How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr...

24
How many beans make How many beans make five? Genetic diversity five? Genetic diversity analysis and taxonomy in analysis and taxonomy in the legume the legume Ononis Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes

Transcript of How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr...

Page 1: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.

How many beans make five? How many beans make five? Genetic diversity analysis Genetic diversity analysis

and taxonomy in the legume and taxonomy in the legume OnonisOnonis

Jane KlodaDr D MacDonald, Dr PGD

Dean and Dr S Mayes

Page 2: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.

Morphology

O. repens O. spinosa

Page 3: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.

MorphologyOnonis repens subsp maritima

Page 4: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.

Morphology

Ononis spinosa

Page 5: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.

Geography

Ononis repens Ononis spinosaPreston, CD, Pearman, DA and Dines, TD (2002) New Atlas of the British and Irish Flora

Page 6: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.

Cytology

O. repens2n=60

O. spinosa2n=30

Scale bar = 2μm

Morisset (1967) Watsonia 12:145-153

Page 7: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.

Flow Cytometry

O. spinosa

O. repens

Mode =59

Mode = 30

Page 8: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.

TaxonomyLinnaeus (1753), Morisset (1967)

O. spinosa L. O. repens L.

Greuter (1986)

O. spinosa subsp. spinosa

O. spinosa subsp. intermedia (Rouy) P. Fourn.

O. spinosa subsp. procurrens (Wallr.) Briq.

O. spinosa subsp. maritima (Dumort.) P. Fourn.

Jarvis, Cannon and Ivimey Cook (1983)

O. campestris G. Koch O. repens L.

Sirjaev (1932)

O. spinosa L. (divided into four subspecies plus 11 varieties)

O. repens L. (divided into 8 varieties)

Stace (1997) O. spinosa L. O. x pseudohircina Schur.

O. repens L. O. repens subsp. maritima

Rouy and Foucaud (1897)

O. campestris Koch et Ziz

O. intermedia Mey

O. procurrens Wallr

O. repens L.

Page 9: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.

Aims

• How many groups are British Restharrows divided into genetically?

• Are Ononis repens and Ononis spinosa interbreeding?

• How does this compare with samples from continental Europe?

• Do present levels of genetic diversity give cause for concern?

Page 10: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.

Tools

• Ten microsatellite markers• DNA sequence

– chloroplast – nuclear: coding and non-coding DNA

• 700 plant samples from 40 populations

Page 11: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.

Collection

sitesKey:

O. spinosaO. repensO. natrixOther

Page 12: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.

Ten highly polymorphic microsatellites

LocusNo of alleles

Mean alleles per population

1 47 8.53 33 4.6

11 21 4.316 25 6.317 24 3.721 46 5.622 39 8.424 42 7.126 47 8.728 46 6.2

Page 13: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.

The trouble with tetraploids

10 ACCCTCGCATTACACACACACACACACACACAAAGGTCGACCGTTCAC10 ACCCTCGCATTACACACACACACACACACACAAAGGTCGACCGTTCAC10 ACCCTCGCATTACACACACACACACACACACAAAGGTCGACCGTTCAC08 ACCCTCGCATTACACACACACACACACAAAGGTCGACCGTTCAC

Is indistinguishable from:

10 ACCCTCGCATTACACACACACACACACACACAAAGGTCGACCGTTCAC10 ACCCTCGCATTACACACACACACACACACACAAAGGTCGACCGTTCAC08 ACCCTCGCATTACACACACACACACACAAAGGTCGACCGTTCAC08 ACCCTCGCATTACACACACACACACACAAAGGTCGACCGTTCAC

Quantitative scoring: 10,10,10,08 and 10,10,08,08Qualitative scoring: 10,08,00,00 and 10,08,00,00

Page 14: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.

Principal Coordinates Analysis

• Similarities between cases• Euclidian distance

– xik variable Xk individual i

– xjk same variable individual j

p

kjkikij xxd

1

2)(

Page 15: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.

PCO British individualsPCO case scores (Euclidean)

repens

Intermedia

maritima

spinosa

Axi

s 2

Axis 1

-0.5

-1.0

-1.4

-1.9

-2.4

0.5

1.0

1.4

1.9

2.4

-0.5-1.0-1.4-1.9-2.4 0.5 1.0 1.4 1.9 2.4

Axis 1 = 10.3 %Axis 2 = 4.2 %

Page 16: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.

PCO British populations PCO case scores (Euclidean)

repens

spinosa

Axi

s 2

Axis 1

-0.3

-0.5

-0.8

-1.0

-1.3

0.3

0.5

0.8

1.0

1.3

-0.3-0.5-0.8-1.0-1.3 0.3 0.5 0.8 1.0 1.3

Axis 1 = 27 %Axis 2 = 11.5 %

Page 17: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.

PCO all populationsPCO case scores (Euclidean)

Spanish O. spinosa

British O. repens

German O. repens

British O. spinosa

Spanish O. natrix

Spanish O. diffusa

French O. repens

French O. spinosa

Spanish O. viscosa

Axi

s 2

Axis 1

-0.3

-0.7

-1.0

0.3

0.7

1.0

1.3

1.7

-0.3-0.7-1.0 0.3 0.7 1.0 1.3 1.7

Axis 1 = 19.5 %Axis 2 = 14.8 %

Page 18: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.

Nei’s genetic distance

)/(log YXXYe JJJDs

xi, yi frequencies of ith allele in populations X and Y

probability that two randomly chosen genes in population X are identical is jx=Σxi

2,

in population Y it is jy=Σyi2

probability of identity for both populations is jxy=Σxiyi.

Jx, Jy and Jxy arithmetic means of jx, jy and jxy, over all loci.

Page 19: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.

Nei’s genetic distance

1

O.repens 19

O.repens 8

O.repens 1 O.repens 22

O.repens 4 O.repens 5 O.repens 2

O.repens 10 O.spinosa 13

O.repens 12r

O.spinosa 12s

O.repens 6

O.repens 17

O.repens 18

O.spinosa 3

O.spinosa 7 O.spinosa 14

O.spinosa 21

O.spinosa 15

O.spinosa 9

O.spinosa 16

Page 20: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.

DNA sequencing

• Chloroplast DNA – trnL spacer• Nuclear – β-amyrin

sequence:intron/exon/protein• Nuclear – microsatellite locus 1

flanking region

Page 21: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.

DNA sequencing

• For O. repens and O. spinosa: – No variation in chloroplast DNA

sequence (except German)– Low variation in β-amyrin sequence, no

species differentiation– High variation in microsatellite flanking

regions, no species differentiation• For other Ononis species, consistent

relationships were revealed

Page 22: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.

Conclusions

• The ten microsatellites are effective – at differentiating O. spinosa and O.

repens in Britain– for studying genetic diversity in

populations of continental Ononis species

• The DNA sequences are effective– for cross-species comparisons

Page 23: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.

Conclusions

• Ononis spinosa and O. repens are not freely interbreeding in Britain

• The same pattern appears in France• There is no further genetic

differentiation between ecotypes• O. spinosa and O. repens are similar in

the DNA sequences studied• Levels of genetic diversity are high and

do not give cause for concern

Page 24: How many beans make five? Genetic diversity analysis and taxonomy in the legume Ononis Jane Kloda Dr D MacDonald, Dr PGD Dean and Dr S Mayes.

Thanks!It is my pleasure to acknowledge:

Dr Sean MayesDr Don MacDonaldDr Peter DeanChris MaddrenDr. François BallouxDr. Johannes Vogel

Cambio and BBSRC