo PIs : Srikanta Samanta Central Inland Fisheries Research Institute (ICAR), Barrackpore, Kolkata
Rationale
Phosphorus (P) is an essential macronutrient. Most of the
freshwater environments are poor in available forms of P, limiting
the aquatic productivity. Although P availability in water column
drives the primary production, sediment acts as a sink or source of
P to the water column. In terrestrial soil P remains bound with Fe,
Al and Ca and P release has long been explained in terms of redox
mediated changes in P sorption by cations, considering the
mineral-bound forms as the predominant or potentially
releasable forms. The phosphorus solubilizing bacteria (PSB)
capable of releasing Ca-bound P, has been used for augmenting
soil fertility. In India and most of the other countries, various
fractionations of sediment P have been rarely studied in
limnology and fisheries research and study of PSB in aquatic
environments are scarce. The overall processes of P availability in
aquatic environments are less understood. In last century, the role
of microbial decomposition has been highlighted as major process
of P releas.e in aquatic environments; however, the extent of P
release through microbial decomposition is debated. However,
little systematic study has been conducted to focus on the major P
release processes, and harvesting and use of microbes to augment
P release processes for enhanced aquatic productivity.
Objectives
· To understand processes of phosphorus transformations and
availability in inland open water environment.
· To evaluate the roles of microbial decomposition on P
availability.
· Isolation of bacteria having strong phytase/phosphatase
activity from aquatic resources for their possible application
in production enhancement.
· Identification of the bacteria and submission of bacterial
cultures to NBAIM.
Significant Achievements
· The study was conducted in Bhomra and Akaipur wetlands
in West Bengal. Although both the wetlands had low levels
of water available P, the sediments were very rich in organic
matter and total P.
· Although P sedimentology is traditionally explained by
interactions between P and Fe/Al/Ca, total mineral (Al-, Ca-
& Fe)-bound P accounted for less than 20% of total P,
indicating, unlike in agricultural soil, less potentiality of P
AMAAS - Annual Report 2010-11
64
release from mineral-bound forms in wetland ecosystems.
Organically bound P formed the bulk (80-93%) of total
sediment P.
· Temperature induced soil microbial activities, including
those involving phosphatases, played key roles in releasing
soil-bound P during summer providing much needed
available P in to water. Organically bound P form was the
major mobile pool and this large pool may be manipulated to
augment release.
· The Fe-P fraction was the second largest mobile pool in
summer. By unknown process, Al-P fraction increased in
summer and decreased in winter. Thus total mineral-bound
P remained more or less constant throughout the year.
· Forty five bacterial strains have been isolated capable of
releasing P from inorganic P source. Wetland and river
sediments were major sources of these microbes. Overall,
isolates from Bhomra wetland and river had higher P release
activity, which correlated with higher level of Ca-P fraction
in these sediments. Most of these strains lack phosphatase
activity and acid production was their mechanism of P
release.
· A total of 25 bacterial strains have been isolated having
phytate mineralizing activity. Fish gut was the major source
of these bacteria followed by pond sediment. Majority of the
isolates from fish gut and wetland sediments had high
phytate degradation ability and may have future application
in enhancing feed digestibility. Interestingly, most of these
strains have P solubilization capability also.
· Considering the significance of organic fraction of P in
wetland sediment, few bacteria and fungi have been isolated
from wetland sediments using chemically separated
Organic-P fraction as carbon and phosphorus sources in an
otherwise chemically defined medium.
· PCR and sequencing of the 16S rDNA gene has identified
many of these isolates as Acinetobacter septicus, Arthrobacter
sp., Bacillus megatarium, Bacillus spp., Curtobacterium citreum,
Enterobacter cloaceae, Klebsiella oxytoca, Methylobacterium
hispanicum, Microbacterium spp., Pseudomonas aeruginosa and
Pseudomonas spp.
Conclusion:
Wetland sediment is very rich in P bound mainly with the
organic matter. A substantial amount of this phosphorus pool is
released through microbial decomposition during summer
season. A good number of microbes have been isolated from
aquatic environments that can release phosphorus from mineral-
bound, organically-bound forms and from phytate. Microbial
isolates from wetland sediment had higher phosphate
solubilzation and isolates from fish gut have higher phytate
degradation abilities and may find their applications in respective
fields.
Seminar, Symposia and Conferences attended:
· N. Maitra, S. K. Manna, S. Samanta and M. Banerjee. 2010.
Isolation and characterization of phytate mineralizing
bacteria from aquatic environments. In: Souvenir &
Abstracts, Seminar on Caring wetlands & conservation of
riverine fisheries, Organized by Central Inland Fisheries
Research Institute, Department of Fisheries Govt. of West ndBengal, and Inland Fisheries Society of India on October 2 ,
2010, Kolkata. p. 132.
· S. Samanta, M. Banerjee, S. K. Manna, N. Maitra and A.N.
Chowdhury. 2010. Phosphorus fractions in wetland
sediment: idea versus reality. In: Souvenir & Abstracts,
Seminar on Caring wetlands & conservation of riverine
fisheries, Organized by Central Inland Fisheries Research
Institute, Department of Fisheries Govt. of West Bengal, and ndInland Fisheries Society of India on October 2 , 2010,
Kolkata. p. 140.
· N. Maitra, S. K. Manna, S. Samanta, D. Debnath and C.
Bandopadhyay. 2010. Organic phosphorus mineralizing stbacteria from aquatic environment. In: Book of Abstracts, 21
All India Congress of Zoology and National Seminar on
Biodiversity Conservation with special reference to Fisheries
and its management for food livelihood and Environmental
Security, Organized by Zoological Society of India Bodh
Gaya, IFSI, CIFRI during December 21-23, 2010, Barrackpore.
p. 94.
Basic and applied investigations on endophytic microorganisms in horticultural crops
PI : P. ThomasCo PI : M. Krishna ReddyIndian Institute of Horticultural Research, Bangalore
Rationale
Microorganisms that colonize the plants internally are
generally referred to as endophytes. They include bacteria and
fungi. An understanding of the endophytic microorganisms
associated with different crop plants assume importance in
agriculture and microbiology taking into account the potential
significance of such organisms in plant growth promotion or
protection against biotic and abiotic stresses. The elucidations of
the nature of relationship they share with the host also assume
significance in understanding their roles in the natural conditions
facilitating their future exploitation. The project aims at
understanding the nature of and the extent of association between
the host plant and the endophytic microorganisms, generating
basic information on the organisms and the association, and
exploring the possibility of exploiting beneficial organisms in
crop growth and production.
Objectives
· Elucidation of endophytic microbial association with
hor t i cu l tura l c rops , inc luding non-cu l turab le
microorganisms.
· Isolation, identification and characterization of endophytic
microorganisms.
· Exploitation of endophytes for applications in agriculture
and allied areas.
Significant Achievements
· Fourteen organisms isolated from in vitro grown watermelon
were assessed for production of auxin, cytokinin and
65
AMAAS - Annual Report 2010-11
gibberllins in pure cultures. Major auxin producers included
Gordonia, Bacillus, B. pumilus and Xenophilus sp. All the
organisms showed the production of zeatin riboside (ZR),
dihydro zeatin riboside (DHZR). Production of GA was 3
recorded in all the organisms except Xenophilus sp. The
leading GA producers included Microbacterium,
Sphingobacterium and Agrobacterium spp. This implied that
such organisms might be playing significant roles in
governing culture performance under in vitro conditions
depending on the extent of colonization by individual
organisms.
· Investigating into host-endophyte interaction, the reliance of
watermelon endophytes on the host was demonstrated
through host tissue extract (HTE) assay. The application of
HTE on watermelon multiplication medium prior to the
inoculation of different endophytic bacteria resulted in
accelerated growth of all the organisms. The results indicated
that host tissue constituents exerted a beneficial effect on the
growth of the associated organisms
· Host tissue extract supplementation was identified as a way
to activate some of the originally non-culturable organisms
to cultivation from cultures that were not displaying
culturable bacteria. Four organisms namely B. pumilus, B.
firmus, Agrobacterium tumefaciens and Microbacterium sp,
were thus brought to cultivation from watermelon cultures
through this approach.
· Growth promotion in watermelon seedlings was shown by
some organisms. Results were not quite consistent on
account of the high variation in seedling vigour. Differences
in the time taken for seed germination, seedling vigour and
the hard seed coat that limits the penetrability of inoculm
into the seeds appeared to be major limiting factors.
· Assessing the reasons for the variable results on growth
promotion effects by different endophytes, tomato seeds
were checked for the possible interfering effects from the
resident seed microflora. Dry seeds as such did not show
much microorganisms. However, overnight incubation of
seeds in sterile water or in nutrient broth brought out
considerable CFU, predominantly Bacillus spp. This
indicated that the effect due to the applied inoculum could be
modified by the resident seed microflora, which may vary
from batch to batch of seeds.
· The observation on resident seed microflora in tomato
suggested the need for surface sterilization of seeds prior to
the application of inoculum. Surface sterilization using
NaOCl and HgCl2 were quite effective for the removal of
seed microflora but H O was not. HgCl had a negative effect 2 2 2
on seedling growth. NaOCl appeared to be the best chemical
for the surface sterilization.
· NaOCl surface sterilization, however, had a significant
negative effect on the survival of Enterobacter cloacae and the
vegetative cells of Bacillus spp., even 10 days after seed
surface sterilization. Spore-formers appeared to be better
candidates for exploitation than non-spore formers like E.
cloacae.
· Papaya: Field evaluation of plants that were inoculated with
beneficial organisms including Microbacterium, Pantoea and
Sphingomonas spp. could not be taken to logical conclusion
due to the interference from Papaya Ring Spot Virus (PRSV)
incidence in the field. As such, the endophytic organisms did
not provide any protection to the host from the viral
infection.
· Management of microbial contamination: 90% ethanol
appeared to be the best level of ethanol for use as a
bactericide. Alcohol challenge and wipes were very effective
to contain the culture spills and hand contamination from
non-sporulating bacteria but ineffective against spore-
formers.
· A new Technique for bacterial CFU enumeration, namely
'Single Plate - Serial Dilution Spotting (SP-SDS)' was
optimized using the pure cultures of diverse bacteria. The
method appeared to be an useful substitute to spread plating
for the estimation of viable bacterial counts in pure cultures,
mixed cultures and environmental samples with
considerable saving of time, and resources like labour,
nutrient media, plates etc. This allowed the simultaneous
testing of six different dilutions in a single plate with
dependable CFU estimates from at least one dilution in a
plate.
Conclusion
The isolation of endophytic bacteria from antibiotic–treated
and sanitized apparently clean plant tissue cultures together with
the documentation of phytohormone production by the different
organisms suggested that tissue culture associated endophytes
may be having masquerading effects on culture performance.
Trials undertaken with watermelon brought out the need for
uniform seed germination and a method to drive in the inoculum
bypassing the hard seed coat towards the identification of
beneficial organisms. The evaluation of tomato Arka Vikas seeds
brought out the presence of resident microflora in considerable
numbers and the need for their elimination before seed
fortification with endophytes. Sodium hypochlorite was the best
Demonstration of phytohormone production in pure cultures of endophytic bacteria isolated from watermelon
Bacterial isolates retrieved from watermelon cultures showing growth promotion with the supply of host tissue extract.
AMAAS - Annual Report 2010-11
66
disinfectant but the survival of organisms on the seeds was
affected by the residual chloramines. Gram-negative E. cloacae
and the vegetative cells of Bacillus spp. were also highly sensitive
to chloramines but the spores were less affected, suggesting the
use of spore-forming organisms as better agents for commercial
exploitation. As for the management of culture spills and other
surface contaminations, ethanol (90%) wipe eliminated the
contamination from vegetative cells instantly, but not of spores it
warranted a 30 min to overnight UV exposition. Single plate serial
dilution spotting (SP-SDS) was developed as a simple and
efficient method for bacterial CFU enumeration with considerable
saving in the number of plates needed and other resources and
assured and acceptable CFU counts from at least one dilution in a
plate.
Papers published from AMAAS work
· Thomas P. 2010. Plant tissue cultures ubiquitously harbor
endophytic microorganisms. 865: 231-239.
Seminar, Symposia and Conferences attended
· Thomas P. et al. 2010. Plant-Microbe Association in tissue
cultures. Poster presented at the 4th Indian Horticultural
Congress, New Delhi, 17-21 Nov. 2010.
Acta Horticulturae
Harnessing arbuscular mycorrrhizae for biofertilization in horticultural crops
PI : George V. ThomasCo PIs : Alka Gupta, Murali Gopal, R. ChandraMohanan, Alok K. Srivastva, S. K. Singh, V. B. Patel, Anil K.
Sharma, Sukhada Mohandas, V. V. Sulladmat, P. Panneerselvam, R. Thangavelu, K. K. Kumar, Rajesh Kumar Central Plantation Crops Research Institute, Kasaragod, Kerala
Objectives
· Diversity analysis and population estimation of AMF and
beneficial microbes-PGPR (Pseudomonas, Bacillus), Biocontrol
agents- Trichoderma, Nitrogen fixers and phosphate
solubilizers from horticultural cropping (coconut, arecanut,
guava, litchi, citrus etc) systems.
· Isolation and identification of efficient strains of AMF and
beneficial microbes for nutritional, plant growth
promotional and disease suppressive properties.
· Green house evaluation for growth response and disease
suppression.
· Interaction studies of AMF with other beneficial microbes.
· Mass multiplication and field evaluation of consortia.
Significant Achievements
· Analysis of soil and root samples in coconut and arecanut
based cropping systems indicated that the AM-root
colonization ranged from 22 to 40% and the spore population
33 to 66 per 10g soil. In the case of citrus spp., the AM
colonization ranged from 16-48% with the spore count of 2 to
29 per 100g soil. Maximum colonization and spore numbers
were found in pummelo, Assam lemon and khasi mandarin
growing in Shillong.
· The coconut, arecanut, sapota, guava and banana based
cropping systems had preponderant population of Glomus
spp and Gigaspora spp whereas; the citrus was having more
diversity with Glomus, Acaulospora, Gigaspora and Entrospora
spp. In Litchi at least eight spp of Glomus genera was
recorded followed by Gigaspora, Scutellospra and Sclerocyctis.
· Mass-multiplication of Glomus and Gigaspora isolated from
coconut and arecanut soils yielded positive results. In funnel
technique experiment, Glomus spp. produced infection
ranging from 20-75% in sorghum roots while Gigaspora
produced 20-58% infection. However in pot studies
Gigaspora produced an average of 43% infection compared to
27% by Glomus spores. Twelve monospore cultures of AMF
could be obtained at GBPUAT which are being maintained
for molecular studies.
· Several plant growth promoting Bacillus spp., Pseudomonas
spp., Enterobacter spp., Brevibacillus spp., Streptomyces spp.
with phosphate and zinc solubilizing, plant growth hormone
producing and pathogen antagonistic capacities were
isolated from different horticultural crops. Bioassays
revealed that combining AMF with the bacteria could
improve growth parameters in sapota seedlings and guava
air-layering. In banana, combination of AMF and
Entoerobacter/ Azotobacter/ Bacillus spp. was able to
significantly promote the root growth and available
phosphorus levels while suppressing the nematode
populations.
· The four MHBs isolated from AM spores of coconut based
cropping systems were identified as Corynebacterium coyleae,
Bacillus subtilis, Bacillus cereus and Bacillus amyloliquefacience
based on their carbon utilization pattern by BIOLOG. The
MHBs isolated from sapota cropping system were identified
as Brevibacillus parabrevis, B. choshinensis, Psudomonas putida,
and P. aeruginosa by molecular method.
Seminar, Symposia and Conferences attended
· Best Poster Paper Award for paper by Pathak, D, Singh, S.K.,
Francis, R G. and Patel, V.B. 2010. Arbuscular mycorrhizal
fungi (AMF) associated in sustainable production of citrus
under changing climatic conditions in different regions of
India”. XXIII Ann. Conf. of National Environmental Science
Academy 27-29th Dec. 2010, New Delhi.
· Pathak, D, Singh, S.K., Francis, R G. and Patel, V.B. 2010.
Diversity and infectivity of Arbuscular mycorrhizal fungi
(AMF) in citrus rhizosphere soil in the northern and western
regions of India. Presented during 4th Indian Hort. Congress
18-21 Nov. 2010, New Delhi, p. 146-147.
· Viji M.V., Thomas, G.V, Ambili K, Gupta, A., Gopal, M. 2010.
Mycorrhizal and other microbial association with coconut
palms of Minicoy, Kalpeni and Kavaratti Islands of
Lakshadweep Island. In proceedings of International
conference on “Coconut Biodiversity for Prosperity”, 25 – 28
October, 2010, Kasaragod, Kerala. p.104.
· Panneerselvam, P., Saritha, B., Ajay, M., Ranganath, S,
Sulladmath V.V. and Mohandas.S 2010. Diversity of
Arbuscular Mycorrhizal fungi in guava cropping system. In:
National Seminar on Developmental Biology, University of
67
AMAAS - Annual Report 2010-11
Bangalore, 15-17th Sep 2010. p. 72.
· Mohandas, S., Panneerselvam, P., B. Saritha, K.M. Ajay and
V.V.Sulladmath.2011. Arbuscular mycorrhizae (AM) fungal
diversity in sapota (Manilkara achras (Mill.) Forsberg)
cropping system and their effect on growth promotion of the
crop under nursery condition. (Paper submitted to National
symposium on microbial diversity and its application in
health, Agriculture and Industry to be held during 4th-5th
March 2011 at ICAR Res. Complex, Goa.
AMAAS - Annual Report 2010-11
68
Theme : Microbial Management of Agrowaste,Bioremediation, Microbes in Post Harvest and Processing
Assessing structural and functional shifts in soil microbial communities of paper mill effluentcontaminated soils and utilization of microflora for crop growth promotion in these soils
Rationale
The pulp and paper industry is a large consumer of fresh 3water (100- 250 m /ton paper). With practically all of this water
3reappearing as effluent (72- 225 m /ton paper), a large amount of
treatment and disposal is required. Pulp and paper mill effluent
contains several elements including important plant growth
nutrients such as nitrogen (N), phosphorus (P) and potassium (K),
which can help contribute to higher crop yields when applied to
nutrient deficient soils. However, other elements (magnesium,
sodium, chlorides, and sulfur) and organic compounds
(chlorinated lignins, phenolic derivatives) that are common in
pulp and paper mill effluent can cause toxicities and nutrient
imbalance in plants. The tendency of certain elements (especially
Na) to accumulate in pulp and paper mill effluent irrigated soils
affects soil structure, increases soil salinity, decreases root
expansion capabilities, and reduces water percolation and soil
aeration. Furthermore, the addition of such a “mixed bag” of
compounds, such as that found in pulp and paper mill effluent,
may induce changes in physiochemical properties of the soil and
also create significant shifts in structure and function of the
associated microbial community, which in turn may ultimately
affect the soil viability for agriculture purposes .
Soil microbial communities play a vital role in nutrient
cycling, the decomposition of organic matter, carbon
sequestration and more general effects on soil genesis, such as
effects on structure and consequently water retention of the soil.
Through several studies pulp and paper mill effluent application
to soil is known to increase the organic matter content in the soil,
thereby increasing the populations of soil microorganisms. The
introduction of culture-independent techniques like 16S rRNA
gene cloning directly from the environment have provided a more
thorough insight into changes occurring in the structure of the
microbial community as a whole .
Objectives
• To assess the functional and structural shift in culturable soil
microbial population as a result of long term irrigation of
pulp and paper mill effluent.
• Diversity analysis of unculturable microflora in pulp and
paper mill effluent contaminated soils.
• Characterization and utilization of selected microbial
isolates for plant growth promotion in effluent degraded
soil.
Significant Achievements
· A total of 128 isolates were randomly selected (71 from water
PI : D. K AroraCo PI : K.K. MeenaNational Bureau of Agriculturally Important Microorganisms, Mau
irrigated fields (WIF) and 57 from effluent irrigated fields
(EIF)) for molecular characterization. Cluster analysis of
combined 16S rRNA gene restriction pattern based on
Jaccard's similarity index, all these isolates grouped under 20
distinct groups. For phylogenetic analysis of the strains
described in this study, one representative isolate from each
ARDRA group was investigated with partial 16S rRNA gene
sequencing. A total of 9 genera were identified from the WIF
and EIF soil samples, viz., Bacillus, Brevibacillus,
Amycolaptosis, Staphylococcus, Flavobacterium, Streptomyces,
Arthrobacter, Rheinheimera and Pseudomonas.
· From the bacterial 16S rDNA clone library, 258 clones (115
from WIF and 143 from EIF) were randomly selected and
each clone was subjected to PCR-RFLP. A total of 82 (37 from
WIF and 45 from EIF) different banding patterns were
detected. DNA isolated from a single representative clone
from each RFLP group was PCR-amplified and sequenced on
both strands. After excision of 3 chimeric sequences, a total of
79 (35 from WIF and 44 from EIF) different phylotypes were
obtained.
· A total of 71 OTU were detected on based on sequences
having similarity of ≥ 97%. The sequenced clones were
affiliated with sequences from 10 phyla of which one (OP10)
is unculturable of the domain Bacteria. Other phyla were α-,
β-, γ-, and δ- subdivisions of the Proteobacteria, Acidobacteria,
Firmicutes, Bacteroidetes, Planctomycetes, Cyanobacteria,
Chloroflexi, Gemmatimonadates, and Aquificae.
· OTUs corresponding to the phylum Proteobacteria were
most abundant in all libraries (55%). Among them, the
subdivision β- Proteobacteria was detected in the majority of
both WIF and EIF soil library. The Acidobacteria related
phylotypes delivered the second most abundant (24%)
number of clones in the library
Conclusion
In conclusion, we found that microbial communities in pulp
and paper mill effluent irrigated fields were more diverse in both
structure and function. This increase in diversity and function
supports the continued use of pulp and paper effluent as the main
source of irrigation water for crops in regions where clean
freshwater is scarce. We showed that the different methods of
microbial fingerprinting gave similar results when samples were
processed consistently and compatible statistical methods were
used. An integrated multi-technique approach where
biochemical and molecular methods are combined can yield
69
AMAAS - Annual Report 2010-11
results that will allow more confidence than the use of a single
method. This approach is important for ecological studies,
especially for determining the impact of anthropogenic activity,
where a single method will not provide data in which researchers
can have absolute confidence in their validity when applied and
used in larger perspective ecological conclusions.
Papers published from AMAAS work
· Tripathi, B.M., Kaushik, R., Kumari P., Saxena, A.K., and
Arora, D.K. (2010). Genetic and metabolic diversity of
streptomycetes in pulp and paper mill effluent treated crop
fields. World J. of Microbiology and Biotechnology, DOI:
10.1007/s11274-010-0614-1.
· Singh, A.K., Tripathi, B.M., Singh, R.N., Sahay, H., Kaushik,
R., Saxena, A.K., and Arora, D.K. (2010). Biochemical and
Molecular characterization of thermo- alkali tolerant
xylanase producing bacteria from Hot water springs of
Manikaran. Indian J. of Microbiology, vol. 50, pp. 2-9.
Seminar, Symposia and Conferences attended
· Kumari P., Tripathi, B.M., Saxena, A.K., Kaushik, R., and
Arora, D.K. (2011). Diversity analysis of pentachlorophenol
degrading bacteria from pulp and paper mill effluent
contaminated fields. In: International Conference on
Microbes in Waste Water (International Water Association),
Goa, India.
Bioremediation of polycyclic aromatic hydrocarbons (PAH) through microbial consortia
Rationale
Polycyclic aromatic hydrocarbons (PAHs) are organic
pollutants found in various ecosystems. They are considered as
priority pollutants due to their potential toxicity, mutagenicity
and carcinogenicity. PAHs occur as natural constituents and
combustion products of crude and refined fossil fuels. In recent
decades, the major sources of PAHs pollution are industrial
production, vehicular discharge, gasification and plastic waste
incineration. Due to their hydrophobic nature, most PAHs bind to
particulate in soil, rendering them less available for biological
degradation. Microbial metabolism plays an important role in
bioremediation of contaminated sites. Soil Pseudomonads are
being reported to possess genes coding for Catechol-2,3-
dioxygenases,a group of key enzymes in the degradative pathway
of the aromatic compounds. Likewise, white rot fungi (WRF)
degrade a variety of organic compounds that are not readily
degraded by other organisms. This has been attributed to low
substrate specificity of their lignin degrading enzymes (Phenol
oxidases and lignin peroxidases).Although, many researchers
have investigated single microorganisms to degrade individual
PAHs, and reports are lacking on use of microbial consortium for
degradation of low and high molecular weight PAH mixtures in
soil. Therefore, the purpose of this project is to develop a
consortium of bacteria and fungi for bioremediation of PAH
contaminated soil.
Objectives
· Isolation and characterization of PAH degrading
microorganisms from soil.
· Screening of microorganisms for their PAH degrading
potentialities.
· Evaluation of selected microorganisms for in situ
decomposition of PAH.
· Development of practical method for application of consortia
to degrade PAH in soil.
Significant Achievements
· Potent PAHs degrading microbial consortium was
developed which consist of a bacterium (Serratia marcescens
L-11), actinomycetes (Streptomyces rochei PAH-13) and a
white rot fungus identified as Phanerochaete chrysosporium
PI : LataCo PI : Anju Arora, Shashi Bala SinghIndian Agricultural Research Institute, New Delhi
VV18.
· The consortium was evaluated for its PAHs( mixture of
anthracene, phenanthrene, flourene and pyrene)degrading
potential with concentration level of 200 ppm under
submerged condition in Bushnell and Haas medium at
37°C.The degradation percentage of individual PAHs
ranged from18-72%.
· Different carbon and nitrogen sources (yeast extract,
ammonium nitrate, glucose, sodium glutamate) were
evaluated as co metabolic [email protected]% for enhanced
degradation of PAH under submerged condition.
Supplementation of yeast extract resulted in 13-65% increase
in PAH degradation at 200 ppm as compared to
unsupplemented control. This study proved the role of N-
source in improving the efficiency of PAH degradation by
consortia under submerged conditions.
· A microcosm experiment with unamended soil (Soil + PAH
mix + consortium (1%v/w), and amended soil (Soil + PAH
mix + consortium 1%v/w+ *co-substrates) [*urea, paddy
straw (0.2%w/w), ammonium sulphate (0.1% v/w), yeast
extract (0.1% v/w), corn steep liquor (0.1% v/w)] was carried
out for in-situ degradation of PAH mixture.
· Amendment of PAH spiked soil with different co-substrates
(urea, paddy straw, ammonium sulphate, yeast extract, corn
steep liquor) resulted in better microbial activities during
microcosm studies.
· The treatment receiving the combination of ammonium
sulphate (0.1% v/w) and paddy straw (0.2% w/w) showed
highest dehydrogenase activity and enzymes involved in
PAH degradation like lignin peroxidase, laccase and aryl
esterase. Therefore, supplementation of contaminated soil
with combination of paddy straw and ammonium sulphate
alongwith microbial consortia can significantly enhance in-
situ removal of PAHs.
· Amendment of PAH spiked soil with different co-substrates
(urea, paddy straw, Ammonium sulphate, yeast extract, corn
steep liquor) resulted in better in situ degradation of PAHs.
· Biostimulation and bioaugmentation are most feasible and
effective approaches for in situ bioremediation of PAH.
AMAAS - Annual Report 2010-11
70
Conclusion
A microbial consortium consisting a bacteria (Serratia
marcescens L-11), an actinomycete (Streptomyces rochei PAH-13)
and a white rot fungus Phanerochaete chrysosporium VV18 was
found to be very effective for degradation of PAH mixture even
up to 200ppm concentration. Supplementation of yeast extract
(0.1%) improved the degradation of PAH. In situ incorporation of
paddy straw and ammonium sulphate in combination with
consortium can be used as an effective measure for removal of
PAH from soil. Enhancement of PAH degradation by
biostimulation of microbial cultures has been found to be most
feasible and effective approaches for in situ bioremediation of
accidental spills and chronically contaminated sites.
Papers published from AMAAS work
· Chaudhary P, Sharma R., Singh S.B. and Lata (2011).
Bioremediation by Streptomyces sp. Bulletin of Environmental
contamination and Toxicology. (in Press)DOI: 10.1007/s00128-
011-02115).
· Chaudhary P., Pandey A.K., Prasanna R., Singh S.B.,
Chaudhary S. and Lata (2011).Evaluating the phenotypic and
functional diversity of polycyclic aromatic hydrocarbon
(PAH) utilizing bacteria isolated from petroleum refinery
soil. Annals of Plant Protection Sciences. (In Press).
· Chaudhary P., Singh S.B., Lata and Chaudhry S. (2010).
Effect of carbon source on growth of hydrocarbon
degrading strain Serratia marcescens isolated from compost.
Annals of Plant Protection Sciences. 18: 543-544.
Selected microbial strains for consortium development and bioremediation of PAHs.
Genotyping and isolation of sphingomonads from HCH contaminated agricultural soils and theirapplication in bioremediation
Rationale
In India technical HCH was used until 1997 followed by
restricted use of lindane. This led to low (at agricultural land) as
well as high levels (at dump sites) of HCH contamination
problems. From these contaminated sites the HCH residues
spread and leach upto ground water. Thus there is an urgent need
to decontaminate the HCH contaminated soils. The project has
been designed from basic (pathway and genetics of HCH
degrading sphingomonads) as well as applied (application of
microorganisms to decontaminate the contaminated sites) point
of view. The isolation of novel HCH degrading bacteria and genes
enrich the diversity and genetic pool of HCH degraders while
characterization of rate of degradation and study of genes and
enzymes involved in HCH degradation will help in selection of
better organisms for bioaugmentation of contaminated soils.
Finally the part of basic research will be applied to develop
effective bioremediation technology for cheap, effective and
sustainable removal of HCH from contaminated agricultural
sites.
Objectives
· Identify heavily contaminated agricultural sites with HCH
isomers.
· Enrichment of soil samples for the isolation of
sphingomonads that degrade HCH or other pollutant.
· Genotyping of soils for presence of sphingomonads.
· PCR amplification and cloning of degradative genes.
PI : Rup LalDepartment of Zoology, University of Delhi, Delhi
· Microcosm/mesocosm studies to determine efficacy in the
field.
Significant Achievements
· Highly HCH contaminated agricultural sites have been
found in Chinhat, Deva, and Ummari village (Lucknow, UP).
· A number of HCH degrading bacterial strains have been
isolated.
· The rate and genetics of degradation has been worked out in
these strains. Moreover some of these strains have been
characterized taxonomically and belong to sphingomonads.
· The genes responsible for HCH degradation have been
characterized in these strains.
· Metagenomic approach has been taken up to study bacterial
diversity and genes involved in HCH degradation from
these contaminated sites.
· Biostimulation has been carried out to determine the HCH
degradation potential of indigenous soil organism.
· A defined consortium of 5 HCH degrading bacteria has been
developed.
· Small scale pot experiments have been conducted which
suggested the efficiency of consortium in HCH degradation.
· The preliminary laboratory work on consortium is being
applied to the fields.
Conclusion
A number of bacterial strains have been isolated that have
71
AMAAS - Annual Report 2010-11
HCH degradation potential. These strains have lin genes that are
responsible for HCH degradation. Many variants of lin genes
have been isolated using metagenomic approach. Biostimulation
of indigenous soil population suggests that it can be used for
decontamination of those sites where bioaugmentation fails.
Consortium application to the pot level experiments suggests that
a consortium is more efficient than a single bacterium for
decontamination of such sites. The degradation data from the
fields can eventually suggest the possibility to use this consortium
in developing an efficient bioremediation technology in near
future.
Papers published from AMAAS work
• Lal D., Gupta S.K., Schumann P. and Lal R. (2010)
Microbacterium lindanitolerans sp. nov. isolated from
hexachlorocyclohexane contaminated soil. Int. J. Syst. Evol. Microbiol. (Accepted)
• Jit S., Dadhwal M., Kumari H., Jindal S., Kaur J., Lata, P.,
Niharika, N., Lal, D., Garg, N., Gupta, S. K., Sharma, P., Bala,
K., Singh, A., Vijgen, J., Weber R. & Lal R. (2010). Evaluation
of hexachlorocyclohexane contamination from the last
Lindane production plant operating in India. Environ Sci
Pollute Res DOI 10.1007/s11356-010-0401-4.
• Kaur, J., Verma, M. and Lal, R. (2010). Rhizobium
rosettiformans sp. nov., isolated from hexachlorocyclohexane
(HCH) dump site in India, and reclassification of
[Blastobacter] aggregatus Hirsch et al. [1985] as Rhizobium
aggregatum comb. nov. .Int. J. Syst. Evol. Microbiol. (Accepted).
• Kumari, K., Sharma, P., Tyagi, K. and Lal, R. (2010).
Pseudoxanthomonas indica sp. nov. isolated from
Hexachlorocyclohexane dumpsite in north India. Int. J. Syst.
Evol. Microbiol. (Accepted).
Refinement in indoor compost technology for white button mushroom using thermophilic organisms
Rationale
Cereal straw, which is abundantly available in our country, is
the basic raw material for the compost production of white button
mushroom. Our yields levels of white button mushroom
(Agaricus bisporus) are the lowest in the world and main reason
attributed to this is the poor quality compost used for the
cultivation. The present project envisages its improvements
through thermophilic microorganisms for increased yields.
Compost prepared either by long method of composting (LMC) or
by short method of composting (SMC) involves traditional
outdoor composting, which causes environmental problems. In
our country laws governing pollution (emission of odour) have
become very stringent which may result in closure of such units
producing compost by above methods. Need is therefore felt to
control the composting process in such a manner so that there is a
least possibility of environmental pollution and at the same time
to monitor the whole composting procedure in such a way that an
end product most suitable for the growth of mushroom mycelium
is obtained with a clean procedure in shortest possible time
specially with the help of thermophilic organisms. Present project
envisages the exploitation of different thermophilic organisms
towards refinement in environment friendly indoor composting
procedure where compost will be prepared in 7-10 days time as
against 16-28 days presently taken in LMC and SMC. Further
improvements in the present day composting procedures (LMC &
SMC) by their inoculations with potent stains of thermophilic
organisms are also envisaged for increased yields of this
mushroom.
Objectives
· To conduct surveys at compost units in different corners of
India for the isolation of thermophilic organisms for their
screening towards their potential in converting agro wastes
into white button mushroom compost.
· Molecular characterization, physiological and enzymatic
studies on different thermophilic organisms.
PI : B. VijayDirectorate of Mushroom Research, Chambaghat, Solan
· Refinement in environmental friendly indoor, long and short
method composts using above strains of thermophilic
organisms.
· Development of microbial inoculation technology package
for bulk production of different composts for commercial
purpose.
Significant Achievements
· During the year under report a large number of compost
samples were analyzed for mycoflora isolations. S.
thermophilum, H. insolens and H. grisea were dominantly
isolated from various samples. Theses fungi showed lots of
variability among them selves. Molecular characterization is
under progress.
· Seven strains of Humicola insolens collected from different
locations across the country were screened for laccase and
manganese peroxidase activity on seven compost
formulations. Formulation –1 having chicken manure and
cottonseed meal exhibited highest laccase activity for all
most all the strains. Among all the strains tried, strain-2
exhibited highest activity in formulation- 6.
· All the above strains secreted lesser manganese peroxidase
enzyme compared to laccase. Highest activity of this enzyme
was shown by all most all the strains in formulation-2,
compared to control, which showed far lesser activity. Strain
–1 showed the highest activity among all the strains tried in
formulation –1.
· Seven strains of S. thermophilum were evaluated for C-1
Cellulase production on seven compost formulations. All the
strains exhibited different activities of this enzyme on
different formulations. Among all the strains tried Strain X-
10 exhibited highest activity.
· Total cellulose percentage was estimated in compost piles
inoculated with S. thermophilum, H.insolens and their
consortium. Consortium of above fungi showed highest
cellulose degradation activity from initial to maturation
AMAAS - Annual Report 2010-11
72
phase.
· Composting period was brought down to 20 days from 28
days under LMC with the help of thermophilc fungi.
· Methodology for total indoor compost production using
consortium of thermophlic fungi (S. thermophilum, H.
insolens, H. grisea) almost standardized (3 trials done). In this
case, compounding mixture after its thorough wetting
(3days) was directly filled in the Phase II tunnel, escaping
Phase -I conditions altogether. Compost was subjected to
pre- pasteurization conditioning, pasteurization and post
pasteurization conditioning. Entire operation lasted for 10
days (3days mixing + 7days in tunnel). All the trials gave
excellent results. Wheat straw to final compost ratio was 1:3.
No environment pollution was observed using such
technique.
· In another trial on indoor composting, pasteurized compost
was used as consortium of thermophlic organisms. Compost
was successfully prepared in 10-12 days time using this as
inoculum source. Excellent spawn run was observed in all
the treatments.
· Looking to the success of the new technology developed for
total indoor compost production and its demonstration to
the mushroom growers in the mushroom mela organized at ththe center on 10 Sept.2010, one mushroom grower Mr.
Harsuranjeet Singh (Sunny) from Hosiarpur (Punjab) came
forward to adopt this technology. One large scale on farm
trial (20 tons compost production) on this technique was
taken at his unit. Very good compost was produced by this
new technique and the grower reported around 20%
conversion from such compost in 60 days of cropping.
· One day mushroom consumption fair was organized at
above farm on 03.02.11 in which newly developed indoor
composting technique was demonstrated.
Conclusion
A new method of total indoor compost production was
standardized in 10 days time escaping phase-I conditions
altogether using consortium of thermophilic fungi. Such
composting procedure, besides being an express method (only 10
days against 20 days of short method) is environment friendly,
less labour consuming and steam requirement for pasteurization
is almost nil (pasteurized by self generation of heat) and end
product is most suitable for the growth of mushroom mycelium
giving higher productivity of mushroom. Efforts are also on to
reduce the period of long method compost for seasonal growers
from 28 days to 20-16 days with the help of thermophilic fungi
(partial success achieved).
Papers published from AMAAS work
· Vijay B., Nitika Sharma and Swet Kamal. 2010. Cellulose
production by Scytalidium thermophilum and its potential use
in rapid composting for Agaricus bisporus. Mushroom Research
(accepted).
Seminar, Symposia and Conferences attended
· Vijay B., Ashutosh Pathak, Vikas Taank and Manjit Singh
2011. Role of thermophilic fungi in shortening the duration of
composting for Agaricus bisporus (white button mushroom)
cultivation. Invited paper presented at Indian Science thCongress, held at Chennai from 3-7 Jan 2011
· Pathak A., V.K. Taank and B. Vijay. 2010. Laccase and
Mangenese Per Oxidase activity of Humicola insolens strains
on different compost formulations. Paper presented at National Symposium on Diversification for Sustaining
Profitability in Mushroom Production, UHF, Nauni (HP). Nov.
26-27.
· Vijay B., Ashutosh Pathak, Vikas Taank and Manjit
Singh.2010.Total indoor compost production for white
button mushroom (Agaricus bisporus) using thermophilic
organisms. Paper presented at National Conference on Hort. Bio-diversity for Livelihood, Economic Development and Health
Care at UHS, Bangalore, 21-31. May 2010. pp117.
Optimization of parameters for utilization of paddy straw, kinnow pulp and pea pods forproduction of cellulases, ethanol and feed supplements
Rationale
India is the second largest producer of paddy in the world
and produces about 21% of the total paddy produced in the world.
Paddy yields a significant amount of biomass in the form of paddy
straw, which due to non availability of the infrastructure or
bioprocessing technologies in India is burnt in the fields after crop
harvest resulting in loss of biomass and environmental pollution.
Since, paddy straw contains cellulose and hemicellulose in
significant quantity, it has a good potential for production of
value-added products such as cellulase and ethanol. Cellulase is
indispensable for cellulosic ethanol production and contributes
significantly to its production cost. Cellulase is a complex enzyme
of different components which show a lot of diversity depending
PI : H. S. OberoiCo PIs : V. K. Bhargav, Pranita JaiswalCentral Institute of Post- Harvest Engineering and Technology, Ludhiana
upon the microorganism used for its production. The
commercially available cellulase is expensive since different
components such as cellulase, β- glucosidase, xylanase etc are
added separately for efficient hydrolysis of lignocellulosic
material, thereby increasing the production cost. Thus,
production of consortium of all components in one cocktail with
high specific activity will help in improving the process
economics. Despite being rich in sugars and minerals, kinnow
waste and pea pods do not find any commercial application in
India and are disposed off into the municipal bins, thus leading to
environmental pollution. Development of a cost effective process
for utilization of kinnow waste and pea pods is imperative for
management of the huge quantum of biomass available in the
73
AMAAS - Annual Report 2010-11
form of crop residues. Production of cellulolytic enzymes using
such substrates and use of the fermented residue as feed
supplement would add value to the residue thus generating
interest among farmers for better residue management, by getting
extra remuneration by sale of residues too and entrepreneurs for
setting up commercial units in rural areas.
Objectives
· Development of microbial consortium for cellulose
degradation, hexose and pentose fermentation.
· Optimization of operating parameters such as substrate and
inoculum concentrations, pH, temperature, aeration etc for
cellulase and ethanol production
· Optimization of downstream processing parameters for
recovery and purification of cellulase and ethanol
· Evaluation of residues after fermentation for suitability as
feed supplements.
Significant Achievements
· About twenty isolates showing characteristic zones on CMC
plates impregnated with congo red belonged to genera
Aspergillus, Trichoderma and Humicola. They were assayed for
filter paper cellulase and β-glucosidase activities.
· Four isolates belonging to the genera Aspergillus showed
filter paper cellulase activity of 1 FPU/ml or higher were
further assayed for the total cellulase enzyme profile. On the
basis of morphological and biochemical characterization,
they were identified as isolates belonging to Aspergillus niger,
Aspergillus flavus and Aspergillus fumigatus.
· Two yeast isolates and one bacterial isolate have been
isolated using selective adaptation on xylose medium and
have shown the capability to assimilate and ferment pentose
sugars such as xylose and arabinose.
· Simultaneous saccharification and fermentation of Kinnow
waste with cellulase obtained from Aspergillus niger and
fermentation by Pichia kudriavzevii resulted in ethanol
concentration of 34 g/l and ethanol productivity of 2.8 g/l/h.
· Galactose adaptation of thermotolerant Pichia kudriavzevii
cells helped in enhancing ethanol production from
sugarcane juice at fermentation temperatures at 40 and 45
ºC.
· Statistical optimization of concentration of cellulase, β-
glucosidase, hydrolysis, temperature and time helped in
obtaining 92% conversion of glucose from glucan in alkali
pre-treated rice straw.
· Crude enzyme filtrate with filter paper cellulase (FP) activity
of 1.50 FPU/ml could be concentrated to 8 FPU/ml in about
2h with protein getting concentrated from 0.17 mg/ml to 1.49
mg/ml.
· Rice straw as well as pea pods used for enzyme production
through solid-state fermentation showed a reduction in
cellulose, hemicellulose and lignin concentrations and an
increase in protein and ash concentrations in the biomass left
after enzyme extraction indicating potential for use as cattle
feed.
· The products such as kinnow peel candies and kinnow pulp
leather prepared from kinnow residues are being evaluated
for nutritional and sensory attributes.
Conclusion
Simultaneous saccharification and fermentation (SSF) using
crude cellulolytic enzyme produced by a strain of Aspergillus niger
and a thermotolerant strain of Pichia kudriavzevii cells produced
ethanol at a concentration from 34 g/l. Statistical optimization of
concentration of cellulase, β-glucosidase, hydrolysis, temperature
and time helped in obtaining 92% conversion of glucose from
glucan in alkali pre-treated rice straw. Recycling of Pichia
kudriavzevii cells in a galactose medium over three cycles helped in
enhanced ethanol production at temperatures in the vicinity of 40
ºC and 45 ºC. Rice straw as well as pea pods used for enzyme
production through solid-state fermentation showed a potential
for use as cattle feed.
Papers published from AMAAS work
· Dhaliwal SS, Oberoi HS, Sandhu SK, Nanda D, Kumar D and
Uppal SK (2011) Enhanced ethanol production from
sugarcane juice by galactose adaptation of a newly isolated
thermotolerant strain of Pichia kudriavzevii. Bioresource
Technology. (in press) Doi: 10.1016/j.biortech.2011.02.015.
· Babbar N, Oberoi HS, Uppal DS and Patil RT (2011) Total
phenolic content and antioxidant capacity of extracts
obtained from six important fruit residues. Food Research
International. 44: 391-396.
· Oberoi HS, Vadlani PV, Nanjundaswamy A, Bansal S, Singh
S, Kaur S and Babbar N (2011) Enhanced ethanol production
from Kinnow mandarin (Citrus reticulata) waste via a
statistically optimized simultaneous saccharification and
fermentation process. Bioresource Technology 102: 1593-1601.
· Oberoi HS, Babbar N, Dhaliwal SS, Kaur S, Vadlani PV,
Bhargav VK and Patil RT (2010). Enhanced oil recovery by
pre-treatment of mustard seeds using crude enzyme extract
obtained from mixed-culture solid-state fermentation of
Kinnow (Citrus reticulata) waste and wheat bran. Food and
Crude enzyme concentration using 10 kDa regenerated cellulose membranes
Effect of temperature on ethanol production from sugarcane juice with galactose adapted and non - adapted Pichia kudriavzevii cells.
AMAAS - Annual Report 2010-11
74
Bioprocess Technology. (in press) Doi: 10.1007/s11947-010-
0380-y.
· Oberoi HS, Vadlani PV, Brijwani K, Bhargav VK and Patil RT
(2010). Enhanced ethanol production by fermentation of rice
straw using hydrolysate adapted Candida tropicalis ATCC
13803. Process Biochemistry 45: 1299-1306.
Seminar, Symposia and Conferences attended
· Sandhu SK, Dhaliwal SS, Oberoi HS: Statistical optimization
of hydrolysis process for Kinnow Mandarin (Citrus reticulate)
peel using crude enzyme consortium obtained from newly stisolated Aspergillus oryzae in 51 annual AMI conference at
BIT, Ranchi, 14-17 December 2010.
· Babbar N, Oberoi HS, Dhaliwal SS and Kaur S: Effect of
enzymatic maceration treatment on enhancement in juice
content, total phenolic content and antioxidant activity in
guava juice in National conference on New Horizons in
Bioprocessing of Foods (NHBF) held at SLIET, Longowal, 25-
26 February 2011.
Patents filed from AMAAS project work
· One patent application “Glow U: Face care system”, has been
filed with the Controller of Patents and designs, New Delhi
(2325/DEL/2010 dated 28/09/2010).
Bioremediation of commonly used pesticides in tropical rice ecosystem
Rationale
Environmental pollution caused by the release of wide range
of compounds as a consequence of industrial and agricultural
progress has now assumed serious proportions. Bioremediation,
a biodegradation process in which sites contaminated with
xenobiotics are cleaned up by means of bacterial bio-geochemical
processes, preferably in situ, exploits the ability of
microorganisms to reduce the concentration and/or toxicity of a
large number of pollutants. Bioremediation relies on encouraging
biological processes to minimize an unwanted environmental
impact usually being the removal of a target contaminant from the
biosphere. Microbial diversity offers an immense field of
environment-friendly options for mineralization of contaminants
or their transformation into less harmful non-hazardous
compounds. Exploring the range of microbial biodiversity is the
key to developing effective and environment friendly “green
technologies”. Bioremediation is one such process that exploits
the catabolic abilities of microorganisms to degrade harmful and
toxic xenobiotics. In view of the potential role of microorganisms
to derive biochemical process in a more energy conserving
manner, it is possible to develop bioremediation process that are
in harmony with nature resulting in huge social and economic
benefit in ensuring the sustainability of the ecosystem.
Objectives
· Develop an understanding of the structural and functional
diversity analysis of microbial communities and their
dynamics in response to anthropogenic stress including
xenobiotic application.
· Determine the biochemical mechanisms including
enzymatic pathways involved in aerobic and anaerobic
degradation of pesticides.
· Expand understanding of microbial genetics as a basis for
enhancing the capabilities of microorganisms to degrade
polluting xenobiotic.
· Conduct microcosm/mesocosm studies of new
bioremediation techniques to determine in a cost-effective
manner whether they are likely to work in the field, and
establish dedicated sites where long-term field research on
bioremediation technologies can be conducted.
PI : T. K. AdhyaCo PI : T. K. DangarCentral Rice Research Institute, Cuttack
· Develop, test and evaluate models for assessing efficacy of
bioremediation technologies.
Significant Achievements
· Three times application of 10 μg α-, β-, γ- and δ-HCH/g rice
soil of Canning and CRRI at 7d intervals enriched only the β-
and γ-HCH degraders.
· Finally, about 96-98% and 72-85% of β-isomer of the pesticide
was degraded in the CRRI and Canning soils, respectively
within 29d.
· Within the same period, 14-50% and 23-35% γ-HCH was
metabolized in the Canning and CRRI soils, respectively.
· Nineteen β-HCH degrading bacteria (Is1-19) were isolated
from the pesticide treated soils and checked for degradation
of the pesticide. In MS medium, the organisms were able to
degrade about 50-97% β-HCH. The decreasing order of
degradation of β-HCH by 4 most potent isolates was Is12
(98%), Is5 (89%), Is3 (88%), and Is18 (83%) after third
application @10 μg/ml. The retention time of the
degradation product was 1.73 min.
· About 20% γ-HCH was degraded by one isolate (Is19) after
10d incubation.
· The most potent β-HCH degrading bacterium (PCRBHCH)
formed pale-pink and 1-4 mm colonies. It was Gram (–)ve,
motile, aerobic rods of 2.0-2.9 × 1.00-1.02 µm size. The
organism did not produce any diffusable fluorescent
pigment. Optimal temperature for growth of the organism 0was 30-37 C and pH 6-7.
· The organism was positive for oxidase, catalase, starch and
gelatin hydrolysis and MR-VP test but negative for nitrate
reduction and H S production. The organism utilized lactose, 2
fructose, dextrose, galactose, raffinose, trehalose, arabinose,
mannose, glycerol, inositol, mannitol, ribose, salicin,
glucosamine, chloroform and formamide. However, it did
not use xylose, maltose, melibiose, sucrose, inulin, sodium
gluconate, dulcitol, sorbitol, adonitol, citrate, α-methyl-d-
glucoside, adonitol and lactose.
· The organism produced lysine and ornithine decarboxylase
and urease but did not produce phenylaline deaminase and
75
AMAAS - Annual Report 2010-11
nitrate reductase.
· The isolate was sensitive to the antibiotics penicillin G,
gentamicin, ciprofloxacin, vancomycin, chloramphenicol,
neomycin, ampicillin, tetracycline and rifampicin forming
0.3-1.9 cm inhibition zones but resistant to nalidixic acid and
erythromycin.
· The 16S rRNA sequence identified it (PCRBHCH) as
Methylobacterium (sequence accession no. G340522).
· Two other bacteria were also isolated from the flooded rice
soil of Canning which degraded p-nitrophenol (PNP)
efficiently within 24h. The isolates were identified as Bacillus
spp. by 16s rRNA sequencing.
· The 471 and 250 bp amplicons of the genome of the
Methylobacterium sp. were amplified by the HCH specific
primers viz. linA and linB in PCR, respectively which proved
that the isolates contain the HCH degrading genes.
· Five bacteria isolated from CRRI and coastal saline rice field
soils of West Bengal were capable to degrade 10 μg/ml
chlorpyriphos to undetectable level in MS medium within
12-15d. One of the isolates was similar to Labrys monachus (T)
(NCBI Accession No. AJ535707) and the other was identified
as Inquilinus limosus (NCBI Accession No. AY043373).
Characterization of the other isolates is in progress.
· Degradation of chlorpyriphos (10 μg/ml) by the soil from
flooded, planted (variety Naveen)/unnplanted,
chlorpyriphos treated/untreated conditions was faster in the
planted and treated soils than the others. About 99.6%
chemical was metabolized in the former conditions but it was
about only 60-80% in the other soils.
· Degradation trend was similar in the non-flooded, planted
and chlorpyriphos treated soils than the non-flooded,
unplanted and chlorpyriphos untreated; non-flooded,
planted and chlorpyriphos treated; and unplanted and
chlorpyriphos untreated conditions. Overall degradation
was more effective under planted and chlorpyriphos treated
and non-flooded situation which was about 99.9% of the
pesticide.
· The Labrys sp. strain CH23 did not significantly degrade
chlorpyriphos (10 μg/ml) in CRRI field soil under flooded
and non flooded conditions up to 20d.
· Repeated chlorpyriphos application in costal saline Canning stsoil, enhanced urease activity from 1 treatment (6.4-12.5
ndmg/kg/h) to 2 treatment (22.7-37.8 mg/kg/h) but declined rdafter 3 treatment (5.9-20.3 mg/kg/h) under flooded,
planted/unplanted and chlorpyriphos treated/untreated
soils. The trend, however, was not followed for non-
flooded/flooded, planted/unplanted and chlorpyriphos
treated/untreated fields. Optimum activity (24-38 ndmg/kg/h) was also recorded after 2 application in non-
flooded conditions but it subsequently remained
unchanged.nd· Alkaline phosphatase activity was also higher after 2 rdapplication (58-88.9 µg/g/h) and it declined after 3
application. But in non-flooded conditions no specific trend
could be observed.
· Dehydrogenase activity did not follow any trend in flooded,
planted/un-planted chlorpyriphos treated soils (ranged nd0.08-2 µg/g/d) but in untreated soils it declined after 2
treatment and remained unchanged thereafter (0.16-0.30 ndµg/g/d). In non-flooded soils, the activity increased after 2
treatment but in other conditions activity was low (0.04-0.28
µg/g/d) and did not change.
· Optimum temperature for chlorpyriphos degradation for the oisolate CH23 was 35 C and about 99.88% of the chemical was
detoxified by the bacteria after 15 days incubation.
· Two chlorpyriphos degrading bacteria of CRRI soil were
identified as Labrys spp. Strain CH23 (PCR2) and
Methylobacterium sp. Strain PCR CH13 by 16S rRNA
sequencing.
· One potent chlorpyriphos degrading bacteria was isolated
from Hazaribagh soil which was identified as Inquilinus sp.
· Degradation kinetics of three potent bacteria showed that
degradation increased with concomitant increase of bacterial
population of two isolates (CN 1, 2) but in case of one bacteria
(CN 3) degradation increased despite decline of bacterial
population.
Three times application of 10 μg α-, β-, γ- and δ-HCH/g rice
soil of Canning and CRRI at 7d intervals enriched only the β- and
γ-HCH degraders. Nineteen β-HCH degrading bacteria (Is1-19)
were isolated from the pesticide treated soils and checked for
degradation of the pesticide. In MS medium, the organisms were
able to degrade about 50-97% β-HCH. The decreasing order of
degradation of β-HCH by 4 most potent isolates was Is12 (98%),
Is5 (89%), Is3 (88%), and Is18 (83%) after third application @10
μg/ml. The retention time of the degradation product was 1.73
min. Degradation kinetics of three potent bacteria showed that
degradation increased with concomitant increase of bacterial
population of two isolates (CN 1, 2) but in case of one bacteria (CN
3) degradation increased despite decline of bacterial population.
Conclusion
PCR product by amplification of linA primer
PCR product by amplification of linB primer
AMAAS - Annual Report 2010-11
76
Development of bacterial consortia for bio-processing agricultural wastes and bioremediation ofaquaculture effluents
Rationale
Lignocelluloses are the most abundant renewable organic
matter on the earth and their utilization could allow self-
sustainable processes and products. Lignocelluloses consist of
lignin, hemicelluloses and celluloses. Bioconversion of
lignocellulosic wastes could make a significant contribution to the
production of fish through aquaculture. Serious concern is raised
by the environmentalists about pollution and environmental
degradation from aquaculture effluents. This project aims at
remediating the effluents, which are rich in ammonia, sulphur,
organic matter and methane using bacteria. Bacterial consortium
is better than the use of one or two bacterial strains to treat the
waste having varying composition. This project aims at
developing bacterial consortium capable of decomposing
lignocellulosic agro-waste and also to develop bacterial
consortium to bio-remediate toxic materials from aquatic farms.
The project also aims at reducing the recalcitrant organic matter
content in the environment, reducing the pollution problem and
chemical fertilizers load, maintaining the sustainability in
production, and providing scope for waste land development.
Objectives
· To develop bacterial consortia capable of decomposing
lignocellulosic agro-waste.
· To develop bacterial consortia to bio-remediate toxic
materials from aquatic farms.
Significant Achievements
· The crude consortium Cb (Bacillus pumilus, B. subtilis, B.
endophyticus and B. megaterium), which was designed in 2009-
10 was evaluated for its efficiency to degrade complex agro-
wastes like cotton boll and also for its stability.
· The consortium showed lower xylanase and cellulase
activities compared to individual members.
PI : C. S. PurushothamanCo PIs : P. K. Pandey, A. VennilaCentral Institute of Fisheries Education, Mumbai
· The crude consortium Ca (B. pumilus, B. megaterium, A.
feacalis, and B. cereus) evaluated in 2009-10 was modified
since B. cereus was found to have a negative effect on the
overall activity of the consortium.
· B. cereus was replaced with B. subtilis and this modified
consortium Ca (now referred to as Ca*) was evaluated for
activity as well as stability.
· Of all the crude consortia evaluated till date, Ca* has given
the best results with higher xylanase activities compared to
individual members.
· Cellulase activity of B. subtilis was significantly higher and
that of B. megaterium was slightly higher than the consortium;
so, Ca* can be considered for further evaluation.
· Standardization of zymogram analysis to compare the types
of enzymes produced by different isolates is being done; total
protein was precipitated from culture supernatants followed
by dialysis of the precipitate.
· Higher cellulase activity was detected in the dialyzed
fraction compared to the supernatant.
· No active bands were detected in activity staining with
cellulose as substrate.
· Using the water samples collected from fish/prawn rearing
unit in 2009-10, a total of ten isolates were obtained on solid
medium for isolation of nitrifying bacteria.
Conclusion
Consortium Ca* has given the best results with higher
xylanase activity compared to that of individual members.
Cellulase activity of B. subtilis was significantly higher, and that of
B. megaterium was slightly higher than that of the consortium.
Therefore, Ca* is selected for further work. The identities of the
isolates obtained on nitrifying media need to be confirmed and
their nitrifying abilities need to be tested.
Average cellulase activity (left) and average xylanase activity (right) of consortium Ca*, its individual members and knockouts.
77
AMAAS - Annual Report 2010-11
Microbial bioremediation of wastewater for heavy metals
Rationale
Waste water, particularly from industries contain high
concentration of heavy metals which enter into human beings and
animals through food chain. Physico-chemical methods such as
reverse osmosis, solvent extraction, lime coagulation, ion
exchange and chemical precipitation for removal of heavy metals
from wastewater are very expensive and these do not remove
heavy metals from wastewater up to desired limits. Therefore, it is
desirable to remove these heavy metals from wastewater through
low cost technology before its use in agriculture. Biomass of
microbes acts as adsorbent to remove heavy metals from
wastewater. The ability to remove heavy metals from wastewater
varies greatly among microbes. This needs to be exploited for
bioremediation of heavy metals from wastewater through
efficient microbes.
Objectives
· Isolation of microbes from sites polluted with heavy metals.
· Screening of microbes for tolerance to heavy metals.
· Monitoring of polluted sites for heavy metals.
· Microbial removal of heavy metals from wastewater under
laboratory conditions.
· Development of technology for removal of heavy metals
from wastewater through efficient microbes.
· Characterization of efficient microbes through biochemical
tests and molecular techniques.
· Field testing of efficient microbes for removal of heavy
metals from wastewater.
Significant Achievements
· Trichoderma longibrachiatum showed higher Pb, Cd, Ni
removal capacity (70.85%, 82.20% & 50.80%) than T.
fasciculatum (55.50%, 60.55% & 39.40%) respectively within
144 h from potato dextrose broth containing 20 ppm Pb, Cd &
Ni individually.
· Bacillus cereus showed higher Pb removal capacity (62.25%)
than Bacillus sp. (57.45%) within 48 h whereas B. cereus
removed higher Ni (43.20%) within 12 h as compared to
Bacillus sp. which removed 23.51% Ni within 18 h. Cadmium
removal capacity was also higher for Bacillus sp. (47.55%)
PI : P. K. Joshi Co-PI : L. BatraCentral Soil Salinity Research Institute, Karnal
within 36 h as compared to B. cereus (33.90%) within 48 h from
nutrient broth containing 20 ppm of Pb, Cd and Ni
individually.
· T. longibrachiatum showed higher Pb removal capacity
(80.50%) than T. fasciculatum (71.00%) at 3.0% inoculum size,
whereas T. longibrachiatum removed higher Cd (89.85%) at
2.0% inoculum size as compared to T. fasciculatum which
removed (62.60%) Cd at 2.5% inoculum size. Ni removal
capacity was also higher for T. longibrachiatum (59.20%) as
compared to T. fasciculatum (42.55%) at 2% inoculum size
from potato dextrose broth containing 20 ppm of Pb, Cd and
Ni individually.
· B. cereus showed higher Pb & Ni removal capacity (55.90%
and 40.75%) than Bacillus sp. (43.50% & 23.50%) at inoculum
size of 2.5% and 2% respectively. Cadmium removal capacity
was higher from Bacillus sp. (39.60%) as compared to B. cereus
(24.30%) at 0.5% inoculum size from nutrient broth
containing 20 ppm of Pb, Cd and Ni individually.
· The FTIR analysis of untreated and heavy metal (Pb, Cd &
Ni) treated T. longibrachiatum indicated the involvement of
functional groups such as –NH, -OH, -CH, and C=O in the
binding of Pb, Cd and Ni with T. longibrachiatum.
· Consortium of five fungi (Aspergillus niger, A. terreus, T.
longibrachiatum, T. fasciculatum & A. awamori) and two
bacteria (B. cereus & Bacillus sp.) in combination with
different agrowaste material like charcoal, pressmud, rice
straw, FYM and rice husk were tested for removal of heavy
metals (Cr, Cu & Ni) from industrial effluents. Data indicated
encouraging results with microbial consortium along with
pressmud in comparison to pressmud alone.
Conclusion
Optimum conditions like time, inoculum level were worked
out for efficient fungi (T. longibrachiatum & T. fasciculatum) and
bacteria (B. cereus & Bacillus sp.) for maximum removal of heavy
metals (Pb, Cd & Ni) under laboratory conditions. The FTIR
analysis of T. longibrachiatum indicated the involvement of
functional groups such as –NH, -OH, -CH, and C=O in the
binding of Pb, Cd and Ni with T. longibrachiatum. Consortium of
Fig. Effect of inoculum size on removal and uptake of Pb from potato dextrose broth containing 20 ppm of Pb by T. fasciculatum and T. longibrachiatum
Fig. Effect of inoculum size on removal and uptake of Cd from nutrient broth containing 20 ppm of Cd by B. cereus and Bacillus sp.
AMAAS - Annual Report 2010-11
78
five fungi (Aspergillus Niger, A. terreus, T. longibrachiatum, T.
fasciculatum & A. awamori) and two bacteria (B. cereus & Bacillus
sp.) grown on pressmud indicated encouraging result for removal
of heavy metal (Cr, Cu & Ni) from industrial effluents.
Papers published from AMAAS work
· Joshi, P.K., Kumar, R., Rajput, V.D., and Singh, N (2010).
Isolation and screening of bacterial isolates for tolerance to
heavy metals. Journal of Soil Salinity and Water Quality 2 (1),
12-17.
· Joshi, P.K., Swarup, A., Maheshwari, S., R, Kumar and Singh,
N (2011). Bioremediation of heavy metals in liquid media
through fungi isolated from contaminated sources. Indian. J.
Microbiol (Accepted).
Seminar, Symposia and Conferences attended
• Joshi, P.K., Kumar, R and Rajput, V.D. 2010. Biosorption of
Pb, Cd and Ni by fungi and bacteria from liquid medium. In st51 Annual Conference of AMI and International
symposium on recent Advances in Cross-disciplinary
Microbiology: Avenues and Challenges held at Birla Institute
of Technology, Ranchi, P-176.
Bioremediation of effluents from shrimp farms
Rationale
Modern intensive and semi-intensive aquaculture practices
involve use of supplementary feeds rich in protein (as much as 25-
40 percent). In high intensity aquaculture, water quality becomes
a limiting factor. Fish and shrimp accumulate about 20-25% of
protein and the rest is released to the pond as ammonium and
organic nitrogen. These proteinaceous wastes result in total
ammonia nitrogen (TAN) and biochemical oxygen demand
(BOD). Ammonia is also a major end product of protein
catabolism excreted by fish, crustaceans and mollusks into the
culture system. TAN is composed of unionised (NH -N) and 3
+ionised forms (NH ). The unionised ammonia is most toxic to 4
aquatic organisms, as it can readily diffuse through cell
membranes and is highly lipid-soluble. Nitrite (NO ), an 2
intermediate product of nitrification is also one of the toxic form of
nitrogen that can be found in aquaculture ecosystems. These
substances despite being toxic to the cultured animals per se
increase their susceptibility to diseases, particularly shrimp,
which are bottom dwelling organisms. Hence, it is extremely
important to mitigate these organic pollutants generated during
aquaculture to achieve optimal aquaculture productivity.
The microbes involved in ammonia and sulfur oxidation,
majority being autotrophic in nature, are extremely slow growing.
The proposed study will first of all help in understanding the
cultivable and uncultivable microbial flora involved in two
important biogeochemical cycles, viz., nitrogen and sulfur, and
PI : S. V. AlavandiCo PIs : T. C. Santiago, N. Kalaimani, K. K. VijayanCentral Institute of Brackishwater Aquaculture, Chennai
specifically, those involved in the oxidation of ammonia and
hydrogen sulfide. The approach to harness naturally occurring
AOB and SOB recovered from brackishwater aquaculture ponds
for developing immobilized microbial mats and their application
in bioreactors / biofilters has not been explored so far in India. The
proposed study provides scope for exploration of mass
production of these extremely slow growing bacteria, which is a
challenging task. Depending on the success in mass production
protocols, formulation protocols would be taken up for in situ
bioremediation.
Objectives
· To develop bioremediation tool for ammonia and nitrite
mitigation in shrimp hatchery.
· To develop bioremediation tool for ammonia, nitrite and
sulfide mitigation in shrimp grow-out ponds.
Significant Achievements
· Nitrifying-denitrifying biofilters were designed, assembled
and found to efficiently remove ammonia and nitrite
completely in lab scale aquaria.
· Occurrence of Anammox bacteria in traditional and
intensive shrimp culture ponds (with high DOC) was
confirmed using PCR-DGGE analysis.
· Eight denitrifying isolates were confirmed to carry out
denitrification under aerobic conditions using RT-PCR of
nosZ gene.
· Two Chemolithotrophic sulfur oxidizing bacteria have been
Nitrification-denitrification biofilter for ammonia and nitrite mitigation in aquarium (left) and nitrifying bacteria colonised filter cartridge (right)
Sulfide oxidizing activity of heterotrophic sulfur oxidizing bacteria
79
AMAAS - Annual Report 2010-11
identified based on 16S rRNA gene sequence analysis.
· 16S rRNA gene sequences of 14 denitrifying bacteria
submitted to NCBI, Genbank
· A total 4 isolates of Beggiatoa sp. have been isolated and
identified from brackishwater ecosystem of Tamilnadu.
· Fourteen heterotrophic sulfur oxidizing bacteria (HSOB)
were confirmed for their activity in vitro.
Conclusion
Bacteria involved in nitrogen and sulfur cycles viz.,
chemolithotrophic nitrifiers, aerobic denitrifiers, heterotrophic
nitrifiers, chemolithotrophic and heterotrophic sulfur oxidizers
have been isolated and characterized for their efficiency to oxidize
ammonia, nitrite and sulfide. The activities of these isolates have
been tested in vitro. Efficient isolates have been used to construct
nitrifying-denitrifying biofilters that are capable of simultaneous
nitrification and denitrification for complete removal of
ammonia, nitrite and nitrate. Such biofilter systems could be
exploited for better management of water quality in shrimp
hatcheries and for bioremediation of aquaculture discharge.
Occurrence of Anammox bacteria in traditional shrimp culture
ponds of Kerala and intensive shrimp culture ponds of Andhra
Pradesh suggest that they play a key role in maintenance of
ammonia and nitrite in such perennially water covered
ecosystems.
Papers published from AMAAS work
· Alavandi S. V. 2010. Mitigating nitrogenous wastes in
aquaculture ENVIS Newsletter, Microorganisms and
Environment Management, 8(3 & 4): 5-9.
Assessment of nisin production in selected strains of LAB and market acceptability
Rationale
The application of various chemical preservatives has been a
common feature in processed fruits and vegetables, dairy
products, bakery and confectionery products for extending the
shelf-life. Although, these chemicals beyond the maximum
permissible limit cause serious health hazards to the consumers.
Therefore, consumers are demanding natural and fresh foods
with no chemical additives. The increasing demand of the
convenience type of foods has stimulated interest in finding
natural and safe preservative. The use of bio preservatives is
gaining popularity nowadays to reduce the health hazards
associated with chemical additives. The use of bio preservatives
seems to be more effective in controlling the large group of food
spoilage microorganisms. Nisin, an effective GRAS bio
preservative is produced by certain strains of Lactococcus lactis.
The strains Lactococcus lactis is sub-divided into L. lactis sub sp.
lactis, L. lactis sub sp. cremoris and L. lactis sub sp. biovar.
diacetylactis. L. lactis sub sp. cremoris and L. lactis sub sp. lactis are
used for lactic acid production in cheese manufacture. L. lactis sub
sp. lactis biovar. diacetylactis is used to provide flavor in cottage
cheese, cultured sour cream and cultured butter milk. Therefore,
the aim of the present study is to isolate more strains of L. lactis
from dairy and non-dairy sources in order to isolate the strains of
Lactococcus lactis and to assess the potential of nisin production
and evaluate the efficacy of these cultures in extending the shelf
life of processed vegetables.
Objectives
· Isolation, characterization and purification of nisin
producing cultures.
· Testing the utility of nisin producing culture in vegetables.
Significant Achievements
· A total 27 isolates (19 isolates from 56 LAB of dairy and 08
isolates from 44 LAB of non-dairy samples) were identified
as Lactococcus lactis sub sp. lactis on the basis of phenotypic
characterization. PCR amplification of gad B gene (600 bp
PCR product) and similar protein profiling with reference
PI : Sudhir SinghCo PI : Major SinghIndian Institute of Vegetable Research, Varanasi
strain Lactococcus lactis sub sp. lactis NCDC 094.
· The confirmation of nisin gene in the identified isolates and
reference strain L. lactis sub sp. lactis NCDC 094 was carried
out by PCR based amplification of genomic DNA using a pair
of designed primer from the published sequences for
structural gene of nisin A (nis A) yielded the amplification of
174 bp PCR products. A total of 17 Nis+ isolates (65.15 % from
dairy and 62.50 % from non-dairy samples) of Lactococcus
lactis sub sp.lactis has been observed. The bacteriocin activiry +in Nis isolates and reference strain Lactococcus lactis sub sp.
lactis NCDC 094 was ranged between 800-6400 AU/ml.
· The direct detection of purified bacteriocin of isolates and
reference strain for molecular weight determination in SDS-
PAGE resulted in an apparent molecular weight of about 5.0
kDa.
· The 100% activity of extracted bacteriocin of isolates and
reference strain was obtained over a wide range of pH 2-8
thereby decreased activity occurred in basic pH 9-12.
· The effect of various enzymes on complete inactivation or
significant reduction in the inhibitory activity of extracted
bacteriocin by exposure of extracted bacteriocin with
proteinase-K, pronase-E, lysozyme, trypsin, α-
chymotrypsin, pepsin and α-amylase resulted in the
complete inactivation of bacteriocin in the presence of
proteinase-K, pronase-E and α-chymotrypsin while no
inactivation was obtained with trypsin, pepsin, lysozyme
and α-amylase.
· A broad spectrum of antibacterial activity was exhibited by
the extracted bacteriocin against different gram positive and
related lactic acid bacterial strains. However, no inhibitory +activity was observed against Nis reference strain
Lactococcus lactis sub sp. lactis NCDC 094 and some gram
negative bacteria.
· Addition of extracted bacteriocin to early logarithmic phase
cells of L. acidophilus NCDC 015 (2 h old, 3.7×106 CFU/ml)
resulted in decreased (2.33%) cell growth after 2 h of
AMAAS - Annual Report 2010-11
80
incubation of bacteriocin addition and reduction in growth
was increased to 16.79% after 14 h incubation than the
growth pattern of L. acidophilus NCDC 015 without
bacteriocin addition.
· Various responses such as extent of browning, ascorbic acid,
moisture content, texture profile analysis, color
measurement, sensory quality for flavor, body and texture,
color and appearance, overall acceptability and microbial
plate count were evaluated up to 180 days of storage (24-o32 C) for all combination of variables. Among different
combinations of nisin (400-6400 AU/ml) and KMS (1000-
3000 ppm) on blanched cauliflower, the formulation
consisting of nisin (3200 AU/ml) and KMS (1000 ppm) was
most acceptable. In the optimum combination of nisin and
KMS treated dried cauliflower, ascorbic acid was decreased
from 6.10 to 4.16 mg/100g. The moisture content and extent
of browning was increased from 2.17 to 3.79% and 0.039 to
0.149 OD at 440 nm respectively. Rehydration ratio was
decreased from 5.92 to 3.13. The total bacterial count was
increased from 3.59 to 7.30 logCFU/ml/g without yeast and
mold count during the storage at room temperature.
· An experimental model was designed by response surface
methodology to study the response pattern and to determine
the optimum combination of sugar (20% w/v) diffusion time
(70.29-360 min) and nisin concentration (0-6400AU/ml) in
osmo-air dried carrot slices for extending the shelf life.
Various responses such as β-carotene, % moisture, texture
profile analysis, sensory score for color and appearance,
flavor, body and texture, overall acceptability and microbial
plate count were evaluated up to 180 days of ambient storage otemperature of 24-32 C for the possible combination of
variables. In the optimum combination of variables (sugar
diffusion time 240 min and nisin 6400AU/ml), beta-carotene
decreased from 5.77 to 5.47 mg/100g, total sugar from 3.42 to
3.13 g/100g, pH value from 6.63 to 5.54, texture (area) from
3010.83 to 2843.41g.s, texture (force) from 1222.11 to 815.63 g
and color ('a' value) from 65.28 to 64.38. However, the %
moisture and rehydration ratio increased from 5.28 to 5.91
and 2.23 to 2.73, respectively. The total bacterial plate count
increased up to 4.95log CFU/g.
Conclusion
The isolates of Lactococcus lactis sub sp. lactis have been
identified and screened as nisin producer. Extraction of
bacteriocin and its detection, characterization and antimicrobial
activity spectrum confirmed that the extracted bacteriocin is nisin
like bacteriocin and can be used in food items. It may be an
effective alternative in controlling natural fermentation in foods. +Thus, isolation, identification and characterization of Bac L. lactis
from dairy and non-dairy sources provide potential nisin like
bacteriocin producers for enhancing the strength of industrial
important strains for the application as starter cultures. Dried
cauliflower upon rehydration exhibited maximum (6.5) overall
acceptability score on 9- point Hedonic scale with the formulation
of nisin concentration (3200 AU/ml) and KMS (1000 ppm) after 6
months of storage at ambient temperature. The shelf-life of osmo-
air dried carrot slices was extended to 6 months at ambient storage
temperature with the formulation of sugar diffusion time of 240
min and nisin concentration of 6400 AU/ml.
Seminar, Symposia and Conferences attended
· Mishra Solan, Singh Sudhir and Khemariya Priti. Influence of
nisin and potassium metabisulfite on quality of dehydrated
cauliflower, Paper presented ICON11 BHU. 21-23 January
2011.
· Mehrotra Puja, Singh Sudhir and Khemariya Priti. Influence
of nisin and potassium metabisulfite on quality of
dehydrated carrot slices. Paper presented ICON11 BHU, 21-
23 January 2011.
Molecular weight determination of purified bacteriocin in Glycine –SDS PAGE produced by Lactococcus lactis ssp. lactis
Effect of heat treatment on bacteriocin activity (AU/ml) of extracted bacteriocin of Lactococcus lactis ssp. lactis
81
AMAAS - Annual Report 2010-11
Fermented products from fruits, vegetables and Cereals
Rationale
Demand for natural instead of synthetic pigments for
colouring fabrics, foods and cosmetics is increasing. Unlike
pigments that are synthetic, natural sources allow subtle
differences in tone because such pigments generally comprise
various colour components. Natural dyes and pigments were
emerged as an important alternative to potentially harmful
synthetic dyes. These natural dyes and pigments were applied in
dyeing of cotton, silk and wool samples. However, the main
disadvantage of these natural dyes or pigments lies in the order of
magnitude of their extraction yield factors (a few grams of
pigment per kg of dried raw material). This makes their current
market price about USD 1/g, thus limiting their application to
high-value-added natural-coloured garments only. To defeat this
constraint, it is suggested to exploit the potentiality of other
biological sources such as fungi, bacteria and cell cultures, since
appropriate selection, mutation or genetic engineering techniques
are likely to improve significantly the pigment production yields
with respect to wild organisms. Glycanoligosaccharides have
received particular attention recently because of their excellent
biological and functional properties, namely as a prebiotic
compound it encourages the growth of beneficial bacteria in the -1colon and as low calorie (2 KCal.g ), non-carcinogenic sweetener
suggested health benefits which include immune system
activation, resistance to infections, synthesis of B-complex
vitamins and calcium absorption and it is recommended for
diabetic patients. Microbial production of fructooligosaccharides
by the action of microbial fructosyltransferase (FTase) on sucrose
is more feasible at industrial level and it provides a cost effective
and convenient alternative to chemical synthesis. In view of the
great demand of glycanoligosaccharides as food ingredients,
scope exists for screening and identification of newer strains
capable of producing glycansucrases.
Objectives
· Selection of microbial cultures with high potential for bio
colorants and nutraceuticals from fruits, vegetables and
cereals.
· Exploitation of microorganisms for food preservation and
nutrient fortification.
· Selection of microbial cultures for wine production from
cereals and fruits and studying their antioxidant properties.
Significant Achievements
· Concentrated yellow pigment extracted from Thermomyces
sp. was utilized as colour additive for the development of
food products. To enhance the appearance and acceptability
of foodstuff yellow pigment was added. The products
namely cookies, rice wine, jelly and orange squash were
developed by adding the pigment. The colour value of food
products was analyzed. The stability of the colorants were
also studied.
· Yellow colour bands identified by TLC were further purified
by using HPLC. From the TLC separated yellow pigment, a
total of 6 peaks excluding solvent peak was obtained.
Occurrence of more than one peak indicated the presence of
PI : S. GunasekaranCo PIs : R. Murugesan, K. Vijila, S. KarthikeyanTamil Nadu Agricultural University, Coimbatore
more than one molecule in the extract. The HPLC fraction 3
and 4 were collected for further analysis by GC-MS.
· The GC-MS analysis resulted in single peak for both fractions
of band 3 and 4 . The library match of GC –MS showed that it
could be 2, 4 – bis (1, 1 dimethylethyl) - phenol and pentanoic
acid 5 hydroxyl ester as per the NIST library.
· The infra red spectra showed the presence of hydrogen -1bonded-OH groups (3300 – 3400 cm ) and of the carbonyl
function. The carbonyl stretching vibration frequency of the -1pigments is in the region 1635 -1639 cm . The observed
stretching frequencies are, however close to phenol and
quinines.
· The extracted yellow fungal pigment was subjected to
dyeing in cotton, silk and wool using various chemical and
natural mordant. The cotton and wool have poor affinity for
fungal pigment but the silk have high affinity to yellow
pigment.
· The rubbing and washing fastness results showed that the
fastness to wet and dry rubbing of the pigment dyed fabric
rated between 3-4. The rating for wash fastness was
determined with respect to staining on cotton, wool, acrylic,
polyester, nylon and acetate had recorded 4-5 ratings.
· The anti-bacterial activity of fabric dyed with yellow
pigment of Thermomyces sp. showed a maximum bacteria
reduction in optimized fabric against Salmonella typhi (51.05
%), Staphylocococus aureus (45.52 %), E. coli (48.32 %), B. cereus
(52.2 %) and Vibrio cholerae (23.73 %).
· Selection of acceptor molecule for the glycansucrase
produced by the selected LAB isolates (LAB 11) indicated its
specificity to the sucrose molecules.
· Optimization of concentration of sucrose and the physical
parameters such as pH and temperature by composite design
was carried out.
· Intrinsic antioxidant potential of fruit wines and cereal wine
was measured by FRAP assay. Antioxidant potential has
increased gradually during ageing of wines. Among nine
wines, grape wine showed more ferric reducing antioxidant -1power (18.45±0.10 mML ascorbic acid) followed by
pomegranate wine and mango wine.
· Free radicals such as super oxide radical, hydroxyl radical,
nitric oxide and ABTS radical scavenging activities were
analyzed for nine wines. Grape wine and rice wine showed
more scavenging activity of super oxide radicals. In hydroxyl
radical scavenging assay, grape wine had exhibited highest
scavenging activity followed by musambi wine and mango
wine. Grape wine recorded more ability to scavenge nitric
oxide and ABTS radicals.
· Physico – chemical properties of fruit wines and cereal wine
were determined at various intervals i.e. initial (fruit juice),
12 months and 18 months of ageing. The alcohol content, pH,
reducing sugars at different storage levels were studied.
· HPLC analysis was performed to quantify the trans –
resveratrol compound in the fruit wines. Among the fruit
wines, grape wine and muskmelon wine had shown with
AMAAS - Annual Report 2010-11
82
similar retention time as that of standard trans – resveratrol. -1The trans- resveratrol content in grape wine was 0.92 mgL
-1and in muskmelon wine, was 0.42mgL .
Conclusion
Thermomyces sp. yellow color pigments application in food
products (cookies, rice wine, jelly and orange squash) were
studied. The cotton and wool have poor affinity for fungal
pigment but the silk have high affinity to yellow pigment. The
anti-bacterial activity of fabric dyed with yellow pigment of
Thermomyces sp. showed a maximum bacteria reduction. The
library match of GC –MS showed that it could be 2, 4 – bis (1, 1
dimethylethyl) - phenol and pentanoic acid 5 hydroxyl ester as per
the NIST library. Improvement in biomass production with
sucrose as a growth limiting nutrient was found while culturing
the isolate in fed -batch system. The correlation between growth,
lactic acid production and oligosaccharides production were
studied. Free radicals such as super oxide radical, hydroxyl
radical, nitric oxide and ABTS radical scavenging activities were
analyzed for nine wines. During fermentation of fruit juice, total
soluble solids, reducing sugars, tannin content and pH decreased
and acidity of wines increased. HPLC analysis was performed to
quantify the trans – resveratrol compound in the fruit wines.
Seminar, Symposia and Conferences attended
· Parthiban. M., G. Thilagavathi, R. Poornimmal and S.
Gunasekaran (2010). Optimization of Process Parameters for
Coloration & Antimicrobial Finishing of Protein Fabrics
Using Natural Fungal Extracts. Paper presented at the
International Conference on “Health care and hygiene care
& textiles (HEAT 2010)” held at PSG College of Technology,
Coimbatore, India on 30- 31July 2010.
· Gnanasambandam A.V., M. Karthikadevi and S.
Gunasekaran. Grape wine – a health drink. Paper presented
at the International Conference on bio resource Technology-
its applications and achievements, held at Nirmala College
for Women, Coimbatore, 7-8 October2010. p. 83.
· Karthikadevi M., A.V. Gnanasambandam and S.
Gunasekaran. Antibacterial Properties of red wine. Paper
presented at the International Conference on bioresource
Technology- its applications and achievements, held at
Nirmala College for Women, Coimbatore, 7- 8 October 2010.
P 168.
· Poorniammal R. and S. Gunasekaran 2010. Production and
food application of the yellow pigment of Thermomyces sp.
Paper presented at the International Conference on
bioresource Technology- its applications and achievements,
, held at Nirmala College for Women, Coimbatore, October 7-
8, 2010. p 168.
· Gnanasambandam A.V., M. Karthikadevi and S.
Gunasekaran 2010. Basil Wine – A Medicinal drink. Paper
presented at the National Symposium on “Unbound
Opportunities in Food Processing “held at Tamil Nadu
Agricultural University, Coimbatore, 13 October 2010.
· Gnanasambandam A.V., M. Karthikadevi and S.
Gunasekaran 2011. Nutrition In Wine. International
Conference on Food and Nutraceuticals for Nutrition and
Health: Technology and Delivery, Periyar University, Salem-
NC-P-100. 20–22 January 2011. p 62.
Utilization of fruit processing waste for obtaining value added products through fermentation
Rationale
Substantial amount of solid waste is generated during
processing of fruits. For example, mango generates 30-50%,
banana 20%, pineapple 40-50% and orange 30-50% solid waste.
These wastes are rich in organic constituents like, cellulose, starch
pectin vitamins, minerals etc and posed serious environmental
pollution.
The utilization of waste through fermentation will not only
economize the cost of finished products but also reduce the
pollution level. The waste could be used for the production of
value added products such as enzymes, protein enriched feed,
bio fuel, fibre and other biomolecules.
Objectives
1. Standardization of protocols for enzyme (amylase and cellulase) immobilization for enhanced enzyme stability and storability.
2. Testing of enzyme produced for juice clarification.
3. Strain improvement for hyper production of enzymes
4. Mushroom production using fruit waste compost
Significant Achievements
· Extracellular amylase mass produced by Fusarium solani using mango kernel as substrate was immobilized in calcium alginate beads through entrapment technique.
PI : Neelima GargCo PI : M. Muthukumar Central Institute for Subtropical Horticulture, Lucknow
· Maximum enzyme immobilization efficiency was achieved in 2mm size beads formed by 6.5 % (w/v) of sodium alginate in 2% (w/v) calcium chloride.
· The catalytic properties of the immobilized amylase were assessed in comparison with the free enzyme (soluble). The activity yield of the immobilized enzyme was 81% of the free enzyme.
· The immobilized enzyme showed optimum activity at pH and temperature of 4.5-6.0 (range) and 40ºC, respectively, in contrast to the free enzyme at 5.5 and 30ºC, respectively.
· Thermal stability of the immobilized enzyme after heat inactivation at 60ºC was found to be more than the free enzyme over a long time interval. The immobilized enzyme retained activity upto 20% of optimum even after 180 min. but the activity of the free enzyme was less than 20% after 60 min which reached zero by 120 min.
· The kinetic constants, viz., K (Michaelis constant), V and M max
activation energy of the immobilized enzyme were affected by immobilization which influenced the substrate utilization negatively.
· The immobilized enzyme showed higher stability over a wider pH and temperature ranges. The immobilized amylase in calcium alginate beads supports its long term storage which has immense industrial applications
· Cellulase was mass produced by Aspergillus niger using mango
83
AMAAS - Annual Report 2010-11
peel as substrate and immobilized in calcium alginate beads through entrapment technique.
· The catalytic properties of the immobilized CMCase were compared to free enzyme.
· The activity yield of the immobilized CMCase was 89.87% over free enzyme, while for β-glucosidase, it was 96.45% of the free enzyme.
· Maximum CMCase and β-glucosidase immobilization efficiency was achieved in 2mm & 1mm bead size respectively.
· Beads formed by 5 % (w/v) of sodium alginate in 2% (w/v) calcium chloride resulted in max. immobilization efficiency
· The immobilized CMCase showed optimum activity at 4.5 pH and 50ºC, in contrast to the free enzyme at 4.5 and 40ºC, respectively.
· β-glucosidase showed optimum activity at pH 5.0 and 40ºC over free enzyme at pH 5.0 and 40ºC
2+· Mg showed positive effect in immobilized CMCase activity but 2+, 2+, 2+ 2+ 3+ 2+ 2+ Cu Mo Mn , Ca , B , Zn and Fe showed negative whereas in
2+ 2+ 2+ 2+ 3+, 2+ 2+ 2+β-glucosidase Cu , Mo , Mn , Ca , B Zn , Mg and Fe , showed positive effect.
· Immobilized CMCase and β-glucosidase expressed 20-25 % relative activity after 4th time repeated use.
· Thermal stability of the immobilized CMCase after heat treatment at 70ºC was better over the free enzyme.
· CMCase & β-glucosidase produced by A. niger and purified 12.26 and 13.06 fold was used to clarify mango juice using response surface methodology by (Brookfield DV-II) rotating cylindrical viscosity meter.
· The optimum yield (97%) of juice was obtained at 1% cellulase enzyme concentration.
· Suitability of Mango peel and mulberry pomace composts for growing Oyster mushroom, Pleurotus florida (Mont.) Singer was investigated. Preliminary studies indicated that the mango and mulberry waste composts could very well support the spawn run and fruiting of P. florida and may be utilized as substrates for oyster mushroom cultivation.
· Highest production (609g) of fruiting bodies was recorded from mango compost, followed by wheat straw (507g) and mulberry compost (477g), respectively.
· Biological efficiency was recorded highest (50.7%) in wheat straw followed by mango compost (30.5%) and mulberry compost (23.9%), respectively.
· Protein content of fully mature fruiting bodies was highest (30.6%) in mulberry compost, followed by mango compost (28.0%) and wheat straw (24.3%) respectively.
Conclusion
Extracellular amylase mass produced by Fusarium solani using mango kernel as substrate was immobilized in calcium alginate beads
pH optima for immobilized vs. Free cellulaseGL IM- Immobilized β glucosidase; GL FE-Free β glucosidase; CMC IM-Immobilized CMCase; CMC FE- Free CMCase
Temperature optima for immobilized vs. Free cellulaseGL IM- Immobilized β glucosidase; GL FE-Free β glucosidase; CMC IM-Immobilized CMCase; CMC FE- Free CMCase
Mushroom fruiting on mango peel compost
AMAAS - Annual Report 2010-11
84
through entrapment technique. Maximum enzyme immobilization efficiency was achieved in 2mm size beads formed by 6.5 % (w/v) of sodium alginate in 2% (w/v) calcium chloride. Cellulase was mass produced by Aspergillus niger using mango peel as substrate and immobilized in calcium alginate beads through entrapment technique. Suitability of Mango peel and mulberry pomace composts for growing Oyster mushroom, Pleurotus florida (Mont.) Singer was investigated. Preliminary studies indicated that the mango and mulberry waste composts could very well support the spawn run and fruiting of P. florida and may be utilized as substrates for oyster mushroom cultivation.
Papers published from AMAAS work
· Devendra Kumar, Mohd. Ashfaque, Muthukumar. M, Munna Singh and Neelima Garg. Production and characterization of carboxymethyl cellulase from Paenibacillus polymyxa using
mango peel as substrate. Journal Environmental biology (Accepted)
Seminar, Symposia and Conferences attended
· Immobilization of extracellular amylase from Fusarium solani as calcium alginate beads in 51 Annual conference association of microbiologist of India as “International symposium on resent advances in cross-disciplinary microbiology: Avenues & challenges” & International workshop on rRNA sequencing, phylogeny & next generation genome sequencing held at Birala institute of technology, Mesra, Ranchi, India, from 14-17 December, 2010, pp.191-192.
· Prelimiliry studies on Utilization of fruit Waste compost for production of Pleurotus florida in 10th x Agriculture Science Congress held at National Bureau of Fish Genetic Resources, Lucknow from 10-12 February, 2011, pp. 436.
85
AMAAS - Annual Report 2010-11
Development of microbial consortium for alleviation of salt and drought stress for growth and yield of wheat
Rationale
Environmental stresses represent the most limiting factors
for agricultural productivity. Apart from biotic stress caused by
plant pathogens, a number of abiotic stresses such as extremes
temperature, drought, salinity, heavy metals and radiation have
detrimental effects on plant growth and yield. Drought is very
detrimental to all types of plant growth. When there is no water in
the soil, there are deficiency of many nutrients to support plant
growth. Salinity affects plant growth and development adversely
and exerts negative impact on critical ecological balance in the
agro ecosystem to disturb biological stability. Metabolic
imbalances caused by ion toxicity, osmotic stress and nutritional
deficiency under saline conditions may lead to oxidative stress. It
has been claimed by one study that abiotic stress causes the most
crop loss of any other factor and that most major crops are reduced
in their yield by more than 50% from their potential yield. The
project, therefore, addresses the application of microbial
consortium for the alleviation of salt and drought stress in wheat
crop. Microorganisms have been implicated in alleviating the
effects of abiotic stress by different mechanisms. They can
alleviate salt and drought stress by production of growth
promoting substances and also involved in production of
antioxidants to prevent injury to the plant due to stress. Bacterial
exo-polysaccharides have been implicated in providing
protection from environmental stresses and host defenses.
Objectives
· Survey of salt and drought affected area of India.
· Isolation of microorganisms from rhizotic zones of cereal
crop grown under salt stress and drought stress.
· Screening of salt & drought tolerant bacteria at different
NaCl and PEG concentration.
· Evaluation of selected micro-organisms in the rhizosphere of
cereal crop on the basis of phytotron studies.
· Biochemical & molecular characterization of selected
microorganisms.
· Development of consortium of microorganisms that can
alleviate the effect of salinity and drought to improve the
growth and yield of cereal crop (wheat).
· Field evaluation of consortium of microorganisms for
improvement of wheat growth and yield.
· Osmoprotectant studies (proline, glycine betaine) on salt
tolerant and drought tolerant bacteria.
PI : Dilip K. AroraCo- PI : Kamlesh Kumar MeenaNational Bureau of Agriculturally Important Microorganisms, Mau
Significant Achievements
· The isolates obtained from salt and drought affected regions
have been identified using molecular techniques like
16SrRNA gene sequencing.
· On the basis of biochemical screening, the potent isolates
were subjected to develop the HPLC profiling to identify the
osmoprotectent produced in response of the stresses. Potent
isolates on the basis of HPLC profiling were selected to
further characterization for their PGP traits.
· The potent osmoprotectent producing bacterial isolates i.e.
Bacillus pumilus (EU 927414), Pseudomonas mendocina (EU
927412), Arthrobacter sp. (EU 927410), Halomonas sp.
(FJ984532), and Nitrinicola lacisaponensis (FJ973520) were
selected for further characterized for PGP traits. The results
showed that all isolates were found to be IAA-producers and
possess different PGP-traits like P-solubilization,
siderophore and ammonia production and salt-tolerance
capabilities varied from 0-22% NaCl concentration.
· Bacterial strains (AS 121, AS 40 and AS 18) were isolated from
the rhizospheric soils collected from Mau, Ghazipur and
Ballia districts of Uttar Pradesh (India) and other two isolates
SL-9 and SL-11 isolated from sambhar salt lake were used for
pot experiment.
· The effect of individual treatment was studied in the form of
chlorophyll, carotenoid and protein content of the wheat
leaves at different stages. Apart from this, other parameter
like root, shoot length, fresh weight and dry weight were also
considered.
· Treatments with bacterial inoculants supported plant
growth as assessed 15 and 30 days after inoculation (DAI) as
compared to non-inoculated control showed significant
enhancement shoot and root length after inoculation of B. pumilus.
· Total chlorophyll and protein content was maximum in B. -1pumilus inoculated plant leaves (17.47 and 19.21 mg fresh
wt. after 15 and 30 DAI) as compared to control (11.36 and -114.94 mg fresh wt.).
· Carotenoid content was maximum in plants inoculated with -1 Halomonas sp. (806.8 and 912.9 mg fresh wt.) as compared to
-1 control (682.7 and 726.4 mg fresh wt.) after 15 and 30 DAI.
Arthrobacter sp. caused maximum accumulation of total -1 protein (2.45 and 2.62 mg fresh wt.) in comparison to control
-1 (1.33 and 1.72 mg fresh wt) at 15 and 30 DAI.
AMAAS - Annual Report 2010-11
86
Theme: Microbial Management of Abiotic StressTheme: Microbial Management of Abiotic Stress
· Inoculation with bacterial isolates increased the levels of total
flavonoids and total phenol content in wheat leaves. In
comparison to control, proline and reducing sugar
accumulation was maximum in N. lacisaponensis (1.74 -1µmole/g and 268.6 µg fresh wt. respectively) after 15 DAI
-1 -1and (2.28 µmole and 419.9 µg fresh wt respectively) in B.
pumilus after 30 DAI. Halomonas sp., favoured maximum -1accumulation of total soluble sugar (283.8 and 375.5 µg fresh
-1wt.) as compared to uninoculated control (1.12 and 1.54 µg
fresh wt.) after 15 and 30 DAI.
· Inoculation with B. pumilus resulted in maximum
accumulation of individual phenolics (gallic, caffeic,
syringic, vanillic, ferulic and cinnamic) after 15 DAI. When
root exudates from the inoculated plants and control were
assessed, higher level of phenolics was again recorded and
interestingly, in the root exudates, we were able to analyse
the presence of a flavonoid, quercetin.
Conclusion
The results showed that the microbes which can tolerate up
to 15 -20% NaCl, 25% PEG concentration could be utilized to
alleviate salt and drought stress for growth and yield of wheat
crop. Particularly isolate Bacillus pumilus AS-121 and
Nitrinicolalacis aponensis SL 11 has a great potential as it has all the
attributes of physical, biochemical and PGP traits. It is evident
from the growth kinetics and HPLC studies that bacteria-
mediated presence of phenolics and quercetin in the root exudates
and rhizosphere played an essential role in the enhanced
interaction of bacterial inoculants on the plant roots which finally
played a cumulative synergistic role in systemic accumulation of
stress-tolerance biochemical in leaves and enhanced plant growth
promotion. Cultivable isolates of salt and drought tolerant
isolates further explored for consortia developmental studies as a
bioinoculant under alleviated abiotic stress for growth and yield
of wheat crop.
Papers published from AMAAS work
· Shweta Tiwari, K.K. Meena, D.P.Singh and D.K.Arora. Salt-
tolerant rhizobacteria-mediated induced systemic tolerance
in wheat (Triticum aestivum) and chemical diversity in
rhizosphere enhance plant growth. Under review Biology
and Fertility of Soil.
Seminar, Symposia and Conferences attended
· Field evaluation of Bacterial consortia to alleviate salt stress
for growth and yield of wheat. First Asian PGPR Congress
2009, Hyderabad
· Molecular Diversity of Halotolerant bacteria from Chilka stLake, India. (51 AMI Conference 2010, Ranchi)
Utilization of actinomycetes to alleviate salt and drought stress in cereal crops
Rationale
Agricultural productivity is severely affected by soil salinity
because salt levels that are harmful to plant growth affect large
terrestrial areas of the world. The damaging effects of salt
accumulation in agricultural soils have influenced ancient and
modern civilizations. It is estimated that 20% of the irrigated land
in the world is presently affected by salinity. In India about 10
million ha of arable land is salt affected and approximately 68% is
affected with drought. Increased salinity and drought in soil is
harmful to both microbes and crops. Microbes have been
implicated in alleviation of effects of abiotic stresses by various
mechanisms like production of osmolytes, sugars, sugar alcohols,
exopolysaccharides etc. Such microorganisms not only alter the
environment around the rhizosphere of crops but also maintain
the ratio of various nutrients. Actinomycetes are found in neutral
to saline soils. Most of actinomycetes are tolerant to alkaline
conditions and in alkaline soils, 95% population may be
actinomycetes. Most of the actinomycetes possess inherent
capacity to tolerate salt stress (especially Streptomycetes genera,
Nocardiopsis sp., Saccharomonospora sp.) by synthesis of the
compatible solutes like alanine, proline, glycine betaine and -
glutamine in response to stresses. It is also known that
actinomycetes produce important antibiotics and secondary
metabolites. They are known to inhibit many plant pathogens and
some are known to produce plant growth promoting substances.
Thus, keeping these points in consideration, an attempt was made
to utilize actinomycetes to alleviate the salt and drought stresses
and increase the crop yields under salt and drought affected soils.
PI : Mahesh YandigeriCo- PI : Kamlesh Kumar MeenaNational Bureau of Agriculturally Important Microorganisms, Mau
Objectives
· Isolation and screening of actinomycetes from different salt
affected regions of India.
· Diversity analysis studies from salt stressed regions.
· Characterization of the isolates for the accumulation of
sugars, sugar alcohols, amino acids, osmolytes and
secondary metabolites.
· Evaluation of the promising actinomycetes under pot/ field
experiments and study of plant microbial interactions during
salt stress.
· Development of consortia of actinomycetes to alleviate the
effect of salinity in crop plants.
Significant Achievements
· Soil sampling survey was carried out for the salt affected
regions of Kanpur, Fatehpur, Auraiya, Etawah, Mainpuri
and Mau Districts of Uttar Pradesh for the isolation of salt
tolerant actinomycetes. A total of 23 soil samples were
collected from Kanpur, Etawah, Auraiya, Mainpuri and 10
soil samples were collected from Mau district.
· The pH of soil samples ranged from 7.5 to 11.0 and electrical
conductivity (EC) from 0.30 to 13.33 dS/m. A total of 112
morphotypes were obtained from saline soils of Kanpur and
Mau Districts of Uttar Pradesh using different media and
enrichment methods.
· Actinomycetes isolated from the Uttar Pradesh saline soils
region were evaluated on different salts (NaCl, KCl and
87
AMAAS - Annual Report 2010-11
Map depicting the sampling sites of salt affected regions of Kanpur District and drought affected regions of Rajasthan
Pie diagram representing salt tolerance capacity of Kanpur and Mau isolates against different NaCl concentrations
MgSO ). The Actinomycetes isolated from Kanpur regions 4
had shown significant results on NaCl. A total of 5 isolates
shown growth on 4% NaCl concentration, 20 isolates were
shown growth at 10% KCl and 30 isolates were shown
growth at 10% MgSO4 while the isolates from Mau region
showed tolerance up to only 10% NaCl concentration.
· Salt tolerant actinomycetes from Uttar Pradesh showed
significant PGP traits viz., IAA production, ammonia
production, siderophore production, HCN production, H S 2
production and P-solubilization and extracellular enzyme
activity.
· Salt tolerant actinomycetes have been subjected for osmolyte
production (proline) and estimation of osmolytes.
· The actinomycetes have been subjected to molecular
identification using universal 16S rDNA primers and
restriction fragment length polymorphism is under progress
for clustering and identification of representative isolates for
sequencing.
Conclusion
Among all the isolates obtained from the salt stressed regions
most of the isolates showed tolerance upto 6-8% of NaCl
concentration along with considerable extent of PGP attributes
and extracellular enzyme activity. These isolates can be taken
further to assess their potential for seed germination and
promotion of plant growth under stress conditions as well as
production of compatible solutes to cope up with stressed
environment. Promising isolates will be further taken for pot and
then field assay in saline soil for assessing their potential as stress
alleviators and in development of consortia along with other
microbes.
Seminar, Symposia and Conferences attended
· Nityanand M., Yadav A. K., Divya S., Shrivastava P.,
Yandigeri M.S. and Arora D.K (2010). Genotypic diversity of
actinomycetes from Indogangetic plain of India. In:
International Conference on Aquatic Microbiology (status,
challenges and opportunities) to be held at CAS in Marine
Biology, Faculty of Marine Sciences, Annamalai University,
Parangipettai, September 2 – 4, 2010, p. 117.
· Singh D., Shrivastava P., Malviya N., Yadav A.K., Mahesh
S.Y. and Arora D.K. (2010). Utilization of plant associated
actinomycetes to alleviate drought stress in cereal crops. In:
International Conference on Aquatic Microbiology (status,
challenges and opportunities) to be held at CAS in Marine
Biology, Faculty of Marine Sciences, Annamalai University,
Parangipettai, September 2 – 4, 2010, p. 32-33.
· Manish Roy, Divya Singh, Pooja Shrivastava, Mahesh S.
Yandigeri and Dilip K. Arora (2010) Isolation, identification
and characterization of halophilic actinomycetes from salt
affected regions of Eastern Uttar Pradesh. In: International
Conference on Aquatic Microbiology (status, challenges and
opportunities) to be held at CAS in Marine Biology, Faculty
of Marine Sciences, Annamalai University, Parangipettai,
September 2 – 4, 2010, p. 40.
Isolation, inventorization and field assessment of agriculturally important microorganisms in thestress ecosystems of Karnataka
Rationale
Increased incidences of abiotic and biotic stresses impacting
productivity in principal crops are being witnessed all over the
world. Extreme events like prolonged droughts, intense rains and
flooding, heat waves and frost damages are likely to further
increase in future due to climate change. A wide range of
adaptations and mitigation strategies are required to cope with
such impacts. Efficient resource management and crop/livestock
PI : A. R. AlagawadiCo PIs : P. U. Krishnaraj, K. S. Jagadeesh, S. G. PatilUniversity of Agricultural Sciences, Dharwad
improvement for evolving better breeds can help to overcome
abiotic stresses to some extent. However, such strategies being
long drawn and cost intensive, there is a need to develop simple
and low cost biological methods for the management of abiotic
stresses, which can be used on short term basis. Microorganisms
could play a significant role in this respect, if we can exploit their
unique properties of tolerance to extremities, their ubiquity,
genetic diversity, their interaction with crop plants and develop
AMAAS - Annual Report 2010-11
88
methods for their successful deployment in agricultural
production. Besides influencing the physico-chemical properties
of rhizospheric soil through production of exopolysaccharides
and formation of biofilm, microorganisms can also influence the
response of higher plants to abiotic stresses through different
mechanisms like induction of osmo-protectants and heat shock
proteins etc. in plant cells. Use of these microorganisms per se can
alleviate stresses in crop plants thus opening a new and emerging
application in agriculture. These microbes also provide excellent
models for understanding the stress tolerance, adaptation and
response mechanisms that can be subsequently engineered into
crop plants to cope with climate change induced stresses.
Objectives
· Isolation, enumeration, characterization and inventorization
of AIMs (N fixers, P-solubilizers, PGPRs, fluorescent 2
pseudomonads, cellulose and lignin degraders) from
saline/salt affected soils, water logged areas and dry tracts of
Karnataka,
· Assessing the functional potential of each group of
organisms for use in agriculture,
· Setting up the culture bank of the potential isolates under
each group and deposit them with the NBAIM,
· Field testing of potentially efficient isolates/consortia of
isolates (based on lab/ green house studies.
Significant Achievements
· ACC deaminase activity of 172 salt tolerant AIMs (18
Azospirillum, 14 Azotobacter, 60 P-solubilizers and 80
fluorescent pseudomonads) was determined in vitro and
found 132 of them (15 Azospirillum, 14 Azotobacter; 45 P-
solubilizers and 58 fluorescent pseudomonads) to be positive
for ACC deaminase activity. The enzyme activity of the
isolates ranged from 15.08 to 457.8 nmol keto-butyrate/g
biomass/h.
· The amount of glycine betaine accumulated by the salt
tolerant AIM's ranged from 0.3 to 1.42 moles, 0.33 to 1.9
moles, 0.68 to 1.79 moles, 0.34 to 1.49 moles, and 0.27 to 0.8
moles/mg of protein in the presence of 8, 10, 12.5, 15 and
17.5% respectively as compared to 0.03 to 0.25 moles/mg of
protein in the control medium (without any added salts).
· Out of 24 salt tolerant AIMs identified using 16S rDNA
sequencing technique, four isolates showed closest
affiliation to Pseudomonas putida; three each to Pseudomonas
chlororaphis sub. sp. aureofaciens, Pseudomonas aeruginosa,
Azotobacter vinelandii and Azospirillum irakense; two each to
Pseudomonas sp. and Azotobacter chrocooccum; one each to Azotobacter salinestris, Azospirillum halopreferans, Azospirillum
brasilense, and Azospirillum sp. All the 24 sequences were
deposited to NCBI using Sequin software and Accession
numbers issued for each sequences were from HQ18734 to
HQ18757. All these strains have been deposited with
NBAIM.
· Consortia comprising Azospirillum (ES-173), Azotobacter
(S63(1)R), PSB (S125R) and fluorescent pseudomonad
(S4(1)S) gave significant improvement in the plant growth
and yield of cotton (cv RAHS-14) at all the soil EC levels.
Consortia recorded 16.5 per cent increase in seed cotton yield
over UIC at soil EC 10 dS/m.
· Influence of 19 efficient salt tolerant AIMs on sorghum (CSH-
14) was assessed with two soil salinity levels (4.28 and 8.0
dS/m) under field conditions at ARS, Gangavati. Inoculation
of sorghum with Azotobacter S63(1)R, Azospirillum ES-145,
PSB S-125R, PSF WL-9S and FP S4(1)S gave 46 to 76 and 56 to
92 per cent increase in fodder yield over UIC at soil EC 4.28
and 8.0 dS/m respectively.
· Field efficacy studies of selected AIMs and their consortia in
sunflower (KBSH-1) at three salinity levels indicated
consortia to give significantly higher seed yield (14.5, 10.95
and 7.39 q/ha, respectively) over UIC (8.52, 6.50 and 3.75
q/ha, at soil EC of 4.5, 7.9 and 10.3 dS/m respectively).
· Seed inoculation of sunflower with selected salt tolerant
isolates and their consortia gave 10 to 14, 14 to 21 and 28 to 39
per cent increase in seed germination; 16 to 30, 21 to 41 and 22
to 60 per cent increase in biological yield; and 16 to 70, 18 to
68, 26 to 97 per cent increase in grain yield over UIC at soil EC
of 4.5, 7.9 and 10.3 dS/m respectively.
Conclusion
Most of the isolates tolerating varied concentration of NaCl
were found to have ACC deaminase activity indicating the
importance of this property to overcome the adverse effect of salt
stress. Inoculation effect was more at higher salinity, indicating
the importance of these isolates in improving growth and yield of
different crops grown under saline soils. It can be concluded that,
Papers published from AMAAS work:
· Alagawadi, A.R., Krishnaraj, P.U., Mudenoor, M.G., Chaitra,
D. and Ammanna, S., 2011, Studies on salt tolerant
fluorescent pseudomonads isolated from stress ecosystems
of Karnataka. National symposium on “Microbial Diversity
and its Applications in Agriculture, Industry and Health” held at
ICAR complex for Goa, March 4-5, 2011. p. 37.
screening of salt tolerant potentially efficient AIMs resulted in
finding useful strains for improving agricultural productivity and
eco-restoration of stressful surroundings.
Consortia at soil EC 10.3 dS/m UIC at soil EC 10.3 dS/m
Response of Sunflower KBSH-1 to inoculation of salt tolerant isolates and their consortia under different soil salinity at ARS, Gangavati
89
AMAAS - Annual Report 2010-11
Development of microorganism consortium to alleviate abiotic stresses like drought, hightemperature and salinity in millets
Rationale
Since biotic stresses like drought and salinity are limiting the
crop yields in rainfed agriculture, any attempt to manage these
stresses with low cost methods like use of AIMs will contribute to
sustainable production of rainfed crops and minimize the risk to
the farmers. Hence, this project is proposed to utilize the high
biodiversity of AIMs available in rainfed agro ecosystem for
management of biotic stresses in plants through a systematic
programme of screening, characterization, green house, field
evaluation and product development based single and
consortium of microorganisms.
Objectives
• To isolate microorganisms from rhizotic zones of millets
grown under stress conditions like drought and extreme
temperatures.
• Biochemical characterizations and testing of these organisms
for their response to drought and high temperature stresses
under in vitro conditions.
• Evaluation of promising strains on millet crops (pearl millet
and finger millet) in pot culture conditions.
• Development of consortium of microorganisms, application
methods and field evaluation for improvement of yield of
target crops.
Significant Achievements
· Based on previous years studies, abiotic stress tolerant
bacterial consortium was developed using Pseudomonas-P7,
Bacillus-B30 and Azospirillum- G12. The different ratios of
three bacterial strain were studied for their effect on sorghum
plants under drought as well as temperature stress. Study
revealed that bacterial consortium with equal cell population -9(10 ) of three strains (P7+B30+G12) showed significant
increase in shoot, root and dry biomass of sorghum seedlings
compared to mono, dual and mixture of three strains with
different cell population of each strain under non-stress
(NS),drought stress (DS) and temperature stress (TS).
· A similar trend was observed with plant biochemical
parameters inoculated with equal ratio (1:1:1) of cell -9population (10 ) of three strains (P7+B30+G12). A significant
increase in proline (34.6±0.4, DS; 32.5±0.4, TS; 13.9±0.04 non-
stress), total sugars (146.9±1.1,NS; 101.5±0.3,DS; 98.4±0.4);
and chlorophyll (17.4±0.08,NS; 14.9±0.05,DS;13.1±0.04,TS)
content was observed in sorghum seedlings compared to
other ratios. Inoculation with bacterial consortium (1:1:1)
also improved relative water content under drought stress
and decreased electrolyte leakage under temperature stress.
· Field studies were also conducted with two bacterial
consortia; P7+B30+G12 for sorghum and (P45+B17+G12) for
sunflower with inorganic and organic fertilizers
amendments. Studies revealed that soil amended with 100%
inorganic and organic fertilizers and with bacterial
consortium increased grain yield in sorghum as well as in
sunflower plants compared to 75% chemical + Inoculation;
50% chemical +8tons FYM+ Inoculation; 75% chemical +
PI : Minakshi GroverCo PI : S. K. YadavCentral Research Institute for Dryland Agriculture, Santoshnagar, Hyderabad
4tons FYM+ Inoculation; 75% chemical + 4tons FYM and
100% Inoculation.
· As suggested by nodal center, more than 200 new
rhizobacteria were isolated from stressed rhizosphere soils
using different oligotrophic and selective media. All isolates
were screened for tolerance to abiotic stresses viz.,
temperature, drought and salinity.
· 29 thermotolerant (50º C), 31 drought tolerant (30% PEG) and
18 salinity tolerant (10% NaCl) isolates were identified. Eight
isolates could tolerate all the three abiotic stresses tested.
· Abiotic stress tolerant isolates were screened for plant
growth promoting characters viz. phosphorus solubilization,
siderophore and IAA production and 19, 9 and 15 isolates
showed the above PGPR characters respectively.
· Biochemical characterization viz . carbohydrate
fermentation, oxidase, catalase, citrate and indole
production, gelatin and starch hydrolysis, Methyl Red and
Voges Proskauer test were done for the abiotic stress tolerant
isolates.
Conclusion
Bacterial consortium containing equal ratios (1:1:1) of
Pseudomonas-P7, Bacillus-B30 and Azospirillum- G12 was found to
be more effective in improving plant growth and biochemical
parameters of sorghum plants under drought as well as high
temperature stress as compared to other ratios studied, dual and
single inoculations. Field experiment with sorghum and
sunflower crops with 100% (inorganic and integrated) and 75%
(Inorganic and integrated) fertilizer dose indicated that treatment
with 100% chemical fertilizer + consortium inoculation was
performing better in terms of plant growth, yield and biochemical
status, as compared to uninoculated 100% (inorganic and
integrated), 100% integrated + consortium, and 75% (inorganic
and integrated) + inoculation. Besides more that 200 stress
tolerant rhizobacteria were isolated and characterized for
tolerance to different abiotic stresses, biochemical and plant
growth promoting traits. Twenty nine thermotolerant (50º C), 31
drought tolerant (30% PEG) and 18 salinity tolerant (10% NaCl)
isolates were identified. Eight isolates could tolerate all the three
abiotic stresses tested. Phosphorus solubilization, siderophore
and IAA production was observed in 19, 9 and 15 isolates
respectively. The isolates are under further screening for
imparting tolerance to host plant under drought and heat stress.
Papers published from AMAAS work
· Sandhya Vardharajula, Shaik Zulfikar Ali, Minakshi Grover,
Gopal Reddy; Venkateswarlu Bandi (2010) Drought-tolerant
plant growth promoting Bacillus spp. effect on growth,
osmolytes, and antioxidant status of maize under drought
stress. J. Plant Interact. DOI: 10.1080/17429145.2010.535178
· Shaik Zulfikar Ali, Vardharajula Sandhya, Minakshi
Grover, Linga Venkateswar Rao, Bandi Venkateswarlu
(2010) Effect of inoculation with a thermotolerant plant
growth promoting Pseudomonas putida strain AKMP7 on
growth of wheat (Triticum spp.) under heat stress. J Plant
AMAAS - Annual Report 2010-11
90
Interact. DOI:10.1080/17429145.2010.545147
· V.Sandhya, Sk.Z.Ali, Minakshi Grover, Gopal Reddy,
B.Venkateswarlu (2010) Effect of plant growth promoting
Pseudomonas spp. on compatible solutes, antioxidant status
and plant growth of maize under drought stress. Plant
Growth Regul. 62: 21-30.
· V. Sandhya, Sk.Z.Ali, Minakshi Grover, Gopal Reddy,
B.Venkateswarlu (2010) Effect of osmotic stress on plant
growth promoting Pseudomonas spp. Arch. Microbiol. 192:
867-876.
· Minakshi Grover, Sk.Z.Ali, V.Sandhya, B.Venkateswarlu
(2010) Role of microorganisms in adaptation of agricultural
crops to abiotic stresses. W.J.Microbiol. Biotechnol. DOI:
10.1007/s11274-010-0572-7.
Seminar, Symposia and Conferences attended
· Minakshi Grover, Sk Z Ali, V. Sandhya, Madhubala, Komal Vig, Shree R Singh and B. Venkateswarlu. Effect of drought
tolerant bacterial consortium on sorghum plants, under
different nutrient management practices. 96th South Eastern
Branch of American Society of Microbiology annual meeting
held at Montgomery, Alabama, USA, November 4-6, 2010.
Development of a bacterial consortium to alleviate cold stress
Rationale
The hill and mountain agro-ecosystems are characterized by
difficult terrain inadequate infrastructure, fragile ecosystem and a
society entrenched in traditions. Despite the low population
density, hill farmers face difficulty in producing crops to meet
their needs due to scattered land holdings, severe topsoil erosion
and low input application due to various factors. Therefore, by
default hill agriculture largely remains a low external input based
production system. The hill and mountain agro-ecosystem of
Uttarakhand and Garhwal state is subject to extreme winters
(during rabi season), during which the frost and snowfall are quite
common. In the upper reaches of the state, the ground remains
frozen for varying periods of time, subjecting the various rabi
crops to intense cold stress, thereby reducing the productivity of
crops. The effects of cold stress on crops can be reduced to a great
extent by utilizing plant growth promoting microbial inoculants
that retain their functionality at cold temperature conditions and
thereby offset the deleterious effects of cold stress on plants.
Alternatively selection of bacteria with low ice nucleating activity,
for phyllosphere colonization would help in overcoming frost
induced damages, which has been largely attributed to ice
nucleating bacterial inhabitants of the leaf surface. Since such an
approach has not been carried out earlier and most microbial
inoculants that have been developed so far are from the plain
regions of the nation where such harsh extremities of temperature
are non-existent. Hence, this study aims at developing bacterial
consortia that would alleviate cold stress on crop plants when
applied in the rhizospheric and phyllosphere regions of crop
plants.
Objectives
· To isolate cold tolerant bacteria from the rhizosphere of
various hill crops and screen them under in- vitro cold
conditions for their PGPR activity.
· To develop comprehensive biomarkers for the quality
control and field detection of the elite PGPR isolates.
· To develop a consortium of elite bacterial isolates to alleviate
the effect of cold stress.
· To evaluate the performance of consortium on selected Rabi
crops under pot culture conditions.
Significant Achievements
PI : Pankaj K. MishraCo PI : K. JeevanandanVivekananda Parvatiya Krishi Anusandhan Sansthan, Almora
· Cold tolerant bacterial cell survival in charcoal based -1formulation ranged from 7.2 to 7.6 log cfu gm under non-
refrigerated and refrigerated condition after six months.
· Bacterization with cold tolerant bacterial consortia had
significantly (P < 0.05) enhanced uptake of N (6.0. to 51.3%), P
(10.3 to 48.7% except C3), K (1.19 to 1.87 fold), Fe (1.46 to 2.43 + +fold), Zn (11.2 to 62.55%) and decreased Na / K ratio in
wheat (VL Gehun 804) at 60 DAS as compared to
nonbacterized control under pot condition.
· Bacterization with cold tolerant bacterial strains significantly
(P < 0.05) enhanced uptake of N (11.2 to 34.1% except PGRs4),
P (5.5 to 87.7%), K (8.7 to 129.0%), Fe (1.3 to 2.9 fold except
PGERs17), Na (10.4-55.2% except PGRs4), Zn (7.7 to 53.9% + +except PGRs4 & NPRs3) and decrease Na / K ratio in wheat
(VL Gehun 804) at 60 DAS as compared to nonbacterized
control under field condition.
· Inoculation with single cold tolerant bacterial strain NARs9,
PBRs5, PPERs23 and PGERs17 enhanced wheat (VL Gehun
804) yield by 19.2, 17.1, 16.0 and 13.5% respectively, over the
uninoculated control under field condition.
· In field condition seed bacterization with cold tolerant
bacterial strains improved plant growth parameters {root
length – 3.8 to 35.7%, shoot length - 9.0 to 35.3%, dry shoot
biomass - 3.7 to 55.5%, dry root biomass - 7.1 to 28.5%, (except
NARs9, NPRp15 & NPRs3), chlorophyll a/b ratio - 0.9 to
47.2%} and cold alleviating parameters {free proline - 1.9 to
2.5 fold, starch content - 1.01 to 2.86 fold (except PPERs23),
amino acids - 1.34 to 1.77 fold (except PPRs4), anthocyanin -
10.1 to 33.7% (except PPRs4), total phenolics - 0.6 to 20.4%
(except PGERs17 and PPRs4), relative water content and
decrease in electrolyte leakage} of wheat (VL Gehun 804) at
60 DAS as compared with uninoculated control in field
condition.
· Inoculation with cold tolerant bacterial consortia enhanced
plant growth parameters {root length - 3.1 to 21.7%, shoot
length - 34.8 to 69.2%, dry shoot biomass - 14.2 to 76.1%
(except C1), dry root biomass - 14.2 to 42.8% (except C3),
chlorophyll a/b ratio - 1.09 to 1.53 fold} and cold alleviating
parameters {free proline - 5.7 to 77.1%, starch content - 0.9 to
72.5%, amino acids - 2.7 to 42.5% (except C4, C5, C6),
91
AMAAS - Annual Report 2010-11
anthocyanin - 1.04 to 1.65 fold, total phenolics - 2.7 to 31.3%
relative water content and decrease in electrolyte leakage} of
wheat (VL Gehun 804) at 60 DAS as compared to
uninoculated control in field condition.
· All the individual strains in the consortium showed wheat
root colonization in the range of 6.0 – 8.4 log cfu after 60 DAS.
· Under field condition three consortium C3, C1 and C4
significantly enhanced wheat (VL Gehun 804) grain yield
25.4, 27.4 and 29.5% respectively, over uninoculated control.
Conclusion
In the context of hill and mountain agro-ecosystems, utility of
such cold active bacterial strains/ consortium is immense
considering the unique crop growing situations and the climatic
conditions of the high altitude agricultural systems. Such systems
require situation specific microbial inoculants that withstand
extremities of cold and retain their functional traits for plant
growth promotion. Twelve cold tolerant bacterial strains and
eight bacterial consortia were evaluated on wheat (VL Gehun 804)
growth and nutrient uptake under pot/ field condition.
Inoculation with Pseudomonas strains significantly enhanced
root/ shoot biomass and nutrients uptake as compared to
nonbacterized control at 60 day of plant growth. Bacterization
significantly improved the level of cellular metabolites like
chlorophyll, anthocyanin, free proline, total phenolics, starch
content, physiologically available iron, proteins and amino acids
that are sign of alleviation of cold stress in wheat plants. Increased
relative water content, reduced membrane injury (electrolyte + +leakage) and Na /K ratio was also recorded in bacterized wheat
plants. Cold tolerant Pseudomonas strain NARs9, PBRs5, PPERs23
and PGERs17 enhanced wheat yield by 19.2, 17.1, 16.0 and 13.5%
respectively, over the uninoculated control under field condition.
Among the bacterial consortium C4 (P. fluorescens PPRs4, P. sp.
PCRs4, P. jessenii PGRs1) recorded maximum (29.5%) wheat yield
over the control under field condition. The result showed that
single as well as bacterial consortium could be utilized to alleviate
the cold stress effect of wheat crop.
Papers published from AMAAS work
· Pankaj K. Mishra, Shekhar C. Bisht, Pooja Ruwari, Gopal K. Joshi, G. Singh, Jaideep K. Bisht, J. C. Bhatt (2010).
Bioassociative effect of cold tolerant Pseudomonas spp. and
Rhizobium leguminosarum-PR1 on iron acquisition, nutrient
uptake and growth of lentil (Lens culinaris L.). European
Journal of Soil Biology. 47:35-43.
· Pankaj K Mishra, Shekhar C Bisht, Pooja Ruwari, Govindan
Selvakumar, Gopal K Joshi, Jaideep K Bisht, Jagdish C Bhatt,
Hari S Gupta (2011) Alleviation of cold stress in
wheat (Triticum aestivum L.) seedlings with psychrotolerant
Pseudomonads from N.W. Himalayas,
· Pankaj K. Mishra, Shekhar C. Bisht, Smita Mishra, G.
Selvakumar, J. K. Bisht and Hari Shankar Gupta (2010).
Coinoculation of Rhizobium leguminosarum-PR1 with a cold
tolerant Pseudomonas sp. Improves iron Acquisition,
Nutrient Uptake and growth of Field Pea (Pisum sativum L.).
Journal of Plant Nutrition. (In press).
Book Chapter
· Pankaj Kumar Mishra, Shekhar Chandra Bisht, Jaideep
Kumar Bisht and Jagdish Chandra Bhatt (2011). Cold
Tolerant PGPRs as Bioinoculant for Stress Management In:
D.K. Maheshwari (ed.) Bacteria in Agrobiology: Stress
Management, Microbiology Monographs Springer-Verlag
Berlin Heidelberg (In press).
Seminar, Symposia and Conferences attended
· Pankaj K. Mishra, Shekhar C. Bisht, Pooja Ruwari, K.
Jeevanandan, G.K. Joshi, J. K. Bisht, J. C. Bhatt: Development
of cold tolerant bacterial consortium to alleviate cold stress theffects in wheat (Triticum aestivum L.) seedlings. 51 Annual
Conference of AMI, BITS, Pilani. Dec 14-16, 2010.
· Pankaj K. Mishra, Shekhar C. Bisht, Pooja Ruwari, J. K. Bisht,
J.C. Bhatt: Enhancement of chilling tolerance in wheat
(Triticum aestivum L.) seedlings with psychrotolerant growth
promoting Pseudomonads from N.W. Himalayas.
International workshop: Mountain Biodiversity & Impacts of
climate change. GBPIHED, Kosi Katarmal, Almora, Dec. 6-8,
2010.
· Shekhar C. Bisht, Pankaj K. Mishra, Tanuja Joshi, Pooja
Ruwari, J. K. Bisht, J.C. Bhatt: Asending migration of
endophytic Bacillus thuringiensis, from roots to leaves and
assessment of benefits to four different legumes of N.W. thHimalayas. 5 Annual Conference UCOST, Doon University,
Dehradun, Nov. 10-12, 2010, p. 12.
inoculated
Arch Microbiol.
(Accepted).
Effect of cold tolerant bacterial strains on plant growth, physiological and biochemical parameters of wheat (variety VL Gehun 804) in field condition
AMAAS - Annual Report 2010-11
92
Theme: Microbial Genomics
Complete genome sequencing of Mesorhizobium ciceri Ca 181
Rationale
Mesorhizobium ciceri ca181 was selected for whole genome
sequencing as it is a nodule forming chick pea rhizobia with very
specific and high qualities like, efficient nitrogen fixer shows good
nodulation competitiveness and performed well at different locations
in different agro-climatic regions, different soil types in All India
Coordinated trials. The whole genome sequencing of this bacterium
unveils the specific properties of it which is encoded by genes that
works in the coordinated form of specific metabolic pathways. After
the completion of gene prediction and annotation, we will understand
the reason of uniqueness of this bacterium, this will come in the form
of new genes and operons and proteins.
Objective
· Complete Genome Sequencing of Mesorhizobium ciceri Ca 181.
Significant Achievements
· Genome Assembly and Annotation: Sequencing of the genome
was done by 454 Next Generation pyrosequencing as well as
Sanger technology. A total of 6461 genes have been predicted
and annotated for the functions they perform in Mesorhizobium
ciceri Ca181. Filtration of annotated genes according to their
functional categories (stress, biosynthesis, regulatory and
signaling) is in the progress.
· Nitrogenous products accumulate in plants when soil nitrogen
level is high and readily available but the plant is unable to utilize
it. Nitrate level can go up and go in plants. After harvesting plant
nitrate gets converted in nitrite that is ten times more toxic in
comparison to nitrate. Above 5000 ppm of nitrate, it is dangerous
for the growth of plants and it checks the formation of root
nodules in the legumes. So the assessment of utilization of toxic
level of nitrate in the soil is planned.
· Experiment has been setup for the assessment of soil nitrate and
nitrite utilization ability of the strain Ca181. Four sets of
PI : Dilip K. AroraCo- PI : Alok K. SrivastavaNational Bureau of Agriculturally Important Microorganisms, Mau
experimental combinations have been made.
· The experiment is set up for the competitiveness of M. ciceri
Ca181 with other chick pea rhizobia strains. A total of eight
different rhizobia strains have been taken including M. ciceri
Ca181. 28 combinations have been made and experiment was
setup with 5 replication including negative control.
Conclusion
After assembly, the genome was search for the similarity in
genome database available at NCBI Genome browser and it found
about 35% similar from its closest organism M. loti. These results show
potential that after complete analysis of the genome, it will give some
new and unique genes and process involved in the specificity of this
organism. The study is incomplete to draw final conclusion. However
the identification of few sequences with unknown function could be
interesting to further work on because it does not have any match in
the database.
Seminar, Symposia and Conferences attended
·
·
·
Singh RP, Singh RN, Shahi P, Sharma A, Srivastava AK, and
Arora DK (2010) 3D structure prediction and modelling of FUR
protein in Bradyrhizobium japonicum USDA110, Interantional
Conference on Genomic Sciences-Recent Trends, Madurai
Kamaraj University, Madurai, India
Shahi P, Singh R N, Sharma A, Singh RP, Srivastava AK, and
Arora DK (2010) Identification of CSP homologous genes in
psychrophillic bacteria isolated from Gurudongmar Lake,
Interantional Conference on Genomic Sciences-Recent Trends,
Madurai Kamaraj University, Madurai, India
Sharma A, Babu BK, Singh RN, Shahi P, Singh RP, Srivastava AK,
and Arora DK (2010) Isolation and sequence characterization of
plasmid present in Mesorhizobium ciceri, Interantional
Conference on Genomic Sciences-Recent Trends, Madurai
Kamaraj University, Madurai, India
Total Contigs used for gene prediction 109 Total number of genes predicted
6461
Genes used for protein prediction and annotation
5560
Distribution of Genes in the Genome of M. ciceri Ca181
Protein involved in different functions in the Genome of M. ciceri Ca181
93
AMAAS - Annual Report 2010-11
Theme: Microbial Genomics
Genomic studies of uncultivated N fixing communities from Uttarakhand2
Rationale
Since, it is established that only less than 3% microbial
population is culturable, it is the need of this hour to unravel the
hidden treasure troves of nature by some alternative approaches.
In view of the above, the proposed objectives will not only
facilitate the characterization, but also expression and
conservation of desired gene(s) in suitable host. Furthermore, this
will provide a systematic documentation of Uttarakhand
microbial wealth which can be explored for socio-economic
upliftment and sustainable crop productivity by local inhabitants.
Objectives
· Identification of targets/isolates from different geographical
regions.
· Metagenomics for csp and nif.
· Isolation of full-length nitrogen fixing genes from a large
number of isolates.
· Characterization of the above genes by sequencing.
· Sequence alignment and identification of different alternate
forms of the above mentioned target genes.
Significant Achievements
· A total of 35 bacterial cultures were isolated from soil
samples of seven different geographical regions of Indian
Western Himalaya.
· The nitrogen-fixing properties of isolates were observed at
low and ambient temperature and six potential strains from
temperate and subtropical regions, were selected for
sequencing and further studies.
· The selected strains were screened for nifH gene and out of 10
nifH positive cultures; six positive strains were sequenced
and submitted to NCBI GenBank.
· Protein expression profile of three potential strains namely
Enterobacter ludwigii strain PAS1; Enterobacter hormaechei
Strain AAB8 and Pseudomonas Sp., Strain JAZ1 during the
PI : Reeta GoelG. B. Pant University of Agri. and Tech., Pantnagar
shiftment of cell cultures temperature from 30°C to 4°C was
studied by two dimensional gel electrophoresis.
· Identified spots were annotated using the database swiss-2D
PAGE.
· In silico analysis was performed on the basis of pI (Isoelectric
point) and Mw (molecular weight) of seperated protein
spots.
· These proteins were further characterized and validated
through mass spectrometry (MALDI-TOF).
Conclusion
Low temperature N fixing bacterial communities were 2
screened from temperate and subtropical regions of Western
Indian Himalayas. Out of 35 isolates, six strains were
sequenced and their 16S rRNA gene sequences were
submitted to NCBI-GenBank. Comparative profiling of three
potential strains (i.e. JAZ1, AAB8 and PAS1) is being carried
out by 2 D gel electrophoresis and MALDI-TOF mass
spectrometry. In-silico analysis of four identified proteins
revealed that these proteins were Universal stress protein A,
GroES protein, Alkyl hydro peroxide reductase subunit C
and GroEL protein, respectively.
Papers published from AMAAS work:
· Singh C., Soni R., Jain S., Roy S. and Goel R. (2010) Study of
nitrogen fixing bacterial community using nifH gene as a
biomarker in different geographical soils of Western Indian
Himalayas. Journal of Environmental Biology.31:553-556.
· Soni R. and Goel R. (2010) Triphasic Approach for
Assessment of Bacterial Population in Different Soil Systems.
Ekologija. 56(3&4) 99-104.
· Soni R. Shaluja B.and Goel R. (2010) Bacterial community
analysis using temporal gradient gel Electrophoresis of 16 S
rDNA PCR products of soil metagenomes. Ekologija. 56(3&4)
94-98.
Characterization of proteins expressed in 2-DE by using MALDI-TOF Mass spectrum. Protein score is significant i.e. (P<0.05) after databases
AMAAS - Annual Report 2010-11
94
Structural Genomics of Mesorhizobium ciceri Ca 181
Rationale
Mesorhizobium ciceri Ca181 is a soil bacterium of Rhizobium
species. Chickpea is an important leguminous crop in most of the
Asian countries. Mesorhizobium ciceri ca181 is a nodule forming
chickpea rhizobia with very high specific qualities like, efficient
nitrogen fixation and shows good nodulation competitiveness
and performed well at different locations in different agro-
climatic regions and soil types. In agriculture, Rhizobium spp.
improves soil fertility in leguminous crops by biological nitrogen
fixation. Rhizobium spp. strains are very sensitive to soil
environmental abiotic factors such as water stresses, high salt, pH,
and temperature stresses that affect their nitrogen fixation
capacity and hence the productivity of legumes. Rhizobium spp.
are also sensitive to desiccation in soils and on seeds. An
understanding of the genetic potential for increased tolerance to
these adverse environmental stresses could enhance production
of food and forage legumes in semi-arid and arid regions of the
world. Phosphorus (P) is one of the major essential
macronutrients for plants and is applied to soil in the form of
phosphate fertilizers. Microorganisms are involved in a range of
processes that affect the transformation of soil P from phosphate
and are thus an integral part of the soil P cycle. In particular, soil
microorganisms are effective in releasing P from inorganic and
organic pools of total soil P through solubilization and
mineralization. Complete genome sequences give us a whole
genomic blue print of an organism such as M. c. Ca181. This will
dissect nitrogen fixation process at molecular level so as to enable
us manipulate genes involved for increasing crop productivity.
Moreover, generating M. c. Ca181 mutants for important genes
like gens involved in water stresses tolerance and phosphate
solubalization will increase our understanding about these genes.
Using the knowledge of different gene sequences and their
function, it may by be possible to use them for increasing crop
yield and development of transgenics with enhanced biological
nitrogen fixation ability and enhanced phosphate solubalization
under abiotic stresses.
PI : Major SinghIndian Institute of Vegetable Research, Varanasi
Simple sequence repeats (SSRs) or microsatellites are tandem
short stretches of DNA with the repeat units of 1-6 bp in length for
varying numbers of times, and the property of microsatellite is
determined by their composition, motif length, and the
distribution in the genome. Simple sequence repeats (SSRs) or
microsatellites, as genetic markers, are ubiquitous in genomes of
various organisms. The analysis of SSRs in various Rhizobium
strains will provide useful information for a variety of
applications in population genetics of Rhizobia.
Objectives
· Complete genome sequencing of Mesorhizobium ciceri Ca 181.
· To utilize sequence data for identification of genes involved
water stress tolerance and phosphate solubilisation.
· SSR markers profiling of Mesorhizobium ciceri Ca 181 with
other Rhizobium.
· Generating Mesorhizobium ciceri Ca 181 mutants for genes
involved water stress tolerance and phosphate
solubilisation.
· Screening of Mesorhizobium ciceri Ca 181 mutants for
phosphate solubilisation and moisture tolerance (low, high).
Significant Achievements:
· Small insert shotgun Genomic DNA insert plasmid library
spanning 1152 (96 x 12 plates) clones was prepared and
plasmid DNA was isolated and analyzed. 702 clones have
been sequenced from 10 plates (5 forward and 5 reverse)
spanning 4,43,407 nucleotides (443.4 Kb). After vector
sequence removal 140 Contigs were assembled and 352
singletons were left. Mesorhizobium ciceri Ca 181 genomic
sequencing has been completed.
· After analysis of genomic sequence of Mesorhizobium ciceri Ca
181, we found 18 SSRs in the genome of Mesorhizobium ciceri
Ca 181 and the frequency of SSRs longer than 10 bp. Among
the various class of microsatellite, trinucleotide and
dinucleotide repeat was the most abundant class. The
frequency of Maximum mononucleotide SSRs are longer
Graph showing the absorbance (600nm) of Mesorhizobium ciceri culture at 0% to 50 % (A);and 25% to 30% of PEG concentration (B).
95
AMAAS - Annual Report 2010-11
Genome analysis of the nitrogen-fixing symbiotic bacteriam Mesorhizobium ciceri
Rationale
Mesorhizobium ciceri, the bacterium responsible for nitrogen
fixation in chickpea has been analysed through conventional
approaches in India and it lead to identification of a superior
strain, CA181. The main features of this strain has been studied
and described earlier. Under the AMAAS project its genome has
been sequenced and annotated. Based on the annotation
information a set of 24 'nif' genes were identified and flanking
primers for amplification of full length genes were synthesized.
Validation and study of sequence variation for these genes in
other nitrogen fixing microorganisms is expected to provide
useful information on reasons for difference in efficiency of
nitrogen fixation in different bacterium analyzed. The DNA
samples of the isolated provided by NBAIM, MAU is being used
for the analyses of nitrogen fixing genes.
Objective
· Complete genome sequencing of Mesorhizobium ciceri strain
Ca181.
Significant Achievements
· Optimization of PCR amplification conditions for all 18
primers to amplify the 24 'nif' genes has been completed for
three of the primer pairs.
PI : K.V.BhatCo PI : A. B. Gaikwad, Rakesh SinghNBPGR, Pusa Campus, New Delhi
· All primers gave good amplification of target genes in Ca181
except gene 30, gene 155 & gene 56.
· There was very poor amplification in other isolates for all
primers.
· For gene 7 and gene 35, the amplification product size in
other Rhizobia is different from that of Mesorhizobium ciceri
Ca181.
· Optimization process is being continued and sequence
than 10 bp and one mononucleotide repeat was C motif
longer than 22 bp. Dinucleotide repeats were all GC (GC and
CG were included) and GA motif. Within trinucleotide
repeats CGG, GGC, GCC, TCG were the predominant repeat
type. With the help of SSRs of Mesorhizobium ciceri Ca 181, we
designed 18 primers for making SSR markers profiling of
Mesorhizobium ciceri Ca 181 with other Rhizobium bacteria.
· For Mesorhizobium ciceri Ca 181 mutants development, we are
using some methods for development of mutants of
Mesorhizobium ciceri Ca 181 such as Tn5 transposon
mutagenesis experiment, chemical mutagenesis by ethyl
methyl sulphonate (EMS) and site directed mutagenesis of
genes related to phosphate solubilisation and moisture stress
tolerance. After analysis of genomic sequence of
Mesorhizobium ciceri Ca 181 we found Pyrriloquinoline
quinone (PQQ) gene series family has property for
phosphate solubilisation and there are 7 genes of PQQ series
family present in Mesorhizobium ciceri Ca 181. Trehalose
phosphate synthatase, cold shock protein, fructosyl
transferase, and choline oxidase series genes family are
responsible for low moisture stress tolerance and there are 14
genes are related to this series. For screening of mutants for
phosphate solubilisation and moisture stress tolerance, we
optimized the screening protocols of Mesorhizobium ciceri Ca
181 for low moisture stress tolerance and phosphate
solubilisation. Polyethylene glycol was used for low
moisture because PEG one of the most useful molecules for
applying osmotic pressure in osmotic stress technique. We
tried different percentage of PEG i.e. 10, 15, 20, 25, 30, 40, and 050 % (w/v) in YEMB. After 6 days of culture at 28 C
absorbance was recorded at 600 nm of M. c. Ca 181 with
different percentage of PEG in Yeast extract Mannitol Broth
(YEMB).
· With increase in concentration of PEG the number of
bacterial cells decreased. With the help of above data we
concluded that at 25% PEG there was growth of the
bacterium is considerable and at 30%, 40% and 50% PEG the
growth was negligible. Therefore, 25% PEG concentration
was found fit to screen low moisture stress tolerance
Mesorhizobium ciceri Ca 181 mutants. For screening of
phosphate solubilisation, the bacteria was grown in
phosphate solubilisation media with bromophenol blue.
When phosphate solubilises by M. c. Ca 181 then blue colour
of bromophenol blue converted into red. However, M. c. Ca
181 was little change the colour in initial experiments.
Conclusion
702 clones have been sequenced from 10 plates (5 forward
and 5 reverse) spanning 4,43,407 nucleotides (443.4 Kb).
Mesorhizobium ciceri Ca 181 genomic sequencing has been
completed. The present study is focused on the development of
mutants of Mesorhizobium ciceri Ca 181, which are able to grow in
low moisture condition and solubilises phosphate. The results
indicated that M. c. Ca 181 has ability to grow in low moisture
condition and can little solubilise phosphate. We are trying to
develop better mutants than wild type. After genome sequence
analysis of Mesorhizobium ciceri Ca 181, we concluded that there
are 18 SSRs and 21 genes related to phosphate solubalization and
low moisture stress. This study will provide valuable information
for SSR application in Rhizobia research.
Amplification profiles for the 25 isolates of Rhizobium for the 'nif' genes tentatively designated as Gene7, Gene35, Gene25, Gene46, Gene56I, Gene241, Gene190 and Gene160. The first lane after DNA size marker lane in all gels is M. cicerii CA181 isolate
AMAAS - Annual Report 2010-11
96
polymorphism is being analysed across the isolates.
Conclusion
Considerable variation was observed for the length of the
total genes across the isolates. Further, failure to obtain good
amplifications with the primers across isolates in all samples
Functional genomic analysis of plant growth promoting rhizobacteria (PGPR) fluorescent Pseudomonads
Rationale
Root colonization is an important step for the successful
establishment plant microbe interaction at the root and
rhizosphere regions whereby the plant growth promoting
bacteria compete with indigenous soil microflora. This process is
regulated by several biotic and abiotic factors at the rhizosphere.
Of these, tolerance to stress induced by the plant partner as well as
other microbiota is of considerable importance. Dissecting the
mechanism of tolerance to stresses in the rhizosphere such as
nutrient starvation would provide critical information regarding
the choice of effective inoculant bacteria and their ecological
success and performance in field conditions.
Objectives
· Selection and characterization of plant growth promoting
rhizobacteria (PGPR) Fluorescent Pseudomonads.
· Genome-wide comparison of the PGPR fluorescent
Pseudomonads isolated from different ecological niches.
· Selection of a PGPR strain, suitable host system for plant root
colonization and analysis of various parameters (biological,
biochemical and environmental) influencing root
colonization.
PI : P. GunasekharanCo PI : K. ManoharanMadurai Kamaraj University, Madurai
· Identification of novel genes influencing rhizosphere
colonization using random Tn5 mutagenesis.
Significant Achievements:
· In a transposon mutant library of Pseudomonas putida S11W,
an iron starvation tolerant (Ht3) was isolated. The region
flanking insertion site of transposon in mutant Ht3 was
sequenced by genome walking PCR.
· Nucleotide sequence analysis revealed the ORF (roxS) into
which transposon had inserted encodes histidine kinase. A
two component signal transduction system (RoxSR)
comprises of an integral membrane sensor signal
transduction histidine kinase (RoxS) and its cognate
transcriptional regulator (RoxR).
· Iron starvation tolerant mutant Ht3 produced more amount
of siderophore pyoverdine under iron limiting conditions
and showed higher iron acquisition ability than parent strain
· Physiological functions namely biofilm formation and seed
adhesion are known to be influenced by iron uptake. Hence,
the mutant Ht3 showed improved ability of biofilm
formation on abiotic surfaces and adhesion to corn seeds.
· An IVET vector was constructed to trap promoters active
during root colonization by beneficial bacteria.
· A suitable host system to apply this developed vector for
promoter trap studies was identified by enriching rice
rhizospheric bacterial suspension in-planta for rice root
colonizing bacteria.
· One strain exhibited very strong seed adherence, root
colonization and plant growth promoting properties.
· The above strain was identified to be Enterobacter cloacae GS1
(ECGS1) by 16S rDNA sequencing and biochemical tests.
· Rice root colonization by GFP tagged ECGS1 was studied in
hydroponic culture conditions by epifluorescence
microscopy.
Conclusion:
In fluorescent pseudomonad P. putida S11W, a two
component regulatory system involved in regulation of
siderophore pyoverdine synthesis was identified and
characterized. To identify bacterial promoters active during plant
root colonization, a Recombinase –IVET vector was constructed.
Promoters active during root colonization by E. cloacae GS1, rice
root colonizing and growth promoting strain shall be identified
using R-IVET.
Papers published from AMAAS work
· Shankar, M., Ponraj, P., Ilakkiam, D., Gunasekaran, P., 2010.
indicated presence of sequence variations for the flanking regions
of the gene. Analyses of sequence variation for the genes are
expected to provide insight into the reasons for differences in
efficiency of nitrogen fixation by different isolates.
Rice root colonization by Enterobacter cloacae GS1 in a hydroponic environment
Recombinase-IVET vector constructed from pGP704 for trapping promoters active during rice root colonization
97
AMAAS - Annual Report 2010-11
Root colonization of a rice growth promoting strain of
Enterobacter cloacae. J. Basic Microbiol. (In Press).
Seminar, Symposia and Conferences attended
· P. Ponraj, M. Shankar, D. Illakkiam and P. Gunasekaran,
“Two component signal transduction system (roxSR)
Structural Genomics of Mesorhizobium ciceri Ca181
Rationale
Studies on whole genome sequences give us a complete
genomic blueprint for an organism so that it is possible to examine
how all parts operate cooperatively to influence the activities and
behavior of an entire organism Mesorhizobium ciceri Ca181.
Similarly complete genome sequencing of this microorganism
will enable us to dissect the nitrogen fixation process at the
molecular level at every stage from bacterial recognition of the
plant, nodulation, infection to finally atmospheric nitrogen
assimilation so as to manipulate the genes involved for increasing
crop productivity. Isolated genes after functional validation will
be used to enhance effectiveness of nitrogen fixation of
indigenous rhizobial strains. This project will yield useful
information on total number of protein and rRNA coding genes,
gene phylogenies, biology and diversity of these important
nitrogen fixing microorganisms, in comparison to other rhizobia,
endophytes as well as other microbes. Further experimental
validation of assignment of functions to the various genes
identified in this project will lead to discovery of many genes of
agricultural importance. Using the knowledge of different gene
sequences and their function it may be possible to use them for
development of transgenics with enhanced biological nitrogen
fixing ability.
Objectives
· Complete genome sequencing of Mesorhizobium ciceri strain
Ca181.
· To utilize the sequence data for isolation/identifi- cation of
novel genes imparting competitiveness to Ca181.
· To search for homologues/orthologues for nod and nif genes
and their regulatory sequences, in other strains of rhizobia.
Significant Achievements
· Construction of large insert (30-40 kb) Fosmid Library of
Mesorhizobium ciceri Ca181: High molecular weight genomic
DNA was isolated from Mesorhizobium ciceri Ca181. Shearing
of genomic DNA into 40kb fragments was done by passing
it through a 200 µl small bore pipette 50-60 times. Sheared
DNA was end repaired to generate blunt ended and 5′-
phosphorylated DNA. Size selection for 25-40 kb fragments
of end repaired DNA was done. Ligation of recovered end
repaired, concentrated insert DNA to copy control pCC2FOS
cloning ready vector was done using fast-link DNA ligase.
Ligated product was packaged using Max Plax lamda
packaging extract. E.coli EPI300-T1 cells were infected with
packaged phage particles and plated on selection medium.
Around 3800 clones have been picked.
· Quality Check and size estimation of fosmid clones: DNA
PI : N. K. SinghCo PI : KanikaNational Research Centre on Plant Biotechnology, New Delhi
from the recombinant fosmid clones was isolated using
fosmid isolation kit (Epicenter).The quality of the fosmid
DNA was checked on 0.8% agarose gel. Pulse field gel
electrophoresis was carried out to estimate the approximate
insert size of DNA in fosmid vector. Fosmid DNA was
digested with HindIII and the digested product was run on
1% PFGE gel.
· End sequencing of the Fosmid DNA: End sequencing of 1824
fosmid clones was done. An average of 700-900 bp good
quality read for forward and reverse sequencing was
obtained.
· Use of fosmid end sequence data for scaffolding of the M.
regulates pyoverdine synthesis in Pseudomonas putida S11” ndpresented at National Science Day and 42 AQUA-TERR
Annual Conference on Genomic Sciences, held at Madurai thKamaraj University, Madurai, India on 28 Feburary, 2011.
Snapshot of sequence data of the fosmid DNA clone
Electrogram of the sequenced fosmid DNA
AMAAS - Annual Report 2010-11
98
ciceri sequence contigs: 1400 Mbp sequence data (60 fold
coverage) from Solexa sequencing and 467 Mbp sequence
date (20.02 fold coverage) using 454 GS FLX Titanium
sequencing have been obtained. De novo assembly was done
with 454 sequence data using 454 Newblerassembler. After
the assembly 23 large contigs were formed. Paired-end
sequences of 672 fosmid clones have been used to fill the
gaps. Out of 22 gaps, 13 gaps were filled using fosmid end
sequence data.
Conclusion
End sequencing of 1824 fosmid clones have been done.
Sequence assembly done using Newbler Assembler, Velbet and
Lasegene DNA Star software and generation of 23 sequence
contigs. Fosmid end-sequences were used for creating scaffolds of
23 sequence contigs and 14 gaps between contigs have been filled
and we have only 3 major scaffolds.
Mining for genes involved in the production of fungicidal compounds in Anabaena strains
Rationale
Cyanobacteria, with their relatively short generation time,
capability of being easily handled and cultured under controlled
conditions and metabolic flexibility, play diverse and significant
roles in the sustainability of the environment and represent a
favourite workhorse for deeper understanding of several
metabolic processes. Anabaena is an important genus, widely
distributed in diverse habitats and exploited not only as a
biofertilizer, but also as a rich source of bioactive compounds,
such as microcystins & laxaphycins. Many such compounds
exhibit fungicidal and herbicidal/weedicidal properties have
been implicated in allelopathic interactions in water and soil.
However, their genomics and proteomics is far from understood.
The present project envisages the identification, sequencing of
genes responsible for fungicidal activity in promising Anabaena
strains, using the tools of genomics and maximizing the
production of these compounds using suitable delivery systems.
Objectives
· To utilize PCR based techniques and sequencing tools to
identify genes involved in the production of the fungicidal
compound(s) in a selected set of Anabaena strains.
· To sequence the gene(s) involved in the production of the
fungicidal compound(s).
· To validate the fungicidal effect of the gene by
transformation of non-toxic strain.
· To develop delivery and expression systems for enhanced
production of fungicidal compound(s).
Significant Achievements
· The genomic library clones of Anabaena laxa were screened
using plate assays for both β-1,3 and β-1,4 endoglucanase
activities and quantitative analyses was undertaken using
cell free recombinant proteins from the positive clones. Both
end 1 and 2 were successfully subcloned into the pET-14b
expression vector, and the recombinant End 1 and 2 proteins
purified using Ni-NTA kit and quantified using modified
Bradford's method. SDS-PAGE of the recombinant purified
proteins revealed 38 and 74 kDa molecular weight from End
1 and 2, respectively and the expression of the purified
recombinant proteins of both End 1 and 2 was evaluated
using activity staining gel method using 1 % CMC (carboxy
methyl cellulose) and laminarin as substrates. The purified
End2 exhibited positive results with both substrates, while
PI : Radha PrasannaCo PI : N. K. SinghIndian Agricultural Research Institute, New Delhi
End1 was positive for only CMC as substrate. The negative
controls did not show any activity with respect to substrate.
· Time course studies were undertaken using two Anabaena
strains (A. fertilissima; A. sphaerica) under different light: dark
conditions viz. continuous light (CL) and dark (CD), L: D::
8:16 and L:D::16:8 (Light: Dark). The time dependent
measurement of chitosanase and antifungal activities under
different light-dark conditions indicated that in A. fertilissima
(RPAN1), both these activities were stimulated in the dark
phase and maximum under L:D::8:16 condition. The
relatively lower level of protein in A. fertilissima (as compared
to A. sphaerica) in the dark phase of L:D-8:16 (particularly at
28d) suggested that the increase in the length of dark phase
leads to retardation of growth which may act as a
physiological signal to increase the chitosanase/antifungal
activities in A. fertilissima. PCR amplified products using
chitosanase specific primers were gel purified and cloned
into pGEM-T easy vector and then transformed into E. coli
host strain DH5α. Sequence analysis of the amplified
product showed that they were similar to glycoside
hydrolase family 3 like (GH3-like) N terminal domain
proteins of A. variabilis ATCC 29413 strain. This enzyme
belongs to the GH3 family protein (PFAM Accession
PF00933).
· The pair-wise amino acid sequence alignment further
revealed 5 insertions and 5 substitutions in the amino acid
sequence of A. fertilissima as compared to A. sphaerica
(negative control). An open reading frame of 362 and 367
amino acids with a predicted molecular mass of 40 kDa and
40.6 kDa was observed in A. sphaerica and A. fertilissima,
respectively. The N-terminal region of the deduced amino
acid sequence of A. fertilissima exhibited a putative peptide
signal of 23 residues long, whereas, neither signal peptide
nor cleavage site was detected in A. sphaerica. Chitosanase
specific proteins were isolated and purified from both the
Anabaena species. SDS-PAGE analysis revealed a size of Cho
proteins of 40.6 and 40.0 kDa in A. fertilissima and A. sphaerica,
respectively. HPLC based profiling results clearly indicated
that the presence of chitosanase activity only in A. fertilissima
Compost formulations, developed by amendment with a set
of Anabaena strains and biocontrol strain Bacillus subtilis were
evaluated for their disease suppressiveness against
phytopathogenic fungal consortium (P. debaryanum, F.
99
AMAAS - Annual Report 2010-11
moniliforme, F. oxysporum lycopersici and R. solani), by
employing them as potting mixture supplements in tomato
crop under greenhouse conditions. The promising strains
were further evaluated in pot experiments set up in the
National Phytotron Facility. Anabaena variabilis RPAN 59
amended composts significantly reduced % disease severity.
The activity of the plant defense enzymes PAL and PPO were
higher in roots than shoots and enhanced significantly in the
fungi challenged treatments i.e. T6-T12.
· The extracellular filtrates from Anabaena sp. such as A. laxa, A.
iyengarii, A. variabilis and A. oscillarioides from 7, 14, 21 and
28d old cultures grown under different conditions of light
[Continuous Light (CL), Light dark (LD; 16:8) and ˚ ˚Continuous Dark (CD)], temperature [19+1 C, 29+1 C and
˚39+1 C], phosphorus doses [1/2P, 1P, 2P], pH levels [5.5, 7.5
and 9.5], were evaluated under laboratory conditions in
terms of total chlorophyll, total proteins, chitosanase,
endoglucanase and CMCase activity and inhibition assay
against P.debaryanum, F. moniliforme, F. oxysporum lycopersici
and R. solani employing standard methods. Four weeks old
cultures exhibited highest enzyme activity. Highest values of
hydrolytic enzyme activity were recorded in all the strains
under CL condition while lowest values were recorded in CD
condition. The pH of 7.5 and 9.5 were found to be optimal for
endoglucanase and CMCase activity, respectively. The ˚activity of chitosanase and CMCase was highest at 39+1 C,
while endoglucanase was not significantly affected. No ˚fungicidal activity was observed at 20+2 C as well as under
CD condition. Chitosanase activity was highest at pH 5.5
while CMCase was not influenced significantly by pH.
Conclusion
Two genes (end 1 and 2) encoding hydrolytic enzymes from
A. laxa (RPAN8) which showed β-1, 4 (end 1 and 2) and β-1, 3 (end
2) endoglucanase activities were identified, purified and
characterized. A novel cho gene associated with GH3-like family
encoding chitosanase from A. fertilissima (RPAN1) was also
characterized in terms of its expression and fungicidal activity.
These are first reports for these organisms. The environmental
conditions leading to highest fungicidal and hydrolytic enzyme
activity were identified as - 4 weeks old cultures incubated under
continuous light (CL), high temperature (39+1˚C) and
phosphorus (0.086 mM). Compost amended with Anabaena
strains showed promise in the suppression of the disease severity,
besides enhanced leading to defense responses of tomato plants
against damping off disease.
Papers published from AMAAS work
· Vishal Gupta, Chitra Natarajan, Kanika Kumar and Radha
Prasanna (2010). Identification and characterization of
endoglucanases for fungicidal activity in Anabaena laxa.
Journal of Applied Phycology 23: 73-81.
· Vidhi Chaudhary, Radha Prasanna, Vishal Gupta, Shashi
Bala Singh, Chitra Natarajan and Lata Nain (2010)
Development of microtitre plate based assay for evaluation
of fungicidal potential and microscopic analyses of
cyanobacterial metabolites with fungal mycelia. Archives of
Phytopathology and Plant Protection 43: 1435-1444.
· Vishal Gupta, Radha Prasanna, Chitra Natarajan, Ashish
Kumar Srivastava and Jitender Sharma (2010). Identification,
characterization and regulation of novel antifungal
chitosanase (cho) in Anabaena fertilissima. Applied and
Environmental Microbiology 76: 2769-2777.
Seminar, Symposia and Conferences attendedth th· 51 Annual Conference of AMI), 14-17 December 2010.
BITS, Mesra, Ranchi.
LPSomics : Characterization of lipolysaccharide (LPS) biosynthetic gene clusters in xanthomonad pathogensof plants
Rationale
Lipolysaccharides (LPS) are an important constituent of the
outer membranes of gram negative bacteria. In pathogenic
bacteria, LPS is required for virulence and at the same time has
been shown to be a potent inducer of the innate immune systems
of animal and plant hosts. In animal pathogenic bacteria,
considerable variation is found at LPS biosynthetic genes clusters
(at the species level), and this variation has been attributed to help
in evading the host innate immune system. The genus
xanthomonas includes a group of gram negative bacteria that
cause more than 300 different plant diseases. We had previously
reported that variation in LPS biosynthetic gene clusters is found
in the xanthomonad group of plant pathogens at the level of the
genus, species and pathovar. This LPS locus is present between
two conserved house keeping genes, metB (involved in
methionine biosynthesis) and etfA (involved in electron
transport). In particular, we have described an interesting
example of interstrain variation in lipopolysaccharide (LPS)
PI : Ramesh V. SontiCo PI : Hitendra Kumar PatelCentre for Cellular and Molecular Biology, Hyderabad
biosynthetic gene clusters in Xoo. The vast majority of Xoo strains
in India and Asia have an LPS gene cluster (called BXO1 type of
gene cluster) that is ~13 kb in length. Mutations in genes encoded
within this locus lead to loss of LPS and extracellular
polysaccharide (EPS) production as well as virulence deficiency.
A variant LPS gene cluster was found in a Xoo strain called BXO8.
This locus is ~24 kb long and encodes 15 genes that are arranged in
two convergently transcribed units. This project is aimed at
characterizing the LPS gene cluster of the BXO8 strain through
mutational analysis, assessing variation in LPS gene clusters in
X a n t h o m o n a d s ( i n c l u d i n g X a n t h o m o n a s a n d
Stenotrophomonas) and to assess rice defense responses to
treatment with Xanthomonas LPS.
Objectives
· Characterize the variant LPS gene cluster in Xanthomonas
oryzae pv. oryzae (Xoo) strain BXO8, an unusual pathotype of
this rice pathogen.
AMAAS - Annual Report 2010-11
100
· Assess extent of LPS gene cluster variation in the related
Stenotrophomonas sp. including plant endophytes and
determine the relationships, if any between, the LPS gene
clusters of Xanthomonas and Stenotrophomonas strains.
· Examine plant (rice) responses to treatment with Xoo LPS.
· Identify new LPS gene clusters in plant pathogenic
xanthomonads.
Significant Achievements
· Out of 50 Indian Xoo strains, belonging to 11 different
pathotypes (provided to us by BAYER India Ltd), 10 strains
were found to have the BXO8 type of LPS gene cluster.
· DNA fingerprinting of these 50 strains, using Southern
hybridizations with a multi-locus RFLP probe (a Xoo IS
element), was done and a dendrogram was prepared to
assess their phytogenetic relationships.
· The most basal strain in the dendrogram has the BXO8 type
of LPS cluster suggesting that the ancestral strain of Xoo has a
BXO8 type of LPS cluster.
· A horizontal gene transfer event introduced the BXO1 (or
canonical) LPS gene cluster into the ancestor of most Indian
strains of Xoo.
· An additional HGT event occurred that re-introduced the
BXO8 type of LPS into a lineage which includes strains that
belong to pathotypes 6, 7 and 8 that are characterized by
compatibility to the xa13 disease resistance gene of rice.
· Additional HGT events occurred at multiple branchpoints in
this lineage, each of which re-introduced the BXO1 type of
LPS gene cluster and led to replacement of the BXO8 type of
LPS gene cluster.
· One of these sub-lineages is primarily comprised of strains
that belong to Xoo pathotypes 3, 4 and 5 that are incompatible
with the xa13 disease resistance gene.
Conclusion
The BXO8 LPS gene cluster appears to be the ancestral LPS
gene cluster for Indian Xoo strains. Multiple HGT events have
occurred at the LPS gene cluster within Indian Xoo strains. The
majority of these HGT events have lead to replacement of the
BXO8 LPS gene cluster with the BXO1 type of LPS gene cluster.
The BXO1 type of LPS gene cluster is either more mobile than the
BXO8 LPS gene cluster or the Xoo strains that have this LPS cluster
have a selective advantage as compared to strains that have the
BXO8 type of LPS cluster.
Cloning and characterization of insecticidal crystal protein (cry) gene from the local isolates of Bacillus
thuringiensis
Rationale
Climate driven emergence of new plant pests and diseases is
of concern- Emerging pests are often plant pests of related species
known as “new encounter” pests, which come into contact with
new hosts that do not necessarily have an appropriate level of
resistance, or are plant pests introduced without their biological
control agents (in particular, insect pests, nematodes and
weeds).There are an estimated 67,000 pest species worldwide that
damage agricultural crops, of which approximately 9,000 species
are insects and mites. Sustainable control of insects in agriculture
is very important since it was estimated that chemical control cost
7500 million dollars. In addition, the use of synthetic insecticides
is not recommended because of the long residual action and
toxicity to a wide spectrum of organisms, including human.
Consequently, interest has developed in the use of alternative
strategies for biological control, such as Bacillus thuringiensis. The
soil bacterium B. thuringiensis Berliner fulfils the requisites of a
microbiological control agent against agricultural pests and
vectors of diseases that lead to its widespread commercial
application. The interest in this microorganism relies on its
forthcoming potential as an economic, effective species-specific
and environmentally safe pesticide. The implications of our
studies are important for new design of -endotoxins that
overcome insect resistance to these toxins and for altered or
improved insecticidal activity, as has been achieved in other Cry
proteins. The discovery of novel B. thuringiensis toxins is likely to
continue at least into the near future. Continued analysis of the
molecular basis of toxin action including studies of insect
specificity, of insect resistance to Cry toxins and of the role of
PI : R. AsokanCo PI : Pious ThomasIndian Institute of Horticultural Research, Bangalore
receptor molecules in toxicity will provide new ways for a rational
design of Cry toxins to control insect pests important in
agriculture or in human health. Such developments will extend
the useful life span of this technology.
Objectives
· Collection of soil samples from different agro-ecological
zones of India.
· Isolation, enumeration of Bacillus thuringiensis.
· Molecular Characterization of the B.thuringiensis isolates.
· Cloning & toxicity of coleopteran active cry genes.
Significant Achievements
· During the year (2010-11), Soil samples collected from
Manipur, Nicobar Islands and Andra Pradesh states were
used for isolation of Bt strains.
· SDS-PAGE analysis of the all the Bacillus thuringiensis isolates
was done.
· Coleopteran active genes viz., cry9Da1, cry22A, cry23A, cry43
and cry43B (Newly primers have been designed and used for
the screening of the potential isolates). Among which cry9Da1/Db (NCBI accessions – 6), cry22A (NCBI accessions-5),
cry23 and cry28 (NCBI accessions-2) cry7Ab (NCBI accessions-
28), cry1F (NCBI accessions-6) genes successfully isolated,
cloned and sequenced. Remaining other cry genes screening
is in progress.
· Successfully cloned and sequenced Nematode active cry
genes (cry5, cry6, cry12, cry13, cry14 and cry21)-cry5A/5B
(NCBI accessions -24); cry6 (NCBI accessions-12) and active
101
AMAAS - Annual Report 2010-11
against sucking pests. cry4A (NCBI accession-26); cry1Ab
(NCBI accessions-20), respectively.
Conclusion
In conclusion, although many Bt toxins have already been
isolated, the cloning of additional novel cry genes continues to
benefit the further development of Cry proteins as competitive
biological insecticides. Studies on isolation of full length gene,
cloning and characterization, recombinant protein production of
cry genes and toxicity studies on different order of insect pests
from these new isolates of Bt will be useful to open new vistas in
the area of integrated pest management for sustainable
agriculture.
Papers published from AMAAS work
· H.M.Mahadeva Swamy, R. Asokan, D. K.Arora, S. N.
Nagesha and Ajanta Birah (2011) Cloning, Characterization
and Diversity of Coleopteran Active Bacillus thuringiensis
Native Isolates From Soils of Andaman and Nicobar Islands
(Editorially accepted BMC Research notes).
· R. Asokan, H.M.Mahadeva Swamy and D.K.Arora (2011)
Screening and partial sequence comparison of vegetative
insecticidal protein (vip3A) genes in the local isolates of
Bacillus thuringiensis Berliner (Editorially accepted BMC
Research notes).
Polyacrylamide gel electrophoretic pattern of total proteins of Sporulated Bt
AMAAS - Annual Report 2010-11
102
Theme: Microbial Genomic Resource Repository
Microbial Genomic Resource Repository
Rationale
Microbes play a critical role in natural biogeochemical cycles
and make up about 60% of the Earth's biomass, yet less than 1% of
microbial species have been identified. Microbes have been found
surviving and thriving in amazing diverse habitats, in extremes of
heat, cold, radiation, pressure, salinity, and acidity, often where
no other life forms could exist. There is a growing interest in the
preservation of DNA. Many research institute/universities all
over the world are carrying out microbiological and
biotechnological research, which results to generate lot of
genomic resources like cDNA libraries, gene constructs, cloned
gene sequences, promoter regions, transgenes etc. These are
valuable resources for gene discovery and transgenic product
development. Hence collection and maintenance of these
genomic resources at a central place would play a vital role in
bioscience research and education. Indian Council of Agricultural
Research has taken up an initiation to establish Microbial
Genomic Resource Repository at National Bureau of
Agriculturally Important Microorganisms (NBAIM), Mau Nath
Bhanjan. “Microbial Genomic Resource Repository” is a facility
that preserves and conserves the genetic material of
microorganisms, maintained in selected hosts or cloned and
maintained in plasmids, accompanying the data details. MGRR
has developed the guidelines for preservation, maintenance and
distribution of the DNA resources.
Objectives
· Nationwide Survey and Collection of Information about the
genetic resources/DNA.
· D e v e l o p m e n t o f l i n k a g e s b e t w e e n r e s e a r c h
institutions/Universities, and researchers.
· Technology and Protocols development for isolation and
long-term preservation of the Microbial Genetic Resources.
· T e c h n o l o g y a n d P r o t o c o l s d e v e l o p m e n t f o r
collection/transportation of microbial samples.
· Development of infrastructure facilities for the preservation
and maintenance of genetic recourses.
· Collection of environmental samples from different Agro
climatic Regions and exploration of non-culturable
microorganisms.
· Development of Databases/Information Bank for Microbial
Genomic Resources.
· Documentation and electronic cataloguing of Microbial
Genetic Resources.
· Exploration of non-culturable microorganisms and direct
PI : Dilip K. AroraCo PIs : Alok K. Srivastava, Sudheer Kumar, Mahesh Yandigeri, K. K. MeenaNational Bureau of Agriculturally Important Microorganisms, Mau
DNA isolations from environmental samples.
· Development and implementation of genome projects to
explore non-culturable microorganisms.
Significant Achievements
· In a short period of time MGRR has enriched its gene bank
with various vectors like cloning, gene silencing GFP, RFP,
YFP. These vectors are now available in MGRR gene bank.
Other than that, MGRR has a very rich microbial genomic
DNA bank, where around 1691 DNA of various bacteria and
fungi has been preserved at -20°C.
· For performing various research activities, MGRR has
equipped with state of art instrument like GSFLX Genome
Sequencer, Confocal Laser Microscope, Automatic culture
media preparatory, Robotic DNA Extractor, Gene Analyzer,
Pulse Field Gel Electrophoresis, Growth Kinetics Analyzer,
Gene Pulser, Barcoding System, Automated Electrophoresis,
Ultra Centrifuge, Thermal Cyclers.
Conclusion
In a short period of time, MGRR DNA bank has collected and
preserved a large number of microbial genomic resources. MGRR
will collaborate with various institutions working in this field for
collection and preservation of genomic resources. It will also
provide necessary research material for an active research study.
A database library of anonymous microbial information will be
built at MGRR which can provide clues for various research
investigations.
Seminar, Symposia and Conferences attended
· Sukumar Mesapogu, Achala Bakshi, Udai B. Singh, B. K.
Babu, Sangeeta Saxena and Dilip K. Arora. (2011). Genetic
markers in detection of variations among Indian isolates of thFusarium udum infecting Pigeonpea. 15 ADNAT
Convention CCMB, Hyderabad, February 23-25.
·
·
·
·
Singh RN, Srivastava AK, Arora DK (2011) Diversity of
psychrophiles of leh glaciers: a molecular approach, 4th
Congress of European Microbiologists Geneva, Switzerland
Singh RN, Srivastava AK, Arora DK (2011) Characterization
of Exiguobacterium isolated from permafrost of himalayan
glacier, 4th Congress of European Microbiologists Geneva,
Switzerland
Singh RN, Srivastava AK, Arora DK (2011) Analysis of
Khardoong La Soil Metagenome, 4th Congress of European
Microbiologists Geneva, Switzerland
Singh RN, Shahi P, Sharma A, Kaushik R, Srivastava AK, and
Arora D K (2010) Genome-wide prediction and comparison
103
AMAAS - Annual Report 2010-11
Theme: Microbial Genomic Resource Repository
of ncRNAs in Mesohizobium loti, Rhizobium leguminosarum
and Sinorhizobium meliloti, The Non-Coding Genome,
EMBL Advanced Training Centre, Heidelberg, Germany,
October 13-16, 2010
Singh RN, Singh RP, Srivastava AK, and Arora DK (2010)
CHUMATHANG: Unexplored habitat of novel
thermophiles, Association of Microbiologist of India, Ranchi,
December 14-17, 2010
·
· Mahesh Yandigiri, Sukumar Mesapogu, Arvind Yadav and
D. K. Arora. (2010). Microbial Culture Banks: Custodian of
Real Natural Wealth. National Conference on Biodiversity,
Development and Poverty Alleviation, Uttar Pradesh State
ndBiodiversity Board, India. 22 May, 2010.
· Achala Bakshi, Sukumar M and Dilip K. Arora. (2010). Soil
Microbial Community Analysis from Rhizospheric and
norhizospheric regions of different leguminous crops by
using Community-Level Physiological Profiling (CLPP).
International Conference on Genomic Sciences-Recent
Trends. Madurai Kamraj University, India.
· Sukumar. M and Dilip K. Arora (2009). Real Time SYBR
Green PCR for Rapid Detection and Quantification of
Fusarium udum by using Species specific Primers.
International Mycological Conference 2009 (IMC-09),
Edinburg, UK, 1-6 Aug 2010. Springer link.
Resource Type
Available Resources
Quantity
Plasmid
Binary, cloning, Gene silencing, GFP, RFP, YFP Expression 71
Genomic DNA
Bacteria and Fungi
1691
Primers and Probes Various gene sequences 92
Shot gun library clones Environmental samples 138 Whole genome shotgun library Mesorhizobium ciceri ca181 6720 Shotgun library Nif H 16 Host cells
DH5a, XL1
Blue, JM107, JM109, K12, TOP-10 F
6
Summary of available Genomic Resources at MGRR.
AMAAS - Annual Report 2010-11
104
Theme: Human Resource Development
Objective
· To train scientists/researchers/technicians/farmers for the
exploration and application of microorganism in agriculture.
Significant Achievements
In the year 2010-11 following training was organized:
· Metagenomics: Method and Applications in Microbiology from January 11-20, 2011.
Microorganisms are responsible for sustaining life on Earth
but how they do so is still poorly understood. The readily cultured
microorganisms represent only 0.1% to 1% of the total microbial
communities present in most habitats. Until the advent of
metagenomics tools, which allow the investigation of
microorganisms that cannot be cultured in the laboratory, we
were unable to study the entire genetic makeup from particular
environments, thereby losing a fruitful source of microbial
biodiversity and functional novelties. Within microbial
communities, the microbes harbor an excellent repertoire of novel
genes for biotechnological applications and represent a key step
for understanding evolution and to comprehend metabolic
pathways. The training provided invaluable opportunities to
discuss and accelerate the implementation of metagenomic
research, it included hands on training microbial ecology,
genomics, bioinformatics, community genomics and
environmental genomics. Metagenomics is a rapidly growing
field of research that has had a dramatic effect on the way we view
and study the microbial world. By permitting the direct
investigation of bacteria, viruses and fungi irrespective of their
culturability and taxonomic identities, metagenomics has
changed microbiological theory and methods and has also
challenged the classical concept of species. This new field of
PI :National Bureau of Agriculturally Important Microorganisms, Mau
Dilip K. Arora
biology has proven to be rich and comprehensive and is making
important contributions in many areas including ecology,
biodiversity, bioremediation and bioprospection of natural
products. Recent, rapid advances in sequencing technologies and
in culture-independent genomic analysis and other microbiology
techniques have established a solid foundation upon which to
build a unique interdisciplinary community for the emerging
scientific subfield of metagenomics. At the intersection of many
diverse disciplines, metagenomics is already beginning to engage
an ever growing and exceptionally wide intellectual community.
The major point discussed under the training were
§ Functional diversity of environmental samples of any
metagenome
§ Community based comparative profiling of metagenome
§ Undepining fundamental rules of microbial ecology
adapting to environmental conditions.
§ The training provided invaluable opportunities to discuss
and accelerate the implementation of metagenomic research,
including hands on training on microbial ecology, genomics,
bioinformatics, community genomics and environmental
genomics. Demos and/or tutorials on advances in next
generation sequencing and on knowledgebase resources was
also provided.
The training covered the bioinformatic approaches and tools under the following thematic areas:
· Microbial Diversity and Community analysis
· Designing of primers and validation
· Cloning, screening and restriction analysis of meta clones
· Molecular phylogeny
105
AMAAS - Annual Report 2010-11
Theme: Human Resource Development
· In silico restriction analysis
· Multiple sequence alignment
· Construction of phylogenetic tree
· Sequencing and sequence analysis
· Bioprospecting, allele mining and quantification of gene
· Annotation of genes
· Comparative genomics
Benefits to participants
· Participants acquire an insight of the culture-independent
Microbial genomic analysis and other molecular techniques,
innovative tools in microbial identification and genome
analysis
· Hands-on research experience and training and exposure to
cutting-edge research.
· Gained better understanding of the scientific process and the
application of the knowledge gained from basic science
research and state of the art techniques to solve complex
problems in microbial community analysis at molecular
level.
· Participants get an understanding of latest bioinformatics
tools.
AMAAS - Annual Report 2010-11
106
Name of the PIs working at different AMAAS Centers
Theme 1: Microbial Diversity and Identification
Dilip K. Arora
A. R. Alagawadi
D. Girija
L. C. Rai
T. K. Adhya
T. C. Santiago
Dinesh Kumar
R. C. Upadhyay
K. K. Pal
Gaurav Rathore
Kiran Singh
Rajesh Gera
V. K. Shahi
Ratul Saikia
B. N. Chakraborty
O. N. Tiwari
Ashok Kumar
Bhim Pratap Singh
Krishna Kumar
D. Radhakrishna
N. K. Maiti
S. K. Gosal
Imelda Joseph
R. D. Rai
Sri Prakash Mohanty
R. Srinivasan
Theme 2: Nutrient Management, PGPR, Antagonist, Biocontrol Agent and Disease Management
Dilip K. Arora
D. L. N. Rao
Suseelendra Desai
Pankaj Mishra
M. Anandraj
George V. Thomas
B. Ramanujam
Lata
T. K. Adhya
K. S. Subramanian
S. Gopalakrishnan
M. Lognathan
M. L. Jeeva
Mohan Singh
R. D. Prasad
Indu S. Sawant
K. K. Vijayan
Sanjib Kumar Manna
P. Thomas
Alok K. Srivastava
Sudheer Kumar
Theme 3: Microbial Management of Agro waste, Bioremediation, Microbes in Post Harvest and Processing
Dilip K. Arora
Lata
Rup Lal
B. Vijay
H. S. Oberoi
T. K. Adhya
C. S. Purushothaman
P. K. Joshi
S. Alavandi
Sudheer Singh
S. Gunasekaran
Neelima Garg
Theme 4: Microbial Management of Abiotic Stress
Dilip K. Arora
A. R. Alagawadi
Minakshi Grover
Pankaj Mishra
Mahesh Yandigeri
Theme 5: Microbial Genomics
Dilip K. Arora
Reeta Goel
Major Singh
K. V. Bhat
P. Gunasekharan
N. K. Singh
Radha Prasanna
Ramesh V. Sonti
R. Asokan
Theme 6: Microbial Genomics Resource Repository
Dilip K. Arora
Theme 7: Nodal Center
Dilip K. Arora
107
AMAAS - Annual Report 2010-11
Name of the Institute/ Project Directorate/ SAU Coordinating the Project
Theme 1: Microbial Diversity and Identification
Theme 2: Nutrient Management, PGPR and Biocontrol
1. Nat iona l Bureau o f Agr icu l tura l ly Important
Microorganisms, Mau
2. Department of Agricultural Microbiology, University of
Agricultural Sciences, Dharwad
3. Kerala Agricultural University, Thrissur, Kerala
4. Department of Botany, Banaras Hindu University, Varanasi
5. Central Rice Research Institute, Cuttack , Orissa
6. Central Institute of Brackish Water Aquaculture, Chennai
7. National Dairy Research Institute, Karnal
8. National Research Center for Mushroom, Solan, Himachal
Pradesh
9. National Research Centre for Groundnut, Junagadh,Gujarat
10. National Bureau of Fish Genetic Resources, Lucknow
11. Maulana Azad National Institute of Technology, Bhopal
12. Department of Microbiology, Chaudhary Charan Singh
Haryana Agricultural University, Hissar, Haryana
13. Govind Ballabh Pant University of Agriculture and
Techanology, Pantnagar, Uttarakhand
14. Rajendra Agricultural University, Pusa, Samatipur, Bihar
15. North East Institute of Science & Technology (CSIR), Jorhat,
Assam
16. Department of Botany, University of North Bengal, North
Bengal
17. Institute of Bioresources and Sustainable Development,
Imphal, Manipur
18. School of Biotechnology, Banaras Hindu University,
Varanasi
19. Mizoram University, Aizwal, Mizoram
20. Central Agricultural Research Institute, Port Blair, Andaman
& Nikobar
21. University of Agricultural Sciences, Gandhi Krishi Vignyan
Kendra, Bangalore
22. Central Institute of Freshwater Aquaculture, Bhubaneshwar
23. Punjab Agricultural University, Ludhiana
24. Central Marine Fisheries Research Institute, Ernakulam,
Kochi, Kerala
25. Division of Biochemistry, Indian Agricultural Research
Institute, New Delhi
26. Central Institute of Freshwater Aquaculture, Bhubaneshwar
27. College of Dairy & Food Science Technology, Maharana
Pratap University, Udaipur
1. Indian Institute of Soil Science, Nabi Bagh, Bhopal
2. Central Research Institute for Dryland Agriculture,
Hyderabad
3. Vivekananda Parvatiya Krishi Anusandhan Sansthan,
Almora
4. Indian Institute of Spice Research, Calicut, Kerala
5. Central Plantation Crops Research Institute, Kasaragod,
Kerala
6. Nat iona l Bureau o f Agr icu l tura l ly Important
Microorganisms, Mau
7. National Bureau of Agriculturally Important Insects,
Bangalore
8. Division of Microbiology, Indian Agricultural Research
Institute, New Delhi
9. Central Rice Research Institute, Cuttack, Orissa
10. Tamil Nadu Agricultural University, Coimbatore
11. International Crops Research Institute for the Semi-Arid
Tropics, Patancheru, Andhra Pradesh
12. Indian Institute of Vegetable Research, Varanasi
13. C e n t r a l T u b e r C r o p s R e s e a r c h I n s t i t u t e ,
Thiruvananthapuram
14. Indian Institute of Pulses Research, Kanpur
15. Directorate of Oilseeds Research, Rajendranagar,
Hyderabad
16. National Research Centre for Grapes, Pune, Maharashtra
17. Central Marine Fisheries Research Institute, Kerala
18. Central Inland Fisheries Research Institute, Barrackpore
19. Indian Institute of Horticulture Research, Bangalore
20. Central Plantation Crops Research Institute, Kasargod
1. Division of Microbiology, Indian Agricultural Research,
Institute, New Delhi
2. Nat iona l Bureau o f Agr icu l tura l ly Important
Microorganisms, Mau
3. Department of Zoology, University of Delhi, Delhi
4. National Research Center for Mushroom, Solan
5. Central Institute of Post Harvest Engineering and
Technology, Ludhiana
6. Central Rice Research Institute, Cuttack , Orissa
7. Central Institute of Fisheries Education, Mumbai
8. Central Soil Salinity Research Institute, Zarifa farm, Karnal
9. Central Institute of Brackishwater Aquaculture, Chennai
10. Indian Institute of Vegetable Research, Varanasi
11. Department of Agricultural Microbiology, Tamil Nadu
Agricultural University, Coimbatore
12. Central Institute for Subtropical Horticulture, Lucknow
Theme 3: Agrowaste management, Bioremediation and microbes in PHT
AMAAS - Annual Report 2010-11
108
Theme 4: Microbial Management of Abiotic Stress
Theme 5: Microbial Genomics
1. Nat iona l Bureau o f Agr icu l tura l ly Important
Microorganisms, Mau
2. Department of Agricultural Microbiology, University of
Agricultural Sciences, Dharwad
3. Central Research Institute for Dryland Agriculture,
Hyderabad
4. Vivekananda Parvatiya Krishi Anusandhan Sanstha,
Almora
1. Nat iona l Bureau o f Agr icu l tura l ly Important
Microorganisms, Mau
2. Department of Microbiology, Govind Ballabh Pant
University of Agriculture and Techanology, Pantnagar,
Uttarakhand
3. Indian Institute of Vegetable Research, Varanasi
4. National Research Center for DNA Fingerprinting, National
Bureau of Plant Genetic Resources, New Delhi
5. Madurai Kamaraj University, Madurai, Tamilnadu
6. National Research Center on Plant Biotechnology, Indian
Agricultural Research, Institute, New Delhi
7. Division of Microbiology, Indian Agricultural Research,
Institute, New Delhi
8. Centre for Cellular and Molecular Biology, Hyderabad
9. Indian Institute of Horticulture Research, Bangalore,
Karnataka
1. Nat iona l Bureau o f Agr icu l tura l ly Important
Microorganisms, Mau
1. Nat iona l Bureau o f Agr icu l tura l ly Important
Microorganisms, Mau
Theme 6: Human Resource Development
Theme 7: Microbial Genomics Resource Repository
109
AMAAS - Annual Report 2010-11