Human Genetics Basics Kate Garber Director of Education Department of Human Genetics...
-
date post
21-Dec-2015 -
Category
Documents
-
view
223 -
download
2
Transcript of Human Genetics Basics Kate Garber Director of Education Department of Human Genetics...
![Page 1: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/1.jpg)
Human Genetics Basics
Kate Garber
Director of Education
Department of Human Genetics
![Page 2: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/2.jpg)
Syndrome named after an old guy
Gene name, which is some meaningless abbreviation
Pathway Genetic test
Medical Genetics
![Page 3: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/3.jpg)
Variable Human TraitsQualitative Traits:Discrete traits
Receding hairlineBushy eyebrowsGray hair
Quantitative Traits:Measurable traits
IQBlood pressureHeight
![Page 4: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/4.jpg)
Genes versus Environment Genes versus Environment
environmentalenvironmentalgeneticgenetic
RareSimple genetics
High recurrence risk
CommonComplex geneticsLow recurrence risk
Sickle cell disease
Scurvy;Infectious diseases;Gunshot wound
HypertensionHeart disease
DiabetesAsthma
Behavioral disorders
![Page 5: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/5.jpg)
Why might someone want to seek genetic services?
Get information about their family history and any genetic risk factors
The diagnosis of a genetic disorder by physical examination and/or genetic laboratory testing
How/why a disorder occurred (in most cases) The chance for the disorder to reoccur in the family The chance for other family members to have the
disorder or pass it on The management and treatment of the disorder Support groups for the disorder Connections to other families who have a child with a
similar/same disorder
![Page 6: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/6.jpg)
Types of genetic testing1. Diagnostic testing - establish or confirm a diagnosis
2. Carrier testing - screen adults to determine if they are carriers of mutations so that their risk of having a child with a genetic defect can be calculated
3. Prenatal testing - determine if a fetus is affected with a genetic disorder (also includes PGD testing).
4. Presymptomatic testing - determine if a currently asymptomatic individual will become affected with a genetic disease in the future.
5. Population screening - screening of the entire population for a genetic disorder so that these individuals can be identified and treated before the onset of symptoms
![Page 7: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/7.jpg)
Chromosome Variation Karyotype 23 pairs autosomes, 2 sex
chromosomes Each chromosome has a
characteristic banding pattern
What is the most common genetic variation you see in karyotypes from a normal population?
46, XX versus 46, XY
![Page 8: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/8.jpg)
Variation in Chromosome Number
Trisomies 13, 18, and 21 are the only non-mosaic trisomies for an entire autosome that are compatible with postnatal survival
Monosomy X is the only monosomy that is viable Trisomy 13 Trisomy 18
Turnpenny & Ellard, 2007
![Page 9: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/9.jpg)
Variation in chromosome structure
Translocations Inversions Duplications Deletions
![Page 10: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/10.jpg)
Chromosome abnormalitiesmicroscopically visible changes in the number or structure of chromosomes occur in:
Approximately 1% of all live births
23% of congenital anomalies with MR 13% of congenital heart defects60% of spontaneous first trimester abortions
Examples: 1. Down syndrome - caused by an additional copy of chromosome 21 2. Unbalanced translocations - partial monosomy for one region of the genome and partial trisomy for another region of the genome 3. 22q11.2 deletion –interstitial deletion of 3Mb removing several genes
![Page 11: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/11.jpg)
When to order cytogenetic testing(i.e. standard of care)
Multiple congenital anomalies
Mental retardation of unknown origin or associated with minor or major malformations
Multiple unexplained spontaneous abortions
Ambiguous genitalia
Prenatal testingAbnormal prenatal screen
Ultrasound abnormalities
![Page 12: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/12.jpg)
Fluorescence In Situ Hybridization (FISH)
Metaphase cell Denaturedtarget DNAds ssDNA
GATT
Denaturedprobe DNA
![Page 13: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/13.jpg)
FISH probes
A shows a normal chromosome 15
B shows a deletion at the end of the other chromosome 15
Unique sequence probes - single copy probes (1 kb feasible). Useful for microdeletions/dups, specific telomeres.
![Page 14: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/14.jpg)
Copy Number Polymorphism
Large chunks of DNA (1000s-1 Mb) that are present in a variable number of copies in different people
Can affect the number of copies of a gene that are present in a person
Even if they don’t contain a complete gene, they can affect the level of gene expression
![Page 15: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/15.jpg)
Comparative Genome Hybridization
Fragments of sample and reference DNA labeled with different fluorescent dyes
Labeled DNAs are denatured and incubated with metaphase chromosomes or on DNA arrays
The DNAs compete for binding to the target DNA
Resulting relative fluorescence is measured
If there’s an equal sequence between sample and reference,you get a yellow signal. If not you get red or green.
![Page 16: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/16.jpg)
Indications for array CGH Patients with normal chromosome analysis and:
Unexplained developmental delay or mental retardation Dysmorphic features or congenital anomalies Autism spectrum disorders, seizures, or a clinical
presentation suggestive of a chromosomal syndrome Patients with a previously identified chromosome
abnormality: To size deletions or duplications and identify genes involved For apparently balanced rearrangements and an abnormal
clinical phenotype, oligo array analysis can be used to test for cryptic deletions/duplications at the breakpoints
![Page 17: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/17.jpg)
Changes to DNA sequence
~ 1 change every 1,000 bases = 99.9% identical from person to person
CTCGAGGGGCCTAGACATTGCCCTCCAGAGAGAGCACCCAACACCCTCCAGGCTTGACCGGCCAGGGTGTCCCCTTCCTACCTTGGAGAGAGCAGCCCCAGGGCATCCTGCAGGGGGTGCTGGGACACCAGCTGGCCTTCAAGGTCTCTGCCTCCCTCCAGCCACCCCACTACACGCTGCTGGGATCCTGGATCTCAGCTCCCTGGCCGACAACACTGGCAAACTCCTACTCATCCACGAAGGCCCTCCTGGGCATGGTGGTCCTTCCCAGCCTGGCAGTCTGTTCCTCACACACCTTGTTAGTGCCCAGCCCCTGAGGTTGCAGCTGGGGGTGTCTCTGAAGGGCTGTGAGCCCCCAGGAAGCCCTGGGGAAGTGCCTGCCTTGCCTCCCCCCGGCCCTGCCAGCGCCTGGCTCTGCCCTCCTACCTGGGCTCCCCCCATCCAGCCTCCCTCCCTACACACTCCTCTCAAGGAGGCACCCATGTCCTCTCCAGCTGCCGGGCCTCAGAGCACTGTGGCGTCCTGGGGCAGCCACCGCATGTCCTGCTGTGGCATGGCTCAGGGTGGAAAGGGCGGAAGGGAGGGGTCCTGCAGATAGCTGGTGCCCACTACCAAACCCGCTCGGGGCAGGAGAGCCAAAGGCTGGGTGTGTGCAGAGCGGCCCCGAGAGGTTCCGAGGCTGAGGCCAGGGTGGGACATAGGGATGCGAGGGGCCGGGGCACAGGATACTCCAACCTGCCTGCCCCCATGGTCTCATCCTCCTGCTTCTGGGACCTCCTGATCCTGCCCCTGGTGCTAAGAGGCAGGTAAGGGGCTGCAGGCAGCAGGGCTCGGAGCCCATGCCCCCTCACCATGGGTCAGGCTGGACCTCCAGGTGCCTGTTCTGGGGAGCTGGGAGGGCCGGAGGGGTGTACCCCAGGGGCTCAGCCCAGATGACACTATGGGGGTGATGGTGTCATGGGACCTGGCCAGGAGAGGGGAGATGGGCTCCCAGAAGAGGAGTGGGGGCTGAGAGGGTGCCTGGGGGGCCAGGACGGAGCTGGGCCAGTGCACAGCTTCCCACACCTGCCCACCCCCAGAGTCCTGCCGCCACCCCCAGATCACACGGAAGATGAGGTCCGAGTGGCCTGCTGAGGACTTGCTGCTTGTCCCCAGGTCCCCAGGTCATGCCCTCCTTCTGCCACCCTGGGGAGCTGAGGGCCTCAGCTGGGGCTGCTGTCCTAAGGCAGGGTGGGAACTAGGCAGCCAGCAGGGAGGGGACCCCTCCCTCACTCCCACTCTCCCACCCCCACCACCTTGGCCCATCCATGGCGGCATCTTGGGCCATCCGGGACTGGGGACAGGGGTCCTGGGGACAGGGGTCCGGGGACAGGGTCCTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTCCGGGGACAGGGGTGTG
![Page 18: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/18.jpg)
What is the effect of a DNA change?
½½
chocolatechocolate
White LilyWhite Lily
![Page 19: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/19.jpg)
DNA change can lead to different results
DeleteriousDeleteriousNo change ???
Neutral variationNeutral variation mutationmutationpolymorphismspolymorphisms
height, weightresponse to certain drugs, hair, skin, eye color
Inborn errors of metabolism, cystic fibrosis, sickle cell anemia, cancer
![Page 20: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/20.jpg)
Mutation can occur in different places across a gene
1 2 3 4 51 2 3 4 5X
promoterpromoterX X X
![Page 21: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/21.jpg)
Clinicians often don’t use pedigrees
“Although there are several obstacles, ... a common underestimation by clinicians of the value of the family history, …”
2% 8%
33%
57%
Blue – 57% - no significant family hxRed – 33% - one chronic conditionYellow – 8% - twoPink – 2% - three or more
(3) Scheuner, et al. Am J Med Genet 1997, 71:315-324.
![Page 22: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/22.jpg)
Pedigree vs. Questionnaire
Focus on individuals by asking about each person in family
Trigger patient memory Easier to see patterns Use to explain patterns Demonstrates biological relationships “Amount of genetic information shared” Reveals social relationships
![Page 23: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/23.jpg)
Family history can provide the basis for:
Making a diagnosis Determining who is at risk and level of risk Assessing needs for education and
psychosocial support
![Page 24: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/24.jpg)
Rules
Squares for males Circles for females Relationship line (horizontal) – connects
partners – double slash equals separation Line of descent (vertical) Sib-ship line (horizontal)
![Page 25: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/25.jpg)
Information to collect
Initials or first name – particularly affected Ages or dates (year) of birth Decades for adult onset concerns okay Unaffected just as important as affected If affected, note age of onset Deceased – slash – age and cause – include
lost pregnancies
d. 58 Colon CA
![Page 26: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/26.jpg)
More information to collect Physical and mental health of each individual Birth defects, developmental delay, mental
retardation, inherited disorders, chronic conditions?
Build key – shading, patterns, etc. Watch abbreviations – add to key as you go Date pedigree, Where and who collected Who reported information - Historian
![Page 27: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/27.jpg)
What to look for:
Mental retardation/
developmental delay Birth Defects Obvious genetic
conditions Infertility/miscarriage
Early age of onset Multiple affecteds Individuals who are
affected multiple times Particular constellations
of features Pattern of inheritance
![Page 28: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/28.jpg)
35 33 30
6263
Dx 48d. 50
Dx 4258
60
28
90
61Type 2 diabetes
Dx. 45
82 82
Breast cancer
![Page 29: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/29.jpg)
35 33 30
6263
Dx 75d. 77
5860
28
90 82 Dx 7680
Breast cancer
Dx 68d. 75 MI
![Page 30: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/30.jpg)
35 33 30
d. 40MI
63
d. 35Car accident
5860
28
90 d. 86Prostate ca
Dx 54d. 78
Breast cancer
70
Dx 5151
![Page 31: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/31.jpg)
Autosomal DominantAutosomal Dominant• Responsible gene on autosome
• Only 1 copy of mutation needed - normal allele not sufficient to compensate for mutant allele
• Heterozygotes and homozygotes are both affected
![Page 32: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/32.jpg)
• appears in every generation
• each affected person has an affected parent (exceptions!)
• each child of an affected parent has 50% risk to inherit trait.
• unaffected family members don’t transmit phenotype to children (exceptions again).
• males and females equally likely to transmit the trait, to children of either sex.
• male-to-male transmission
• new mutations relatively common
Characteristics of Autosomal Dominant DisordersCharacteristics of Autosomal Dominant Disorders
![Page 33: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/33.jpg)
Autosomal RecessiveAutosomal Recessive• Responsible gene on autosome
• Both alleles of the gene must be defective.
• Frequently due to loss of function (gene is inactivated)
• Heterozygotes are unaffected carriers
aa
Aa Aa
Medium chain acyl CoA dehydrogenase (MCAD)
![Page 34: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/34.jpg)
• If disorder appears >1 family member, typically found within a sibship, not across generations.
• The recurrence risk for each sib of the proband is 25%.
• More common with consanguinity, especially for rare diseases.
• Males and females are equally likely to be affected.
• New mutation is almost never a consideration.
Characteristics of Autosomal Recessive Disorders
![Page 35: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/35.jpg)
Sex-LinkedSex-Linked• Responsible gene on X chromosome (also called “X-linked”)
• Usually for females, both copies of the X chromosome must be affected
• Males, hemizygous for the X chromosome, much more likely to be affected
X-linked mental retardation
![Page 36: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/36.jpg)
Genetics and Prenatal Care
Diagnostic Tests Chorionic Villus
Sampling (CVS) Amniocentesis Testing for single gene
defects
Screens Combined first trimester
screen Triple screen/Quad
screen
![Page 37: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/37.jpg)
Genetics and Prenatal Care
Diagnostic Tests Chorionic Villus
Sampling (CVS) Amniocentesis
Screens Combined first trimester
screen Triple screen/Quad
screen
Is 35 a “magic” age cut-off for screening versus testing?Is 35 a “magic” age cut-off for screening versus testing?
![Page 38: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/38.jpg)
From Thompson & Thompson Genetics in Medicine
![Page 39: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/39.jpg)
For an autosomal recessive disorder, what is the family history likely to be?
![Page 40: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/40.jpg)
Carrier TestingThe frequency of Tay-Sachs (prior to the onset of widespread carrier screening among Ashkenazim ) was about:
1/360,000 live births for non-Ashkenazi North Americans, and
1/3,600 for North American Ashkenazi Jews
Carrier frequencies are therefore about:
1/300 for most North Americans, and1/30 for North American Ashkenazi Jews
And within a certain population, particular mutations tend topredominate
![Page 41: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/41.jpg)
Carrier Testing
African Americans: Sickle cell disease 1 in 10
Caucasians: Cystic fibrosis 1 in 25
Ashkenazi Jewish: Tay-Sachs Canavan Disease
1 in 40 Gaucher Disease
1 in 13 Familial Dysautonomia
1 in 30 Cystic fibrosis
1 in 25 Fanconi anemia
1 in 90 Niemann-Pick Disease
1 in 90 Bloom syndrome
1 in 100
What does a negative result tell you?
![Page 42: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/42.jpg)
For an autosomal recessive disorder, what is the family history likely to be?
![Page 43: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/43.jpg)
Newborn Screening
![Page 44: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/44.jpg)
Newborn Screening: WHY ?
Detect an affected infant before before symptoms to prevent or reduce morbidity and mortality
Provide parents and family reproductive options for future pregnancies
Avoid diagnostic odyssey
![Page 45: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/45.jpg)
http://genes-r-us.uthscsa.edu
![Page 46: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/46.jpg)
www.acmg.net/resources Look under “reference materials”
![Page 47: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/47.jpg)
Algorithm for MCADpositive newborn screen
![Page 48: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/48.jpg)
MCAD ACT Sheet
![Page 49: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/49.jpg)
Adults who might seek genetic services:
Those with reproductive problems Those with a known genetic disorder in the
family Those with symptoms of a genetic disorder Those with family history of cancer
![Page 50: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/50.jpg)
Case Study
At the time of her annual physical, your patient, a 30-year old woman, asks about the “breast cancer gene”. She is Jewish and has been reading in the paper that Jewish women may be more likely to have this “gene”. She has two older sisters, aged 33 and 35, who are also worried about their risks.
![Page 51: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/51.jpg)
Cancer risk assessmentSporadic cancerSporadic cancer Familial cancerFamilial cancer
Hereditary cancerHereditary cancer *Early onset cases*Individuals affected with multiple tumors*Particular patterns of tumors Breast and ovarian
Red Flags:
![Page 52: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/52.jpg)
35 33 30
6263
Dx 48d. 50
Dx 4258
60
28
90
61Type 2 diabetes
Dx. 45
82 82
Breast cancer
![Page 53: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/53.jpg)
Genetic testing for BRCA1/2
All testing in North America performed by a single lab, Myriad Exons and adjacent regions sequenced. Also look for large duplications
and deletions. Mutation-specific testing is also available. Possible results:
Mutation positive Mutation negative (known mutation in family) Variant of unknown significance (This happens ~10% of the time) No mutation found
Preferable procedure is to do test on an affected family member first
![Page 54: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/54.jpg)
If our patient tests negative for a BRCA1/2 mutation, what are the possible explanations?
No BRCA1/2 mutation in the family Increased risk
She didn’t inherit the mutation in the family Population risk (1 in 8)
There is a mutation in our patient but we can’t detect it using our testing method. High risk
How can we avoid some of this confusion? Identify a familial mutation Try to test aunt first or test archived tissue sample from
grandmother, if available.
![Page 55: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/55.jpg)
What if the test is positive?
Provide psychosocial support Review cancer risks and management
options Identify at-risk relatives Plan for follow-up
![Page 56: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/56.jpg)
Cancer risks with BRCA mutations
www.myriad.com
![Page 57: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/57.jpg)
Personal risk reduction following BRCA1/2 mutation detection
Increased surveillance Selective estrogen receptor modulators (tamoxifen) Prophylactic mastectomy Prophylactic oophorectomy (usually recommended)
Finch et al. (2006) JAMA 286:185-192
![Page 58: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/58.jpg)
ASCO Guidelines for Hereditary Cancer Testing
Cancer predisposition testing should be offered only when… There is a personal or family history
suggesting a genetic susceptibility to cancer The test can be adequately interpreted The test result will aid in diagnosis or influence
medical management of the patient or family members
![Page 59: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/59.jpg)
Why might somebody who has already had cancer want genetic testing?
They would be at increased risk of other additional primary tumors
Could influence patient management Could help family members
![Page 60: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/60.jpg)
Genetic counseling/risk assessment
When a patient is not interested in or is not a good candidate for cancer genetic testing, genetic counseling and risk assessment are still valuable when there is: A suggestive pattern of cancers in the family or
individual High anxiety A mixture of cancers in the family (suggestive of a
cancer syndrome)
![Page 61: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/61.jpg)
Mendelian versus complex traits
Mendelian traits Are determined by the independent action of a single major
gene Mutation in this gene is necessary and sufficient for
phenotype Have predictable inheritance patterns
Cystic fibrosis
Risk to each sib is 25% and we can do prenatal testing
![Page 62: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/62.jpg)
Mendelian versus complex traits Complex traits
Exhibit familial clustering but not predictable inheritance patterns
Cleft palate
Recurrence risk is 3% (compared to population risk of 0.1%)
![Page 63: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/63.jpg)
Benefits to determining genetic Benefits to determining genetic factors that influence a complex traitfactors that influence a complex trait
Provide a molecular definition of the trait
Improve understanding of disease etiology and mechanism
Can offer early risk assessment
Aids in discovery of new, targeted drugs
Can be utilized for disease prevention
![Page 64: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/64.jpg)
How do we find genes for complex traits?
![Page 65: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/65.jpg)
Search for the occurrence of specific genetic variation at a higher frequency among affected individuals compared to unaffected individuals
Strength of association is measured by an odds ratio
“we identified a variant in the CDKAL1 gene that was associated with T2D in individuals of European ancestry (odds ratio (OR) = 1.20)” Steintorsdottir et al. (2007)
In contrast to studies of Mendelian traits in which you look for mutations throughout a gene that that are inherited with a trait, association studies look for one specific allele that is overrepresented in the case population
An allele is the specific genetic variation in a gene
The sickle cell mutation is an allele of the beta globin gene
We reserve the term “mutation” for alleles that cause disease and are very rare
Association studiesAssociation studies
![Page 66: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/66.jpg)
Association and allele frequency in populationsAssociation and allele frequency in populations
Allele 1
Allele 2
Allele 3
Allele 4
Control Population
Association with allele 1Association with allele 1
Affected Population
Note: the disease-associated allele is found in the control population!
![Page 67: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/67.jpg)
Case Study
A 53-year old African American male has an annual check-up. He is 5’10” and 220 lbs. He reports feeling well. Family history indicates a history of diabetes in his mother that was diagnosed at age 45. She died at age 58 from complications of diabetes after 3 years on dialysis.
![Page 68: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/68.jpg)
“An immediate practical consequence of the discovery, saidDecode’s chief executive, Kari Stefansson, would be todevelop a diagnostic test to identify people who carry thevariant gene. If people knew of their extra risk, they would havean incentive to stay thin and exercise, he said.”
![Page 69: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/69.jpg)
~38% of people examined are heterozygous for the TCF7L2 risk allele
Relative risk if you are heterozygous for the TCF7L2 risk allele is ~1.4. 26% of people in the group without the risk allele had T2D 38% of people in the group heterozygous for the risk allele had T2D
General population risk for T2D is ~33%
TCF7L2 and Type 2 Diabetes
Grant et al. (2006) Nature Genetics 38: 320-323
![Page 70: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/70.jpg)
Why is this study important?
There was no prior evidence that TCF7L2 was involved in diabetes. This gives us a new way to look at the process by which diabetes develops.
Could ultimately lead to new treatments We may find other genes that, in combination with
TCF7L2, help us fully understand genetic contributions to diabetes.
![Page 71: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/71.jpg)
Evaluating Association Studies
Has the result been replicated in an independent population?
How predictive is the genetic variation of disease? How do environmental risk factors interact with this
genetic risk factor? Does the environmental risk have a much bigger role?
Would a genetic test for this variation give us more accurate risk assessment than one based on general family history and lifestyle factors?
![Page 72: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/72.jpg)
Unique Aspects of Genetic Medicine
You’re really treating a family, not an individual
Testing individuals can reveal information about other family members
Testing can be predictive Especially as we move toward genomic tests,
we may find things we’re not looking for
![Page 73: Human Genetics Basics Kate Garber Director of Education Department of Human Genetics kgarber@genetics.emory.edu.](https://reader036.fdocuments.in/reader036/viewer/2022062304/56649d585503460f94a37af5/html5/thumbnails/73.jpg)
Genetic Resources National Society of Genetic Counselors
http://www.nsgc.org/ Genetics Home Reference
http://ghr.nlm.nih.gov/ NIH website with consumer-oriented information on genetic variation and
genetic disease Gene Tests/Gene Reviews
http://www.geneclinics.org/ Current reviews of genetic disorders Labs that offer testing for each, if available Genetic clinics by geographic location
Emory Genetics http://www.genetics.emory.edu/egl/index.php