Research Communication

Hypoxia Regulates the Ferrous Iron Uptake and Reactive OxygenSpecies Level via Divalent Metal Transporter 1 (DMT1) Exon1B byHypoxia-Inducible Factor-1

Dan Wang1*, Li-Hong Wang1,2*, Yu Zhao1, Ya-Peng Lu1 and Li Zhu11Department of Biochemistry, Institute for Nautical Medicine, Nantong University, Nantong 226001,People’s Republic of China2Cancer Research Center, Xiamen University Medical College, Xiamen 361005, People’s Republic of China

Summary

Hypoxia has been shown to increase the expression of a vari-ety of proteins involved in iron homeostasis, including cerulo-plasmin, transferrin, and transferring receptor. Divalent metaltransporter 1 (DMT1) is a transmembrane protein that is im-portant in divalent metal ion transport, in particular iron.Although previous studies have provided that DMT1 exon1A isregulated by hypoxia, little is known about the relationshipbetween DMT1 exon1B and hypoxia. Hypoxia-inducible factor1 (HIF-1) is a transcription factor which is stabilized whenmammalian cells are subjected to hypoxia. In this study, wehave identified a functional hypoxia-response element (HRE) atposition of 2327 to 2323 (-ACGTG-) in DMT1 exon1B pro-moter using a combination of bioinformatics and biologicalapproaches. Both the total cellular iron and ferrous uptakeincreased after hypoxia, decreased after DMT1 RNA interfer-ence. Reactive oxygen species (ROS) were also changed by1iron responsive element (IRE) DMT1 exon1B overexpression.These findings implicated DMT1 exon1B was a target gene forHIF-1. Hypoxia might affect cellular iron uptake throughregulating the expression of DMT1. When iron was present inexcess, cells might be damaged by the ROS production. � 2010

IUBMB

IUBMB Life, 62(8): 629–636, 2010

Keywords divalent metal transporter 1; exon1B; hypoxia-inducible

factor-1a; hypoxia response element; iron uptake; reactive

oxygen species.

INTRODUCTION

In mammalian cells, exposure to a low-oxygen environment

triggers a hypoxic response pathway centered on the regulated

expression of the hypoxia-inducible transcription factor (HIF).

HIF-1 is a heterodimer composed of a and b subunits (1).

Under normoxia, HIF-1a is destabilized by a mechanism involv-

ing prolyl hydroxylation and targeted for proteasomal degrada-

tion (2). In hypoxia, prolyl hydroxylase activity is reduced and

the nonhydroxylated form of HIF-1a is stabilized. HIF-1a then

integrates to HIF-1b subunit to bind hypoxia-responsive ele-

ments (HREs) in target genes. Then HIF-1 activates transcrip-

tion of its target genes that allow for adaptation to hypoxia (3).

To date, there are more than 100 HIF-1 downstream genes iden-

tified with varying functions. Moreover, by using DNA micro-

arrays, it has recently been reported that more than 2% of all

human genes are regulated by HIF-1 in arterial endothelial cells,

directly or indirectly (4).

Iron is needed for several essential functions including cellu-

lar growth and survival. Iron is also potentially dangerous as a

catalyst of reactive oxygen species (ROS) production, so it is

toxic when present in excess (5). Cells have evolved a mecha-

nism to maintain iron homeostasis via iron transporter proteins.

The divalent metal transporter 1 (DMT1), also known as natural

resistance–associated macrophage protein 2 (Nramp2), is a pro-

tein recently shown to play a pivotal role in iron uptake from

both transferrin (Tf) and non-Tf sources in different anatomic

sites (6, 7). Ferrous iron is transported across the endosomal

membrane via DMT1 (8). There are two splice variants of

DMT1 (8). One form contains an iron responsive element (IRE)

in the 30-untranslated region of the mRNA capable of binding

iron response proteins (IRPs) resulting in the stabilization of the

mRNA. Accordingly, this form of DMT1 may be similar to the

transferrin receptor (TfR) in that it potentially can be regulated

by iron. The second mRNA form, lacking the IRE (2IRE), is

*The first two authors made the same contribution to this article.

Address correspondence to: Zhu Li, Department of Biochemistry,

Institute for Nautical Medicine, Nantong University, Nantong 226001,

People’s Republic of China. Tel: 86 139 6298 8532. Fax: 86 513

85051796. E-mail: zhulili65@yahoo.com

Received 5 May 2010; accepted 15 June 2010

ISSN 1521-6543 print/ISSN 1521-6551 online

DOI: 10.1002/iub.363

IUBMB Life, 62(8): 629–636, August 2010

presumably incapable of being regulated by iron, at least by an

IRE/iron response protein interaction (9). DMT1 gene also

has been reported to contain two different promoters with two

alternative exon1 (1A and 1B) (10).

Hypoxia inducible changes in the expression of different

isoforms of DMT1 are already described in PC12 cells. Lis

et al. concludes that expression of the 1A containing species of

DMT1 is increased in hypoxic treatment (11). The studies by

Mastrogiannaki et al. (12) and Shah et al. (13) demonstrate that

DMT1 exon1A is specifically regulated by HIF-2 but not by

HIF-1. Previous studies conducted by our work revealed a high

correlation between the expression of HIF-1a and DMT1 pro-

teins in HepG2 cells treated with chemical (CoCl2) or physical

hypoxia what led us to speculate that DMT1 might also be one

of the target genes of HIF-1 (14). Lee at al. suggested that there

are two motifs (CCAAAGTGCTGGG) that are similar to HIF-1

binding sites (HBS) in the 50 regulatory region of human DMT1

exon1B (between 2412 and 2570), because he thought that

they were similar to the HBS of EPO (15). However, these two

motifs (CCAAAGTGCTGGG) did not contain the core HRE

sequence (-A/GCGTG-). Lee did not show any other evidence

to demonstrate the sequences were HBS.

In this study, we searched for a potential element of the

DMT1 exon1B promoter responsible for transcriptional induc-

tion under hypoxia. We identified a functional HRE at position

2327 to 2323 of the DMT1 exon1B promoter, which is neces-

sary for stimulation of DMT1 gene by hypoxia. We also

demonstrated that total cellular iron levels increased by hypoxic

treatment and there was a remarkable increase of ferrous iron

uptake simultaneously. Meanwhile, our studies showed that

ROS level changed by transfected with DMT1 exon1B expres-

sion plasmid. These results verified our presumption that

hypoxia might affect cell iron homeostasis through regulating

the expression of DMT1 exon1B. Excess of iron uptake induc-

ing by DMT1 exon1B overexpression might lead to intensify

cell death through generated profuse free radical.

MATERIALS AND METHODS

Cell Culture and Hypoxic Induction

Human HepG2 hepatoma cells were cultured in Dulbecco’s

Modified Eagle’s Medium (GIBCO, Grand Island, NY) supple-

mented with 10% fetal bovine serum (GIBCO, Grand Island,

NY) at 378C in 5% CO2 atmospheric air incubator (Froma

Series II, Thermo). For hypoxic treatment, cell culture plates

were incubated in at 5% CO2 level with 1% O2 balanced with

N2 incubator (Model 7101FC-1, NAPCO, USA).

Computerized Search for Nuclear Factor-BindingSites in the DMT1 Promoter

The DNA sequences from the human DMT1 exon1B pro-

moter region were obtained from GeneBank (Accession

#AF064475). Potential nuclear factor-binding sites were found

using MatInspector software online.

Plasmid Constructs

The pIRESneo, pIRESneo-DMT1 isoform I (1IRE DMT1

exon1B), pIRESneo-DMT1 isoform I (2IRE DMT1 exon1B)

were kind gifts from Dr. Mitsuaki Tabuchi (Kawasaki Medical

School, Japan). Various lengths of DNA fragments were ampli-

fied from genomic DNA by polymerase chain reaction (PCR)

using the primers given in Table 1. The PCR products were

cloned into pGL3-Basic, pGL3-SV40 (Promega, Madiso, WI),

and pcDNA3.1 (Invitrogen, Carlsbad, CA). The first construct

(DMT1-prom) contained the promoter from 2386 to 150

including three putative HREs. The second construct (DMT1-

prom-HRE1) contains one putative HRE located from 2386 to

2216. The third construct (DMT1-prom-HRE2) contains two

putative HREs located from 2224 to 248. Site-directed

mutagenesis of the putative HRE in DMT1 exon1B promoter

(CAGTACCTAACGTGGCGCCA?CAGTACCTAAAATGGCG

CCA). The construction containing the site-directed mutagenesis

was referred to as DMT1-prom-HRE2mut. HIF-1a fragments

were amplified with the Phusion High Fidelity PCR Kit (Finn-

zymes) and subcloned into the pcDNA3.1 expression vector. All

the constructs were sequenced to confirm accuracy.

Transient Transfection and Luciferase Assay

One day before transfection, HepG2 cells were plated into 24-

well plates. The cells were grown to 90% confluence, and then

plasmid constructs were cotransfected with an internal control

vector pRL-TK (Promega, Madiso, WI) (100:1 ratio) to the cells

by Lipofectamine 2000 (Invitrogen, Carlsbad, CA). After differ-

Table 1

Primers used for cloning of all constructs

DMT1-prom(2386/150) sense TGGCCTGGCTACCCTTTAC

DMT1-prom(2386/150) anti-sense AGCTCCGCAACCACCTGA

DMT1-prom-HRE1(2386/2216) sense TGGCCTGGCTACCCTTTAC

DMT1-prom-HRE1(2386/2216) anti-sense AGTTGCTGCTTGCGTTGG

DMT1-prom-HRE2(2224/248) sense GCCAACGCAAGCAGCAAC

DMT1-prom-HRE2(2224/248) anti-sense GCAGCCGCACATCCCTATT

HIF-1a sense ATGGAGGGCGCCGGCGGCGAG

HIF-1a antisense GTTAACTTGATCCAAAGCTCTGAG

630 WANG ET AL.

ent treatments, the cells were subsequently harvested and then lu-

ciferase activity was quantitated (Synergy 2, BioTek, USA) using

Dual-Luciferase Reporter System (Promega, Madiso, WI).

siRNA

One day before transfection, HepG2 cells were plated into 6-

well plates. The cells were grown to 50% confluence and then

transfected with 100 nM of human DMT1-specific siRNA duplex

(Dharmacon, Thermo fisher Scientific, USA), using X-treme-

GENE siRNA transfection reagent (Roche, Mannheim, Germany).

Quantification of Iron Content by AtomicAbsorption Spectroscopy

The cells were washed twice with phosphate-buffered saline

and harvested. Aliquots of the lysate were heated in 1008Covernight and then used to quantify the total amount of iron by

atomic absorption spectroscopy.

Calcein Loading of the Ferrous Uptake Assay

The cells were loaded with calcein-AM according to a

method described previously (16). Briefly, the cells were

washed twice with medium, and then incubated with 0.125 lMcalcein-AM in serum-free medium for 10 min at 378C. Excesscalcein-AM on cell surface was removed by three washes with

Hank’s balanced salt solution (HBSS, pH 7.4). Before measure-

ments, 100 lL of calcein-loaded cell suspension and 2 mL

Hepes were added to a shade selection cuvette. The fluores-

cence was measured by Ultraviolet spectrophotometer

(Shimadzu RF-5301PC, Japan) with kex 5 485 nm and kem 5520 nm at 378C. After initial baseline of fluorescence intensity

was collected, ferrous ammonium sulfate (FAS; 40 lM, final

concentration) was added to the cuvette. The quenching of cal-

cein fluorescence was recorded in every 5 min for 30 min. The

fluorescence descent degree reflects the ferrous uptake of cells.

Data were normalized to the steady state (baseline) values of

fluorescence.

ROS Level Detection

Cells were incubated in 5 lM hydroethidine (dihydroethi-

dium; HE) or 25 lM 2,7-dichlorodihydrofluorescein (DCFH)

for 30 min at 378C. Then cells washed twice with phosphate-

buffered saline. The fluorescence was measured with kex 5520 nm and kem 5 610 nm for HE, kex 5 498 nm and kem 5522 nm for DCFH (Synergy 2, BioTek).

MTT Assay

The cell viability was assessed using a 3-(4,5-Dimethylthia-

zol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Briefly,

a total of 100 lL MTT (final concentration 0.5 mg/mL in 0.01

M pH 7.2 phosphate-buffered saline) was added to each well

and another 4 h of incubation at 378C. Then, the supernatant

was removed and 100 lL of dimethyl sulfoxide was added into

each well. Optical density was measured at the 570 nm wave-

length by the use of the ELX-800 microplate assay reader (Bio-

tek). The results were expressed as a percentage of absorbance

measured in control cells.

Statistical Analysis

The statistical analyses were performed using SPSS 10.0.

Data are presented as mean 6 SD. The difference between

means was determined by One-Way analysis of variance

followed by a Student-Newman-Keuls test for multiple com-

parisons. A probability value of *P \ 0.05 was taken to be

statistically significant.

RESULTS

Identification of Sequences Required forHypoxia-inducible Transcription From DMT1 Promoter

We focused our attention on detailed DMT1 exon1B pro-

moter analysis, being of particular interest the search for

putative HIF-binding sequences. We used the online data base

MatInspector (www.genomatix.de). An extensive analysis of 50-flanking region of DMT1 exon1B promoter sequence revealed

the presence of several putative consensus binding sites for vari-

ous transcription factors. Among all the putative response

sequences found in the DMT1 exon1B promoter region, HRE

was one of special interests on factors of the transcriptional

regulation of the gene (Fig. 1). A HRE that 100% homologous

to the consensus HIF binding site (-ACGTG-) was present. The

previously reported analysis of published HRE sequences are

50-R(A/G)CGTG-30 (3). We also found that DMT1 exon1B

promoter contains the other two putative HREs. The positions

of HRE sequences located in the DMT1 promoter were shown

(Tables 2 and 3). Spanning the region of DMT1 promoter

revealed interesting new potential hypoxia binding sites at

positions 2327 to 2323, 2175 to 2171, and 2143 to 2139

that seemed to be good candidates to contribute to the DMT1

stimulation by hypoxia.

Response of Nested Deletions in the 50-Flanking Regionof DMT1 Gene Promoter to Hypoxic Treatment

To delimit the promoter region mediating activation by

hypoxia for 6 h, different fragments of the DMT1 exon1B

promoter were generated and cloned into luciferase reporter

Figure 1. Analysis of DMT1 promoter region. One putative

HRE (-ACGTG-) is located in 2327 to 2323, the other two

putative HRE (-GCGTG-) are located in 2175 to 2171 and

2143 to 2139, respectively. All the sequence position are from

the start of transcription.

631HIF-1, DMT1 EXON1B, AND IRON UPTAKE

vector (Fig. 2A). HepG2 cells were transiently transfected with

these reporter constructs and pRL-TK vector to normalize trans-

fection efficiencies. As shown in Fig. 2B, luciferase activities

from cells transfected with construct pGL3-DMT1-prom treated

with hypoxia were comparable and significantly higher than

those transfected with pGL3-Basic. Thus, 3.11 6 0.53 fold

inductions were observed for pGL3-DMT1-prom construct after

hypoxia treatment. Similar result in Fig. 2C, 2.97 6 0.51-fold

inductions were obtained for pGL3-DMT1-prom-HRE1 con-

struct, after hypoxic treatment. We revealed that luciferase

activities of pGL3-DMT1-prom-HRE2 and pGL3-SV40 were

not significantly different.

To further determine whether the above putative HREs are

essential for DMT1 exon1B responsed to hypoxia, we inacti-

vated this HIF binding sequence by site-directed mutagenesis.

Mutation of HRE (CAGTACCTAACGTGGCGCCA?CAG-

TACCTAAAATGGCGCCA) reduced the induction of reporter

activity after stimulation with hypoxia from 3.15 6 0.37 fold to

1.07 6 0.06 fold (P < 0.01 vs. wt) (Fig. 2C).

To test whether exogenous HIF-1a overexpression could

cause the same stimulatory effects on DMT1 exon1B promoter

as those observed with hypoxia, HIF subunits expression vectors

Table 3

Positions of HIF-1-binding sites

Position HRE sequence

2327 � 2323 CCTAACGTGGCGC

2175 � 2171 CGCCGCGTGCCCC

2143 � 2139 CTCCGCGTGGGCG

Figure 2. DMT1 promoter sequences mediate transcriptional responses to hypoxia. A, The diagram shows the structures of the

pGL3 luciferase vectors containing various lengths of 50-flanking regions of the human DMT1 gene promoter. B–D, The cells were

transfected with different plasmids and incubated in normoxia or in hypoxia (1% O2) for 6 h. The pRL-TK vector was cotran-

siently transfected into HepG2 cells to normalize transfection efficiencies. **P\ 0.01 compared with the control.

Table 2

Sequences of HIF-1-binding sites

DMT1 genebank accession AF064475

50-GCTTGATTGT CAGTACCTAA CGTGGCGCCA

CGGCGAACTA GGGCAGGAAT-30

50-CCGGGTGCCC CAGGGGCCGC CGCGTGCCCC

AGGGGCCGCC GCATCCAGAC-30

50-TCCGCGTGGG CGGAGCCTAG GTCCCTGGTC

TGCGGCCACG CATCCCGGCC-30

632 WANG ET AL.

were assayed. DMT1 exon1B promoter constructs were cotrans-

fected with pcDNA3.1 or pcDNA-HIF-1a and pRL-TK vector

to normalize transfection efficiencies. The pcDNA-HIF-1aconstruct allows exogenous HIF-1a to express under normoxic

conditions. Cotransfection of pGL3-DMT1-prom-HRE1 with the

pcDNA-HIF-1a showed a 2.49 6 0.65 fold in luciferase activity

in contrast to the basic condition. On the other hand, no signifi-

cant additive stimulation was observed when HRE mutated

(Fig. 2D), indicating that the levels of exogenous HIF-1a are

sufficient for full stimulation when cells are expressing constitu-

tively active HIF-1a in normoxic condition.

Effect on Total Cellular Iron Levels by DMT1 Exon1B

To determine whether DMT1 exon1B could alter total cellu-

lar iron levels, HepG2 cells were transfected with two isoform

of DMT1 exon1B expression plasmids. Results in Fig. 3 dem-

onstrate that 1IRE DMT1 exon1B increased total cellular iron

levels significantly by approximately two-fold compared with

control. Meanwhile, 2IRE DMT1 exon1B might have no effect

on total iron uptake. Specific silencing of DMT1 in HepG2 cells

was documented by Western blot (unpublished data).

Effect on ROS Levels by DMT1 Exon1B

We have demonstrated that total iron level was increased

by DMT1 exon1B. As we know, iron has its properties of auto-

oxidation and free radical generation of active oxygen species

capable of attacking other biomolecules. Now many fluorescent

probes have been used for detecting for ROS (17). Here, we

used two fluorescent probes, hydroethidine (dihydroethidium;

HE) and 2,7-DCFH, to measure the ROS level. HE was chosen

to detect the superoxide anion (O�2 ). DCFH was used to detect

the hydrogen peroxide (H2O2) and hydroxyl radical (HO�).

There were no changes with HE fluorescent activities both in

1IRE DMT1 exon1B and –IRE DMT1 exon1B (Fig. 4A).

Results in Fig. 4B showed that 1IRE DMT1 increased DCFH

fluorescent activities. Meanwhile, 2IRE DMT1 exon1B might

have no such effect. Then, MTT assay was performed to deter-

mine the growth inhibition rate. As shown in Fig. 4C, 1IRE

DMT1 exon1B could inhibit the proliferation of the HepG2

cells, and 2IRE DMT1 exon1B could not reduce the growth of

the cells.

Effect on Cellular Iron Level by DMT1 Under Hypoxia

To define the role of DMT1 in regulating iron uptake of

cells under hypoxia, we used a siRNA approach to suppress

DMT1 expression using human DMT1-specific siRNA duplex

(Dharmacon). To control for nonspecific effects of the siRNA

transfection, siRNAcontrol nontargeting siRNA duplex were

used. There was a significant difference between siRNA DMT1

group and control group both under normoxia and hypoxia. The

results showed that DMT1 RNA interference might reverse the

increase of total iron content (Fig. 5A). To confirm that the

calcein fluorescence method provides a valid measure of the

ferrous uptake, a baseline signal was obtained from normal cells

and those with no ferrous added cells. This indicated that the

fluorescence was steady in the 30-min recording (Fig. 5B). We

assessed the effects of downregulating DMT1 protein expression

on ferrous uptake by HepG2 cells. The fluorescence of siDMT1

group decreased less than control group at the beginning of 15

min. The 2.71 6 0.23-fold fluorescence degression was

obtained for siDMT1 group at 30 min. The data indicated that

the less DMT1 expression by RNA interference might lead to

less ferrous iron uptake.

DISCUSSION

HIF-1 is a master regulator of oxygen homeostasis that plays

critical roles in a multitude of developmental and physiologic

processes. Several dozens of HIF-1 target genes have been iden-

tified to date that participate in responses to hypoxia (18).

The expression of a variety of proteins involved in iron

homeostasis, such as erythropoietin (19), ferritin, cerruloplas-

min, transferrin, and transferrin receptor, have been reported to

be induced during hypoxia (20). These changes are compensa-

tory to the low oxygen environment and presumably restore

metabolism toward normal or functionally acceptable homeo-

static conditions required for cell survival. DMT1, the principal

transport protein for iron and other transition metals, behaves in

an analogous fashion to these other essential components

involved in iron homeostasis. DMT1 expression is modified by

hypoxia in a compensatory manner presumably to help preserve

normal iron balance in vivo (11).

Figure 3. Effect on total cellular iron levels by DMT1 exon1B.

HepG2 cells were transfected with DMT1 exon1B expression

plasmids. The cells were washed twice with PBS and harvested,

counted, centrifuged. Aliquots of the lysate were heated in

100 8C and were quantified the total amount of iron by atomic

absorption spectroscopy. **P \ 0.01 compared with the

control.

633HIF-1, DMT1 EXON1B, AND IRON UPTAKE

Previous studies have provided an evidence of a high corre-

lation between the expression of HIF-1a and DMT1 proteins in

responding to CoCl2 or hypoxia in HepG2 cell (14). Sequence

analysis revealed the presence of several putative HREs in

human DMT1 exon1B promoter, which could explain the

described effect of hypoxia on the induction of DMT1 exon1B

gene. Luciferase activities from pGL3-DMT1-prom construct

showed that it contained functional HREs. Compared pGL3-

DMT1-prom-HRE1 with pGL3-DMT1-prom-HRE2, fold induc-

tion results show that promoter sequences site in 2175 to 2171

and 2143 to 2139 were negligible. These two putative HREs

(50-GCGTC-30) of the DMT1 promoter are not essential in the

hypoxic response. The putative HRE located at 2327 to 2323

may be relevant for physiological hypoxic response in the

DMT1 exon1B gene. To confirm unequivocally the importance

of HIF-1a, DMT1 exon1B gene expression was induced with

the use of the transactivating factors HIF-1a. Significant differ-ence in luciferase activities was observed when cotransfected

with pcDNA-HIF-1a in normoxic condition. Thus, results from

HepG2 cells indicate that the levels of exogenous HIF-1a are

sufficient for full stimulation when cells are expressing constitu-

tively active HIF-1a in normoxic condition. The mutation analy-

ses indicate that this HRE sequence is essential for the DMT1

hypoxic response.

Previous studies found that HIF-2a played a crucial role in

maintaining iron balance in the organism by directly regulating

the transcription of the gene encoding DMT1 exon1A, the prin-

cipal intestinal iron transporter. Specific deletion of HIF-2a led

to a decrease in serum and liver iron levels and a marked

decrease in liver hepcidin expression, indicating the involve-

ment of an induced systemic response to counteract the iron

deficiency (12, 13). Altogether, these results demonstrate that

Figure 4. Effect on ROS levels caused by DMT1 exon1B. HepG2 cells were transfected with different DMT1 exon1B express

plasmids for 48 h. A, The cells were incubated in DCFH-DA for 30 min at 378C. B Cells were incubated in HE for 30 min at

378C. Then cells were washed twice with PBS and were quantified the fluorescent activities. C The cell viability was assessed by

MTT assay. *P\ 0.05 compared with the control.

634 WANG ET AL.

both DMT1 exon1A and exon1B are hypoxia-inducible genes

that are stimulated through HIF factor interaction.

Our pervious data showed that when cells exposed to

hypoxia, 1IRE DMT1 protein expression increased and reached

peak at 6 h. –IRE DMT1 protein expression reached the highest

level at 6–12 h hypoxia (14). Both DMT1 exon1A and exon1B

were regulated by hypoxia. The function of human DMT1 dif-

ferent exons is the equivalent efficiency as metal ion transport-

ers (21). The content of total iron and ferrous influx under

hypoxia has been little reported. We showed in this article that

total and ferrous iron levels were significantly higher under

hypoxia or 1IRE DMT1 exon1B express in excess. However,

continued delivery of iron to cells can overwhelm the capacity

of ferritin to store and sequester the metal, inducing oxidative

injury to cells. Indeed, iron can act as a catalyst in the Fenton

reaction to potentiate oxygen and nitrogen toxicity by the gener-

ation of a wide range of free radical species, including hydroxyl

radicals, or the peroxynitrite anion, produced by the reaction

between NO and the superoxide anion (22). Hydroxyl radicals

are the most reactive free radical species known and have the

ability to react with a wide range of cellular constituents,

including aminoacid residues and purine and pyrimidine bases

of DNA, as well as attacking membrane lipids to initiate a free

radical chain reaction known as lipid peroxidation (22). The

data in our experiments also show that cells might be damaged

by the ROS production when iron was present in excess.

Several studies have reported that DMT1 functions as a trans-

porter for a variety of metals including manganese, cobalt,

copper, cadmium, nickel in addition to iron (23).

The fluorescence of siDMT1 group decreased less than

control group at the beginning of 20 min under normoxia. The

1.39 6 0.19-fold fluorescence degression was obtained for

siDMT1 group at 30 min under normoxia (data not shown).

Compared with our pervious results, ferrous influx had been

delayed when cells treated in normoxia. Besides, the fluorescent

degression fold was obviously higher under hypoxia than

normoxia. These experiments indicated that there is a significant

increase of iron content and ferrous influx in hypoxia. These

results suggested that hypoxic stimulation had an important

effect on cellular iron transport maybe principal through

regulating DMT1 expression. Thus, we supposed that hypoxia

might induce the rapid localization of DMT1 transported to the

plasma membrane (14). Subsequently, iron uptake occurred

through a pathway involving DMT1. The increasing of iron

content and ferrous influx displayed a sufficient consistent with

DMT1 protein expression under hypoxia. Such a rapid response

to hypoxia might allow cells to sequester sufficient iron to

maintain enzyme function and cellular survival during a

potentially extended period of low oxygen concentration. Our

favored explanation for the regulation of DMT1 during hypoxia

was increased iron uptake.

Several studies have reported that DMT1 functions as a

transporter for a variety of metals including iron, manganese,

cobalt, copper, cadmium, and nickel (24, 25). At present, it is

little known that whether the upregulation of DMT1 by hypoxia

has effect on cell uptake of these ions. If the answer is positive,

DMT1 may be more important and necessary for adaptation of

cellular metabolism under hypoxia.

In conclusion, we have performed a detailed analysis of the

DMT1 exon1B promoter demonstrating that oxygen-regulated

function depends on HIF-1-binding sites. Hypoxia increased

total and ferrous iron levels through DMT1. ROS changed

by 1IRE DMT1 exon1B overexpression might cause the

death of cells. Although iron is involved in multiple physio-

logical processes, the biological significance of enhanced

DMT1 expression for iron during hypoxia remains to be

determined.

Figure 5. Effects of hypoxia and downregulated DMT1 protein

expression on iron level. HepG2 cells were transfected with

siControl (nontargeting siRNA duplex) or siDMT1 (DMT1-

specific siRNA duplex). HepG2 cells were exposed in normoxia

or hypoxia for 6 h. A The HepG2 cells were washed twice with

PBS and harvested, and counted, centrifuged. Aliquots of the

lysate were heated in 1008C and were quantified the total

amount of iron by atomic absorption spectroscopy. B After the

initial baseline was collected, ferrous ammonium sulfate was

added into and incubated with cells. The quenching of calcein

fluorescence by iron was measured every 5 min for 30 min. The

data represent means 6 SD (% Baseline). *P \ 0.05 compared

with the control; **P\ 0.01 compared with the control.

635HIF-1, DMT1 EXON1B, AND IRON UPTAKE

ACKNOWLEDGEMENTS

This study was financially supported by the National Natural

Science Foundation of China (Grant No. 30770806 &

30971197), Postgraduate Project of Jiangsu Province (CX08S-

027Z), and Natural Science Fund of Nantong University (No.

09Z052). The plasmids of pIRESneo, pIRESneo-DMT1 isoform

I, and pIRESneo-DMT1 isoform II were kind gifts from

Dr. Mitsuaki Tabuchi (Kawasaki Medical School, Japan).

REFERENCES1. Wang, G. L., Jiang, B.-H., Rue, E. A., and Semenza, G. L. (1995)

Hypoxia-inducible factor 1 is a basic-helix-loop-helix-PAS heterodimer

regulated by cellular O2 tension. Proc. Natl. Acad. Sci. USA. 92, 5510–

5514.

2. Ratcliffe, P. J. (2002) From erythropoietin to oxygen: hypoxia-inducible

factor hydroxylases and the hypoxia signal pathway. Blood Purif. 20,

445–450.

3. Semenza, G. L. (1999) Regulation of mammalian O2 homeostasis by

hypoxia-inducible factor 1. Annu. Rev. Cell Dev. Biol. 15, 551–578.

4. Manalo, D. J., Rowan, A., Lavoie, T., Natarajan, L., Kelly, B. D., Ye,

S. Q., Garcia, J. G., and Semenza, G. L. (2005) Transcriptional regula-

tion of vascular endothelial cell responses to hypoxia by HIF-1. Blood.

105, 659–669.

5. Rouault, T. A., and Klausner, R. D. (1996) Iron-sulfur clusters as a

biosensors of oxidants and iron. TIBS. 21, 174–177.6. Andrews, N. C. (2000) Iron homeostasis: insights from genetics and

animal models. Nat. Rev. Genet. 1, 208–217.

7. Wessling-Resnick, M. (2000) Iron transport. Annu. Rev. Nutr. 20, 129–

151.

8. Fleming, M. D., Romano, M. A., Su, M. A., Garrick, L. M., Garrick,

M. D., Andrews, N. C. (1998) Nramp2 is mutated in the anemic

Belgrade (b) rat: evidence of a role for Nramp2 in endosomal iron

transport. Proc. Natl. Acad. Sci. USA. 95, 1148–1153.9. Hubert, N., and Hentze, M.W. (2002) Previously uncharacterized iso-

forms of divalent metal transporter (DMT)-1: implications for regulation

and cellular function. Proc. Natl. Acad. Sci. USA. 99, 2345–2350.10. Hubert, N., and Hentze, M.W. (2002) Previously uncharacterized iso-

forms of divalent metal transporter (DMT)-1: implications for regulation

and cellular function. PNAS. 99, 12345–12350.

11. Lis, A., Paradkar, P. N., Singleton, S., Kuo, H. C., Garrick, M. D., and

Roth, J. A. (2005) Hypoxia induces changes in expression of isoforms

of the divalent metal transporter (DMT1) in rat pheochromocytoma

(PC12) cells. Biochem. Pharmacol. 69, 1647–1655.

12. Mastrogiannaki, M., Matak P., Keith, B., Simon, M. C., Vaulont, S.,

and Peyssonnaux, C. (2009) HIF-2a, but not HIF-1a, promotes iron

absorption in mice. J. Clin. Invest. 119, 1159–1166.

13. Shah, Y. M., Matsubara, T., Ito, S., Yim, S. H., and Gonzalez, F. J.

(2009) Intestinal hypoxia-inducible transcription factors are essential for

iron absorption following iron deficiency. Cell Metab. 9, 152–164.

14. Li, Z., Lai, Z., Ya, K., Fang, D., Ho, Y. W., Lei, Y., and Ming, Q. Z.

(2008) Correlation between the expression of divalent metal transporter

1 and the content of hypoxia-inducible factor-1 in hypoxic HepG2 cells.

J. Cell Mol. Med. 12, 569–579.

15. Lee, P. L., Gelbart, T., West, C., Halloran, C., and Beutler, E. (1998)

The human Nramp2 gene: characterization of the gene structure, alter-

native splicing, promoter region and polymorphisms. Blood Cells Mol.

Dis. 24, 199–215.

16. Ci, W., Li, W., Ke, Y., Qian, Z. M., and Shen, X. (2003) Intracellular Ca21

regulates the cellular iron uptake in K562 cells. Cell Calcium. 33, 257–266.

17. Gomes, A., Fernandes, E., Lima, J. L. (2005) Fluorescence probes used

for detection of reactive oxygen species. J. Biochem. Biophys. Methods.

65, 45–80.

18. Semenza, G. L. (2000) HIF-1 and human disease: one highly involved

factor. Genes Dev. 14, 1983–1991.

19. Wang, G. L., and Semenza, G. L. (1993) Desferrioxamine induces

erythropoietin gene expression and hypoxia-inducible factor 1 DNA-

binding activity: implications for models of hypoxia signal transduction.

Blood. 82, 3610–3615.

20. Schneider, B. D., and Leibold, E. A. (2003) Effects of iron regulatory

protein regulation on iron homeostasis during hypoxia. Blood. 102,

3404–3411.

21. Mackenzie, B., Takanaga, H., Hubert, N., Rolfs, A., and Hediger, M. A.

(2007) Functional properties of multiple isoforms of human divalent

metal-ion transporter 1 (DMT1). Biochem. J. 403, 59–69.

22. Defrere, S., Lousse, J. C., Gonzalez-Ramos, R., Colette, S., Donnez, J., and

Van-Langendonckt, A. (2008) Potential involvement of iron in the patho-

genesis of peritoneal endometriosis.Mol. Hum. Reprod. 14, 377–385.23. Fleming, M. D., Trenor, C. C. III, Su, M. A., Foernzler, D., Beier, D. R.,

Dietrich, W. F., and Andrews, N. C. (1997) Microcytic anaemia mice have

a mutation in Nramp2, a candidate iron transporter gene. Nature Genet.

16, 383–386.

24. Fleming, M. D., Romano, M. A., Su, M. A., Garrick, L. M., Garrick,

M. D., and Andrews NC. (1998) Nramp2 is mutated in the anemic

Belgrade (b) rat: evidence of a role for Nramp2 in endosomal iron

transport. Proc. Natl. Acad. Sci. USA. 95, 1148–1153.

25. Gruenheid, S., Canonne-Hergaux, F., Gauthier, S., Hackam, D. J.,

Grinstein, S., and Gros, P. (1999) The iron transport protein NRAMP2

is an integral membrane glycoprotein that colocalizes with transferrin in

recycling endosomes. J. Exp. Med. 189, 831–841

636 WANG ET AL.