MolecularMicrobiology (1993) 10(5), 995-1011

Hydrophobic domains affect the collagen-bindingspecificity and surface polymerization as well as thevirulence potential of the YadA protein of Yersiniaenterocolitica

Anu Tamm,^^ Ann-Mari Tarkkanen,^ Timo K.Korhonen,^ Pentti Kuusela,^ Paavo Toivanen^ andMikael Skurnik^*' Department of f\Aedical Microbiology, Turku University,Turku, Finland.^Departments of General Microbiology and ̂ Bacteriologyand Immunology, University of Helsinki, Helsinki.Finland.

Summary

The YadA surface protein of enteropathogenicYersinia species contains two highly hydrophobicregions: one close to the amino terminal, and theother at the carboxy-terminal end of the YadApolypeptide. To study the role of these hydrophobicregions, we constructed 66 bp deletion mutants of theyadA genes of Yersinia enterocolitica serotype 0:3strain 6471/76 {YeO3) and of 0:8 strain 8081 (YeO8).The mutant proteins, YadAY8O3-A83-i04 a"d YadAYeos-\ao-iDi. lacked 22 amino acids from the amino-termi-nai hydrophobic region, formed fibrillae and wereexpressed on the ceii surface. Bacteria expressingthe mutated protein lost their auto-agglutinationpotential as well as their coiiagen-binding property.Binding to fibronectin and laminin was affected differ-ently in the YeO3 and the YeO8 constructs. The dele-tion did not influence YadA-mediated complementinhibition. Loss of the collagen-binding property wasassociated with loss of virulence in mice. We aisoconstructed a number of YadAyeoa deietion mutantslacking the hydrophobic carboxy-terminai end of theprotein. Deletions ranging from 19 to 79 amino acidsfrom the carboxy terminus affected polymerization ofthe YadA subunits, and aiso resulted in the loss of theYadA expression on the cell surface. This suggests

Received 14 December, 1992: revised and accepted 24 August, 1993.tPresent address: Abteilung fur Immunologie und Transfusionsmedizjn.Zentrum Inneie MedJzin und Dermatologie, 3000 Hannover. Germany.•For correspondence. Turku Centre (or Biotechnology. Biocity, PO Box123. 20521 Turku, Finland. Tel. (21) 63381; Fax (21) 6338000; E-mailMSKURNIK© F INABO.ABO.F I .

that the carboxy terminus of YadA is involved intransport of the protein to the bacterial outer surface.

Introduction

The pYV virulence plasmid of human pathogenic Yersiniapseudotuberoulosis and Yersinia enterocolitica speciesencodes an outer membrane protein YadA, previousiyknown as Vopi and P I . YadA forms a fibrilious matrixcovering the outer membrane of the bacteria (Kapperudetal., 1985; 1987), involved in the auto-agglutination phe-nomenon (Skurnik etal., 1984; Lachica etal., 1964, Balli-gand et al., 1985). The expression of YadA of Y. entero-cotitica and of Y. pseudotuberculosis is correlated withbacterial adherence to various collagen types (Emody etai. 1989; Schulze-Koops efa/.. 1992) as well as with bac-terial adhesion to epithelial cells (Bukholm ef ai, 1990;Heesemann etai. 1987; Rosqvist etai. 1990), to intesti-nal brush border vesicles and to mucus (Paerregaard efai, 1991). This protein has also been associated withbinding of bacteria to immobilized fibronectin (Tertti etal.,1992), and binding is stronger to cellular fibronectin thanto plasma fibronectin (Schulze-Koops et ai. 1993). Pilz efal. (1992) describe YadA as one of the factors involved inthe complement-activation pathway of the serum-resis-tance phenomenon observed in Y. enterocolitica. YadAinhibits complement activation by coating the bacteria!surface with factor H, thus inactivating the approachingC3b molecules (China ef al., 1993, M. Skurnik, A. Al-Hendy. and P. Toivanen. to be submitted). That YadAinfluences the virulence of YeO8 in mice has also beendetermined (N. Ismail, L. Pelliniemi, P, Toivanen, and M.Skurnik, to be submitted). A YadA-negative YeO8 strain,YeO8-116, was found to be less virulent than the wild-type strain but more virulent than the virulence plasmid-cured strain when the bacteria were adminstered eitherintraperitoneally or intragastrically.

YadA is expressed, when grown at 37^C, on / . entero-colitica and Y. pseudotuberculosis, but not on Yersiniapestis (Bblin et ai. 1984). Structurally, the YadA proteinforms polymers, despite the fact that the sequenceis devoid of cysteine residues. The subunits of this200-240 kDa polymer are 44-47 kDa in size (Skurnik ef

996 A. Tammetal.

al, 1984; Zaieska ef ai. 1985; Skumik and Wolf-Watz,1989). The yadA genes of the three pathogenic Yersiniaspecies, including those of V. enterocolitica serotypes0:3 and 0:8, have been sequenced (Skurnik and Wolf-Watz, 1989), and the hydrophobic and hydrophilic regionsof the deduced amino acid sequences are identified bycomputer-assisted analysis (Skurnik and Wolf-Watz,1989). The hydrophobic carboxy-terminus (the last 70amino acid residues) was proposed as a membrane-anchoring domain. In contrast, Michiels etai (1990) ana-lysed the hydrophobic moment of the deduced amino acidsequence of the YadAyeoa protein (altogether 455 aminoacid residues) and proposed that a segment at the aminoterminus (corresponding to residues 83-104) formed atypical membrane-associated structure.

We herein provide evidence that the amino-terminalhydrophobic region of YadA is critical for binding to colla-gens and for auto-agglutination, whereas the carboxy-terminal region affects the surface localization of YadA.Furthermore, we also show that adhesion to fibronectinand laminin, as well as the serum-resistance property ofYadA, are structurally separate from the collagen-bindingproperty.

Results

To investigate experimentally the roles of the hydrophobioregions of YadA we constructed several deletion variantsof the YadA protein.

Construction of YadAYeO3-A83-104the 22 amino acid deletion derivatives of YadA ofY. enterocolitica O:3 and 0:8 strains

Deletion mutants were constructed using specificallydesigned oligonucleotides and the polymerase chainreaction (PCR). Our goal was to delete the 22 amino acid-long stretoh, which has been suggested to be the mem-brane-associated domain of YadA (Michiels et ai, 1990),i.e. amino acids 83-104 of YadAyeos ^rid amino acids80-101 of YadAveoa (Skurnik and Wolf-Watz, 1989). Thedeleted amino acid sequences of the two serotypesdiffered only in one amino acid residue; the G85 inYadAYeO3 corresponds to Q82 in YadAyeos' The con-struction strategy of >'ac/>̂ YeO3-AB3-i04 's outlined in Fig, 1and is described in detail in the Experimental procedures.The plasmid carrying the yadA-y^03,^33-104 gene (285 bpupstream of the transcription start of the gene and 227 bpdownstream of the stop codon) was designated pATI.Deletion of the 66 bases was verified by sequencing overthe deleted region of pATI (data not shown). TheYadAYeo3a83-io4 protein was not expressed by pATI,since the yadA promoter is under the regulation of LcrF

(Skurnik and Toivanen, 1992). To achieve expression ofthe mutated yadA gene, both in Escherichia coli and in Y.enterocolitica, the /crFgene was cloned to pAT1. The pre-viously amplified 1.5 kb fragment containing the /crFgene(Skurnik and Toivanen. 1992) has BamHI restriction sitesat both ends. The cleaved and purified fragment wascloned into partially BamHI-digested pATI eluted fromthe low-melting-point agarose. Insertion of the 1.5 kb frag-ment into pATI was verified by restriction digestions. Oneof the plasmids containing the IcrF gene was designatedpYL8. The mutated YadA was expressed at 37°C bypYL8 both in Y. enterocolitica and E. coli (see Fig. 6 later).

To study the effect of the 22 amino acid-long deletionon the virulence of enteropathogenic / . enterocolitica, weused the mouse lethal serotype 0:8 strain 8081 (YeO8);the serotype 0:3 strains are not lethal to mice. Therefore.the mutation was also introduced, by PCR. into the yadAgene of YeO8. It was also transferred, using homologousrecombination, into the wild-type strain. In order to selectfor successful recombination events, we inserted thekanamycin-resistance (Km") GenBiock between the openreading frame (ORF) of the yadA gene and its transcrip-tion terminator. The construction strategy is outlined inFig. 2 and is described in detail in the Experimental proce-dures. The final 3.5 kb PCR product was cloned into thesuicide veotor pJM703.1, and the resulting Km^Amp"(kanamycin and ampioillin resistant) plasmid was desig-nated pYGI. Since YeOB is chromosomaily Amp", thepreviously PCR-amplified chloramphenicol-resistance(CIm") gene (M, Skurnik et al., to be submitted) wascloned into the Psfl site of the p-lactamase gene of pYGIresulting in plasmid pRYGI. The pRYG1 plasmid wasthen mobilized into YeO8, and Km"Clm® colonies wereselected to obtain recombinants that had lost the vectorsequences. Because of the strategy used, the recombina-tion upstream of the GenBiock could theoretically occur ateither side of the 66 bp deletion. As a matter of fact, bothtypes of recombinants were recovered. These were sub-jected to SDS-PAGE; the mutant YadAveos-ieo-ioi poly-mers with smaller size (180 kDa), as compared to thewild-type YadAyeoe (200 kDa). were detected (Fig. 3).The YadA proteins were expressed only when the bacte-ria were grown at 37"C. The Km*̂ virulence plasmid carry-ing the yad^̂ Yeos A80-101 ge'̂ ® ^^^ designated pYV082;and that with wild-type yad/̂ Yeoa. pYV085. The 66 bpdeleted region included a Psfl site in the yadA gene ofYeO8. Loss of the Psfl site was confirmed by digestion ofpYV082 (isolated from E coli C600/pYV082 to circum-vent the Yen\ restriction-modification system of Pst\ sitesIn YeO8) with Psfl, and further by hybridization of the blot-ted DNA with the yadA fragment (data not shown). Inser-tion of the GenBiock was confirmed by cleavage withC/al. since the fragment harbours a single restriction sitefor that enzyme (data not shown).

Hydrophobic domains of the Yersinia adhesin. YadA 997

69 905'-aCtcagtatgtcggaaactctc

3193 2113Cgcgcctgtatt«atcctaat-3'

3 ' -•cgcggacataatcaggatt«rf^_• ^ * G G

]:ia3-104. 22 aa dalntlon ]

K G A A V A V G A G S I A T G V N S V A I G . . . 949iccgctgaagcagcg oaaggagcagcagttgccgtggocBctggttca«t:tgcaacaggcgttaattctgtCgc««ttggt cctCtaagtaaggcaCCggfl•

3'-ccacgatgacgacttcotcgco-. -occttcaagtaago

B

Scale (kb)

D [ yad*

I I pYVOJ DNA

I I-12 I L JJL

istPCR, MS31 &MS32

pYV03 as template

2ndPCR,MS29&MS16pYV03 as template

3rdPCR, MS31 &MS16products of 1 st and2nd PCRastemplote

Final construct2096 bp

Fig. 1. Construction strategy of yad4yaO3-wi3-i04fraginentijsing PCR and specific deletion pniners. In the upper part ot the figure (A) are shown Iherelevant pails of the nudeotide sequences and the deleted amino add sequence. The indicated nudeotide positions are Irom the annotated sequence inthe databank under the accession number X13882. The YeO3 sequence is shown in lower case; and the PCR-generated novel sequences containing theSamHI restriction site, in upper case. In the lower part of the figure (B) the PCR strategy is outlined. The templates tor PCR reactions are shown as solidlines; the arrows indicate Ihe 5' to 3' direction. The primers used are shown as sequences in the upper part and as arrows in the lower part of the figure (notdrawn to scale). The yadA gene, its promoter, ORF and terminator, as well as some relevant restriction sites, are indicated in the Figure (see the Resuitsand the Experimentai procedures iot 6e\a\\s).

998 A. TammeXal.

K Q A A V X V G A G S I A T C 3 V N S V A I G . . . 695aaackagctacaottoctsitgaacgctggttcaattgcaacaggagtCaattctaCtacaattgaC ccCCCaagtaaggcaCtggg-

3•-ccacgatoacgacttcgccgcg-

1621 1660tatcattCagaaottaacaagtctatBogasaacaccgaC

3146 2166gttggcattacCtccctcgtg-3'

i•-caaccaCaataaagggagcaccf.

I MS 3 3 I

4345 ' -

-^pUC4F - Km GanBlocH [

4S4 1625

I- 5 • 5 • -

-Oac-3'

B0

USbp

Scale (kb)

pYvoeoei

1stPCR.MS32&MS34pYV8081 astemplata

2ndPCR, MS29&GBY-1pYVaoai as template

3rdPCR.GBY-2&MS3J

pUC4K DNA

4thPCR. MS34&GBY-1Products of 1 at and 2ndPCRas tomplato

5th PCR. in two steps:Step 1; Products of 3rd and 4th PCR andpUC4K-fragmant as template, run 2 cyclesStep 2: Add MS33 and MS34, run 25 cycles

Stap 1,1 st cycle

step 1. 2nd cycle

Step 2

Finol construct, 3528 bp

<*80-101

Hydrophobic domains of the Yersinia adhesin, YadA 999

Construct/on of the carboxy-terminal deletion mutants ofthe YadA ofY. enterocolitica 0:3

Computer analysis identified the carboxy-terminal end ofthe YadA protein as another hydrophobio area. To evalu-ate the possible role of this region as a functional compo-nent of YadA, different deletion mutants of the 3* end ofthe gene were cloned downstream the IPTG-inducibte tacpromoter of the vector plasmid pMMB207 (Morales etai,1991), enabling expression of YadA variants of differentlengths. A schematic presentation of the deletion deriva-tives is shown in Fig. 4A. Details of the construction of thedeletions are given in the Experimental procedures.Sequencing of the deletion regions of the resulting plas-mids pSS91. pEP34, pEE12 and pEB3 confirmed thedeletions (data not shown). From the sequencing data, itwas deduced that pSS91 codes for YadAYeos A377-»55plus seven pMMB207-specific amino acids fused to itscarboxy terminus; pEP34, for YadAYeO3-̂ 409-i55 plus 19pMMB207-specific amino acids; pEE12, for YadAYeO3-A413-455 plus 17 pMMB207-specific amino acids; andpEB3, for YadAYeO3.i437^55 plus 16 pMMB207-specificamino acids. The molecular masses for the YadA poly-peptides with carboxy-terminal deletions were estimatedfrom the sequence as 39.5 kDa for that coded by pSS91;44.7kDa, by pEP34; 44.4kDa. by pEE12; and 46.7 kDa.by pEB3. Likewise for pYL8. the plasmids were trans-formed into E. coli Si7-1 and thereafter mobilized intoYeO3-c.

Analysis of the deletion mutants

The YadAYeO3 deletion mutants expressed in Ye03-owere analysed by SDS-PAGE and immunoblotting ofwhole-cell proteins, using a monoclonal antibody, 2G12,specific for YadAYeO3 (M- Skurnik. Y. El Tahir, M. Saari-nen, S. Jalkanen. and P. Toivanen. submitted). Both thestained acrylamide gel and the immunoblot clearlyshowed the expected size difference between the wild-type YadAYeO3 and YadAYeo^ A83-IO4 proteins (Fig. 4. Band C). Interestingly, two polymeric forms of differentsizes were detectable in both the strains expressing thewild-type YadAYeO3' '6- strains carrying either pYV03 orpYMS4514 (Fig, 4, B and C): one of >200kDa andthe other of about 150 kDa. In the strain expressingYadAYeO3-Ae3-i04. only the 180-200 kDa polymer wasobserved; the smaller one was missing. The higherexpression of the yadA genes by pYMS4514 and pYL8,when compared to pYV03, was most probably caused by

1 2 3 4 5 6 7

200

4 6 -

21.5

14.3-

Flg. 3. Coomassie brilliant blue-siained SDS-polyacrylamide gel of thetotal proteins of Y. enterocolitica 0:8 sirains with virulence plasmidscoding for wild-type and mutated YadA. The YadA bands are indicated byarrows. Lane 1, rainbow markers (sizes in kDa), lane 2, YeO8 at 22 C;lane 3, YeO8 at 37"C: lane 4, YeO8/pVV085 at 22'C; lane 5,YeO8/pYV085 at 57'C\ lane 6, Y908/pYV082 at 22'C; lane 7,YeO8/pYV082at37'^C.

a copy number effect; pYMS4514 and pYL8 are based onthe pACYCi84 derivative pTMIOO. Expression of the>'ad/4YeO3-A83-i04 gene was temperature regulated inpYL8; and similarly to YadAYeO3̂ the mutated protein wasexpressed only when grown at 37"C (data not shown).Significantly, the YadA-specific monoclonal antibodydefected both the wild-type and the mutant proteins.

The expression levels of the oarboxy-terminal deletionmutants showed high variability, the Ye03-o/pSS91mutant produced significantly more protein than the othervariants (Fig.4C), The expression of mutated YadAmolecules by pEE12 and pEB3 was especially weak. Wecannot explain this phenomenon at present; probably thestability of the mRNA molecules varies. Plasmid pSS91produced mostly monomers of approximately 37-40 kDa,whereas relatively little of the polymeric 170-250 kDaforms was detected. It should be noted that under the sol-ubilization conditions used, the wild-type YadAYeos andYadAYBO3-.\83-i04 remained completely in the polymericform (Fig.4C). Plasmid pEP34 enabled the expression of

Fig. 2. Construction strategy of yad>lyeoe..,HD-io,-GenBlock fragment using PCR and specifically designed deletion and hybrid prcmers. The nucleotidepositions in the upper par! of the figure (A) are those of the sequences reported under accession numbers X13881 for yadA^^^. and X06404 for pUC4K.The YeO8 sequence is shown in lower case; the pUC4K. in upper case italics; and the PCR-generated novel sequences containing fcoRI restriction site, inupper case. Only relevant pans of the sequences are shown. Uppercase indicates the YeO3-specific nucleotides in primers MS-29 and fw1S-32. In the lowerpart o{ the figure (B) the PCR strategy is outlined (see also legend to Fig, 1).

1000 A. TammeXaS.

COOHPlasmid

pYMS4514

pYL8

pSS91

pEP34

pEE12

pEB3

100 200 300 400 aa

1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8 9

-200

-21.5

- 14.3

- 2 0 0

-97.4

- 6 9

-46

-21.5

-14.3

Fig. 4. SDS-PAGE and immunobloHing analysis of the YadAygoa protein deletion mutants.A- Schematic presentation of the deletion mutants. The hydrophobic regions of YadA are drawn in black and the hydrophilic regions hatched. The signalpeptide is stippled, as well as the pMMB207-derived fusion peptides preseni in the carboxy-terminal deletion mutants. The fusion peptides are KLGCFGGfor A377^55. GMQAWLFWRMfiEDFQPDTD for A409-455. GSSRVDLQACKLGCFGG for A413-455, and SSRVDLQACKLGCFGG for i437-455. Theplasmids carrying these constructs are stipulated at the nght.B. SDS-polyacrylamidegel.C. Immunoblot of Y. enferocoW/ca strains expressing different mutant YadA proteins. Lane 1. YeO3-c/pEB3; lane 2. YeO3-c/pEE12; lane 3, YeO3-c/pEP34;lane 4, YeO3-c/pSS91: lane 5, YeO3-c/pYL8; lane 6, YeO3-c/pYMS4514: lane 7, YeO3; lane 8, YeO3-c; lane 9, rainbow marker (sizes in kDa).

Hydrophobic domains of the Yersinia adhesin, YadA 1001

a 46 kDa monomer, while the polymeric forms were visu-alized only weakly on the immunobiot. The plasmidspEE12 and pEB3 coded for monomeric proteins of thesame size, 43 kDa. Interestingly, the mobility of thepEP34-YadA was less than expected considering its size.It is possible that the presence of a different fusion pep-tide in YadAYeO3-A409-455 (F'g-4A) affects the mobility ofthis construct in comparison with that of others havingvariants of the same peptide fused.

We were able to detect neither the wild-type nor any ofthe mutated YadA proteins in the growth medium of thebacteria (data not shown).

Localization of YadA in the mutants

To localize the different YadA variants, the bacterialstrains were stained by indirect immunofluorescence,using the YadAyeos-specific mAb 2G12. Fluorescencewas detected on the surface of the Y. enterocoiiticastrains harbouring the plasmids pYMS4514 and pYL8.The polymers of YadAyeoa A83-IO4 were thus accessibleto the monoclonal antibody, suggesting that theYadAYeO3-a63-i04 protein was, in fact, expressed on thebacterial surface. No fluorescence was detected on anyof the carboxy-terminal deletion mutants devoid of YadA(data not shown).

To further demonstrate that the carboxy-terminal dele-tion mutant YadA proteins were expressed, but werelocated either in the cytoplasm or in the periplasm, bacte-ria were dot-blotted onto duplicate nitrocellulose mem-branes. The blotted bacterial cells on one of the mem-branes were subjected to alkaline lysis, whereas the cellson the other membrane were left untreated. YadA wasvisualized on the membranes using the monocionaiantibody 2G12 followed by immunoperoxidase staining.On the untreated membrane, the bacterial strainscontaining the plasmids pYV03, pYMS4514 and pYL8were stained. On the alkaline-treated, immunoperoxidase-stained membrane. YadA was detected in all the carboxy-terminal mutants. Exceptionally, we did not detectYadAveos A83-104 on the alkaline-treated membrane (datanot shown).

Auto-agglutionation

Auto-agglutination is characteristic of YadA-expressingYersinia and E. coli strains. All of our deletion mutantslacked the ability to auto-agglutinate. This could havebeen caused by the loss of hydrophobic domains. Analternative explanation might have involved failure toexpress the mutated proteins on the bacterial surface(see above).

Binding to extracellular matrix components

YadA mediates bacterial adherence to various typesof collagen (Embdy et al., 1989; Schulze-Koops et al.,1992) as well as to fibronectin (Tertti et ai, 1992;Schulze-Koops et al., 1993). We assessed the E. coliC600 strains (expressing the wild-type YadAveos andYadAYeo3 .\83-io4) for adherence to various proteins of theextracellular matrix as well as to reconstituted basementmembrane immobilized on glass. To reveal possible dif-ferences in the affinity of YadA to the target proteins, theadhesion tests were performed by varying first the sur-face concentration of the target proteins and then by vary-ing the bacterial concentration. The E. coti strainC600/pYMS4514 adhered efficiently to type IV, type I,type HI and type V collagens, however, it did not adhereas efficiently to laminin (Fig. 5A). Adhesion to fibronectinwas poor but consistently above the background leveiseen with fetuin and bovine serum albumin (BSA)(Fig.5A). Strain C600/pYL8 did not adhere at all to thevarious collagens types, but did adhere to laminin(Fig. 5B). The plasmidless strain, E. co//C600, showed nosignificant adhesion to any of the target proteins (Fig. 5C).Adherence tests performed in the reverse fashion, i.e.with constant protein coating but with increasing bacterialconcentrations, revealed for all three strains binding pat-terns similar to those observed in the first test (data notshown).

Similar adhesion tests were also performed with E. coliPM191 derivatives carrying plasmids pYMSI, pYMS2,pYMS3, or pYfvIS4, which encode yadA cloned fromY. pestis, Y. pseudotuberculosis, YeO8 or YeO3, respec-tively (Skurnik and Wolf-Watz, 1989). Strain PM191/pYMS1 did not significantly adhere to any of the targetproteins, whereas strains PM191/pYMS2, PfVl191/pYMS3and PM191/pYMS4 exhibited adherence patterns closelyresembling those observed with E. co//C600/pYMS4514(data not shown). These results suggest that the adher-ence properties of the YadA originating from / . enterocoi-itica and Y. pseudotuberculosis are closely similar.

According to these data, YadA possesses separatebinding sites for collagens and for laminin. We, therefore,assessed glycoproteins for inhibition of the binding of '^^1-labelled type IV collagen to E. co//C800/pYfyiS4514. InFig, 6A the binding of radiolabelled type IV collagen to theE. coli strains is shown. An efficient and specific bindingto strain C600/pYMS4514 was evident. This binding wasefficiently inhibited by solubilized type IV and type III col-lagens but not by laminin or fibronectin (Fig. 6B).

Within the extracellular matrices, the glycoproteinsinteract to form macromotecular assemblages. To assesswhether YadA also recognizes extracellular matrixproteins in basement membranes, we tested adhesion ofthe YadA recombinants to the reconstituted basement

1002 A. Tamm etal.

800.

400..

. . $ • • • • '

lx 4x 64x 256x

B

800-

400-

lx 4x 16x 64x 256x

membrane Matrigel. The E. co//C600/pYMS4514 strainadhered efficieritly to Matrigel, whereas the C600 strainadhered only poorly (Fig. 7). Adhesiveness of the E. coliC600/pYL8 strain to Matrigel was demonstrable only atthe higher (5 x 108 mr^) cell density tested (Fig. 7).

The effect of the amino-terminal mutation was testedusing the YeO8 mutant strains, thus confirming the adhe-sive phenotypes of strains YeO8/pYV082 and YeO8/pYV085 {Fig. 8). The virulence plasmid-negative strainYeO8-c did not adhere to any of the test proteins(Fig.8A). On the other hand, strain YeO8/pYV085 washighly adhiesive to the various collagen types, lessadhesive ':o laminin and weakly adhesive to fibronectin(Fig.8B). The 22 amino acid-deletion derivative, YeO8/pYV082, lost its adhesive potential for collagens andlaminin, but it exhibited increased adhesiiveness forfibronectin (Fig. 8C). Only organisms of the YeO8/pYVa85strain adhered in significant numbers to Matrigel(Fig.8D).

Thus, deletion of the 22 amino acids caused a dramaticloss of YeO3- and YeO8-YadA binding to collagen. How-ever, the deletion had a different effect on thts binding ofYadA to laminin and fibronectin. It is noteworthy thatYfiO8/pYV082. used in the virulence tests as describedbelow, adhered to basement membranes (Matrigel) onlyvery poorly.

800.

400-

lx 4x 16x 64x

Relative surface concentration

Fig. 5. Adherence of E. co//C600/pYMS4514 (A), E. co//C600/pYL8 (B),and E. co/i C600 (C) to glass slides coated wilh increasing concentration!:ottypelcollagen(#—#), type III collagen { * • * ) , type IV collagen(O---O). type V collagen (Q—<)). laminin ( *—• ) , or fibronectin(••••••). The surface concentrations of the matrix proteins are presentedin relative values: lx concentration equals 0,02 pmol: 256xconcentration, 5.0 pmoi. Symbols • and D show bacterial adherence to50 ng ml"' of the control proteins fetuin and BSA, respectively. Thebacterial density was 10^ ml"'. The mean number of adherent bacteria in20 microscopic fields of 4.8 x 10^ fim^ is shown. Standard deviations areshown only for higher adhesion values.

Serum resistance

Serum resistance was assayed using 66.7% normal humanserum and EGTA-Mg-treated 66.7% human serum. Bothclassical and alternative complement pathway-mediatedkilling of bacteria are functional in normal serum, whileonly alternative pathway-mediated killing of bacteria ispreserved in EGTA-Mg-treated serum. The virulenceplasmid-cured YeO3-c strains (containing the plasmidspYMS4514 and pYL8) were pre-grown at 25"C and 37'°Cand then incubated with serum for 120 min. The internaldeletion of YadA did not affect the serum-resistance phe-nomenon, as both YeO3-c/pYMS4514 and YeO3-c/pYl.8,when grown at 37^0, were resistant to the classical path-way of complement-mediated killing (60% and 115% via-bilities, respectively), and sensitive when grown at 25°C(<0.1% viabilities). Both strains were resistant to alterna-tive pathway-mediated killing irrespective of growth tem-perature (data not shown).

Virulence

DBA/2 mice were used to measure the LD50 (the dose atwhich 50% die) of Y. enterocoiitica 0:8 strains (Table 1).Increasing doses of 8081 (wild-type strain), of YeO8-116{yadA null mutant), of YeO8/pYVa85 (wild-type YadA),

Hydrophobic domains of the Yersinia adhesin, YadA 1003

6 -

2 -

Bacteria per ml

6 -

4 -

2 -

B

i

•

0^

^^"^^^o

Fig. 6. A. Binding of '^^1-labelled type IV collagen

2.5 10

Inhibitor (pg/ml)

to E. CO/I C600/pYMS4514 ( • — • ) , E coiiC600/pYL8 ( O - O ) , and E co/i C600 { • - - • )are shown.B, Inhibition of the bmding lo E. coliC600/pYMS4514 (3 x 10^ cells mr ' ) bysolubilized type IV collagen { • ' • ) , type IIIcollagen (O—O). laminin ( *—*) , or fibronectin(O--O).

and of YeO8/pYV082 (internally deleted YadA) weredelivered by intragastric inoculation to mice. The LD50doses for mice, calculated from these data, were =10^ for8081 and YeO8/pYV085. The YadAy^os ..Bo-iorexpress-ing strain, YeO8/pYV082, did not kill mice at any givendose. The null mutant, YeO8-116, had decreased viru-lence, and it killed altogether three mice in this experi-ment. This is consistent with our earlier findings with thisstrain (N. Ismail etai, to be submitted).

Discussion '

In this work, we identified two regions of the YadA pro-teins of Vers/n/ae that determine the functional propertiesassociated with YadA. Sequencing of four yadA genes(Skurnik and Wolf-Watz, 1989) earlier on revealed thattheir sequence differences lie primarily in the hydrophilicparts of the proteins. The hydrophobic parts are quiteidentical. In this work, we initially expected the functionalproperties of YadA to be determined by its exposedhydrophobic areas; and, accordingly, we constructed sev-eral deletion derivatives of YadA. We showed that colla-gen binding of YadA depends on a 22 amino acid-longstretch. At present, we do not know whether these 22amino acids directly bind to collagen or whether the lossof binding results from conformational changes in themutated protein. Second, we demonstrated that loss ofthe collagen-binding abiiity is accompanied by loss of vir-ulence. This is an important result, since a number of bac-terial extracellular matrix-binding proteins have beendetected to date but, owing to a lack of specific mutants,their virulence functions have remained largely specula-tive (reviewed in Westerlund and Korhonen, 1993). Third,we showed that the deleted 22 amino acids are not

required for the insertion of YadA into the outer mem-brane. Rather, our evidence suggests that insertion intothe membrane is determined by the carboxy-terminalhydrophobic region. Finally, we showed that differentregions of YadA have different functions; regions mediat-ing binding to fibronectin and laminin, as well as serumresistance, are separate from regions mediating bindingto collagen.

Recent reports by Emody etai (1989), Schulze-Koopsetai (1992; 1993), and Tertti etal. (1992) have shownthat YadA of Y. enterocoiitica and Y. pseudotuberculosismediates bacterial attachment to collagen and tofibronectin. Our study extends these findings by showing

600 -

400 -

200 -

Bacteria per ml

Fig. 7. Adherence of E. co//C600/pYMS4514 ( • — • ) , E. coliC600(pYL8) (C—O), and E co//C600 ( • - • ) to the reconstitutedbasement membrane mouse Matrigel. Means and standard deviations ofbacteria in 20 randomly chosen microscopic fields of 4,8 x 10^ ̂ lm^ areshown.

1004 A. TammeXal.

lDOO

r

Fig. 8. Adherence of V. er^terocolitica 0:8 strainsto matrix proteins (A-C| and to immobilizedbasement membrane (D). Adherence of strainsYeOS-c (A). YeO8/pYV085 (B), andYeO8/pYV082 (C) to glass slides with a 2.5 pmolrelative surface concentration (see legend toFig. 5) of laminin (bar a), fibronectin (barb), type Icollagen (bare), type 1)1 collagen (bard), type IVcollagen (bar e). or type V collagen (bar f), as wellas to control slides coated aJ 25 ng ml"' withfetuin (bar g) or BSA (bar h). In (D) are shown theadherences of YeO8-c (bar 0. YeO8/pYV085 (barj). and YeO8/pYV082 (bar k) to reconstitutedbasement membrane (mouse Matrigel). Thebacterial density was 10^ ml"' in (A-C) and5x10^ in {D) and the area of the microscopic fieldwas 4.8 X 10^ fim^. The means and standarddeviations for 20 calculated fields are shown.

a h c d e f q ti a d c d c f g h i j 1:

that strains expressing YadA exhibit adhesiveness also tolaminin, a prominent gtycoprotein of mammalian base-ment membranes (Hay, 1991) (Figs 5A and 8). Adhesive-ness to laminin was exhibited by recombinants express-ing YeO3, YeO8. and Y. pseudotuberculosis YadAmolecules, indicating that it is a common feature of YadAvariants. The adhesion system we used allows us to drawconclusions about the relative affinity of YadA for theextracellular matrix proteins. YadA-expressing E. co//hada high affinity for collagens, with no major differencesbetween the collagen types tested in this study. Adhe-siveness to laminin was of a lower affinity; and adhesive-ness to plasma-derived fibronectin, even lower. Similarrelative affinity patterns were observed with E. coll recom-binants expressing yadA from Y. enterocoiitica 0:3 and0:8 and from Y. pseudotuberculosis. In contrast, E. coliharbouring yadA from Y. pestis failed, and significantlyso, to adhere to any of the test proteins. The Y. pestisyadA gene is unable to express YadA owing to a 1 bpdeletion early in the gene (Skurnik and Wolf-Watz, 1989).Thus, PM191/pYMS1, in fact, served as a control for thethree other constructs. Within the extracellular matrices,the collagen types, the laminin and the fibronectin eachparticipate in a variety of cellular and molecular interac-tions and form structural networks (Hay, 1991; Yamada,

1991). The finding herein that reconstituted basementmembrane from mouse sarcoma was recognized by E.coli C600/pYMS4514 and YeO8/pYV085 (Figs 7 and 8)indicates that type iV collagen and laminin are alsoaccessible to YadA-expressing bacteria in tissues. Mousesarcoma Matrigel contains mainly laminin and type IV col-lagen, tn vitro, and under physiological conditions,Matrigel forms gel-like structures resembling (in ultra-structure and biological activity) the lamina densa zone ofbasement membranes (Kleinman etai, 1986). The dele-tion derivative C600/pYL8 showed greatly reduced adhe-siveness to basement membranes (Fig. 7); this wasexpected, as the strain had lost the high-affinity binding totype iV collagen but still possessed the low-affinity bind-ing to laminin.

YadA exhibits a strikingly wide array of interactions withproteins of the extracellular matrix. Our results stronglysuggest that YadA molecules possess separate bindingsites for collagens and for laminin. The deletion deriva-tives E. coli C600/pYL8 and YeO8/pYV082 were com-pletely non-adhesive to the various collagen types, butadhered to laminin and/or fibronectin (Figs 5 and 8).Moreover, solubilized laminin did not inhibit binding ofsoluble ^^^l-labelled type IV collagen to E. coti C600/pYMS4514 in an assay where soluble type IV and type III

Table 1. Virulence of Y. enterocoiitica serotype0:8 strains 8081. YeO8-116. 8081 -c/pYV082 and8081-c/pYV085 in intragastrically infected DBA/2mice. Dose/mouse

0.7x10^0.7x10'0.7x10^0.7x10''0.7x10"

8081

4/4(7.7.11,12)2/4 (5,5)2/4 (5,20)3/4 (6,8,20)0/4

Deaths/Inoculated (Time of Death, Days)

8081-c/pYV085

4/4 (6,6,7,7)4/4(6,6,12,14)2/4(14,20)0/41/4(13)

YeO8-116

2/4(16,t6)0/41/4(12)0/40/4

YeO8/pYV082

0/40/40/40/40/4

Hydrophobic domains of the Yersinia adhesin, YadA 1005

collagens caused almost complete inhibition of the bind-ing (Fig. 6). These observations strongly support our con-tention that YadA is a multi-domain adhesive complexwith a high-affinity binding site for various collagens andlow-affinity binding sites for laminin and fibronectin. YadAthus resembles eukaryotic adhesion molecules vwhichcommonly possess numerous binding activities andrecognition domains (Hay, 1991; Yamada, 1991). A simi-lar multi-functional nature has been recently demon-strated for the filamentous haemagglutinin of Bordetellapertussis (Relman ef ai, 1990), the P fimbriae ofuropathogenic E. co//(Westerlund etai, 1991). and for theparacrystaiiine A-layer of the fish pathogen Aeromonassalmonicida(lrus\ etai, 1993).

The yadA gene from YeO3 and YeO8 conferred a simi-lar pattern of adhesiveness on their host cells; andalthough the 22 amino acid deletion completely abolishedthe collagen-binding capacity of both YadA recombinants,this deletion had a strikingly different effect on laminin andfibronectin binding by the YeO3 and the YeO8 YadA pro-teins. Strain C600/pYL8 adhered to laminin and weaklyadhered to fibronectin (Fig. 5). Strain YoO8/pYV082, incontrast, did not adhere to laminin but showed increasedadhesiveness to fibronectin (Fig. 8). At present, our expla-nations for such behaviour can be only speculative. Theamino acid sequences of the two YadA proteins arehighly similar but not identical (Skurnik and Wolf-Watz,1989). It is therefore possible that the regions involved infibronectin and laminin binding might differ slightly. Fur-ther, such differences might possibly explain the differentadhesion phenotypes of C600/pYL8 and YeO8/pYV082.On the other hand, an alternative consideration could bethat the mutations are expressed in different host bacteriaand, as a consequence, the YadA proteins on the cell sur-face might be expressed in a slightly different manner.However, it is our opinion that the different behaviour ofthe 22 amino acid deletions, with regard to laminin andfibronectin binding, does suggest that the binding sites forlaminin and fibronectin in VadA are not completely over-lapping.

We provide evidence that the amino-terminal hydro-phobic region of YadA is also responsible for the auto-agglutination phenomenon observed in the Yersinia spp.Both of the 22 amino acid-deletion mutant strains, YeO3-c/pYL8 and YeO8/pYV082, are auto-agglutination nega-tive. It may be speculated, that both the binding and auto-agglutination functions of this 22 amino acid-long stretchfoster bacterial colonization of the gut. High-affinity bindingto collagen might give bacteria a strong foothold in theintestinal tissue; clumping of bacteria might enable bacte-ria to form microcolonies, inside which bacteria would bephysically less susceptible to the host defence mecha-nisms. Consequently, the loss of collagen-binding capac-ity of the 22 amino acid-long deletion mutant was

reflected as loss of virulence. We have not yet been ableto decipher whether collagen binding constitutes the onlymajor virulence function of YadA. To make such a deter-mination, a mutant defective in mediating serum resis-tance but able to bind collagen, for example, should beconstructed. With such a construct, it would be possible toinvestigate whether YadA-mediated serum resistancemight also constitute a major virulence function of YadA.If, on the other hand, collagen binding is the major viru-lence function of YadA, that would explain why Y. pseu-dotuberculosis YadA-negative mutant strains are no lessvirulent than the parental wild-type strains (Rosqvist etai,1988), since Y. pseudotuberculosis has chromosomallyencoded collagen-binding factor(s) (Embdy et ai, 1989).It is interesting to note that the A-layer of A. salmonicida,which in structure and function resembles YadA, is alsoassociated with virulence (Trust ef ai, 1993). This sug-gests that adhesiveness to extracellular matrix proteinspromotes bacterial invasion and colonization in tissues.

Deletion of the 22 amino acid-long hydrophobic regiondid not affect polymerization of the protein. In fact, no signof either the smaller polymeric form or even the mono-meric form were detected in SDS-PAGE and immuno-blots from E. coli, or YeO3-c, carrying pYL8 (Fig. 4C). It isprobable that polymerization depends on other regions ofYadA. Alternatively, proper polymerization of the 22amino acid-long deletion mutant proved that the missingfunctional properties in the mutant were not caused by aninherent inability to polymerize, but instead were a resultof the deletion of the binding site or parts of it. One expla-nation for the presence of the smaller polymeric form ofwild-type YadA might simply be that it contains onemonomer less. Another, more intriguing explanationcould entail the presence of two conformational polymericvariants of the wild-type YadA, which would then migratedifferently in SDS-PAGE. Removal of the 22 amino acidsmight have eliminated the possibility of forming the fastermigrating variant. This remains to be elucidated in thefuture.

Concerning our carboxy-terminal delotants, we assumethat the highly hydrophobic carboxy terminus of the pro-tein is needed for appropriate transport of YadA throughthe inner and outer membranes, and also for appropriateanchoring of YadA onto the outer membrane, as sug-gested by Skurnik and Wolf-Watz (1989). In the carboxy-terminal deletion mutants, YadA was not detected in thegrowth medium; instead, the protein accumulated intra-cellularly or in the periplasm. None of the four carboxy-terminal deletion mutant proteins, not even YadAYeO3-.\437-.455 lacking only the last 19 amino acids, wasdetected on the surface of the bacteria. Thus, most of thecarboxy terminus seems to be essential for transport ofYadA. This finding is in accordance with the consensussequence identified for the last 10 amino acid residues.

1006 A. rammetal.

required for outer membrane incorporation, in a number

of outer membrane proteins (Bosch et al., 1989; Struyve

et al., 1991). The concensus contains hydrophobic

residues at positions 1 (F), 3, 5, 7 and 9 from the carboxy

terminus, having an aromatic amino acid, most often F, as

the last residue. The carboxy terminus of YadA

(...MYNASFNIEW; Skurnik and Wolf-Watz, 1989), fulfils

all the above criteria. Traces of the polymerized forms of

YadA were detected by immunoblotting in all of the

mutants, even in the longest deletion of 79 amino acids,

i.e. YadA missing the entire carboxy terminus. It seems

likely that the hydrophobic end of the protein is neces-

sary, but not sufficient for the formation of polymers. An

unanswered question remains: where does the polymer-

ization take place? Our hypothesis is, based on the detec-

tion of only traces of cytoplasmic polymers, that YadA

polymerizes while being anchored onto the membrane.

The carboxy termini of monomers can easily interact with

each other as they are being inserted in the membrane.

Such a mechanism could conceivably generate correctly

aligned monomers for efficient polymerization. The role of

the fusion peptides in the carboxy-terminal deletion

mutants on the properties of the proteins remains

unknown. There is, of course, a remote, but distinct, pos-

sibility that these 7-19 amino acid-long peptides them-

selves disturb the carboxy-terminal structure, and the

effects observed might be based on such a phenomenon.

Experimental procedures

Bacterial strains, plasmids and growth conditions

Bacterial strains and plasmids used in this study are listed inTable 2.

Y. enterocotitica and E coti strains were grown in Luria-Bertani (LB) medium (lOg bacto-tryptone, lOg yeast extract,5 g NaCI per litre). Unless othenwise indicated, the V. enteroco-litica strains were grown at 25"C; and E. coli strains at 37"C.For the induction of YadA, the strains were cultivated inMedECa (0.1 g of MgSO4x7H2O, 2g of citric acid, lOg ofK2HPO4, and 3.5g of NaNH4HPO4x4H2O per litre, supple-mented with 0.2% glucose, 0.2% Casamino acids. 1 mg vita-min B, per litre and 2.5 mM CaCl2; Skurnik, 1985) at 25"Covernight, diluted 1:5 in the same medium and grown for 4 h atSy^C. For strains harbouring the yadA gene cloned intopMMB207, 0.2 mM IPTG was added to the media to effectexpression of the tac promoter. For intragastric inoculation ofmice, the bacteria were grown overnight at 25^0 in brain-heartinfusion broth (BHI; Gibco Ltd.). Prior to inoculation, the bacte-ria were centrifuged, washed twice with phosphate-bufferedsaline (PBS, pH7.4) and suspended in PBS to approximately10^' bacteriamrV For LDso determinations, serial dilutions ofthis suspension were prepared. The number of bacteria wasestimated by the wet-weight of bacteria: 100mg of tightlypacked bacteria equals about I O " bacteria. The exact num-bers of bacteria were confirmed by the dilution-plating method.

Recombinant DNA methods

Plasmid DNA isolations, restriction enzyme digestions, DNAligations and transformations were performed as described byAusubel et al. (1987). All the clonings of Yersinia ONA werecarried out in the E. coti C600 background, transformed into E.co//SI 7-1 and mobilized into the Y. enterocolitica 0.3 p\asm\(i-free strain 6471/76-c (YeO3-c). For the construction of theYadAYe08-A8o-ioi Hiutant the pJM703.1-derivative plasmidswere maintained in E. coti Sy327 Xp,, background, and thentransformed into E co//strain SmiO X^,,. From there the plas-mid pRYG1 was mobilized into YeO8, where homologousrecombination between pRYG1 and pYV8081 was selected forby resistance of the colonies to kanamycin and sensitivity ofthe colonies to chloramphenicol.

upstream regionSequencing of the yadA Ye

The published 2285 bp sequence of YadAyeos (Skurnik andWolf-Waiz, 1989) was extended upstream of the promoterregion, with an additional 266 bases. The entire sequence isnow 2551 bp in length, and its annotated version in EMBL/Gen-Bank/DDBJ databank is under accession number X13882. Thenucleotide positions used in this article are in accordance withthe annotated sequence available in the databank.

DNA sequencing of deletions cloned into pMMB207

The deletions in the pMMB207 clones were confirmed bysequencing, using cycle sequencing with Taq polymerase(Adams and Blakesley, 1991). One microgram of templateDNA was subjected to each sequencing reaction of 30 cycles.The sequencing reactions were run, and the results processed,using the automatic sequencing system (BaseStation DNASequencer, Millipore). For this purpose, a pMMB207 sequence-specific, FITC-labelled primer pMMB-S (5'-FITC-ACTGC-CGCCAGGCAAATTCT-3') was synthesized in a PCR-Mate391 DNA Synthesizer (Applied Biosystems).

PCR

The oligonucleotide primers for PCR reactions were synthe-sized using the PCR-Mate synthesizer. Those primers shorterthan 30 nucleotides were synthesized in the TRITYL-OFFmode, and were extracted from the column using concentratedNH4OH. The protective groups were thereafter removed byovernight treatment with concentrated NH4OH at 55°C. Theprimers were dried in a vacuum centrifuge and solubilized inwater. The longer primers were synthesized in the TRITYL-ONmode and, after extraction from the column and removal of pro-tective groups as above, purified by passing over the OPCcolumns (Oligonucleotide Purification Cartridge. AppliedBiosystems). The FITC-labelled primer was purifed by passagethrough the NAP-10 column (Parmacia LKB Biotechnology).Amplifications were carried out in the Perkin Elmer Cetus ther-mal cycler. DNA was denaturated at 94''C. The annealing tem-perature was determined experimentally for every single pair ofprimers. The extension was performed at 72'C for 2 min for theamplification of short fragments, and for 10 min when thedesired DNA was more than 2 kb long.

Hydrophobic domains of the Yersinia adhesin, YadA 1007

Table 2. Bacterial strains and plasmids.Strain/Plasmid

Stfairi

Description

Y. enterocoiitica6471/766471/76-c80818081-C

E. coiiC600S17-1Sy327 Xpir

Sm10>4)ir

JM103

PM191

PlasmidspATIpEB3

pEE12

pEP34

pJM 703.1

PMMB207pRYGIpSS91pT302

pT302-SS9

pTMlOO

pUC4K

pYGI

pYL8pYMSI

pYMS2

pYMS3

pYMS4

PYMS4514

pYV03pVy8081pYV082pYV085

Serotype 0:3, pYV* patient isolate (YeO3)py \ r derivative o( 6471/76 (YeO3-c)Serotype O:8, pYV* (YeO8)pY\r derivative of 8081 {YeO8-c)

thi thr ieu tonA iacY supEthi pro hsdR~ hsdM' rec>l::RP4-2-Tc::Mii-Km::Tn7\(iac pro) argE (Am) rifnalA recA56 (Xpir)

thi thr ieu tonA iacYsupErecA::RP4-2-lc::Mu-Kru (Xpir)

&(iacpro) thistrA supEendA sbcB15hsdR4 FtraD36proAB iaqi^Z M15

recA

yadfAveoa-Aea-KM cloned into pTMlOONucleotides 1922-2551 deleted from yad/l of pT302,ctoned into pMMa207

Nucleotides 1854-2551 deleted from yad/* of pT302,cloned inio pMMB207

Nucieotides 1842-2551 deleted from yad/i\ of pT302,cloned into pMMB207

Suicide vector, contains R6K origin of replicationand RP4 Mob region: must be replicated in (kpii) hosts.

Mobilizable expression vectorca/-gene of pTMlOO cloned into pYGIyadA^eo-3 of pT302-SS9 cloned into pMMB207yad/Ayeos cloned info Mi3mp18

Nucieofides 1746-2551 deleted from yad>AYBO3 of pT302

Mobilizable vector, pACYC184-oW7"of RK2

Origin of the Km-GenBlock cassette

yad^YBOB-iBo-ioi-Km-GenBlock fragment clonedmto pJM703.1

icrPygo^ cloned into pATIyadA gene of Y. pestis 019 cloned into pBR322

yadA gene ot V. pseudotubercuiosis YPIII/plBIcloned into pBR322

yadAyeQQ cloned into pBR322

yadAyeoa cloned into pBR322

^crP^ieo^ and yadAiso^ cloned into pTMlOO

Virulence plasmid of 6471/76Virulence plasmid of 8081pYV8081:: Km-GenBlock yad,flye06-Aao-ioipYV8081::Km-GenB)ock

Source

Skurnik (1984)Skurnik {1984)Portnoy efa/. (1981)Portnoy efaf (1981)

Appleyard(1954)Simon etai. (1983)Miller and Mekalanos(1988)

Miller and Mekalanos(1988)

Messing efa/. (1981)

Meacock and Cohen(1980)

This workThis work

This work

This work

Miller and Mekalanos(1988)

Morales era/. (1991)This workThis workSkurnik and Woli-Watz

(1989)Skurnik and Wolf-Watz

(1989)Michieis and Cornells

(1991)Pharmacia-LKB, Uppsala,Sweden

This work

This workSkurnik and Wolf-Watz

(1989)Skurnik and Wolf-Watz

(1989)Skurnik and Wolf-Watz(1989)

Skurnik and Wolf-Watz(1989)

Skurnrk and Toivanen(1992)

Skurnik (1984)Portnoy e(a/. (198t)This workThis work

1008 A. Tamm etal.

Construction of 22 amino acid-long deletion mutants ofYadA

03- From the DNA sequence of thetwo 41 nucleotide-long complementary oligonucleotide primers,MS29 and MS32, were designed. These primers containedthe flanking sequences of the 66 bp to be deleted, i.e. thesequence of positions 843-863 and 930-949 of yad-Aveoalinked together (Fig.1). Two outer primers were constructedupstream of the promoter and downstream of the transcriptiontermination regions of the yadA gene, MS31 and MSI 6,respectively (Fig. 1). Both the outer primers were constructedwith the flanking SamHI restriction site in their 5' ends.

Construction of the deletion mutant is shown In Fig. 1, In thefirst two PCR amplifications. pYV03, the virulence plasmid ofY. enterocotitica O:3, was used as a template for the primerpairs MS31-MS32 and MS29-MS16, resulting in two yadA-specific fragments with the expected sizes of 0.8 and 1.3 kb,respectively. A 2 ^1 volume of both the previous reaction prod-ucts was directly used as the target in the third PCR reaction, inwhich only tfie outer primers, MS31 and MS16 were included(Fig. 1). The resulting 2.1 kb fragment was first treated with pro-teinase K and purified by elution from low-melting-pointagarose. After SamHI digestion and phenol treatment, the2.1 kb fragment was ligated into SamHI-digested pTMlOO, amobilizable derivative of pACYC184. The resulting plasmidwas designated pATl.

YadAy^oe._iao-,oi- The same principle of PCR amplificationas was used in the case of YadAveos was applied for the con-struction of the mutation in YeO8 (Fig. 2). The YeO3-specificprimers, MS29 and MS32, were also used with YeO8, despitea one nucleotide difference between the seqences of yadA^eo^and yad/Aveos- Usage of the oligos in YeO8-PCR resulted inthe substitution of the 75th amino acid residue serine inYadAveOB with threonine. Primer MS34, identical to MS31except for the EcoRI site instead of the SamHI site in the 5' endof the primer, was used as the outer primer upstream of thepromoter region. Since we wanted to introduce the mutationinto the wild-type pYVyeoa with homologous recombination, thekanamycin-resistance GenBlock of the plasmid pUC4K wasinserted between the end of the ORF and the transcription ter-mination region of the yadA gene. This allowed for selection ofthe mutant phenotype later on. To accomplish this with PCR,recombinant primers GBY-1 and GBY-2 were constructed, asshown in Fig. 2. Both contained 20 nucleotides of yad>^-specificsequence downstream of the gene's translation stop codon inthe 3' side, and 21 nucleotides of the GenBlock sequence inthe 5' side of the oligo. Lastly, a primer MS33 downstream ofthe terminator region of yad^^veoe. with an additional EcoRI siteat the 5' end, was synthesized.

Construction of the yad>^Yeo8-A8o-ioi-GenBlock fragment isoutlined in Fig. 2. In the three first-phase PCR reactions, threeprimer pairs. MS34-MS32, MS29-GBY-1 and GBY-2-MS33,were used for the amplification of the yad/A-specific DNA of thevirulence plasmid pYV8081 of Y. enterocolitica 8081. Thisresulted in three fragments of sizes 0.8 kb, 1 kb and 0.5 kb,respectively. The second phase involved the direct amplifica-tion of 2 |jl of the 0.8 kb and 1 kb PCR products with the primersMS34 and GBY-1. resulting in a 1.8 kb fragment that harbouredthe desired deletion. The 1.8 kb and 0.5 kb PCR fragments,together with the Psfl-cleaved 1.2 kb long GenBlock DNA,

were subjected to the third-phase PCR reaction, at first withoutany added primers. The outermost primers MS34 and MS33were then added to the reaction mixture after two cycles ofamplification. The PCR product, of the anticipated 3.5 kb size,was cloned into the EcoRI-digesied suicide vector, pJM703.1,and the resulting Km^Amp" plasmid was designated pYG1.

Construction of the carboxy-terminal deietion mutants of

Construction of the deletion derivatives was based on pT302, aM13mp18-based plasmid, containing the yadA gene in a2107bp Cla\-Sph\ fragment (Skurnik and Wolf-Watz, 1989).One of the deletion derivatives used, pT302-SS9, had beencreated earlier for sequencing purposes by exonuclease IIItreatment of Sphl-Sfy I-cleaved pT302, followed by blunt-endligation. The sequence of pT302-SS9 revealed that the yadA-specific DNA beyond position 1745 was deleted. At the aminoacid level, the last 79 amino acids (amino acids 377-455; i.e.the entire hydrophobic carboxy terminus) were deleted. Theyac//AYeO3-A377-455 g^ne was cloned, in a SamHI-Hf'ndlll frag-ment, into pMMB207 to obtain plasmid pSS91. The yadAy^osgene had single restriction sites for Psfl, EcoRV and Bgl\ atpositions 1841, 1854 and 1926, respectively. The EcoRI-PsflyadA fragment of pT302 was cloned into EcoRl-Ps/l-digestedPMMB207 to obtain pEP34. The EcoRI-EcoRV and EcoRI-Bgt\ yadA fragments, the latter fragment treated witfi SI nucie-ase, were cloned into SamHI-Smal-digested pMMB207 toobtain plasmids pEE12 and pEB3.

SDS-PAGE and immunoblotting

SDS-PAGE and immunoblotting were carried out using stan-dard methods (Ausubel et at., 1987). Whole cells of the bacte-rial strains were centrifuged, and the pellet was resuspensed inSDS-PAGE buffer and incubated at 25°C for 2 h. The acryla-mide concentrations were 4% in the stacking gel and 10% in theseparation gel. The Rainbow^'^ protein molecular weight mark-ers (Amersfiam) were used as size standards. For immuno-blotting, the bands were transferred onto supported nitrocellu-lose membrane (BAS85, Schleicher & Schuell), using thesemi-dry blotting device (Milliblot-SDE system, Millipore). Asthe primary probing antibody, YadAyeoa^specific mouse mAb2G12 (M. Skurnik et at., submitted.) was used at a 1:5 dilutionin 2% BSA-PBS of the tissue culture supernatant. As thesecondary antibody, rabbit peroxidase-conjugated immuno-globulins against mouse immunoglobulins (P260, Dakopatts)were used at a 1:200 dilution in 2% BSA-PBS. The bound per-oxidase was visualized with 4-chloro-l-naphtole as substrate.

Immunodetection of the expression of YadA

For detection of YadA on the bacterial surface, the indirectimmunofluorescence technique was used. Bacteria werewashed in PBS, incubated with anti-YadA mAb 2G12, diluted1:5 in PBS at room temperature. After washings, FITC-conju-gafed anti-mouse immunoglobulins (Sigma) at a 1:200 dilutionin 2% BSA-PBS were used for the detection of bound mAbs.The reaction was visualized under a fluorescent microscope.

Hydrophobic domains of the Yersinia adhesin, YadA 1009

The growth suspension containing about 10 bacteria wasblotted onto the nitrocellulose membrane (BAS85, Schleicher& Schuell), using a dot blot apparatus. The filters used to detectthe presence of YadA on the bacterial cell surface were dried ina vacuum oven. Bacteria on duplicate filters were lysed byalkaline treatment, as previously described (Kennett et at.,1985). The lytic process allowed the demonstration of bothextracellular and intracellular expression of YadA. Immunode-tection of YadA, using 2G12 at a 1:5 dilution, was carried out asdescribed by Kennett etal. (1985).

Auto-agglutination test

The Y. enterocotitica and £. coli cells were grown in MedECaovernight at room temperature. The cultures were diluted 1:10in MedECa and grown for an additional 4 h at 37 C. For strainsharbouring the pMMB207 constructs, 0.2 mM IPTG was added.Autoagglutination was observed as ciearance of the mediumas the bacteria formed aggregates.

Adhesion tests

Bacterial adhesion to proteins immobilized on glass slides wastested by the method described by Westertund et al. (1989b),Bacteria were tested at concentrations of 10' to 5x 10^ cellsm\~\ and the incubation time was 3h. Conditions for quantita-tive coating of the glass slides with the glycoproteins wereavailable from previous work (Westerlund et at., 1989a).Human plasnna fibronectin was purified as described by Vuentoand Vaheri (1979); the other test proteins were obtained fromSigma Chemicals. Following incubation and subsequent wash-ing of the slides, the adherent bacteria were stained withmethyiene blue, and randomly chosen fields were pho-tographed, using light microscopy and the TP-2560 videoprinter system (Toyo Corporation), The number of bacteria in20 fields, each of 4 8x10^jim^, were calculated. Bacterialadherence to reconstituted basement membrane was testedusing Basement Membrane Matrigel (Collaborative ResearchInc) diluted 1:50 in ice-cold PBS. Two-hundred-and-fiftymicrolitres of the suspension was pipetted onto a chamberglass slide at 4"C and allowed to gel in a chamber for 2.5 h at37 C. The slides were then quenched at room temperature for1 h with PBS containing 2% BSA and used in the adhesionassay as above, with two exceptions: 300|jl of bacterial sus-pensions were used and the adherent bacteria were notstained with methyiene blue.

The method for testing the binding of radiolabelled type !Vcollagen to bacteria was as described by Westerlund ef al.(1989a). Type IV collagen was labelled with '^^1, using thelodogen procedure (Markwell and Fox, 1978; Pierce Chemi-cals Co.). The specific activity measured was about " 'protein.

Serum resistance analysis

The methods for the preparation of human serum and forthe analysis of serum resistance by classical and alternativecomplement activation pathways will be described in detailelsewhere (M. Skurnik et al.. to be submitted). Briefly, serum

resistance was assayed as viability of bacteria after incubationin 66.7% human serum for 120 min. Untreated serum was usedto evaluate the total serum killing capacity, i.e. action of boththe classical and alternative pathways; and EGTA-Mg-treatedserum, the alternative pathway-mediated killing. Maximum(100%) viability was defined as the number of bacteria recov-ered from heat- inactivated serum.

Virulence experiments

For virulence testing, groups of four 8-10-week-old femaleDBA/2 mice were infected with different doses of the bacterialpreparations. Serial dilutions of bacteria grown at room temper-ature were delivered, using intragastric tubing. The bacterialdoses were determined by the dilution-plating method. Themice had free access to water and food before and after inocu-lation. All mice were observed for a period of 4-5 weeks, andLD50 values were determined as described earlier (Reed andMuench1938).

Acknowledgements

This study was supported by the Sigrid Jus6lius Foundationand by the Academy of Finland. We are grateful to Ms ReijaVenho for excellent technical assistance. The language of thismanuscript was revised by Jeri L, Hill, Ph.D

References

Adams, S.M., and Blakesley, R. (1991) Linear amplificationDNA sequencing. Focus 13: 56-58,

Appleyard, R.K- (1954) Segregation of new lysogenic typesduring growth of doubly lysogenic strain derived fromEscherichia coli K:2. Genef/cs 39: 440-452.

Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D,D., Seid-man, J.G.. Smith, J.A., and Struhl, K, (1987) Current Proto-cots in Molecular Biotogy. New York: John Wiley & Sons.

Balligand, G., Laroche, Y., and Cornelis, G. (1985) Geneticanalysis of a virulence plasmid from a serogroup 9 Yersiniaenterocolitica strain: role of outer membrane protein PI inresistance to human serum and autoagglutination. Infect/mmun 48: 762-786.

Bblin, I,, and Wolf-Watz, H. (1984) Molecular cloning of thetemperature-inducible outer membrane protein 1 of Yersiniapseudotubercutosis. Infect tmmun A3: 72-78.

Bosch, D,, Scholten, M., Verhagen, C, and Tommassen, J.(1989) The role of the carboxy-terminal membrane-spanningfragment in the biogenesis of Escherichia coti K12 outermembrane protein PhoE. Mot Gen Gene( 216:144-148.

Bukholm, G,, Kapperud, G., and Skurnik, M. (1990) Geneticevidence that the yopA gene-encoded Yersinia outer mem-brane protein Yopl mediates inhibition of the anti-invasiveeffect of interferon, tnfect Immun 58: 2245-2251.

China, B,,Sory,M.-P,. N'Guyen, BT.,de Bruyere, M , and Cor-nelis, G.R, (1993) Role of the YadA protein in prevention ofopsoni2ation of Yersinia enterocolitica by C3b molecules,tnfect Immun 61: 3129-3136.

Emody, L., Heesemann, J., Wolf-Watz, H., Skurnik, M., Kappe-rud, G., OToole, P., and Wadstrom, T. (1989) Binding to coi-lagen by Yersinia enterocolitica and Yersinia pseudotutyer-culosis evidence of yopA-mediated and chromosomallyencoded mechanisms. Infect Immun 171: 6674-6679.

1010 A. Tammetal.

Hay, E.D. (1991) Cell Biology of Extracellular Matrix. NewYork: Plenum Press.

Heesemann, J., and GrCiter, L. (1987) Genetic evidence thatthe outer membrane protein YOP1 of Yersinia enterocoliticamediates adherence and phagocytosis resistance to humanepithelial cells. FEMS Microbiol Left 40: 3 7 ^ 1 .

Kapperud, G., Namork, E., and Skarpeid, H.-J. (1985) Temper-ature-inducible surface fibriliae associated with the virulenceplasmid of Yersinia enterocotitica and Yersinia pseudotuber-culosis. Infect Immun 47: 561-566.

Kapperud, G., Namork, E., Skurnik, M., and Nesbakken, T.(1987) Plasmid-mediated surface fibrillae of Yersinia pseu-dotuberculosis and Yersinia enterocoiitica: relationship tothe outer membrane protein Y0P1 and possible importancefor pathogenesis. Infect Immun 55: 2247-2254.

Kennett, R.H., Leunk, R., Meyer, B., and Silenzio, V. (1985)Detection of E. co//colonies expressing the v-s/s oncogeneproduct with monoclonal antibodies made against syntheticpeptide. J/mmuno//Wef/7 85:169-182.

Kleinman, H.K., McGarvey, M.L., Hassel, J.R., Star, V.L., Can-non, F.B., Laurie G.W., and Martin, G.R. (1986) Basementmembrane complexes with biological activity. Biochemistry25:312-318.

Lachica, R.V., Zink, D.L., and Ferris, W.R. (1984) Associationof fibril structure formation with cell surface properties ofYersinia enterocolitica. Infect Immun 46: 272-275.

Markwell, M.A.K., and Fox, C.F. (1978) Surface-specific iodi-nation of membrane proteins of viruses and eukaryotic cellsusing l,3,4,6-tetrachloro-3-,6-diphenylglycouril. Biochem-istry ^7•.4807-A8^7.

Meacock, P., and Cohen, S. (1980) Partitioning of bacterialplasmids during cell division: a c/s-acting locus that accom-plishes stable plasmid inheritance. Celt 20: 529-542,

Messing, J., Crea, R., and Seeburg, P.H. (1981) A system forshotgun DNA sequencing. NucI Acid Res 9: 309-321.

Michiels, T., and Cornelia, G.R. (1991) Secretion of hybrid pro-teins by the Yersinia Yop export system. J Bacteriol 173:1677-1685.

Michieis, T., Wattiau, P., Brasseur, R., Ruysschaert, J.-M., andCornelis, G. (1990) Secretion of Yop proteins by Yerslniae.Infect tmmun 5B: 2840-2849.

Miller, V.L., and Mekalanos, J.J. (1988) A novel suicide vectorand its use in construction of insertion mutations: osmoregu-lation of outer membrane proteins and virulence determi-nants in Vibrio cholerae requires toxP- J Bacteriot 170:2575-2583.

Morales, V.M., Backman, A., and Bagdasarian, M. (1991) Aseries of wide-host-range low-copy-number vectors thatallow direct screening of recombinants. Gene 97: 39-47.

Paerregaard, A., Espersen, F., Jensen, O.M., and Skurnik, M.(1991) Interactions between Yersinia enterocoiitica and rab-bit ileal mucus: growth, adhesion, penetration, and subse-quent changes in surface hydrophobicity and ability toadhere to ileal brush border membrane vesicles, infect/mmun 59: 253-260.

Pilz, D., Vocke, T., Heesemann, J., and Brade, V. (1992)Mechanism ot YadA-mediated serum resistance of Yersiniaenterocotitica serotype 03. infect Immun 60:189-195.

Portnoy, D.A., Moseley, S.L., and Falkow, S. (1981) Character-ization of plasmids and plasmid-associated determinants ofYersinia enterocolitica pathogenesis. Infect Immun 31 :775-782.

Reed, L.J., and Muench, H. (1938) A simple method of estimat-ing fifty percent endpoint. Am J Hyg 27: 493-497.

Relman, D., Tuomanen, E., Falkow, S., Golenbock, D.T.,Saukkonen, K., and Wright, S.D. (1990) Recognition of abacterial adhesin by an integrin: macrophage CR3 (ct̂ [̂i2,CD11n/CD18) binds filamentous hemagglutinin of Borde-tella penussis. Cell 61: 1375-1382.

Rosqvist, R., Skurnik, M., and Wolt-Watz. H. (1988) Increasedvirulence of Y. pseudotuberculosis by two independentmutations. Nature 33A: 522-525.

Rosqvist, R., Forsberg, E., Rimpilainen, M., Bergman, T., andWolf-Watz, H. (1990) The cytotoxic protein YopE of Yersiniaobstructs the primary host defence. Mot Microbiot 4:657-667.

Schulze-Koops, H., Burkhardt, H., Heesemann, J., von derMark, K., and Emmrich, F. (1992) Plasmid-encoded outermembrane protein YadA mediated specific binding ofenteropathogenic Yersiniae to various types of collagen.infect Immun 60: 2153-2159.

Schulze-Koops, H., Burkhardt, H,, Heesemann, J., Kirsch, T.Swoboda, B., Bull, C , Goodman, S., and Emmrich, F.(1993) Outer membrane protein YadA of enteropathogenicYersiniae mediates specific binding to cellular but notplasma fibronectin. hfect tmmun 61: 2513-2519.

Simon, R., Priefer, U., and Piihler, A. (1983) A broad hostrange mobilization system for in vivo genetic engineering:transposon mutagenesis in Gram negative bacteria.Biotechnology 1: 784-791.

Skurnik, M. (1984) Lack of correlation between the presence ofplasmids and fimbriae in Yersinia enterocoiitica and Yersiniapseudotubercutosis. J AppI Bacteriol 56: 355-363.

Skurnik, M. (1985) Expression of antigens encoded by the viru-lence plasmid of Yersinia enterocolitica under differentgrowth conditions. Infect Immun ^7: 183-190.

Skurnik, M., and Toivanen, P. (1992) LcrF is the temperature-regulated activator of the yadA gene of Yersinia enterocolit-ica and Yersinia pseudotuberculosis. J Bacteriot 17^: 2047-2051.

Skurnik, M., and Wolf-Watz, H. (1989) Analysis of the yopAgene encoding the Yopi virulence determinants of Yersiniaspp. hAol Microbioi Z: 517-529.

Skurnik, M., Bolin, I., Heikkinen, H., Piha, S., and Wolf-Wafz,H. (1984) Virulence plasmid-associated autoagglutination inVers/n/a spp. J Bacteriot 1SZ: 1033-1036.

Struyve, M., Moons, M., and Tommassen, J. (1991) Carboxy-terminal phenylalanine is essential for the correct assemblyof a bacterial outer membrane protein. J Mol Biol 218:141-148.

Tertti, R., Skurnik, M., Varlio, T., and Kuusela, P. (1992) Theadhesion protein YadA of Yersinia species mediates bindingof bacteria to fibronectin. Infect Immun 60: 3021-3024.

Trust, T.J., Kostrynska, M., Emody, L., and Wadstrom, T.(1993) High-affinity binding of the basement membrane pro-tein collagen type IV to the crystalline virulence surface pro-tein array of Aeromonas salmonicida. Mol Microbiot 7:593-600.

Vuento, M., and Vaheri, A. (1979) Purification of fibronectinfrom human plasma by affinity chromatography under non-denaturating conditions. Biochem J183: 331 -337.

Westerlund, B., and Korhonen, T.K. (1993) Bacterial proteinsbinding to the mammalian extracellular matrix. Mol Microbiot9: 687-694.

Westerlund, B,, Kuusela, P., Risteli, J., Risteli, L, Varlio. T.,Rauvala, H., Virkola, R., and Korhonen, T.K. {1989a) TheO75X adhesin of uropathogenic Escherichia coti is a type IVcollagen-binding protein. Mol Microbiol 3: 329-337.

Hydrophobic domains cf the Yersinia adhesin, YadA 1011

Westerlund, B., Kuusela, P., Vartio, T., van Die, I., and Korho-nen, T.K. (1989b) A novel lectin-independent interaction of Pfimbriae of Escherichia coti with immobilized fibronectin.FEBS Lett 2A3: 199-204.

Westerlund, B,, van Die, I., Kramer, C , Kuusela, P., Holthofer,H., Tarkkanen, A.-M., Virkola, R., Riegman, N., Bermans,H., Hoekstra, W., and Korhonen, T.K. (1991) Multifunctionalnature of P fimbriae of uropathogenic Escherichia coth muta-tions in fsoE and fsoF influence fimbrial binding to renal

tubuli and immobilized fibronectin. Mol Microbiol 5:2965-2975.

Yamada, K.M. (1991) Adhesive recognition sequences, J BiolChem 266: 12809-12812.

Zaieska, M., Lounatmaa, K., Nurminen, M., Wahlstrom, E., andMakela, P.H. (1985) A novel virulence-associated cell sur-face structure composed of 47-kd protein subunits inYersinia enterocolitica. EMBO JA: 1013-1018.