Huang et al. Nanoscale Res Lett (2021) 16:27 https://doi.org/10.1186/s11671-021-03475-5

NANO EXPRESS

Human Umbilical Cord Mesenchymal Stem Cells-Derived Exosomal MicroRNA-18b-3p Inhibits the Occurrence of Preeclampsia by Targeting LEPQin Huang1, Meng Gong1, Tuantuan Tan2, Yunong Lin3, Yan Bao1 and Cuifang Fan1*

Abstract

Exosomes derived from human umbilical cord mesenchymal stem cells (hucMSCs) expressing microRNAs have been highlighted in human diseases. However, the detailed molecular mechanism of hucMSCs-derived exosomal miR-18b-3p on preeclampsia (PE) remains further investigation. We aimed to investigate the effect of exosomes and miR-18b-3p/leptin (LEP) on occurrence of PE. The morphology of the hucMSC and hucMSC-exosomes (Exos) was identi-fied. The exosomes were infected with different lentivirus expressing miR-18b-3p to explore the role of miR-18b-3p in PE. The PE rat model was established by intraperitoneal injection of N-nitro-l-arginine methyl ester. The expression of LEP and miR-18b-3p was tested in PE rat placenta tissues. Also, the effect of exosomes on LEP and miR-18b-3p expression was detected. The systolic blood pressure (SBP), proteinuria, inflammatory factors, the weight of fetal rat and placenta and cell apoptosis in PE rats were detected. Finally, the relationship between miR-18b-3p and LEP was verified using dual-luciferase reporter gene assay and RNA pull-down assay. Exosomes, restoring miR-18b-3p or inhib-iting LEP reduced SBP and proteinuria of PE rats as well as increased the weight of fetal rat and placenta, decreased serum levels of inflammatory factors as well as suppressed apoptotic cells of PE rats, exerting a suppressive effect on PE progression. miR-18b-3p was decreased and LEP was increased in placenta tissues of PE rats. LEP was the direct target gene of miR-18b-3p. Upregulation of miR-18b-3p or treatment of the exosomes suppressed LEP expression and reduced PE occurrence, while downregulation of miR-18b-3p had contrary effects. Downregulated LEP reversed the effect of miR-18b-3p reduction on PE rats. HucMSCs-derived exosomal miR-18b-3p targets LEP to participate in the occurrence and development of PE. This study may provide a novel theoretical basis for the mechanism and investi-gation of PE.

Keywords: Preeclampsia, Human umbilical cord mesenchymal stem cells, Exosomes, MicroRNA-18b-3p, Leptin, Apoptosis

© The Author(s) 2021. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creat iveco mmons .org/licen ses/by/4.0/.

IntroductionPreeclampsia (PE), featured by proteinuria and hyperten-sion [1], is a major cause of fetal and maternal mortal-ity and morbidity in human pregnancy [2]. The etiology

and pathogenesis of PE are not clear [3], which has been reported to be associated with abnormal trophoblast invasion resulting in maternal endothelial dysfunction, chronic placental malperfusion and hypertension with adverse outcomes [4]. With the exception of fetal and placental delivery, there is no specific therapy for PE [5]. Therefore, it is urgent to explore the therapeutic targets to improve the prognosis of this disease.

Open Access

*Correspondence: fancuifang@whu.edu.cn1 Department of Obstetrics and Gynecology, Renmin Hosptial of Wuhan University, 238 Jiefang Road, Wuchang District, Wuhan 430060, Hubei, ChinaFull list of author information is available at the end of the article

Page 2 of 13Huang et al. Nanoscale Res Lett (2021) 16:27

Human umbilical cord (huc) is a suitable source of mesenchymal stem cells (MSCs) which secrete a variety of trophic factors and cytokines as well as show strong anti-inflammatory and immunomodulatory capaci-ties [6]. A study has verified that PE accelerates neu-roglial marker expression in umbilical cord Wharton’s jelly-derived MSCs [7]. A protective effect of hucMSCs exosomes (Exos) on placental morphology and angio-genesis in PE rats has also been reported [8]. Exosomes are small (50–100 nm) secretory vesicles which mediate communication between cells in the tumor microenvi-ronment via encapsulating and transmitting carcino-genic factors to distant sites or to surrounding cells by the circulation [9]. A study has revealed the damage of vascular functions and complications induced by effec-tive transfer of sFlt-1 and sEng into endothelial cells in patients with PE by exosomes [10]. MicroRNAs (miR-NAs) are endogenous, non-coding RNAs with a length of 18–25 nucleotides, and regulate the expression of gene at the post-transcriptional level [11]. The data in a study have reported that miR-18b expression affects cell invasion, viability and migration of trophoblast cells in PE [12]. Furthermore, Wu et al. have proposed that miR-18b attenuates proliferation in human retinal endothelial cells induced by high-glucose, which may offer a new insight into comprehending the mechanism of diabetic retinopathy pathogenesis [13]. However, the role of hucMSC-derived exosomal miR-18b-3p in PE remains unknown. Leptin (LEP) has pleiotropic effects on cell differentiation/proliferation and immunity of physiological states and mainly emerged from adipo-cytes, in addition to other tissues, including placenta [14]. A study has verified that the abnormal LEP pro-moter methylation is involved in the PE progression [15]. Another study has suggested that placenta is a main site of the expression of LEP in pregnancy [16]. Nevertheless, the binding relationship between miR-18b-3p and LEP is still elusive. Therefore, we aimed to explore the role of hucMSC-derived exosomal miR-18b-3p in PE with the involvement of LEP, and we inferred that hucMSC-derived exosomal miR-18b-3p may inhibit PE progression via targeting LEP.

Materials and MethodsEthical ApprovalThe study was approved by the Institutional Review Board of People’s Hospital of Wuhan University. All participants signed a document of informed consent. All animal experiments were tally with the Guide for the Care and Use of Laboratory Animal by Interna-tional Committees of People’s Hospital of Wuhan University.

Isolated, Culture and Identification of HucMSCsThe fetal umbilical cord delivered by healthy puerper-ant was collected and cut into mince and filtrated with sieve then mingled with phosphate-buffered saline (PBS) solution. The umbilical cord tissues were centri-fuged at 1500 r/min for 5 min with 10 cm of centrifu-gal radius. The tissues were suspended with Dulbecco’s modified Eagle medium (DMEM)/F12 containing 10% fetal bovine serum (FBS) and transferred to a cul-ture flask. The liquids were changed after 4  days and then changed once every 3 d. Cells were sub-cultured when the confluence reached about 90%. The adherent growth and morphology of hucMSCs were observed under a light microscope. The cells were stained with oil red O staining solution (Beyotime Institute of Bio-technology, Shanghai, China) to detect osteogenic differentiation of hucMSCs and dyed with alkaline phosphatase (ALP) staining solution (Beyotime) to detect adipogenic differentiation of hucMSCs. A flow cytometer (Beckman Coulter Life Sciences, Brea, CA, USA) was adopted to test CD73, CD166 (both 1: 10, BD Biosciences, Franklin Lakes, NJ, USA) and CD105 (1: 20, AbD Serotec, Oxford, UK).

Extraction and Identification of HucMSC‑ExosThe well-growing hucMSCs were cultured. The superna-tant was collected and centrifuged at 28,500 r/min for 1 h with 10  cm centrifuge radius. The supernatant was dis-carded, and the cells fixed with 2% glutaraldehyde and 1% osmic acid, dehydrated with ethanol, immersed in pro-pylene oxide, dried for 2  h, embedded by Epon812 and sliced. The slices were stained with uranium and lead, respectively. Finally, the exosomes were observed under the electron microscope. Nanosight detector (Malvern Instruments, Malvern, UK) was utilized to detect Brown-ian movement imaging of exosomes nanoparticles and its size. The surface markers of hucMSC-Exos were identi-fied by western blot assay, and the results showed that hucMSC-Exos expressed CD9, CD81 and CD63.

Lentivirus Infection MethodHucMSC was infected with lentivirus containing low expression of miR-18b-3p vector and low expression of miR-18b-3p vector negative control (NC) (Shang-hai GenePharma Co, Ltd, Shanghai, China). Finally, the stably expressed hucMSC-antagomir NC and hucMSC-miR-18b-3p antagomir were obtained. Cells were cul-tured for 48  h, and the supernatant was collected and centrifuged with ultracentrifugation to obtain the cor-responding Exos-antagomir NC and Exos-miR-18b-3p antagomir.

Page 3 of 13Huang et al. Nanoscale Res Lett (2021) 16:27

Experimental AnimalsWistar rats (weighing 200–250  g, aging 8 w, irrespec-tive of gender) in a health-clean level and sexual matu-rity were selected (the Experimental Animal Center of Wuhan University, Wuhan, China). The rats were fed in a barrier system with a temperature of 18–28 °C, relative humidity of 40–70% and adequate diet and water.

Establishment of Rat PE ModelsThe rat PE model was established by intraperitoneal injection of 50  mg/kg nitric oxide synthetase inhibitor, N(G)-nitro-l-arginine methyl ester (L-NAME, Beyotime) with reference to an article [17]. The successful establish-ment of PE model was based on increased blood pressure with 20 mmgHg and higher than 115  mmHg as well as enhanced proteinuria.

Animal GroupingThe female rat and the male rat were randomly cohab-ited at 1: 1, and the two rats were kept in an individual special cage at 5–6  pm. the previous day. The sperm in the vaginal secretions of the female rats was observed by vaginal plug and microscope the next day. If the result was positive at the same time, the day was recorded as the 0th day of gestation. From the 13rd day of gestation, rats were divided into 6 groups (10 rats in each group): normal group (the same amount of normal saline was injected intraperitoneally from day 13 to day 20 of ges-tation), PE group (L-NAME [50  mg/kg per day] was injected intraperitoneally from day 13 to day 20 of ges-tation, and 20 μL of normal saline was injected to the placenta on day 16 to day 19 of gestation), PE + miR-NC group (L-NAME [50 mg/kg per day] was injected intra-peritoneally from day 13 to day 20 of gestation, and 20 μL of 4  nmol miR-NC was injected to the placenta on day 16 to day 19 of gestation), PE + miR-18b-3p agomir group (L-NAME [50 mg/kg per day] was injected intra-peritoneally from day 13 to day 20 of gestation, and 20 μL of 4  nmol miR-18b-3p agomir was injected to the placenta on day 16 to day 19 of gestation), PE + miR-18b-3p antagomir group (L-NAME [50  mg/kg per day] was injected intraperitoneally from day 13 to day 20 of gestation, and 20 μL of 4  nmol miR-18b-3p antagomir was injected to the placenta on day 16 to day 19 of ges-tation), PE + miR-18b-3p antagomir + small interfering RNA (si)-LEP group (L-NAME [50  mg/kg per day] was injected intraperitoneally from day 13 to day 20 of ges-tation, and 20 μL of 4 nmol miR-18b-3p antagomir and si-LEP was injected to the placenta on day 16 to day 19 of gestation) and PE + si-LEP group (L-NAME [50  mg/kg per day] was injected intraperitoneally from day 13 to day 20 of gestation, and 20 μL of 4  nmol si-LEP was

injected to the placenta on day 16 to day 19 of gestation). Rats were treated with exosomes and exosomes carrying lentiviruses. The rats were assigned into 5 groups (10 rats in each group): normal group (the same amount of nor-mal saline was injected intraperitoneally from day 13 to day 20 of gestation), PE group (L-NAME (50 mg/kg per day) was injected intraperitoneally from day 13 to day 20 of gestation, and 20 μL of normal saline was injected to the placenta on day 16 to day 19 of gestation), PE + Exos group (L-NAME (50 mg/kg per day) was injected intra-peritoneally from day 13 to day 20 of gestation, and 20 μL of Exos (80 μg exosomes were suspended in 20 μL normal saline) was injected to the placenta on day 16 to day 19 of gestation), PE + Exos-antagomir NC group (L-NAME (50  mg/kg per day) was injected intraperitoneally from day 13 to day 20 of gestation, and 20 μL of Exos-antag-omir NC (80 μg exosomes were suspended in 20 μL nor-mal saline) was injected to the placenta on day 16 to day 19 of gestation) and PE + Exos-miR-18b-3p antagomir group (L-NAME (50 mg/kg per day) was injected intra-peritoneally from day 13 to day 20 of gestation, and 20 μL of Exos-miR-18b-3p antagomir (80 μg exosomes were suspended in 20 μL normal saline) was injected to the placenta on day 16 to day 19 of gestation).

Detection of Systolic Blood Pressure (SBP) and Determination of 24‑h ProteinuriaThe pressure of rats was measured by rats tail-artery blood pressure measurement. The tail-cuff SBP of all pregnant rats was measured on the 10th, 13th, 16th and 19th day of gestation using the rat tail artery pressure detector (Tensys (R) Medical Inc., San Diego, CA, USA). The pressure was measured 3 times in a short time; then, the average value was taken as the blood pressure.

In the case of free diet and water, the 24-h urine of pregnant rats was collected on the 10th, 13th, 16th and 19th day of the gestation, and the protein content was detected in the nephrology department of People’s Hos-pital of Wuhan University.

Sample CollectionThe pregnant rats were anesthetized with 3% pentobar-bital sodium on the 21st day of gestation. The peripheral blood of the rats was preserved, centrifuged to taken the serum and stored in the refrigerator at –  20  °C for standby. Then fetal rat and placenta were taken by cesar-ean section, the fetal membrane and the connected umbilical cord were removed, and the umbilical cord connected to the fetal rat was cut off. The placenta and fetal rat were placed on aseptic gauze to dry blood and amniotic fluid, respectively, and then put on the analyti-cal balance to weigh the weight. One part of placental tissues was fixed with 4% paraformaldehyde, dehydrated

Page 4 of 13Huang et al. Nanoscale Res Lett (2021) 16:27

with ethanol, cleared with xylene, embedded with paraf-fin and continuously cross-sliced (5  μm) for hematoxy-lin–eosin (HE) staining and terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate-biotin nick end-labeling (TUNEL) staining. The rest were stored at -80  °C for reverse transcription quantitative poly-merase chain reaction (RT-qPCR) detection, Western blot analysis and enzyme-linked immunosorbent assay (ELISA).

ELISATumor necrosis factor-α (TNF-α), interleukin (IL)-1β and IL-6 contents in serum were tested by ELISA. The con-centrations of TNF-α, IL-1β and IL-6 were determined following the instructions of the kit (R&D Systems, Minneapolis, MN, USA). Optical density (OD) values (490  nm) were tested by a microplate reader (Thermo Fisher Scientific, MA, USA). The corresponding standard curve was obtained using the OD value as the abscissa and the concentration of the corresponding standard sample as the ordinate. TNF-α, IL-1β and IL-6 concen-trations were calculated from the standard curve.

HE StainingThe paraffin samples of placenta tissues were cleared in xylene, dehydrated by conventional gradient alcohol, dyed with hematoxylin, differentiated by 1% hydrochloric acid alcohol and returned to blue by 1% ammonia water. Then the tissues were counterstained with 1% eosin solu-tion, dehydrated (75%, 90%, 95% ethanol, respectively, absolute ethyl alcohol) and cleared by xylene, dried, blocked and observed under the electron microscope.

TUNEL StainingParaffin-embedded sections were routinely dewaxed and dehydrated according to the instructions, and then, apoptosis was detected by TUNEL Kit (Nanjing Kejin Biotechnology Co., Ltd., Jiangsu, China). 4,6-Diamino-2-phenylindole (Shanghai Baitai Biotechnology Co., Ltd., Shanghai, China) was used to observe TUNEL-positive cells using a fluorescence microscope (Nikon, Tokyo, Japan) [18].

RT‑qPCRThe placenta tissues were weighed. Per 50–100  mg pla-centa tissues were added with 1 mL TRIzol (Invitrogen, Carlsbad, California, USA) and completely dissolved. The tissues were appended with 200 μL chloroform and centrifuged at 4 °C, 12,000 rpm to extract the total RNA. The concentration and purity of RNA were determined by DU-800 protein nucleic acid spectrophotometer (Beckman). U6 and β-actin were utilized as the loading controls. PCR primers were designed and compounded

by Shanghai Sangon Biotechnology Co. Ltd. (Shanghai, China). The primer sequences are listed in Table 1. RNA was reversed to cDNA on the basis of instructions of RNA reverse transcription kit (Sangon). PCR was ampli-fied and products were verified by agarose gel electro-phoresis. The data were computed by 2−ΔΔCt method.

Western Blot AssayThe total protein of placenta tissues was extracted by radio-immunoprecipitation assay cell lysis buffer (Bey-otime). HucMSC-Exo was utilized to abstract buffer, which was centrifuged at 14,000  rpm. The supernatant was preserved for testing the protein expression of exo-somal marker protein (CD81, CD63 and CD9) in serum. The protein concentration was determined by bicin-choninic acid kit (Beyotime, P0010). The sample was loaded according to the quantitative results of protein, treated with 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to membrane. The membrane was blocked with 5% skimmed milk, probed with primary antibodies LEP, CD63, CD81, CD9 and β-actin (4  mL, 1:1000, Santa Cruz Biotechnology, Inc, Santa Cruz, CA, USA), re-probed with 4 mL secondary antibody goat anti-rabbit IgG/horseradish peroxidase, exposed and developed. β-Actin was utilized as internal reference. The gray value was analyzed by gel graphic analysis software Image Lab.

Dual‑Luciferase Reporter Gene AssayOn-line prediction software https ://cm.jeffe rson.edu/ was adopted to predict the target relationship between miR-18b-3p and LEP as well as the binding site of miR-18b-3p and LEP 3′untranslated region (UTR). The LEP 3′UTR promoter region sequence containing miR-18b-3p binding site was composed. The LEP 3′UTR wild-type (WT) plasmid and LEP 3′UTR mutant type (MUT) were constructed. The recombinant plasmids were named as LEP 3′UTR-WT and LEP 3′UTR-MUT, respectively. The

Table 1 Primer sequence

F forward, R reverse, miR-18-3p microRNA-18-3p, LEP leptin

Gene Sequence (5′ → 3′)

miR-18-3p F: 5′-TAA GGT GCA TCT AGT GCA GTTAG-3′

R: 5′-CCA TAA GGT GCA TCT AGT GCAGT-3′

U6 F: 5′-CTC GCT TCG GCA GCACA-3′

R: 5′-AAC GCT TCA CGA ATT TGC GT-3′

LEP F: 5′-TGG TCC TAT CTG TCC TAT GTT-3′

R: 5′-GGA GGT CTC GCA GGT TCT -3′

β-actin F: 5′- GTG GGC CGC TCT AGG CAC CAA-3′

R: 5′- CTC TTT GAT GTC ACG CAC GAT TTC -3′

Page 5 of 13Huang et al. Nanoscale Res Lett (2021) 16:27

cultured 293T cells were co-transfected with miR-18b-3p mimic and LEP 3′UTR-WT, miR-18b-3p mimic and LEP 3′UTR-MUT, mimic NC and LEP 3′UTR-WT, mimic NC and LEP 3′UTR-MUT for 30 h. Then 293T cells were col-lected. Firefly and renilla luciferase activity in cells were measured by luminescence measurements in accordance with dual-luciferase reporter gene detection kit (Pro-mega, Madison, WI, USA).

RNA Pull‑Down AssayBiotinylated RNA probes (Bio-miR-NC, Bio-miR-18b-3p and Bio-miR-18b-3p-Mut) were incubated with the lysate of 293T cells and extracted using magnetic beads conju-gated with antibiotic streptomycin. The experiment was performed based on instructions of Pierce magnetic RNA pull-down kits (Pierce, IL, USA). The RNA was eluted and purified using TRIzol (Pierce). The enrichment of LEP in RNA complex was quantified using RT-qPCR as previously described [19].

Statistical AnalysisAll data were explicated by SPSS 21.0 software (IBM Corp. Armonk, NY, USA). The measurement data were indicated as mean ± standard deviation. The data were conducted by independent sample t test for two groups comparisons, while comparisons among multiple groups were assessed by one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test. The criterion for statis-tical significance was set at p < 0.05.

ResultsMorphology and Identification of the HucMSC and HucMSC‑ExosThe umbilical cord tissue masses were observed under an inverted microscope. It could be seen that cells crawled out of the tissue mass on the day 3; cells showed spindle shape and threadiness as well as grew like colony at about 5 days. When cultured to passage 3, the morphology of cells was uniform long fusiform and similar to fibroblast morphology, and the arrangement was regular (Fig. 1a). After 2 w of adipogenic differentiation of hucMSC, lipid droplets were formed in the cytoplasm, and the lipid droplets showed Kranz structure under the inverted microscope (Fig.  1b), suggesting that the isolated cul-tured hucMSC had the ability of adipogenic differen-tiation. After 2 w of osteogenic differentiation, a large number of brown calcium nodules could be seen under an inverted microscope (Fig. 1c), indicating that isolated cultured hucMSC had the ability of osteogenic differen-tiation. A flow cytometer was adopted to test the immu-nophenotype of cells, and the results included that cells overexpressed surface marker CD73, CD105 and CD166 of MSCs (Fig. 1d).

The morphology of hucMSC-Exos was observed by the TEM, and the results presented that the exosomes were round or oval with low central density and thick staining on both sides (Fig.  1e). Nanosight analysis was utilized to analyze the particle size of exosomes, and the results showed that the particle size was mainly distrib-uted between 40 and 100 nm, more concentrated around 80 nm (Fig. 1f ). Western blot assay revealed that all the surface markers CD81, CD63 and CD9 were expressed in hucMSC-Exos (Fig. 1g).

Restoring miR‑18b‑3p Alleviates Pathological Characteristics of PE RatsThe results of SBP and 24-h proteinuria presented that: there was no significant difference in SBP and 24-h pro-teinuria in 6 groups before administration (day 10 of gestation). SBP and 24-h proteinuria in day 19 of gesta-tion showed no obvious difference in normal rats. In PE rats or PE rats treated with miR-NC, miR-18b-3p ago-mir, miR-18b-3p antagomir, miR-18b-3p antagomir + si-LEP, si-NC or si-LEP, SBP and 24-h proteinuria began to increase at day 13 of gestation. There was no distinct difference of SBP and 24-h proteinuria in day 16 and day 19 of gestation in PE rats treated with miR-18b-3p ago-mir and si-LEP. PE rats had increased SBP and 24-h pro-teinuria in day 19 of gestation; this increase was reduced by miR-18b-3p elevation but further enhanced by miR-18b-3p inhibition; LEP reduction abrogated the role of miR-18b-3p downregulation in the SBP and 24-h pro-teinuria on day 19 of gestation in PE rats (Fig. 2a, b).

The weight of fetal rat and placenta reduced in the PE rats; upregulated miR-18b-3p or downregulated LEP increased, while downregulated miR-18b-3p decreased the weight of fetal rat and placenta in PE rats; LEP silenc-ing reversed the effect of miR-18b-3p inhibition on the weight of fetal rat and placenta in PE rats (Fig. 2c, d).

Inflammatory factors in serum of PE rats were detected. It was found that TNF-α, IL-1β and IL-6 con-tents enhanced in the PE rats; miR-18b-3p elevation or LEP inhibition suppressed, while miR-18b-3p reduction promoted the contents of TNF-α, IL-1β and IL-6; the effect of inhibited miR-18b-3p on TNF-α, IL-1β and IL-6 contents was abrogated by LEP depletion (Fig. 2e).

Overexpressed miR‑18b‑3p Ameliorates Histopathological Change of Placenta Tissues of PE RatsIn normal rats, the placental villus was rich in blood ves-sels and had a clear structure, syncytiotrophoblasts were the main trophoblasts in placental villi, and there were fewer cytotrophoblasts. In PE rats or PE rats treated with miR-NC, miR-18b-3p antagomir, si-NC or miR-18b-3p antagomir + si-LEP, the number of placental villi decreased, the structure was blurred and atrophied,

Page 6 of 13Huang et al. Nanoscale Res Lett (2021) 16:27

some villi were performed fibrinoid necrosis, and the number of syncytiotrophoblast nodules in placental villi increased, and most of the villi were immature. The number of trophocytes was reduced, and the pathologi-cal changes were alleviated in PE rats treated with miR-18b-3p agomir and si-LEP (Fig. 3a).

TUNEL staining suggested that a small number of apoptotic cells could be seen. PE rats had increased

apoptotic cells, which were reduced by miR-18b-3p ele-vation and LEP silencing, and were further enhanced by miR-18b-3p inhibition; LEP silencing also reversed the effect of miR-18b-3p inhibition on the number of apop-totic cells in PE rats (Fig. 3b, c).

Taken together, rats with upregulated miR-18b-3p or inhibited LEP had a decreased degree of PE progression in histology, and silenced LEP could abolish the thera-peutic effect of inhibited miR-18b-3p.

a b c

d

e f g

CD81

CD63

CD9

50μm 50μm 50μm

100nm

HLA-DR-FITCCD45-FITCCD34-FITC

CD

73-P

E

CD

105-

PE

CD

166-

PE

Size (nm)

inte

nsity

(%)

Fig. 1 Morphology and identification of the hucMSC and hucMSC-Exos. a The morphology of the hucMSC under the inverted microscope, b hucMSC was tested by oil red O staining. c hucMSC was tested by ALP staining. d Flow cytometry was used to detect immunophenotype. e The shape and size of hucMSC-Exos observed through a TEM. f Detection of particle size distribution of exosomes using Nanosight analysis. g Protein expression of CD9, CD81 and CD63 in hucMSC-Exos was detected by western blot assay

Page 7 of 13Huang et al. Nanoscale Res Lett (2021) 16:27

miR‑18b‑3p is Downregulated, While LEP is Upregulated in PE Rat Placenta Tissues and miR‑18b‑3p Targets LEPBased on the above results, LEP downregulation reversed the therapeutic effect of downregulation of miR-18b-3p on PE rats in pathology and histology; thus, we hypoth-esized that miR-18b-3p may be related to LEP.

Western blot assay and RT-qPCR revealed that PE rats had decreased miR-18b-3p and increased LEP expression levels; the treatment of miR-18b-3p agomir upregulated miR-18b-3p and downregulated LEP in PE rats, while the treatment of miR-18b-3p antagomir increased LEP expression; LEP silencing reversed the promotive effect of miR-18b-3p reduction on LEP expression in PE rats (Fig. 4a–c).

Western blot assay and RT-qPCR were used to explore the role of exosomes in PE rats. The results displayed that exosomes upregulated miR-18b-3p and downregu-lated LEP in PE rats, indicating the suppressive effect of exosomes on PE development. Moreover, exosomes

conveying miR-18b-3p antagomir induced miR-18b-3p downregulation and LEP upregulation in PE rats (Fig. 4d–f).

The target relationship between miR-18b-3p and LEP was forecasted by bioinformatics online prediction software https ://cm.jeffe rson.edu/ (Fig.  4g). Dual-lucif-erase reporter gene assay suggested that miR-18b-3p mimic diminished the luciferase activity of LEP 3′UTR-WT, while imposed no impacts on that of LEP 3′UTR-MUT (Fig.  4h). Furthermore, the RNA pull-down assay revealed that LEP enrichment was increased in by WT-biotinylated miR-18b-3p (Fig.  4i). These findings indi-cated that LEP is a target gene of miR-18b-3p.

hucMSC‑Exos Attenuate Pathological Characteristics of PE RatsThe results of SBP and 24 h presented that there was no significant difference in SBP and 24-h proteinuria in 5 groups before administration (day 10 of gestation). SBP

Fig. 2 Restoring miR-18b-3p alleviates pathological characteristics of PE rats. a Results of SBP in rats. b Results of 24-h proteinuria in rats. c Weight changes of fetal rats. d Changes of placental weight in rats. e Changes of inflammatory factors in serum were detected using ELISA. n = 10, *p < 0.05 versus the normal group. ^p < 0.05 versus the PE + miR-NC group. @p < 0.05 versus the PE + miR-18b-3p antagomir group. &p < 0.05 versus the PE + si-NC group. Measurement data were depicted as mean ± standard deviation, and comparisons among multiple groups were assessed by one-way ANOVA followed by Tukey’s test

Page 8 of 13Huang et al. Nanoscale Res Lett (2021) 16:27

and 24-h proteinuria in day 19 of gestation showed no distinct difference in normal rats. In PE rats, SBP and 24-h proteinuria began to raise at day 13 of gestation. There was no distinct difference of SBP and 24-h protein-uria in day 16 and day 19 of gestation in PE rats treated with hucMSC-Exos and hucMSC-Exos transmitting antagomir NC. SBP and 24-h proteinuria heightened in day 19 of gestation in the PE rats, while the increase was reduced by injection of hucMSC-Exos. Inhibiting miR-18b-3p reversed the effect of hucMSC-Exos on SBP and 24-h proteinuria in day 19 of gestation in PE rats (Fig. 5a, b).

The weight of fetal rat and placenta was measured, and we found that the PE rats had decreased weight of fetal rat and placenta; miR-18b-3p downregulation abolished the role of hucMSC-Exos in the weight of fetal rat and placenta in PE rats (Fig. 5c, d).

Inflammatory factors in serum were detected using ELISA. TNF-α, IL-1β and IL-6 contents remarkably increased in PE rats. Exosomes treatment decreased

TNF-α, IL-1β and IL-6 contents in serum of PE rats, which were enhanced by injection of exosomes inhibiting miR-18b-3p (Fig. 5e).

Exosomes Alleviates Pathological Change and Inhibit Apoptosis of Placenta Tissues of PE RatsIn normal rats, the placental villus was abundant in blood vessels with a clear structure, syncytiotrophoblasts were the main trophoblast in placental villi, and there were fewer cytotrophoblasts. In the PE rats and PE rats treated with hucMSC-Exos-miR-18b-3p-antagomir, the number of placental villi reduced, the structure was blurred and atrophied, some villi were presented fibrinoid necrosis, and the number of syncytiotrophoblast nodules in pla-cental villi enhanced, and most of the villi were imma-ture. The pathological change was improved in the PE rats treated with hucMSC-Exos or hucMSC-Exos-antag-omir NC versus the PE rats and PE rats treated with huc-MSC-Exos-miR-18b-3p antagomir (Fig. 6a).

Apo

ptos

is ra

te (%

)

50μm 50μm 50μm

50μm

50μm

50μm 50μm 50μm

50μm 50μm 50μm 50μm

50μm 50μm 50μm 50μm0

20

40

60

Normal

Normal

PE

PE

PE+miR-NC

PE+miR-NC

PE+miR-18b-3p agomir

PE+miR-18b-3p agomir

Normal PE PE+miR-NC PE+miR-18b-3p agomir

PE+miR-18b-3p antagomir

PE+miR-18b-3p antagomir

PE+miR-18b-3p antagomir+si-LEP

PE+miR-18b-3p antagomir+si-LEP

PEC+si-NC

PE+si-NC

PE+si-LEP

PE+si-LEP

PE+miR-18b-3p antagomirPE+miR-18b-3p antagomir+si-LEP PE+si-NC PE+si-LEP

*

^ &

@

^

a

b

c

Fig. 3 Overexpressed miR-18b-3p ameliorates pathological change and suppresses apoptotic cells of placenta tissues in PE rats. a HE staining was utilized to test pathological features of placenta tissues. b TUNEL staining was implemented to determine apoptotic cells of placenta tissues in PE rats. c Cell apoptosis rate was detected by TUNEL staining. n = 10, *p < 0.05 versus the normal group. ^p < 0.05 versus the miR-NC group. @p < 0.05 versus the miR-18b-3p antagomir group. &p < 0.05 versus the si-NC group. Measurement data were depicted as mean ± standard deviation, and comparisons among multiple groups were assessed by one-way ANOVA followed by Tukey’s test

Page 9 of 13Huang et al. Nanoscale Res Lett (2021) 16:27

TUNEL staining indicated that in normal rats, a small number of apoptotic cells could be seen. PE rats had enhanced apoptotic cells, and reduced miR-18b-3p reversed the impacts of hucMSC-Exos on the number of apoptotic cells in placenta tissues from PE rats (Fig. 6b, c).

DiscussionPE is a multisystem pregnancy disorder characterized by proteinuria and either high blood pressure or other adverse conditions and is linked to a wide range of mater-nal endothelial dysfunction [20]. It was reported that hucMSC-Exo improved the morphology of placental

a cb

d fe

g h i

β-actin

LEP

β-actin

LEP

Normal

ModelExo

s

Exos-a

ntagomir

NC

Exos-m

iR-18

-3p an

tagomir

NormalPEPE+Exos

PE+Exos-antagomir NCPE+Exos-miR-18-3p antagomir

NormalPEPE+Exos

Bio-miR-18b-3p-WTBio-miR-NCBio-miR-18b-3p-MUT

PE+Exos-antagomir NCPE+Exos-miR-18-3p antagomir

miR-18b-3p LEP

Rel

ativ

e lu

cife

rase

act

ivity

LEP-WT LEP-MUT0.0

0.5

1.0

1.5

mimic NC miR-18b-3p mimic

miR-18b-3p LEP

Normal PEPE+miR-NCPE+miR-18b-3p agomirPE+miR-18b-3p antagomirPE+miR-18b-3p antagomir+si-LEPPE+si-NCPE+si-LEP

Normal

Normal

PE

PE

PE+miR-NCPE+miR-18b-3p agomirPE+miR-18b-3p antagomirPE+miR-18b-3p antagomir+si-LEPPE+si-NCPE+si-LEP

PE+miR

-NC

PE+miR

-18b-3p

agomir

PE+miR

-18b-3p

antag

omir

PE+miR

-18b-3p

antag

omir+si-

LEP

PE+si-N

C

PE+si-L

EP

2599

Gene Name:miRNA: mmu-miR-18b-3p

LepENSMUSG00000059201ENSMUST00000069789

2619

CCTTGGGG T - TTTGGAGCAGTT

TCTTCCCCGTAAATCCCGTCAT

2599 2619

CCTTGGGG T - TTTGGAGCAGTT

1 22

TACTGCCCTAAATGCCCCTTCT

Rel

ativ

e R

NA

exp

ress

ion

0

1

2

3

LEP/

β-ac

tin ra

tio

0.0

0.5

1.0

1.5

Rel

ativ

e R

NA

exp

ress

ion

0.0

0.5

1.0

1.5

2.0

*

#$

*

#

$

LEP/

β-ac

tin ra

tio0.0

0.5

1.0

1.5

*

#$

Rel

ativ

e LE

P en

richm

ent

0

2

4

6P<0.05

P<0.05P<0.05

*

^&

*

^

@

^

^

*

^ &

@

^

Fig. 4 miR-18b-3p is downregulated and LEP is upregulated in placenta tissues of PE rats. a Expression of miR-18b-3p and LEP mRNA in placenta tissues was detected using RT-qPCR. b Protein band of LEP in placenta tissues. c Western blot assay was conducted to detect LEP protein expression in placenta tissues. d Expression of miR-18b-3p and LEP mRNA in placenta tissues after exosome treatment was detected using RT-qPCR. e Protein band of LEP in placenta tissues after exosome treatment. f Western blot assay was performed to detect LEP protein expression after exosome treatment. g The binding sites of miR-18b-3p and LEP predicated by an online software. h The target relationship between miR-18b-3p and LEP verified by dual-luciferase reporter gene assay. i targeting relationship between miR-18b-3p and LEP verified by RNA pull-down assay. n = 10, *p < 0.05 versus the normal group. ^p < 0.05 versus the miR-NC group. @p < 0.05 versus the miR-18b-3p antagomir group. &p < 0.05 versus the si-NC group. #p < 0.05 versus the PE group. $p < 0.05 versus the PE + Exos-antagomir NC group. Measurement data were depicted as mean ± standard deviation, and comparisons among multiple groups were assessed by one-way ANOVA followed by Tukey’s test

Page 10 of 13Huang et al. Nanoscale Res Lett (2021) 16:27

tissue in PE rats through suppressing cell apoptosis and facilitating angiogenesis in placental tissue in a dose-dependent manner [8]. A study has reported that miR-18b expression affected cell migration, viability and invasion in PE [12]. Moreover, it was verified increased maternal LEP concentration and hypomethylation of the LEP in placenta in early onset PE [21]. The current study was designed to explore the effect of exosomes and miR-18b-3p targeted LEP on the occurrence of PE. The findings in this study revealed that hucMSC-derived exo-somal miR-18b-3p inhibited PE progression by reducing LEP.

Based on our findings, miR-18b-3p reduced and LEP elevated in placenta tissues of PE rats. Similar to our study, the mRNA expression of miR-18b was markedly suppressed in PE placental tissues relative to that in nor-mal placental tissues [12]. In addition, a study revealed that miR-18b content was dramatically reduced in malig-nant melanoma tissues in comparison with their matched adjacent non-tumor tissues [22]. Another study has verified that placental LEP expression was raised in pre-term PE compared with controls [23]. Moreover, a study showed that LEP expression was obviously heightened in preeclamptic placentas [15]. This literature provided a theoretical basis for us to explore the abnormal expres-sion of miR-18b-3p and LEP in PE. Moreover, it was predicted using a bioinformatic software that LEP was targeted by miR-18b-3p, and this targeting relationship was further confirmed with dual-luciferase reporter gene assay in our research. A study reported that LEP is a tar-get for all three miRNAs (miR-1301, miR-223 and miR-224) in early-onset PE [16]. Another study has displayed that LEP decreased miR-93 expression in osteoarthri-tis and rheumatoid arthritis [24]. However, the binding between miR-18b-3p and LEP in human diseases, espe-cially in PE, remains scarcely studied, which is the nov-elty of this study. Furthermore, a result emerging from our study reported that exosomes increased miR-18b-3p and decreased LEP in placenta tissues of PE. It was for-merly documented that the expression of miR-18b-5p was notably raised in colorectal cancer plasma exosomes [25], while the relationship between hucMSC-Exos and miR-18b-3p/LEP in PE needs further study.

Additionally, the finding from our investigation showed that restored miR-18b-3p reduced SBP and 24-h protein-uria of PE rats, increased the weight of placenta, declined

TNF-α, IL-1β and IL-6 contents in serum and placenta tissues as well as suppressed cell apoptosis. These data indicated that miR-18b-3p elevation contributes to alle-viating the symptoms and pathological changes in PE. It was demonstrated that stable upregulation of miR-18b produced effective tumor inhibitor activity, such as inhibiting melanoma cell viability, inducing apoptosis and reducing tumor growth in vivo [26]. Another result in our study was that hucMSC-Exos reduced SBP and 24-h proteinuria of PE rats, increased the weight of pla-centa, declined TNF-α, IL-1β and IL-6 contents in serum and placenta tissues as well as suppressed cell apoptosis. The findings of the current study revealed that exosomes treated PE rat models presented an increase of the num-ber and quality of fetuses, the quality of placenta, but cell apoptosis was significantly reduced [8]. Interestingly, a previous research has demonstrated that the addition of fetal bovine exosomes declined contents of macrophage TNF-α and IL-6 [27]. A study has revealed that purified exosomes suppressed production of IL-1β in lipopoly-saccharide/nigericin-stimulated macrophages [28]. Fur-thermore, Nong et al. have suggested that inflammatory markers, such as TNF-α and IL-6, were dramatically decreased after administration of exosomes produced through human-induced pluripotent stem cell-derived MSCs [29]. There is a article finding that the SBP was markedly elevated in the group of women who later developed PE [30, 31]. It was displayed that PE patients were positively associated with SBP and diastolic blood pressures and proteinuria [32]. Also, a recent study has provided a proof that proteinuria heightened with advancing gestation in PE women [33]. A important find-ing was that rats from the PE group had increased TNF-α relative to the normal pregnant group [34]. Another study has verified that serum IL-6 and IL-1β were obvi-ously elevated in women with PE in relation to controls [35]. The above findings suggested that PE patients usu-ally showed high SBP, proteinuria and levels of inflamma-tory factors. Thus, it could be inferred from our results that the hucMSC-derived exosomal miR-18b-3p had a therapeutic effect on PE.

(See figure on next page.)Fig. 5 hucMSC-Exos attenuate pathological characteristics of PE rats. a Results of SBP in rats after exosome treatment. b Results of 24-h proteinuria in rats after exosome treatment. c Weight changes of fetal rats after exosome treatment. d Changes of placental weight in rats after exosome treatment. e Changes of inflammation factors after exosome treatment in serum were determined using ELISA. n = 10, *p < 0.05 versus the normal group. #p < 0.05 versus the PE group. $p < 0.05 versus the PE + Exos-antagomir NC group. Measurement data were depicted as mean ± standard deviation, and comparisons among multiple groups were assessed by one-way ANOVA followed by Tukey’s test

Page 11 of 13Huang et al. Nanoscale Res Lett (2021) 16:27

a b

c

e

Cont

ent (

pg/m

l)

TNF-α IL-1β IL-60

50

100

150

200

NormalPEPE+Exos

PE+Exos-antagomir NCPE+Exos-miR-18-3p antagomir

NormalPEPE+Exos

PE+Exos-antagomir NCPE+Exos-miR-18-3p antagomir

NormalPEPE+Exos

PE+Exos-antagomir NCPE+Exos-miR-18-3p antagomir

*

#

$

* # $*#

$

d

Syst

olic

Blo

od P

ress

ure

(mm

Hg)

10 13 16 1980

100

120

140

160

180

Gestational Day Gestational DayU

rinar

y Pr

otai

n (m

g/da

y)

10 13 16 190

5

10

15

NormalPEPE+Exos

PE+Exos-antagomir NCPE+Exos-miR-18-3p antagomir

NormalPEPE+Exos

PE+Exos-antagomir NCPE+Exos-miR-18-3p antagomir

*

#$

0

2

4

6

*

#$

Feta

l rat

wei

ght (

g)

Plac

enta

l wei

ght (

g)

0.0

0.5

1.0

1.5

*

#

$

*

#$

Page 12 of 13Huang et al. Nanoscale Res Lett (2021) 16:27

ConclusionIn conclusion, our study provides evidence that hucM-SCs-derived exosomes upregulate miR-18b-3p, which targets LEP to suppress the contents of inflammatory factors and reduce cell apoptosis rate in PE rat placenta tissues, thereby inhibiting the occurrence of PE. Thus, exosomal miR-18b-3p may be a potential candidate for treatment of PE via targeting LEP. This research identi-fied the role of hucMSC-derived exosomal miR-18b-3p targeting LEP during PE development for the first time, which provided a novel insight for PE treatment. How-ever, due to the limitation of known researches, the study needs to be monitored rigorously and reported appropri-ately in the future clinical trials.

AcknowledgementsWe would like to acknowledge the reviewers for their helpful comments on this paper.

Authors’ contributionsCF contributed to study design; QH contributed to manuscript editing; MG and TT contributed to experimental studies; YL and YB contributed to data analysis. All authors read and approved the final manuscript.

Availability of data and materialsNot applicable.

Ethics approval and consent to participateThe study was approved by the Institutional Review Board of People’s Hospital of Wuhan University. All participants signed a document of informed consent. All animal experiments were tally with the Guide for the Care and Use of Laboratory Animal by International Committees.

Consent for publicationNot applicable.

Competing interestsThe authors declare that they have no conflicts of interest.

Author details1 Department of Obstetrics and Gynecology, Renmin Hosptial of Wuhan University, 238 Jiefang Road, Wuchang District, Wuhan 430060, Hubei, China. 2 Ultrasound Imaging Department, Renmin Hosptial of Wuhan University, Wuhan 430060, Hubei, China. 3 Department of Statistics, UW-Madison, Madi-son 53703, USA.

Received: 3 July 2020 Accepted: 5 January 2021

References 1. Yang X, Zhang J, Ding Y (2017) Association of microRNA-155, interleukin

17A, and proteinuria in preeclampsia. Medicine (Baltimore) 96(18):e6509 2. Zhou C et al (2017) Preeclampsia downregulates microRNAs in fetal

endothelial cells: roles of miR-29a/c-3p in endothelial function. J Clin Endocrinol Metab 102(9):3470–3479

3. Hu S et al (2019) MicroRNA1443p may participate in the pathogenesis of preeclampsia by targeting Cox2. Mol Med Rep 19(6):4655–4662

4. Singh K et al (2017) Up-regulation of microRNA-202-3p in first trimester placenta of pregnancies destined to develop severe preeclampsia, a pilot study. Pregnancy Hypertens 10:7–9

5. Skurnik G et al (2017) Labor therapeutics and BMI as risk factors for postpartum preeclampsia: a case-control study. Pregnancy Hypertens 10:177–181

6. Sironi F et al (2017) Multiple intracerebroventricular injections of human umbilical cord mesenchymal stem cells delay motor neurons loss but not disease progression of SOD1G93A mice. Stem Cell Res 25:166–178

7. Joerger-Messerli M et al (2015) Preeclampsia enhances neuroglial marker expression in umbilical cord Wharton’s jelly-derived mesenchymal stem cells. J Matern Fetal Neonatal Med 28(4):464–469

a b c

Apo

ptos

is ra

te (%

)

0

10

20

30

40

*

#

$

Normal

Normal

PE

50μm 50μm

50μm

50μm

50μm

50μm 50μm

50μm

50μm

50μm

PE

PE+Exos

PE+Exos

PE+Exos-antagomir NC

PE+Exos-antagomir NC

PE+Exos-miR-18-3p antagomir

PE+Exos-miR-18-3p antagomir

Normal

PE

PE+Exos

PE+Exos-antagomir NC

PE+Exos-miR-18-3p antagomir

Fig. 6 Exosomes alleviate pathological change and decrease apoptotic cells of placenta tissues in PE rats. a HE staining was utilized to test pathological features of placenta tissues in PE rats after exosome treatment. b TUNEL staining was implemented to determine apoptotic cells of placenta tissues in PE rats after exosome treatment. c Cell apoptosis rate was detected by TUNEL staining. n = 10, *p < 0.05 versus the normal group. #p < 0.05 versus the PE group. $p < 0.05 versus the PE + Exos-antagomir NC group. Measurement data were depicted as mean ± standard deviation, and comparisons among multiple groups were assessed by one-way ANOVA followed by Tukey’s test

Page 13 of 13Huang et al. Nanoscale Res Lett (2021) 16:27

8. Xiong ZH et al (2018) Protective effect of human umbilical cord mesenchymal stem cell exosomes on preserving the morphology and angiogenesis of placenta in rats with preeclampsia. Biomed Pharmaco-ther 105:1240–1247

9. Hannafon BN et al (2019) Metastasis-associated protein 1 (MTA1) is trans-ferred by exosomes and contributes to the regulation of hypoxia and estrogen signaling in breast cancer cells. Cell Commun Signal 17(1):13

10. Chang X et al (2018) Exosomes from women with preeclampsia induced vascular dysfunction by delivering sFlt (soluble Fms-like tyrosine kinase)-1 and sEng (soluble endoglin) to endothelial cells. Hypertension 72(6):1381–1390

11. Tanaka H et al (2017) miR-125b-1 and miR-378a are predictive biomarkers for the efficacy of vaccine treatment against colorectal cancer. Cancer Sci 108(11):2229–2238

12. Wang S et al (2017) Expression and role of microRNA 18b and hypoxia inducible factor-1alpha in placental tissues of preeclampsia patients. Exp Ther Med 14(5):4554–4560

13. Wu JH et al (2016) MiR-18b suppresses high-glucose-induced prolifera-tion in HRECs by targeting IGF-1/IGF1R signaling pathways. Int J Biochem Cell Biol 73:41–52

14. Inagaki-Ohara K (2019) Gastric leptin and tumorigenesis: beyond obesity. Int J Mol Sci 20(11):2622

15. Xiang Y et al (2013) Up-regulated expression and aberrant DNA methyla-tion of LEP and SH3PXD2A in pre-eclampsia. PLoS ONE 8(3):e59753

16. Weedon-Fekjaer MS et al (2014) Placental miR-1301 is dysregulated in early-onset preeclampsia and inversely correlated with maternal circulat-ing leptin. Placenta 35(9):709–717

17. Yan T et al (2014) Assessment of therapeutic efficacy of miR-126 with contrast-enhanced ultrasound in preeclampsia rats. Placenta 35(1):23–29

18. Wu Y et al (2020) Bone marrow mesenchymal stem cell-derived exosomes alleviate hyperoxia-induced lung injury via the manipulation of microRNA-425. Arch Biochem Biophys 697:108712

19. Li R et al (2019) A potential regulatory network among WDR86-AS1, miR-10b-3p, and LITAF is possibly involved in preeclampsia pathogenesis. Cell Signal 55:40–52

20. Dayan N et al (2018) Circulating microRNAs implicate multiple athero-genic abnormalities in the long-term cardiovascular sequelae of preec-lampsia. Am J Hypertens 31(10):1093–1097

21. Hogg K et al (2013) Hypomethylation of the LEP gene in placenta and elevated maternal leptin concentration in early onset pre-eclampsia. Mol Cell Endocrinol 367(1–2):64–73

22. Chen Y et al (2016) MicroRNA-18b inhibits the growth of malignant melanoma via inhibition of HIF-1alpha-mediated glycolysis. Oncol Rep 36(1):471–479

23. Szabo S et al (2015) Activation of villous trophoblastic p38 and ERK1/2 signaling pathways in preterm preeclampsia and HELLP syndrome. Pathol Oncol Res 21(3):659–668

24. Yang WH et al (2014) Leptin induces oncostatin M production in osteo-blasts by downregulating miR-93 through the Akt signaling pathway. Int J Mol Sci 15(9):15778–15790

25. Zhang H et al (2019) A panel of seven-miRNA signature in plasma as potential biomarker for colorectal cancer diagnosis. Gene 687:246–254

26. Dar AA et al (2013) The role of miR-18b in MDM2-p53 pathway signaling and melanoma progression. J Natl Cancer Inst 105(6):433–442

27. Beninson LA, Fleshner M (2015) Exosomes in fetal bovine serum dampen primary macrophage IL-1beta response to lipopolysaccharide (LPS) chal-lenge. Immunol Lett 163(2):187–192

28. Wang Z et al (2019) Cyclic stretch force induces periodontal ligament cells to secrete exosomes that suppress IL-1beta production through the inhibition of the NF-kappaB signaling pathway in macrophages. Front Immunol 10:1310

29. Nong K et al (2016) Hepatoprotective effect of exosomes from human-induced pluripotent stem cell-derived mesenchymal stromal cells against hepatic ischemia-reperfusion injury in rats. Cytotherapy 18(12):1548–1559

30. Udenze IC et al (2017) A prospective cohort study on the clinical utility of second trimester mean arterial blood pressure in the prediction of late-onset preeclampsia among Nigerian women. Niger J Clin Pract 20(6):741–745

31. Bagci B et al (2016) Renalase gene polymorphism is associated with increased blood pressure in preeclampsia. Pregnancy Hypertens 6(2):115–120

32. Liu X et al (2014) Plasma concentrations of sAxl are associated with severe preeclampsia. Clin Biochem 47(3):173–176

33. Furuta I et al (2017) Association between nephrinuria, podocyturia, and proteinuria in women with pre-eclampsia. J Obstet Gynaecol Res 43(1):34–41

34. Song J, Li Y, An R (2017) Vitamin D restores angiogenic balance and decreases tumor necrosis factor-alpha in a rat model of pre-eclampsia. J Obstet Gynaecol Res 43(1):42–49

35. Kalinderis M et al (2011) Elevated serum levels of interleukin-6, interleu-kin-1beta and human chorionic gonadotropin in pre-eclampsia. Am J Reprod Immunol 66(6):468–475

Publisher’s NoteSpringer Nature remains neutral with regard to jurisdictional claims in pub-lished maps and institutional affiliations.