HLA-B27-specific Immune Response to Influenza is ... · Ali Akram Doctorate of Philosophy in...
Transcript of HLA-B27-specific Immune Response to Influenza is ... · Ali Akram Doctorate of Philosophy in...
HLA-B27-specific Immune Response to Influenza is Critically
Dependent on ERAP-1 and on MHC-I Allelic Co-dominant
Expression
by
Dr. Ali Akram
A thesis submitted in conformity with the requirements for the degree of
Doctorate of Philosophy in Medical Sciences
Institute of Medical Sciences
Faculty of Medicine
University of Toronto
Copyright © 2014 by Ali Akram
ii
HLA-B27-specific Immune Response to Influenza is Critically
Dependent on ERAP-1 and on MHC-I Allelic Co-dominant
Expression
Ali Akram
Doctorate of Philosophy in Medical Sciences
Institute of Medical Sciences, Faculty of Medicine
University of Toronto
2014
Abstract
Genetic studies have demonstrated that both the HLA-B27 and endoplasmic reticulum
aminopeptidase (ERAP) are contributing factors to the pathogenesis of ankylosing spondylitis
(AS). In my studies I have used HLA transgenic (Tg) mice to examine the contribution of HLA-
B7 and ERAP1 to the HLA-B27-mediated immune response to influenza (flu) infection, results
of which could be used as proof of principle for AS.
Influenza infection affects millions of individuals worldwide annually. Because of the
well-established HLA allele-specific epitope recognition, I used flu infection in HLA Tg mice
deficient of endogenous MHC-I expression; i.e., H2-D-/-, H2-K-/- or double knock out (DKO) in a
proof-of-concept strategy to define the details of first, the interaction of HLA-B7 and HLA-B27
and secondly, the contribution of ERAP to allele-specific immunodominance.
Immunodominance during a viral infection is influenced by many factors. To assess
whether co-expression of HLA-B7 and HLA-B27 would influence the immune response in double
HLA Tg mice, I created double Tg B7/B27 mice with intact ERAP expression on a DKO
iii
background. Following flu infection, the dominant anti-viral CTL responses was surprisingly
directed predominantly at the B7-restricted NP418-426 epitope while the CTL response to the
B27-restricted NP383-391 epitope was significantly reduced. Using chimeras and flu-specific
tetramer staining I showed that the reduced B27/NP383-391 CTL response in B7/B27 Tg mice
was due to negative selection of T cells specific to NP383-391 recognition. Secondly, recent
genome-wide association studies (GWAS) with AS patients have shown that loss-of-function
genetic variants of ERAP1 are protective, and that this relationship is seen exclusively in B27+
patients. To investigate these interactions in an in vivo model, I created single Tg B7 and B27 mice
in the absence of ERAP. Following flu infection the B27/NP383-391 CTL response was reduced
in B27/ERAP-/- Tg mice compared to B27/ERAP+/+ mice. No difference in the CTL response to
the B7/NP418-426 epitope was observed between the B7/ERAP-/- and B7/ERAP+/+ mice. This is
the first in vivo validation of the gene-gene interaction between B27 and ERAP1 which had been
suggested by prior genetic studies.
iv
Acknowledgments
This has been a long journey and I would not have been able to go through this
voyage without the support of my wife, my son and my family.
My beautiful wife encouraged me to achieve my goals when it seemed almost
impossible. Her continuous support and love enabled me to fulfill my dream.
I love you very much Ghizal Jan!
Qand Pader, Yusuf Aryan Jan, you are the best gift God could have given us.
Having you and playing with you on a daily basis changed me forever.
I love you so much Babeh Babah!
v
Contributions
Chapter 1
A part of this chapter describing the factors contributing to immunodominance was
published in the journal of Clinical Immunology. The citation for this article is: Akram A and
Inman RD. Immunodominance: a pivotal principle in host response to viral infections. Clin
Immunol. 2012 May; 143(2):99-115. Some minor parts of this chapter was also published as part
of my MSc thesis.
Chapter 3
This chapter describing the effects of dual HLA allele co-expression influencing the flu
response was published in the European Journal of Immunology. I did all the experiments and
analysis. I prepared the draft for publication. The citation for this article is: Akram A and Inman
RD. Co-expression of HLA-B7 and HLA-B27 alleles is associated with B7-restricted
immunodominant responses following influenza infection. Eur J of Immunol 2013 Dec; 43(12):
3254-67.
Chapter 4
This chapter describing the role of ERAP in flu response of HLA Tg mice has been
published in the Journal of Immunology. The citation for this article is: Ali Akram, Aifeng Lin,
Eric Gracey, Cathy Streutker, Robert D. Inman. .HLA-B27, but not HLA-B7, Immunodominance
to Influenza is Uniquely ERAP Dependent. J Immunol. 2014 Jun 15; 192(12):5520-8
vi
Aifeng Lin and Eric Gracey helped with mouse genotyping. Cathy Streutker helped with
the scoring of the H and E slides. All authors approved the draft. I did all the described
experiments and analysis. I prepared the draft for publication.
vii
Table of Contents
Acknowledgments……………………………………………………………………… iv
Contributions………………………………………………………………………….... v
Table of Contents………………………………………………………………………. vii
List of Figures ………………………………………………………………………….. xiv
List of Tables…………………………………………………………………………… xvi
List of Abbreviations …………………………………………………………………… xvii
Chapter 1 Introduction ………………………………………………………………... 1
1 MHC Molecules and Their Role in the Immune system……………………………… 1
1.1 MHC Class I and Class II…………………………………………………………… 1
1.2 Antigen Processing and Presentation ………………………………………………. 4
1.2.1 Antigen Processing and Presentation by Class I………………………….. 7
1.2.2 Calnexin…………………………………………………………………… 7
1.2.3 ERp57……………………………………………………………………… 8
1.2.4 Calreticulin………………………………………………………………… 11
1.2.5 Proteasome………………………………………………………………… 12
1.2.6 Cytosolic Aminopeptidases ………………………………………………. 14
1.2.7 TAP……………………………………………………………………….. 16
1.2.8 Tapasin ……………………………………………………………………. 17
1.2.9 Endoplasmic Reticulum Aminopeptidase 1………………………………. 20
1.2.10 Peptide Loading to MHC Class I and Transport From The ER to Golgi…. 21
1.2.11 Presentation of Exogenous Peptides by MHC Class I Molecules………… 22
viii
1.3 Recognition of MHC Class I/Peptide Complexes (pMHC-I) by CD8+ T Lymphocytes and
Memory T Cell Generation………………………………………………………………… 23
1.4 Influenza A…………………………………………………………………………...... 27
1.5 Introduction to Immunodominance (Clin Immunol. 2012 May; 143(2): 99-115)…….. 31
1.5.1. Factors Influencing Immunodominance in Flu Infections………………….. 32
1.5.1.1 Prior Infection History…………………………………………….. 34
1.5.1.2 Route of Viral Infection…………………………………………… 34
1.5.1.3 Viral Mutation…………………………………………………….. 35
1.5.1.4 Role of Proteasome……………………………………………….. 36
1.5.1.5 Role of Transporter with Antigen Processing (TAP)……………... 37
1.5.1.6 Endoplasmic Reticulum Aminopeptidase (ERAP)………………... 38
1.5.1.7 Role of Tapasin……………………………………………………. 39
1.5.1.8 Co-expression of Multiple MHC Class I Alleles………………….. 40
1.5.1.9 Role of Enzymes Involved in TCR Generation……………………. 42
1.5.1.10 T Cell Precursor Frequency……………………………………..... 43
1.5.1.11 TCR:pMHC Binding……………………………………………… 44
1.5.1.12 Role of Granzymes………………………………………………... 45
1.5.1.13 Role of Memory T Cells…………………………………………... 45
1.5.1.14 Role of Regulatory T Cells (Treg)………………………………..... 47
1.5.1.15 Host Age ………………………………………………………….. 48
1.5.1.16 Other Factors ……………………………………………………… 48
1.5.2 Immunodominance: Summary…………………………………………….... 50
ix
1.6 MHC Class I Genes and HLA-B Locus……………………………………………… 51
1.6.1. HLA-B27…………………………………………………………………… 52
1.6.2. HLA-B7…………………………………………………………………….. 54
1.7 MHC Class I genes and Spondyloarthritis……………………………………………. 55
1.7.1 Ankylosing Spondylitis (AS)………………………………………………... 56
1.8 Endoplasmic Reticulum Aminopeptidase (ERAP)…………………………………..... 58
1.8.1. ERAP: Structure……………………………………………………………. 59
1.8.2. ERAP: Function…………………………………………………………….. 62
1.8.2.1 ERAP: Peptide Presentation……………………………………….. 64
1.8.2.2. ERAP: Unstable pMHC-I Complexes……………………………. 65
1.8.3. ERAP in AS………………………………………………………………… 66
1.8.4. ERAP in other Diseases……………………………………………………. 66
1.8.5. Development of ERAP Deficient Mice……………………………………. 67
1.9 Development of HLA Tg Mouse Models for Studying The Human T Cell Response to Viral
Infection…………………………………………………………………………………… 68
Chapter 2. Aims and Hypothesis……………………………………………………….. 69
2.1 Aim……………………………………………………………………………………. 69
2.2 Hypothesis…………………………………………………………………………….. 70
x
Chapter 3.
Co-expression of HLA-B7 and HLA-B27 alleles is associated with B7-restricted
immunodominant responses following influenza infection. Eur J of Immunol 2013 Dec;
43(12): 3254-67................................................................................................................... 71
3.1 Introduction…………………………………………………………………………… 71
3.2 Materials and Methods………………………………………………………………… 74
3.2.1 Double Transgenic HLAhyb/H2-K-/-D-/- Double Knockout Mice (DKO)
Generation………………………………………………………………… 74
3.2.2 Flow Cytometry Analysis…………………………………………………. 74
3.2.3 Tetramer Staining and Enrichment of Antigen-specific CD8+ T Cells…… 75
3.2.4 Influenza A/X31 (H3N2) Infection and IFN-γ ELISpot Assays…………. 76
3.2.5 In vitro Peptide Stimulation, Peptide and NP DNA Immunization………. 76
3.2.6 Generation and Identification of HLA Tg Chimeras…………………….. 77
3.2.7 Statistical Analysis………………………………………………………. 77
3.3 Results ………………………………………………………………………………. 79
3.3.1 Characterization of a novel Tg HLA-B7/B27/H2 DKO mouse…………. 79
3.3.2 CD8+ response to influenza infection: B7/NP418-426 dominates the CD8+ response
in B7/B27 Tg mice………………………………………………………. 79
3.3.3 Differential class I expression level and antigen processing do not contribute to
immunodominance………………………………………………………. 87
3.3.4 Lower number of naive B27-restricted NP383-391 specific CD8+ T cells in double
Tg B7/B27 mice…………………………………………………………. 93
xi
3.3.5 Increased peripheral TCR Vβ repertoires of flu-infected Tg B7/B27 mice compared
to naive mice……………………………………………………………. 101
3.3.6 Tetramer staining of HLA Tg chimeras: deletion of naive B27/NP383-391 CD8+ T
cells …………………………………………………………………….. 104
3.4 Discussion…………………………………………………………………………… 113
3.5 Conclusions…………………………………………………………………………. 116
Chapter 4.
HLA-B27, but not HLA-B7, Immunodominance to Influenza is Uniquely ERAP-Dependent.
J Immunol. 2014 Jun 15; 192(12):5520-8 .……………………………………………. 117
4.1 Introduction………………………………………………………………………… 117
4.2 Materials and Methods…………………………………………………………….. 121
4.2.1 Generation and identification of HLA Tg ERAP-/- Mice……………… 121
4.2.2 Flow Cytometry Analysis……………………………………………… 121
4.2.3 Influenza A/X31 (H3N2) Infection and IFN-γ ELISpot Assays……….. 122
4.2.4 Tetramer Staining and Enrichment of Antigen-specific CD8+ T Cells… 122
4.2.5 Peptide Immunization …………………………………………………. 123
4.2.6 Body Weight Loss and H and E Staining……………………………… 123
4.2.7 Cytokine Analysis……………………………………………………… 124
4.2.8 Statistical Analysis ……………………………………………………. 124
4.3 Results……………………………………………………………………………... 125
4.3.1 Characterization of novel B7/ERAP-/- and B27/ERAP-/- Mice…………. 125
xii
4.3.2 Reduced B27/NP383-391 CD8+ T cell response in flu-infected B27/ERAP-/- Tg
mice ……………………………………………………………………… 125
4.3.3 Reduced viral clearance in B27/ERAP-/- Tg mice………………………. 127
4.3.4 Flu infected B27/ERAP-/- Tg mice have reduced levels of inflammatory cytokines
and increased edema……………………………………………………… 133
4.3.5 Reduced number of B27/NP383-391 CD8+ T cell in B27/ERAP-/- Tg mice.. 134
4.3.6 Deletion of Vβ8.1+ CD8+ T cells in B27/ERAP-/- Tg mice………………. 137
4.3.7 Generation and presentation of B27/NP383-391 flu epitope is
ERAP-dependent………………………………………………………….. 140
4.4 Discussion…………………………………………………………………………….. 143
4.5 Conclusion…………………………………………………………………………….. 147
Chapter 5. Conclusions and Future Directions ………………………………………. 148
5.1 Conclusions………………………………………………………………………….. 148
5.2 Future Directions……………………………………………………………………. 149
5.2.1 Studies of ERAP Expression in B27/ERAP Tg Mice…………………… 149
5.2.2 What is the actual length of the N-terminally extended B27/NP383-391 epitope
before it is trimmed by ERAP?................................................................... 149
5.2.3 Introduction of human ERAP-variants linked to AS to B27/ERAP-/- mice. Does
the introduction of human ERAP-variants associated with AS (e.g., 30187)
rescue the B27-directed T cell response in B27/ERAP-/- mice following flu
infection?.................................................................................................... 151
xiii
5.2.4 Overexpression of ERAP in B27/ERAP-/- Tg mice. Does overexpression of
ERAP lead to AS-like symptoms in single Tg B27/ERAP-/- mice?............ 152
5.2.5 Presence of HLA-B27 homodimers in B27/ERAP-/- Tg mice. Does absence of
ERAP lead to increased homodimerazation of B27 molecules?.................. 153
5.3 Studies of ERAP Expression in B27 Tg Rats…………………………………...... 153
5.3.1. Down regulation of ERAP in rat AS animal model. Does down regulation of
ERAP lead to decreased AS symptoms?....................................................... 153
5.4 Final Conclusions …………………………………………………………………….... 154
References …………………………………………………………………………….... 155
xiv
List of Figures
Figure 1.1 The structure of HLA-B2705……………………………………………… 3
Figure 1.2 Model of separate antigen-presenting pathways for endogenous and exogenous
antigens……………………………………………………………………. 5
Figure 1.3 The classical pathway of antigen processing and MHC class I biogenesis... 9
Figure 1.4 Stoichiometry and molecular architecture of the MHC class I peptide-loading
complex (PLC)…………………………………………………………….. 18
Figure 1.5 The structure of a TCR bound to the HLA-B2705 class I:peptide complex..26
Figure 1.6 Influenza A life cycle and host immune response following flu infection… 29
Figure 1.7 The structure of ERAP…………………………………………………….. 60
Figure 3.1 Characterization of Double Tg B7/B27 Mice……………………………... 80
Figure 3.2 ELISpot analysis of the CD8+ CTL response to flu infections in single and double
A2/B7 and A2/B27 Tg mice……………………………………………..... 82
Figure 3.3 ELISpot analysis of flu-infected single and double HLA Tg B7/B27 mice.. 85
Figure 3.4 The LN expression level of A2, B7, and B27 as detected by allele specific mAb in
HLA Tg mice……………………………………………………………..... 88
Figure 3.5 Peptide and NP DNA immunization and in vitro stimulation of flu infected HLA
Tg mouse splenocytes………………………………………………………90
Figure 3.6 Enumeration of naive and flu-infected enriched T-cell populations in different Tg
mice using B7/NP418-426, B27/NP383-391, and the WT/NP366-374 flu
tetramers……………………………………………………………………95
Figure 3.7 Enumeration and kinetics of naive and flu infected enriched T cell populations in
single and double Tg A2/B27 and A2/B7 mice…………………………….98
xv
Figure 3.8 Analysis of TCR Vβ repertoire of naive and peptide-stimulated CD8+ T cells from
flu infected Tg mice……………………………………………………… 102
Figure 3.9 Description and identification of HLA Tg chimeras…………………….. 105
Figure 3.10 ELISpot analysis of flu-infected HLA Tg chimeras……………………... 108
Figure 3.11 Tetramer quantification of flu infected T-cell populations and determination of
naive TCR Vβ repertoire of different chimeras………………………….. 111
Figure 4.1 Characterization of HLA Tg ERAP-/- mice………………………………. 126
Figure 4.2 ELISpot analysis of the CD8+ CTL response to flu infections in single and double
HLA Tg ERAP+/+ and ERAP-/- mice…………………………………….... 128
Figure 4.3 Differences in the profile of HLA Tg ERAP+/+ and ERAP-/- Tg mice following flu
infection as examined by body weight baseline change, cytokine analysis and
H&E staining of lung sections……………………………………………. 130
Figure 4.4 Enumeration of naive and flu infected enriched T-cell populations in different Tg
mice using B7/NP418-426, B27/NP383-391, and the WT/NP366-374 flu
tetramers…………………………………………………………………… 135
Figure 4.5 Analysis of TCR Vβ repertoire of ERAP+/+ and ERAP-/- HLA Tg mice. Spleen
cells from naive mice were stained for the expression of CD3, CD8 and various
TCR Vβs…………………………………………………………………… 138
Figure 4.6 Peptide immunization of HLA Tg mice in the presence or absence of ERAP with
canonical and N-terminally extended 14-mer version of flu epitopes…….. 141
xvi
List of Tables
Table 1. Factors contributing to immunodominance following a viral infection…… 33
xvii
List of Abbreviations
A2 HLA-A2 (Transgenic HLA-A2/H2 DKO)
A2/B7 HLA-A2/B7 (Transgenic HLA-A2/B7/H2 DKO)
A2/B27 HLA-A2/B27 (Transgenic HLA-A2/B27/H2 DKO)
Ab Antibody
ABC ATP Binding Cassette
ACE Angiotensin-Converting Enzyme
AIDS Acquired Immunodeficiency Syndrome
A-LAP Leucine Aminopeptidase
APC Antigen Presenting Cell
ARTS-1 Aminopeptidase Regulating Tumor Necrosis Factor Receptor I Shedding 1
AS Ankylosing Spondylitis
ATP Adenosine Triphosphate
B7 HLA-B7 (Transgenic HLA-B7/H2 DKO)
B7/ERAP HLA-B7/ERAP (Transgenic HLA-B7/ERAP-/-/H2 DKO)
B27 HLA-B27 (Transgenic HLA-B27/H2 DKO)
B27/ERAP HLA-B27/ERAP (Transgenic HLA-B27/ERAP-/-/H2 DKO)
B7/B27 HLA-B7/B27 (Transgenic HLA-B7/B27/H2 DKO)
BH Bleomycin Hydrolase
BM Bone Marrow
β2m MHC β2-Microglobulin
CD Cluster of Differentiation
CLIP Class II-associated Invariant Chain Peptide
xviii
CMV Human Cytomegalovirus
Con-A Concavalin A
COP II Coatomer II
CTL Cytotoxic T Lymphocyte
DCs Dendritic Cells
DKO H2-K/H2-D MHC Class I Deficient Mice
DOX Doxycycline
DRIPS Defective Ribosomal Products
EBV Epstein Barr Virus
ER Endoplasmic Reticulum
ERAAP Endoplasmic Reticulum Associated Aminopeptidase with Antigen Processing
ERAP Endoplasmic Reticulum Aminopeptidase
ERAP1 Endoplasmic Reticulum Aminopeptidase 1
ERAP2 Endoplasmic Reticulum Aminopeptidase 2
ERK Extracellular Signal-regulated Kinase 1
ES Embryonic Stem Cell
FBS Fetal Bovine Serum
FHC Free Heavy Chain
Flu Influenza A
GAG Glycosaminoglycan
GWAS Genome Wide Association Studies
HA Haemagglutinin
HAUs Hemagglutinating Units
xix
HBV Hepatitis B Virus (HBV)
HC MHC Class I Heavy Chain
HCV Hepatitis C Virus
HIV Human Immunodeficiency Virus
HLA Human Leucocyte Antigen
HPV Human Papillomavirus
HSP60 Heat Shock Protein 60kDa
HUGO Human Genome Organization
IBD Inflammatory Bowel Disease
IBP Inflammatory Back Pain
ICAM-1 Intracellular Adhesion Molecule 1
IFN-γ Interferon Gamma
Ig Immunoglobulin
IL Interleukin
IL-6 Interleukin 6
IL-1a Interleukin 1 Alpha
ImDc Immunodominance
ImD Immunodominant
i.n. Intranasal Infection
i.p. Intraperitoneal Infection
kDa Kilo Dalton
KIR Killer Cell Immunoglobulin-like Receptor
KO Knock-Out
xx
L-Amc Leucine-7-Amino-Methylcoumarin
LAP Leucine Aminopeptidase
LC MHC Class I Light Chain
LCMV Lymphocytic Choriomeningitis Virus
LIR Leukocyte Immunoglobulin-like Receptor
LMP2 Low Molecular Protein 2 (Proteasomal Component)
LN Lymph Node
L-RAP Leukocyte-derived Arginine Aminopeptidase
M1 Flu Matrix 1 Protein
mAb Monoclonal Antibody
MECL1 Multicatalytic Endopeptidase Complex-Like 1 (Proteasomal Component)
MHC Major Histocompatibility Complex
MHC-I Major Histocompatibility Complex Class I
MIP-1 Macrophage Inflammatory Protein 1
MFI Mean Fluorescence Intensities
MPER Membrane Proximal External Region
MRI Magnetic Resonance Imaging
NA Flu Neuraminidase
NBD Nucleotide Binding Domain
NEP Nuclear Export Protein
NK Natural Killer Cells
NP Flu Nucleoprotein
NS Flu Non-structural Polypeptide
xxi
OVA Ovalbumin
PA Polymerase A Protein
PB1 Polymerase B1
PB2 Polymerase B2
PBLs Peripheral Blood Lymphocytes
PBMC Peripheral Blood Monocytes
PBS Phosphate Buffered Saline
PCR Polymerase Chain Reaction
PILS-AP Puromycin Insensitive Leucyl Aminopeptidase
PLC Peptide Loading Complex
pMHC-I Peptide-bound MHC Class I Complex
POL Polymerase
PSA Puromycin-sensitive Aminopeptidase
R-Amc Arginine-7-Amino-Methylcoumarin
RNA Ribonucleic Acid
RNP Flu Ribonucleoprotein
SbD Subdominant
SFU Spot-forming Unit
shRNA Short Hairpin Ribonucleic Acid
SIJ Sacroiliac Joints
SIV Simian Immunodeficiency Virus
SNP Single Nucleotide Polymorphism
SP Spleen
xxii
SpA Spondyloarthritis
TALEN Transcription Activator-like Effector Nucleases
TAP Transporter Associated With Antigen Processing
TCR T Cell Receptor
TdT Terminal Deoxynucleotidyl Transferase
Tet Tetracyclin
Tg Transgenic
TM Transmembrane
TNF-α Tumor Necrosis Factor Alpha (α)
TOP Thimet Oligoendopeptidase
TPP II Tripeptidyl Peptidase II
TReg Regulatory T Cells
UPR Unfolded Protein Response
VDJ Variable Diversity Joining
WT Wild Type
WIV Whole Inactivated Virus
1
Chapter 1
A part of this chapter describing the factors contributing to immunodominance was published in
the journal of Clinical Immunology. The citation for this article is: Akram A and Inman RD.
Immunodominance: a pivotal principle in host response to viral infections. Clin Immunol. 2012
May;143(2):99-115. Some minor parts of this chapter was also published as part of my MSc thesis.
1 MHC Molecules and Their Role in the Immune System
Major histocompatibility complex (MHC) class I molecules were discovered in studies of
tumour rejection in inbred mice in the mid 1900s (1). Studies by Zinkernagel and Doherty
established the physiological role of these molecules (1). They were able to show that T cells from
a certain infected animal recognize virally infected cells only from genetically identical animals
and not from genetically different animals. These findings defined the basis for the phenomenon
of MHC restriction in which target cell recognition is restricted by the MHC genotype. Based on
these results, subsequent studies concentrated on deciphering the details of MHC restriction and
function in immune system. In subsequent sections below I describe the MHC molecules in detail.
1.1 MHC Class I and Class II
The MHC locus consisting of both class I and class II MHC genes is located on
chromosome 6 in human and chromosome 17 in mice (2). The class I genes in mice are H2-K,-D
and – L while their human counterparts are HLA-A, -B and –C. Overall, each of these genes can
exist in different allelic forms which contribute critically to antigen presentation. Due to the focus
of my thesis, details about MHC class II molecules and genes will not be discussed, except to say
2
that there are two class II genes (i.e., I-A and I-E) in mouse and three class II genes (i.e., DP, DQ
and DR) in human. Generally, class I gene products are found on almost all nucleated cell types,
whereas those of class II are expressed only on antigen-presenting cells (APC) such as B
lymphocytes, dendritic cells (DC) and macrophages, as well as cortical epithelial cells in the
thymus (1).
MHC class I (i.e., MHC-I) genes encode cell surface proteins consisting of a highly
polymorphic heavy chain (HC) and a light chain (LC) which is β2-microglobulin (β2m) (Fig. 1.1).
While the HC is encoded in the MHC locus, the LC is not. The heavy chain is approximately 45
kDa and the LC is 12 kDa. The HC is made up of three extra-cellular domains (i.e., α1, α2 and α3),
a transmembrane domain (TM) and a cytoplasmic domain. The α3 domain and β2m mainly consist
of β sheets whereas the α1 and α2 domains are made up of both α helices and β sheets (Fig. 1.1).
The eight β sheets in the α1 and α2 domains form a ‘floor’ on top of which two α helices are
positioned in an anti-parallel orientation forming the antigen binding site (Fig. 1.1 B)(3). This site
consists of 6 “pockets” (named A to F) or “grooves” (3, 4). These “grooves” are oriented outwards
from the cell membrane. Different peptides have been shown to interact with one or more of these
unique pockets of the antigen binding site of different MHC-I molecules through their anchor
residues (4-6). The chemical composition of the anchor residues, as well as the structural
complementarity between these residues and the class I side chains within the pockets, determine
the pattern of allele-specific peptide binding (4-6). Usually the length of peptides binding to class
I molecules is 8-11 amino acids (aa).
The first three-dimensional structure of a MHC molecule, which was an HLA-A2, was
resolved by Bjorkman et al. in 1987 (3). Subsequent studies by others have shown that all MHC
class I molecules have the same overall general structure but with minor, unique differences that
3
differentiate each allele from the rest (4, 6-8). The bound peptide-MHC class I (i.e., pMHC-I)
complex is expressed on the cell surface where it is recognized by T cells via specific T cell
receptors (TCRs). The detailed description of antigen processing and presentation by MHC class
I and T cell recognition will be discussed below.
Figure 1.1 The structure of HLA-B2705
Legend to Figure 1.1.
The structure of HLA-B2705.
(A) The different domains of HLA-B27 are labeled and color coded as shown. (B) The peptide
binding cleft consisting of α1 (top) and α2 (bottom) domains is shown with its bound peptide (light
blue) as seen from the top looking down at it. The numbers refer to different amino acids located
within the peptide binding groove. Modified from PLoS One (2012): 7(3), e32865. (9)
A) B)
4
1.2. Antigen Processing and Presentation
Successful clearance of a viral infection (e.g., influenza A) relies on the host’s ability to
effectively present viral antigenic peptides to T cells in the context of self-MHC class I molecules.
Following an infection, a complex multi-step process involving the action of several different
proteins (i.e., antigen processing) leads to the generation of antigenic peptides which are then
presented on the cell surface by MHC-I molecules. MHC-I molecules mostly present peptides
derived from endogenous proteins (Fig. 1.2 A)(2, 10, 11) which are the products of intracellular
synthesis. These undergo proteasomal processing before being bound and presented by MHC-I
molecules. Viral proteins and tumour antigens provide important sources of foreign peptides that
are presented by MHC-I molecules. Newly synthesised proteins failing to fold properly contribute
to the misfolded and damaged protein group collectively referred to as defective ribosomal
products (i.e., DRIPS). DRIPS presented by MHC-I molecules constitute about 30-70% of the
newly synthesized proteins by ribosomes and are of cytosolic, nuclear, and mitochondrial origins
(12, 13). In contrast to endogenous proteins, exogenous proteins such as bacterial proteins enter
the host by phagocytosis, pinocytosis or endocytosis (Fig. 1.2 B). Exogenous protein-derived
peptides are usually generated in endosomes or in other endocytic compartments and are presented
on the cell surface by MHC class II molecules. While it was assumed for some time that
endogenous peptides were only presented by MHC class I and exogenous peptides by MHC class
II, recent findings have shown that class I molecules are also capable of presenting exogenous
peptides under certain circumstances through a process called cross presentation (14-16). A
number of different pathways have been suggested to explain how cross presentation occurs, and
I will discuss some of these pathways briefly in Section 1.2.11. Overall, the steps and proteins
involved in the classical pathway of peptide generation for MHC-I presentation described below
are similar for both humans and mice.
5
Figure 1.2. Model of separate antigen-presenting pathways for endogenous and
exogenous antigens.
ERAP
MHC Class I MHC Class II
Invariant Chain
Endogenous
Pathway
Exogenous
Pathway
A) B)
6
Legend to Figure 1.2
Model of separate antigen-presenting pathways for endogenous and exogenous antigens.
Peptides generated through the endogenous pathway (A) are presented by MHC class I whereas
those originating from the exogenous environment (B) are presented by MHC class II. The details
of each pathway are not shown. Please refer to text for explanation of abbreviations. Modified
from Nature Reviews Immunology 2012: 813-820. (17)
7
1.2.1 Antigen Processing and Presentation by MHC Class I
Following infection, viral proteins are degraded by proteasomes and the resulting peptides
are transported by the transporter associated with antigen processing (TAP) into the endoplasmic
reticulum (ER). In the ER, the newly generated peptides are loaded onto newly synthesized MHC
class I molecules with the help of calnexin, calreticulin, tapasin, and ERp57. These class I
molecules subsequently leave the ER and go through the Golgi before being presented on the cell
surface (Fig. 1.3). Together, these processes are collectively referred to as antigen processing and
presentation and the different components contributing to this process are described in detail
below.
1.2.2 Calnexin
Immediately after synthesis, the MHC class I HC enters the ER lumen and becomes
associated with a chaperone called calnexin (18, 19)(Fig. 1.3). Calnexin, discovered in 1991 (19),
is a transmembrane protein which has been shown to bind to incompletely assembled and
misfolded glycoproteins and to promote their proper folding (20). For MHC-I molecules, calnexin
helps proper folding of the HC and association with β2m (21). Upon association of the HC with
β2m and peptide, calnexin is released from the complex, while in the absence of β2m and peptide
it promotes the retention of the HC in the ER (22-25). Thus, calnexin functions as a ‘quality
control’ point preventing proteins such as MHC-I HC from reaching the Golgi in their non-native
form (20). Phosphorylation of calnexin prevents the release of partially misfolded proteins to the
secretory pathway (24, 25) indicating how calnexin is regulated in vivo. Beside these functions,
calnexin is also involved in apoptosis (26) and plays an important role in controlling coronavirus’
8
ability to infect hosts in the severe acute respiratory syndrome (27). The details of calnexin’s role
in ImDc will be discussed below (Section 1.5).
1.2.3 Antigen Processing and Presentation: ERp57
Another protein, a thiol-dependant oxido-reductase named ERp57, aids in disulfide bond
formation of the HC and β2m proteins (28). Since association of the class I HC with β2m is non-
covalent and unstable, this protein is thought to stabilize the HC/β2m complex (28). ERp57 was
initially named ERp60, but in 1998 it was renamed ERp57 reflecting its actual molecular weight
(29-31). ERp57 was shown to bind to newly synthesized glycoproteins (29-31). It binds covalently
with tapasin via a disulfide bond and appears to work cooperatively with calnexin and calreticulin
(see below) to assist in substrate folding (32). Also, the ability of ERp57 to carry out disulfide
reduction/re-oxidation reactions has linked it to making the peptide binding groove more receptive
to peptide loading (33). Studies with ERp57-deficient B cells (ERp57 knock-out mice do not
survive) revealed reduced MHC-I expression, reduced pMHC-I complex formation due to
suboptimal peptide loading, and lower antigen presentation (34). MHC class I molecules interacted
briefly with the peptide loading complex when ERp57 was absent. This indicated ERp57 is
essential for stabilizing the peptide-loading complex. Together, ERp57 contributes to formation of
a stable peptide-bound MHC-I molecule.
9
Figure 1.3 The classical pathway of antigen processing and MHC class I biogenesis
ERp577
Calreticulin
Tapasin TAP
Newly synthesized MHC heavy chain
Calnexin
β2m
Protein
Peptides
TAP/Tapasin
Calnexin
ER
26S Proteasome
Heavy Chain
Aminopeptidases
ERAP1
Cell Surface
Golgi
Ribosome
pMHC-I
10
The legend to Figure 1.3
The classical pathway of antigen processing and MHC class I biogenesis
Polypeptides containing MHC class I epitopes are tagged with a multiubiquitin chain (not shown)
and are targeted to the 26S proteasome for degradation. Proteasomal processing results in the
generation of various length peptides. Peptides larger than ~15 aa residues may undergo further
trimming by aminopeptidases in the cytosol or in the ER to the correct length (~8-11aa). The newly
synthesized class I heavy chain (HC) first binds to calnexin, which promotes its folding.
Subsequently, β2m binds non-covalently to this class I HC forming an unstable heterodimer. This
is followed by the joining of a preformed complex consisting of TAP, tapasin, ERp57 and
calreticulin to this heterodimer. The resulting complex, called the peptide loading complex (PLC),
is ready to receive peptides. Following peptide binding, the newly formed peptide-MHC class I
complex (pMHC-I) is then transported through the Golgi to the cell surface. Refer to text for more
details.
11
1.2.4. Antigen Processing and Presentation: Calreticulin
Studies with human cells have shown calnexin to be replaced by another chaperone called
calreticulin during later steps in MHC class I biogenesis (Fig. 1.3)(35, 36). Mouse class I HC/β2m
complexes, on the other hand, either remain attached to calnexin or are replaced by calreticulin
(37). Calreticulin is a soluble luminal, Ca2+-dependent binding protein with high amino acid
sequence similarity to calnexin (37). Like calnexin, calreticulin binds to newly synthesized
proteins and assists in their proper folding and subunit assembly. It associates with MHC-I prior
to peptide binding and disruption of this association (e.g., by castanospermine)(35) prevents
binding of class I/tapasin to TAP (see below). Calreticulin possibly functions by binding to
peptides and chaperoning them onto MHC-I molecules (38, 39). In the absence of calreticulin, as
shown by studies involving calreticulin-deficient cells (40), unstable/empty class I molecules are
transported at a faster rate out of the ER and are expressed at a reduced level at the cell surface.
This suggests that calreticulin affects the efficiency at which class I molecules exit the ER and are
expressed on the cell surface. These findings also suggest that calreticulin is involved in retaining
the assembly intermediates in the ER. In spite of similarities in their functions, calnexin and
calreticulin have been shown to bind to different glycoproteins for reasons that are unknown (36,
41). Calreticulin also affects the WNT signaling pathway which is essential in embryonic stem cell
pluripotency, growth and proliferation, cell differentiation and embryonic patterning. Calreticulin-
deficient cells reveal disruption of the WNT signalling pathway presumably due to lack of Ca2+
release and activation affecting kinases and phosphatases involved in this pathway (42). Recent
evidence implicated calreticulin in an unfolded protein response during tumor cell therapy. Tumor
cells targeted by radiation therapy experienced enhanced antigen processing and surface
expression of calreticulin inducing enhanced cytotoxic T lymphocyte (CTL) response (43). These
12
results collectively indicate calreticulin is an important component of the peptide loading complex.
Its role in relation to ImDc will be discussed later on (See section 1.5).
1.2.5. Antigen Processing and Presentation: Proteasome and Immunoproteasome
The actions of these aforementioned proteins partially contribute to the formation of an
empty, folded, peptide-receptive MHC class I heterodimer in the ER. This class I heterodimer
becomes stable once a peptide has bound to it. Most of the peptides binding to these class I
heterodimers are generated by proteasomes. Although proteasomes have been shown to function
in protein turnover in many organisms, in mammals they have also been shown to be responsible
for generating peptides presented by MHC class I molecules. Proteins destined for degradation are
usually tagged with a 76 aa polypeptide called ubiquitin. These tagged proteins are recognized,
unfolded and degraded by the proteolytically active 26S proteasome (Fig. 1.3)(44-46). The 26S
proteasome consists of a 20S proteasome core and two 19S regulatory subunits. One 19S
regulatory subunit is found at each end of the 26S proteasome. The 20S core complex is involved
in the degradation of unfolded proteins while the 19S complex is responsible for substrate
recognition and binding (44, 47, 48). The 20S core is a barrel-shaped structure of four stacked
rings, each containing seven α (i.e., α1-α7) and β (i.e., β1-β7) subunits (49). The three β subunits
(i.e., β1i, β2i, and β5i) are replaced following an immune response by induced subunits called low
molecular weight proteins (LMP) 2, LMP10, and LMP7, respectively (50, 51). Proteasomes
incorporating these subunits are called immunoproteasomes (discussed below). The 19S
proteasome is made up of 17 different subunits forming a base and a lid (49, 52). The “base”
contains the ATPase activity responsible for binding and unfolding of the substrate, while the lid
is thought to be involved in de-ubiquitination (52). Studies where proteasome activity was
13
inhibited with specific inhibitors have shown impaired MHC-I assembly and peptide presentation
(53-56), thus demonstrating the importance of the proteasome in antigen presentation.
Proteasomes can cleave proteins at the C-terminal side of basic and hydrophobic amino
acids using trypsin-like activity and chymotrypsin-like activity, respectively (47, 55, 57). The
generated peptides mostly have the correct C-terminus whereas the N-terminus is sometimes
extended and needs further trimming by various aminopeptidases (see below). Peptides generated
by proteasomes vary in length from ~3 to approximately 40 residues, many of which are too short
(i.e., less than 8aa) to function in antigen presentation. TAP transporters are capable of transporting
peptides of up to 40 residues long, although they preferentially transport shorter peptides (~8-16
residues) at a more efficient rate (58-60). Since about 25-30% of the newly generated peptides are
8-11 aa long, these are likely able to act directly as substrates for TAP transporters and MHC class
I molecules (59-62), whereas longer peptides probably require additional processing (see below).
Interferon (e.g., IFN-α, -β, or γ) stimulation leads to the induction of immunoproteasomes
(50, 63). Immunoproteasomes are also constitutively expressed in lymphoid organs such as the
spleen, lymph nodes, and the thymus (64). Compared to 20S proteasomes, immunoproteasomes
are ‘better’ at cleaving peptides after basic and hydrophobic residues, but weaker at cleaving after
acidic residues (65, 66). Besides being involved in antigen processing and presentation,
immunoproteasomes are also involved in generating biologically active proteins (e.g., cytokines)
involved in inflammatory processes, thymocytes development, T cell differentiation and survival
(67). It is interesting to note that immature DCs express equal amount of both proteasomes and
immunoproteasomes while mature DCs predominantly express immunoproteasomes (68). Hence,
it comes as no surprise that the identitiy of peptides generated by immunoproteasomes are mostly
different than those generated by proteasomes. Following infection of HeLa cells with the vaccinia
14
virus expressing the hepatitis B virus core antigen, Kloatzel’s group showed the generation of the
ImD hepatitis B virus 141-151 epitope was immunoproteasome-LMP7 dependent (69). Other
studies showed DCs of mice lacking LMP2, -5- and 7 expression could not present several MHC-
I epitopes normally expressed by WT DCs. The epitope repertoire in these KO mice was about
50% different than that of WT mice (70).
Other than its role in antigen processing and presentation, proteasomes also affect protein
signaling and the induction of inflammatory cytokines. Studies where proteasome activity was
inhibited by a chemical inhibitor (e.g., MG132)(46) showed a reduction in ocular inflammatory
cytokine levels in patients with macular degeneration, the leading cause of blindness. Next, ERK
(extracellular signal-regulated kinase 1) phosphorylation in human monocytes is essential in
priming inflammasomes formed in response to pathogenic infections and tissue damage. Inhibition
of the proteasome in LPS-stimulated human monocytes led to reduced inflammasomes indicating
an important role for the proteasome in priming of inflammasomes (71). The role of the proteasome
in ImDc will be discussed later on (see section 1.5). Collectively, these results show the importance
of proteasomes in antigen presentation.
1.2.6. Antigen Processing and Presentation: Cytosolic Aminopeptidases
As mentioned previously, proteasomes can also generate N-extended precursors. These
precursors are usually 2-25 (59) residues longer than the optimal 8-11 residues capable of binding
to MHC class I molecules. These N-extended peptides are further trimmed to optimal size by
aminopeptidases present in both the cytosol and the ER (Fig. 1.3)(72-78). Tripeptidyl peptidase II
(TPP II) is a cytosolic aminopeptidase which has been shown to remove tri-peptides sequentially
from free N-termini of peptides (79, 80). It has also been shown to generate peptides distinct from
the ones generated by the proteasome, thus increasing the complexity of the MHC class I peptide
15
repertoire. Studies with TPP II deficient mice showed increased MHC-I surface expression
indicating TPP II may also be involved in peptide destruction (81). Another cytosolic
aminopeptidase is thimet oligoendopeptidase (TOP). Saric et al. (2001)(82) found that TOP can
degrade peptides by endoproteolytic cleavage and that the preferred substrates are 6-17 residues
in length. Using human cytomegalovirus Seifert’s group showed inhibition of TOP in Hela cells
did not alter the overall generation- and the CD8+ T cell response to the pp65495-503 epitope
indicating that TOP is selective and does not degrade all cytosolic peptides with 6-17 residue
lengths (83). Other cytosolic peptidases including leucine aminopeptidase (LAP), puromycin-
sensitive aminopeptidase (PSA) and bleomycin hydrolase (BH) affect the overall pool of peptides
generated in the cytosol too. Deficiency in LAP expression led to increased peptide presentation
while no such change was observed when BH and PSA were absent (83-86). Dipeptidyl peptidase
9 is the first cytosolic aminopeptidase capable of removing dipeptides with a proline in the second
position of the MHC-I ligand precursors (87). This is unique as peptides with proline at the first
three amino acid positions usually are not processed within the cytosol or the ER (e.g., by ERAP,
see below). A report by Kessler et al. (2011) showed, other than proteasome, TOP and nardilysin
peptidases can also generate epitope precursors with the correct C-terminus (88). This was the first
report of proteasome-independent cytosolic peptidase activities able to generate epitope C-
terminals. In spite of the presence of cytosolic aminopeptidases, some N-terminally extended class
I precursor peptides are still translocated into the ER in a TAP-dependent fashion (78, 82, 89, 90).
Serwold et al. (2002)(72) were the first ones to show that the ER enzyme, ERAP (discussed in
details in section 1.8), sequentially cleaves residues from the N-terminus of peptides but does not
cleave peptides to less than 8 residues (Fig. 1.3). Recent data by Shen et al. (2011) showed some
peptides with extended C-termini undergo carboxypeptidase trimming in the ER by angiotensin-
16
converting enzyme (ACE)(91). ACE was shown to both destroy and produce epitopes for
presentation in association with major and minor histocompatibility molecules affecting the overall
pMHC-I repertoire. Thus, these reports together indicate that there are several aminopeptidases
residing in both the ER and the cytosol which likely contribute to the array of peptides available
to be presented by MHC-I molecules. Some of these aminopeptidases likely also destroy certain
peptides and thereby limit their presentation. Collectively, aminopeptidases and carboxypeptidases
in the cytosol and the ER contribute to the overall pool of peptides generated in vivo.
1.2.7. Antigen Processing and Presentation: TAP
Newly generated peptides enter the ER lumen with the help of TAP and some of these
become part of the peptide loading complex (PLC), whereas others are degraded. The PLC
consists of the class I HC/β2m heterodimer, the chaperones calreticulin and calnexin, ERp57, TAP,
and tapasin (Fig. 1.4). Translocation and binding of newly generated antigenic peptides influences
class I HC folding, stability, and translocation to the cell surface, thereby affecting the level of
HC/β2m expression on the cell surface. TAP is a heterodimer consisting of TAP1 and TAP2 which
are both members of the ATP (Adenosine Triphosphate) binding cassette (ABC) family of
transport proteins (92). The genes encoding these subunits are located in the MHC locus (92).
Although the precise membrane topology of TAP1 and TAP2 is still under debate, most recent
studies indicate that TAP1 and TAP2 monomers consist of a nucleotide binding domain (NBD)
and six transmembrane helices forming the core of the transmembrane domain (Fig. 1.4B)(93-95).
Both TAP subunits contain an N-terminal hydrophobic TM domain and a C-terminal ABC domain
which contains the ATP binding site. The TM domains of TAP1 and TAP2 are thought to form a
pore through which peptide substrates are translocated from the cytosol into the ER. Peptide
17
translocation starts with the binding of a peptide to the peptide binding site formed by both TAP1
and TAP2 between the putative pore and the ABC domains (92). The ABC domains hydrolyze
two ATP molecules (Fig. 1.4A) to facilitate induction of conformational changes required for
substrate transfer and subsequent translocation of peptides into the ER lumen (96). Studies with
cell lines deficient in TAP (e.g., T2 or 0.174), as well as with TAP knock-out mice, have shown
decreased levels of class I surface expression indicating the importance of TAP in antigen
presentation and MHC cell surface expression (97-100).
1.2.8. Antigen Processing and Presentation: Tapasin
The other component of the PLC is tapasin (Fig. 1.4). Tapasin is a class I-specific accessory
molecule thought to bridge an interaction between class I and TAP. It brings empty class I
molecules into proximity of the TAP transporter which facilitates peptide loading. Tapasin, first
discovered in 1994, is a 48 kDa type I ER membrane protein (101, 102). It consists of a single
luminal region, a transmembrane domain, and a short cytosolic tail domain (101, 103, 104).
Tapasin’s luminal domain is thought to be involved in class I binding (to the α2 and α3 domains of
the HC)(105) and play an important role in ERp57 and calreticulin interaction. Indeed, tapasin is
covalently linked via a disulfide bond to ERp57 (Fig. 1.4A)(106, 107). The TM domain and the
cytosolic tail have been shown to be important in mediating interaction with TAP (101, 108-110).
Recent data by Cresswell’s group indicate there are three tapasin docking sites on TAP (110).
Manipulation of these sites indicated all three sites to be essential for TAP’s heterodimerization
and stability. In 2012 Hulpke et al. (94) showed that the human PLC consists of two tapasin
18
Figure 1.4 Stoichiometry and molecular architecture of the MHC class I peptide-loading
complex (PLC).
19
Legend to Figure 1.4
Stoichiometry and molecular architecture of the MHC class I peptide-loading complex
(PLC).
(A) Model of PLC showing tapasin, calreticulin, ERp57, TAP, and MHC class I with a bound
peptide. (B) 3D model of the PLC. The different members of the PLC consists mainly of alpha
helices and beta sheets. Please refer to text for complete list of abbreviations. TMD,
transmembrane domain. Modified from Hulpke S et al. (2012) FASEB J. 26: 5071-5080. (94)
20
molecules, with one tapasin molecule bound to each TAP subunit. Blocking of one tapasin
molecule does not affect the overall antigen presentation indicating that one tapasin is sufficient
enough for efficient MHC-I presentation (94). Tapasin’s ability to bind to different members of
the PLC have led to its various suggested roles, including i) formation of a physical bridge between
class I and TAP (101, 111), ii) retention of empty class I molecules in the ER (32, 112, 113), iii)
TAP stabilization (101, 105), iv) peptide editing (114, 115), and v) enhancing peptide transport
(108, 116-118) and peptide binding (106). Recent evidence from Shastri’s lab indicate tapasin
influences the carboxy end of some epitopes (e.g., of LPS origin) affecting the overall peptide pool
available for MHC-I presentation (119). Deficiency in tapasin altered the overall peptide repertoire
leading to both loss and gain of pMCH-I complexes. The 3D structure of tapasin covalently bound
to ERp57 was resolved in 2009 by Reinisch’s group (120)(Fig. 1.4B). Tapasin consists of two core
domains linked by a flexible region. It interacts with the two catalytic domains of ERp57.
Mutational analysis discovered a prominent conserved patch on the surface of the N-terminal
domain of tapasin, absence of which affects the peptide loading and editing functions of the
tapasin-ERp57 heterodimer (120).
1.2.9. Antigen Processing and Presentation: ERAP (Endoplasmic Reticulum Aminopeptidase)
Estimates are that about 50% of proteasome-generated fragments are too small for direct
presentation by MHC class I molecules, ~ 25-30% are of the appropriate size and ~20% are too
large (55, 61, 73). This implies that most of the longer peptides need to be trimmed before properly
fitting MHC-I molecules. Peptides with extended N-terminals are further trimmed by ER
aminopeptidase associated with antigen processing (ERAAP or ERAP). The details of ERAP’s
role in peptide presentation and its structure will be discussed below (section 1.8). Briefly, humans
21
have two ERAP genes (i.e., ERAP1 and ERAP2) while mice only have ERAP1. ERAP trims
peptides with extended N-terminal to the correct length suitable for MHC-I binding. The details
of ERAP’s role in immunodominance will also be discussed in section 1.5.
1.2.10. Peptide Loading to MHC Class I and Transport from The ER to Golgi
A newly synthesized class I molecule achieves its 3D shape with the help of
calnexin/calreticulin and associates with β2m to form an empty heterodimer. Subsequently, this
heterodimer binds to the pre-PLC complex which leads to the formation of a ‘mature’ PLC capable
of accepting peptides (Fig. 1.3 and Fig. 1.4). Thus, association of the MHC class I molecule with
the pre-PLC complex appears to increase its efficiency of receiving peptides. Whether a peptide is
loaded onto a MHC class I molecule randomly or is directed by various members of the PLC is
not entirely clear. However, some studies suggest that tapasin (110, 121), calreticulin (40), ERp57
and TAP aid in loading peptides onto the binding site in the α1/α2 domains of class I molecules. It
has been shown that four class I HC/β2m complexes and four tapasin molecules associate with a
single TAP1/TAP2 heterodimer (120, 122). Aside from these known molecular interactions, it is
possible that there may be additional molecules involved in MHC/peptide complex formation. This
continues to be an active area of investigation.
The newly formed class I HC/β2m and peptide (i.e., pMHC-I) complex exits the ER and is
transported via carrier vesicles, first to the Golgi apparatus and then to the plasma membrane where
it is expressed on the cell surface and available for recognition by T cells (Fig. 1.3). The
mechanisms of ER export are not fully known except that a set of proteins known as coatomer II
(COP II) present in the carrier vesicles seems to promote transport of pMHC-I complexes from
the ER to the Golgi. From the Golgi, these pMHC-I complexes are then transported via vesicles to
22
the cell surface where their membranes fuse with the plasma membrane allowing for cell surface
expression.
1.2.11. Presentation of Exogenous Peptides by MHC Class I Molecules
Normally MHC class I molecules present peptides of endogenous origin (i.e., synthesized
within the cell, discussed previously), but in certain instances they have been shown to present
peptides of exogenous origin (i.e., not synthesized within the cell) through a process referred to as
‘cross-presentation’. Cross-presentation takes place with greatest efficiency in DCs, although
macrophages and some other cell types have been shown to be capable of this activity too (123).
Cross-presentation is one of the main ways tumour antigens and peptides from other micro-
organisms, which do not infect DCs or macrophages directly, are presented by MHC-I molecules.
There is some controversy on the exact mechanisms and pathways leading to exogenous peptide
presentation: some studies indicate that exogenous peptides can be presented by MHC class I
molecules in a TAP-independent manner requiring no peptide transport to the cytosol (123, 124),
whereas others suggest the opposite (i.e., in a TAP-dependent manner), meaning peptides have to
be transported to the cytosol where they can be digested by proteasomes and loaded onto MHC-I
molecules in a TAP-dependent manner. Whatever the mechanisms and the routes, antigens have
to be first internalized by endocytosis, macro-pinocytosis or phagocytosis. Following peptide
internalization, some of these peptides may escape into the cytosol because the endocytic-
compartment is “leaky”. This leakiness has been suggested to be due to the presence of specific
channels or translocators (e.g., Sec61) permitting peptides of certain sizes to escape from the
endocytic compartments (124, 125). Once in the cytosol the same steps as outlined for endogenous
peptides (Fig. 1.2) may take place leading to exogenous peptide presentation by MHC-I molecules.
23
Some other studies (123, 126, 127), however, have proposed the ER to be directly involved in
cross-presentation. During phagocytosis, the ER membrane has been shown to fuse with the
plasma membrane to form the phagocytic cup and the initial phagosome. Proteomic analysis of
isolated phagosomes showed that several ER components, including Sec61, TAP and tapasin, were
present in the phagosome membrane, suggesting that exogenous proteins may gain access to ER-
based MHC class I loading machinery in the phagosomes. Once in the ER, these exogenous
peptides can bind MHC class I molecules like their endogenous counterparts and are eventually
presented on the cell surface. Taken together, these two pathways, in addition to the endogenous
pathway described before (section 1.2), may provide further ways of presenting peptides for
recognition by CD8+ T cells. Collectively, these pathways can affect the overall adaptive immune
response elicited following an infection.
1.3. Recognition of MHC Class I/Peptide Complexes (pMHC-I) by CD8+ T lymphocytes and
Memory T Cell Generation
Following a viral infection, the crucial first step in adaptive immunity is the activation of
naive antigen-specific T cells by antigen-presenting cells in the lymphoid organs. Briefly, naive T
cells respond to viral antigens only if they are presented by APCs in the context of self-MHC
molecules (1) . Both the MHC molecule and its bound peptide have to be recognized by the naive
T cell’s TCR in order to achieve T cell activation (128). The type of TCR (i.e., αβ-TCR), the allele
of the MHC class I molecule (e.g., HLA-B7 vs. HLA-B27), as well as the peptide origin (i.e.,
exogenous vs. endogenous), the sequence and the length of the peptide all play important roles in
T cell activation (128-131). Generally, CD4+ T cells recognize exogenous peptides associated with
class II molecules whereas CD8+ T cells recognize class I-associated endogenous peptide
24
complexes (128). However, due to the nature of this thesis, I will focus on the classical pathway
of antigen processing, presentation and recognition by MHC class I-restricted CD8+ T cells. I will
not deal directly with cross-presentation or with antigen recognition by CD4+ T cells.
CD8+ T cell activation is initiated by the interaction of a TCR-CD3 complex with a pMHC-
I complex (Fig. 1.5)(132). TCR makes contact with both α1 and α2 domains of class I molecule as
well as its bound peptide, whereas CD3 helps in signal transduction initiated by this interaction
(71). Activation is further promoted by the interaction of the CD8 co-receptor molecule with the
pMHC-I complex (128, 130-132). This interaction of TCR-CD3 complex with a pMHC-I complex
enables the T cell and the APC to come closer, allowing for interaction of other molecules with
their ligands. Interaction of co-stimulatory molecules and adhesive molecules with their ligands
(e.g., CD80 or CD86 with CD28 or LFA-1 with ICAM-1), along with the interaction of CD8 co-
receptors with TCR-pMHC-I complexes, initiate a cascade of biochemical events leading to gene
activation and cell cycle induction of resting T cells. The induced gene products, such as IL-2, help
in the differentiation and proliferation of peptide-specific T cells into either effector- (e.g., CTL)
or memory cells, whereas other gene products, such as granzymes, help in the removal of antigen-
infected cells by these activated, peptide-specific T cells (133). Activated CD8+ CTLs destroy
infected target cells through release of membrane disintegrating proteins, such as perforins, or
induction of apoptosis by activating the Fas/FasL pathway (134). After antigen elimination, the
expanded antigen-specific T cell pool contracts substantially through apoptosis and only about
10% of the antigen-stimulated T cells persist as memory cells (135).
Memory T cells provide enhanced protection after re-infection because of their increased
precursor frequency compared with the naive repertoire, and their ability to proliferate and carry
out effector functions at the site of infection. How memory T cells develop from the initial pool of
25
activated T cells is still not completely understood. Different models have been proposed as a
result of investigation of responses to distinct viruses (e.g., influenza)(135-137). These models are
not mutually exclusive. The divergent model predicts that early in the response, a population of
memory cells is formed that persists even after the pathogen has been eliminated and the effector
cells have died. The linear differentiation model, on the other hand, proposes that memory T cells
develop from the effector T cell pool after the antigen load has decreased (138). Nevertheless, after
their formation, memory cells may persist for extended time periods ranging from weeks to months
(in mice) to years (in human) depending on the organism (139, 140). Re-infection with the same
virus initiates clonal expansion of effector T cells from these memory pools and lead to an
increased size of the antigen-specific T cell population in the memory state (135, 138, 140).
With the thematic focus of this thesis, the following sections will first introduce the
influenza virus followed by a discussion of factors contributing to immunodominance in relation
to a viral (e.g., flu) infection in general.
26
Figure 1.5 The structure of a TCR bound to the HLA-B2705 class I:peptide complex
The legend to Figure 1.5
The structure of a TCR bound to the HLA-B2705 class I:peptide complex
The TCR binds to the MHC class I:peptide complex, straddling both the α1 and α
2 domain helices.
TCR, magneta; MHC heavy and light chains, green; bound peptide, orange. HIV-1 peptide, cyan.
Bound β2m not shown. Modified from: Xia Zhen et al. (2014): Scientific Report. Feb 13; 4:4087.
(132)
27
1.4. Influenza A
Influenza virus has been divided into three different types: A, B, C based on disease
pathogenesis (141). Among these, influenza A is best characterized and poses the most serious
threat to public health. According to World Health Organization, in North America alone more
than 15,000 people die due to complications related to influenza infection. This number is even
higher worldwide reaching well over 250,000 deaths per year. Recent emergence of avian
influenza and bird flu strains reinforces the serious threat this virus poses to the human race.
Influenza A virus belongs to the Orthomyxoviridae family of viruses consisting of negative RNA
strands. Its genome consists of eight RNA segments encoding for ten different viral proteins (i.e.,
HA, NA, M1, M2, PB1, PB2, PA, NP, NS1 and NS2)(141). Most of these polypeptides are
incorporated into virions and have known specific functions. Haemagglutinin (HA) and
neuraminidase (NA) play important roles in cell cycle entry and exit, while matrix one (M1) is
thought to act as an adaptor protein between the lipid envelope and the internal ribonucleoprotein
(RNP) particles (141). Polymerase B1 (PB1), B2 (PB2), and A proteins (PA) act as RNA
polymerases, while nucleoprotein (NP) is involved in virion RNA encapsidation (141, 142). The
NS1 and NS2 (Non-structural Protein one and two)(also known as Nuclear Export Protein, NEP)
proteins have been implicated in the export of influenza virus RNP complexes from the nucleus.
A number of reports suggest these proteins may also be involved in the evasion of host immune
response (141, 143, 144).
Viral infection begins with the entry of the virus into host cell through receptor-mediated
endocytosis (Fig. 1.6)(145). After fusion of endosomal and viral membranes, the RNPs are
released into the cytoplasm and then transported into the nucleus. Transcription and replication of
the negative-sense RNA segments take place in the nucleus. The newly generated viral RNAs are
28
transported into the cytoplasm where translation occurs. The resulting viral proteins transit through
the ER and Golgi and combine with the newly replicated RNA segments forming new virion
particles. These virions eventually “bud out”, thereby killing the host cell and then go on to infect
other cells (145). In addition, some of the newly synthesized viral proteins are processed to
peptides by the proteasome (as previously discussed).
Infection with influenza A initiates both an antibody (Ab) response by B cells, and a clonal
expansion of antigen-specific T cells (141, 146) in both humans and mice. T cells acquire various
effector functions allowing them to eliminate infected cells by different means including apoptosis,
while Ab responses are mainly directed against the HA and NA surface proteins. Antibodies help
to block off further viral infection by preventing the binding of the viral particles to host cells (146)
in addition to targeting invading viruses for destruction by either complement or Ab-dependent
cytotoxicity (141, 146, 147). The composition of Abs produced following initial and subsequent
flu infections differ: high levels of IgM make up for the majority of the Abs produced following
first flu infection while IgG constitutes the majority of the Abs produced following subsequent flu
infections. In both humans and mice, specific CTL activity arises within 3-4 days after infection,
peaking by 7-10 days, and then declining after 12 days (141, 148, 149). Within 7-10 days of
primary infection, most virions are eliminated by the viral-antigen-specific killer activity of CTLs,
paralleling the developments of CTLs (148). A second round of infection with the same virus, will
lead to a mainly CTL memory response. Memory CD8+ T cells confer enhanced protection after
re-infection because of their increased precursor frequency compared with the naive repertoire,
and their rapid ability to proliferate and carry out effector functions at the site of infection (141,
148).
29
Figure 1.6 Influenza A life cycle and host immune response following flu infection
Figure 1.5
30
Legend to Figure 1.6
Influenza A life cycle and host immune response following flu infection.
(A) Following influenza infection, the virus binds via its cell surface receptors (i.e., HA) to
epithelial cell surface markers inducing endocytosis. Once inside the cell, the viral genome (i.e.,
RNA) enters the nucleus where replication and transcription take place. Newly transcribed RNAs
move from the nucleus to the cytosol where translation occurs. Some of the newly translated viral
proteins are degraded into peptides by the proteasome and some other cytosolic aminopeptidases
whereas other viral polypeptides combine with the newly formed viral core to give rise to new
viral particles. Peptides degraded within the cytosol are transported into the ER by TAP. Once in
the ER, some peptides may be further trimmed by ERAP before being loaded onto MHC class I
molecules whereas other peptides of the right length and sequence bind directly to newly
synthesized MHC class I molecules. MHC class I molecules are synthesized and loaded with
newly generated peptides within the ER with the help of tapasin, calreticulin, calnexin and ERp57.
Bound peptide MHC class I complexes move along the ER and through the Golgi before being
presented on the cell surface. (B) Thymocytes originating in the bone marrow travel to the thymus
where they mature into functional T cells. Following negative and positive selections, T cells
expressing CD4 and CD8 are generated. CD4+ T cells differentiate further into TH1, TH2, and TReg
cells whereas CD8+ T cells differentiate into CTL following its activation via peptide-MHC class
I-T cell receptor interaction. Infected host cells are destroyed by activated CTL. Subsequently,
most of the activated CTL die while some differentiate into memory T cells persisting for a very
long time. Newly formed viral particles may bud out of their host cell before they are destroyed
by CTL thereby continuing its viral cycle. The numbers refer to different factors contributing to
immunodominance in response to influenza infection (Section 1.5). Adapted from (145).
31
1.5. Introduction to Immunodominance (The majority of this section was published in the journal of
Clin Immunol. 2012 May; 143(2): 99-115)
Following a viral infection, CD8+ CTL recognize viral antigenic peptides bound with a
self-MHC class I molecule on the surface of an infected cell and are thereby activated to lyse that
target cell (137, 150). A central feature of many anti-viral T cell responses is the phenomenon of
immunodominance (ImDc). This refers to the observation that, despite the co-expression of 3-6
different MHC-I molecules on APC, and the potential generation of hundreds to thousands of
distinct 8 to 11-mer viral peptides from the proteins of a typical virus for recognition, a large
proportion of the anti-viral CTL population tends to be dominated by certain class I MHC alleles,
and only a small number of viral peptides are presented by a given class I MHC (151). The peptides
that dominate the recognition events with a particular MHC allele are referred to as the
immunodominant (ImD) epitopes, whereas less-favored peptides are termed subdominant
(SbD)(151).
Immunodominant epitopes have been shown to be critical in eliminating infected cells and
in contributing to the memory T cell pool, thereby enabling the immune system to respond more
rapidly following re-infection. For example, of the 10 different influenza A proteins generated
during infection of H2b mice, one clearly preferred viral epitope recognized by CTL is the NP366-
374 peptide in association with H2-Db (152). The predominant mouse TCR that recognizes this
H2-Db/NP366-374 complex uses the Vβ8.3 chain (152, 153). Although this system seems to work
well for responses to most infections, certain other viruses, like HIV-1 (Human Immunodeficiency
Virus), are highly prone to mutation. As a result, such a focused CTL response against one or a
few specific ImD epitopes may actually constitute a handicap in host response because of the
potential mutation of the ImD epitope and consequent evasion of CTL recognition.
32
Although the mechanisms of ImDc are not completely understood, it appears that almost
every step in the antigen processing and presentation pathway and factors listed in Table 1 may
contribute to ImDc. Some of these factors influence ImDc directly (e.g., negative selection of
potential immunodominant viral epitope specific T cell precursors) whereas others affect it
indirectly (e.g., by inducing changes in the antigen processing and presentation pathways leading
to changes in the overall immune response). There have been examples of ImDc in response to
infections caused by the vaccinia virus (154-157), lymphocytic choriomeningitis virus
(LCMV)(158-160), human cytomegalovirus (CMV)(161), hepatitis B virus (HBV)(162, 163),
hepatitis C virus (HCV) (164), West Nile virus (165), Listeria (166), Epstein Barr virus
(EBV)(167), and HIV-1 (168-173) . Since the preponderance of my studies and studies dissecting
the biologic basis of ImDc focus on influenza A infection, I will concentrate on the lessons learned
from this infection. I will mention ImDc seen with other viral types (e.g., HIV-1) very briefly.
Below is a detailed discussion of different factors contributing to ImDc.
1.5.1. Factors Influencing Immunodominance in Flu Infections
The dominant factors contributing to ImDc are listed in Table 1 and most of these factors
are shown in Figure 1.6. The factors contributing to ImDc function either alone or in combination.
These factors play an important role in ImDc regardless of viral type. A number of studies have
shown evidence of ImDc or a shift of ImDc in flu-infected mice. Most of the anti-viral CTL
responses are directed against the H2-Db/NP366-374 peptide in flu-infected wild type (WT) mice
(152, 153). This predominant CTL response has been shown to be due to the ability of DC and
other APC to present this epitope (174). Other flu peptides, such as PA224-233, are presented only
by DC and hence may be less recognized, compared to NP366-374, by CTL. Flu infection of HLA-
33
B7 or HLA-B27 transgenic mice recognizes ImD flu epitopes NP418-426 and NP383-391,
respectively (152). These same epitopes are also recognized in allele matched humans (152, 175,
176). The individual factors contributing to ImDc are discussed below and are shown and
numbered in no particular order in Figure 1.6.
Table 1. Factors contributing to immunodominance following a viral infection.
Possible Factors
Prior viral infection
Route of viral infection
Viral mutation
Role of proteasome
TAP specificity
ERAP
Calnexin/calreticulin/tapasin
Co-expression of multiple MHC class I
Enzymes involved in TCR generation
Frequency in naive repertoire of T cells with appropriate TCR
TCR:MHC binding
Granzymes
Transport/stability of MHC/peptide complexes
Generation of memory CTL
Treg
Age
Ag processing specificity
Viral protein abundance
Degree of proliferative expansion of T cell following antigen recognition
Competition at the level of Ag processing and presentation
Polymorphism
34
1.5.1.1 Prior Infection History
Prior infection with a specific viral strain may influence the immune response to
subsequent infection with a different viral strain of the same type. The immunodominant CTL
response can be shifted as a result of prior flu infection or flu vaccination as shown by Bodewes
et al. (177). This group showed that flu A/H3N2 infected mice with no prior vaccination with
whole inactivated virus (WIV) had similar anti-viral CTL response against both NP366-374 and
PA224-233 peptides following secondary infection with flu A/H5N1. Yet mice exposed to prior
WIV vaccination or secondary infection with flu A/H5N1 had higher CTL responses directed at
NP366-374 peptide. This demonstrates that prior vaccination with different flu strains may shift
the repertoire of anti-viral CTL responses against a specific ImD epitope. Vaccination with WIV
led to a larger pool of CD8+ CTL recognizing pMHC/NP366-374 complexes instead of
pMHC/PA224-233 complexes. These results confirm previous findings shown by others (152)
indicating the dominance of NP366-374 epitope recognition. Thus, prior viral infection influences
T cell pools capable of recognizing both ImD and non-ImD epitopes.
1.5.1.2 Route of Viral Infection
Immunodominance is also influenced by the route of infection and the subsequent
frequency of precursors capable of responding to ImD epitopes. Jenkins et al. (178) showed that
mice infected intranasally with PR8/H1N1 and X31/H1N1 flu A viruses, which were engineered
to express the ovalbumin OVA257-264 epitope in NA (i.e., PR8-OVA and X31-OVA), showed
similar levels of anti-viral CTL responses to both ImD OVA257-264 and NP366-374 epitopes.
However, the CTL responses to other ImD PA224-233 and PA1.703-711 epitopes were
diminished. PR8-OVA primed mice infected intraperitoneally with X31-OVA led to reduced CTL
35
responses to all known ImD flu epitopes except for OVA256-264 (178). This indicates that
increased frequency of CTL capable of recognizing a specific ImD epitope (i.e., OVA256-264)
could influence the magnitude of CTL responses to other ImD epitopes. Furthermore, the route of
infection seems to affect ImDc as well. Intraperitonal infection leads to reduced antigen
presentation whereas intranasal infection, which is the natural route of flu infection, allows for
more effective antigen presentation. Our studies with flu infected transgenic mice (Chapter 3)
and studies done by others with other pathogens, such as LCMV, have shown the important role
of viral infection route in determining ImDc (160).
1.5.1.3 Viral Mutation
The influenza virus is prone to mutation due to the absence of proof-reading polymerase.
Mutations within a viral genome may affect the overall anti-viral CTL responses in hosts following
viral infections. Changes in the anti-viral CTL responses mostly, but not always, lead to changes
in the overall ImDc following a viral infection. Whether a shift in the overall immune response
and hence ImDc is observed depends on the type of mutation (e.g., point versus frame shift
mutation), the viral type/strain and the host. To investigate the role of mutation to flu, Turner’s
group (179) introduced a point mutation at position 6 of the ImD NP366-374 polypeptide in flu
virus. WT mice infected with the mutated version of flu showed a narrower TCR repertoire.
However, the magnitude of anti-viral CTL response to NP366-374 was similar in mice infected
with both the native and the mutated flu strains. Even the level of CTL activity and cytokine
production was similar among these two groups. These results indicate point mutations in flu
sequences may not always lead to changes in the overall immunodominant response observed. But
these may be exceptions to the norm, as shown by mutation affecting the flu HA and NA proteins.
36
Mutations affecting these proteins allow for viral evasion of host adaptive immunity. In this
context, host immunity has adapted to respond to these viral changes by producing different kinds
of antibodies as opposed to changing the overall anti-viral CTL response. Another example of this
kind of mutation within an ImD flu epitope was reported by Berkhoff et al. (176). They generated
two flu viruses, either with or without the B27-restricted flu NP383-391 epitope (i.e., with a
mutation within the NP383-391 sequence). Peripheral blood monocytes (PBMC) infected in vitro
with the mutated version of flu had an overall reduced level of anti-viral CTL response compared
to PBMCs infected with the WT version of this virus. Thus, a change within the sequence of a
specific viral protein seems to influence ImDc. These reports collectively show mutations as a
result of replication and recombination influence the overall anti-viral CTL response. These reports
also indicate that changes in the overall anti-viral CTL response on the most part, but not always,
influence the overall pattern of ImDc following a viral infection.
1.5.1.4 Role of Proteasome and Immunoproteasome
The role of proteasome is critical in determining ImDc. Most of the peptides binding to
MHC-I molecules are generated by proteasomes. The absence of proteasomal components has
recently been shown to be detrimental on the overall pool of peptides generated following a viral
infection (180). Although proteasomes have been shown to function in protein turnover in many
organisms, in mammals they have also been shown to be responsible for generating peptides
presented by MHC-I molecules as discussed previously (44, 47). A recent study has shown the
absence of the 26S proteasome components lead to a different viral (e.g., LCMV) peptide pool
than when these are present (180). Mice deficient in proteasomal catalytic core components, such
as LMP2 and MECL1 (multicatalytic endopeptidase complex like 1), show overall reduced anti-
37
viral CTL responses to both ImD NP366-374 and PA224-233 epitopes following flu infection
(181). The severity of diminished CTL response was more evident in LMP2 knock out (KO) mice
(LMP2-/-) than in MECL1 KO mice (MECL1-/-). The absence of LMP2 in LMP2-/- mice led to
reduced PA224-233 epitope generation compared to WT mice. Absence of other proteasomal
components, such as LMP7, did not affect the overall presentation of PA224-233 epitope. The
number of CD8+ T cells was also lower (i.e., ~50%) in LMP2-/- mice compared to WT mice
although the TCR Vß usage and PA224-233 peptide avidity was similar to that of WT mice (181).
Thus, this report along with a recent report (180) indicates a direct correlation between the presence
of some proteasomal components and the effects they would have on the overall number of
peptides generated. Reduced number of peptides produced (e.g., PA224-233) can lead to a reduced
number of peptide-specific T cells activated hence affecting the overall immune response to that
particular virus. Other reports with different viruses (181-184) have also shown the importance of
the proteasome in peptide generation. Thus, depending on the peptide some proteasomal
components may affect its generation more than others. Further investigation into each of the
proteasomal components should elucidate their specific roles in peptide generation and hence
ImDc.
1.5.1.5 Role of Transporter with Antigen Processing (TAP)
The transporter associated with antigen processing also plays an important role in ImDc.
Newly generated peptides enter the ER lumen with the help of TAP. As discussed above TAP is a
heterodimer consisting of TAP1 and TAP2. Peptide translocation starts with the binding of a
peptide to the peptide binding site formed by both TAP1 and TAP2 between the putative pore and
the ABC domains (92). Studies with cell lines deficient in TAP (e.g., T2 or 0.174), as well as with
38
TAP KO mice, have shown decreased levels of class I surface expression indicating the importance
of TAP in antigen presentation and MHC cell surface expression (185, 186).
There are no documented instances which demonstrate that TAP plays an important role in
presentation of ImD flu epitopes in mice or humans. However, a recent study by Tenzer et al. (187)
showed the importance of TAP in HIV-1 peptide presentation. This group followed HIV-1 infected
individuals and found that peptide binding and affinity to TAP is critical in peptides being
presented on the cell surface by MHC-I molecules. Peptides not having the correct C-terminal (i.e.,
basic and hydrophobic amino acid) composition and being longer than the desired length preferred
by TAP (i.e., > 45aa in length) for translocation are omitted from being transported into the ER
lumen. This affects the immune response to HIV-1 viral epitopes. Introduction of phenylalanine
at position 79 of a polypeptide, from which many epitopes are generated, reduced its binding
affinity to TAP leading to an overall reduced anti-viral CTL response to peptides that otherwise
would have been ImD (187). This study along with other reports (188-191) with different viruses
and bacteria show how important TAP is to the overall immune response and ImDc.
1.5.1.6 Endoplasmic Reticulum Aminopeptidase (ERAP)
The role of ERAP is becoming increasingly recognized as a key element in
immunodominance. ERAP trims precursor polypeptides in the endoplasmic reticulum to epitopes
of various lengths thereby generating (192) and destroying (193) potential peptides to MHC-I
binding. The role of ERAP in peptide generation has been reviewed by us and others (125). Reports
by two different groups (194, 195) suggest that absence of ERAP may not be detrimental in
immunodominant CTL responses following flu infection. However, findings by others with
ERAP-deficient mice challenged this view. For instance, a study by York et al. (196) showed that
39
even in the presence of T cells expressing TCR repertoires capable of responding to various viral
peptides, the cytotoxic immune responses to LCMV epitopes in ERAP-deficient mice change. The
anti-viral CTL responses to some ImD epitopes decreased while responses to some SbD increased
following LCMV infection. The authors demonstrated that this was due to the absence of ERAP.
The functional importance of ERAP is also evident in individuals infected with the HIV-1 virus.
ERAP mediates the generation of ImD epitopes from p17 (i.e., HLA-A2-restricted gag77-85 and
HLA-A30-restricted gag76-86 epitopes) and p24 (i.e., HLA-B27-restricted gag131-140) proteins.
Different variants of the p17 epitopes, some with extended N-termini and some with point
mutations at one or more positions within the epitope sequence, had different rates of digestion by
ERAP. Only peptides which ‘fulfilled’ ERAP’s criteria for peptide modification were generated
and subsequently recognized by specific anti-viral CTLs (187). These results indicate that ERAP
importantly influences the overall immune response following viral infections.
1.5.1.7 Role of Tapasin
Following infection, viral proteins are degraded by proteasomes and the resulting
peptides are transported by TAP into the ER. In the ER, the newly generated peptides are loaded
onto MHC class I molecules with the help of calnexin, calreticulin, tapasin, and ERp57. Selected
populations of these generated proteins may influence ImDc following a viral infection. Studies
by Elliot’s group (158, 197) showed that tapasin deficient mice had altered immune response to
LCMV ImD peptides rather than reduced immune response following infection. They were able
to show that the altered immune response was due to tapasin’s editing ability, which quantifies
peptide optimization as a function of peptide supply and peptide unbinding rates, instead of a lack
of T cell stimulation or antigen presentation. Another study by Dalchau et al. (198) showed
40
tapasin’s role in ImDc in relation to gag and pol epitopes in HIV-1 infected individuals. They
showed that tapasin influenced peptide binding to MHC-I molecules without affecting the overall
MHC-I cell surface presentation. ImD epitopes seem to bind to their MHC molecules faster than
other non-ImD epitopes. This in turn leads to more ImD peptides being presented on the cell
surface, thus affecting the overall immune response. The role of the other three proteins, calnexin,
calreticulin, and ERp57, in relation to ImDc is not well established although one study with HPV
from Peng et al. (199) suggests that calreticulin is important in ImDc. Further investigation with
calnexin, calreticulin and ERp57 in relation to flu infection will determine their roles in generating
ImD flu epitopes.
1.5.1.8 Co-expression of Multiple MHC Class I Alleles
Expression of specific MHC-I allele combinations and their level of expression determine
what epitopes CTLs will recognize. The absence of these MHC-I alleles may lead to reduced
immune responses to well-known ImD viral epitopes. Thus, co-expression of multiple MHC-I
alleles seem to be an important factor contributing to ImDc as seen in studies with monkeys, mice,
and humans. In monkeys, such as the cotton-top tamarin for instance, co-expression of different
types of MHC-I alleles determines what flu epitopes will be responded to following infection
(200). As expected, only those peptides capable of binding to and being presented by specific
MHC-I molecules induce an immune response. Similar studies by Day et al. (201) with mice co-
expressing H2-Kk and H2-Db showed that CD8+ T cell responses to the ImD epitope H2-
Db/PA224-233 diminished, whereas that of NP366-374 did not change following X31/H3N2 flu
infection. They were able to show that this lower CD8+ T cell response was due to lower number
of naive PA224-233 T cell precursors in H2-Kkxb F1 compared to homozygous mice. Functional
41
studies showed impairment in PA224-restricted T cell expansion and differentiation. Our studies
with flu infected transgenic mice co-expressing HLA-A2 with either HLA-B7 or HLA-B27 have
shown similar anti-viral CTL responses to known ImD epitopes (Chapter 3). These results lead
to different conclusions to the study of Turner’s group (201), but yet confirm others by
Chamberlain’s group (152). Studies with flu infected human subjects expressing A2, B7, or B27
class I alleles showed CTL responses to the same ImD epitopes as in transgenic mice (152, 202).
Thus, it seems that co-expression of certain allele combination determines whether one sees ImDc
in host response to flu.
Not all combinations of allele co-expression lead to ImDc. This holds true also for HIV-1
infected subjects. Co-expression of HLA-B with HLA-A and HLA-C alleles shows ImDc of HLA-
B epitopes over other alleles (168). Brander’s group showed that the magnitude of HLA-B
restricted CTL epitope response was higher than those of HLA-A and –C as determined by
ELISpot. Functional avidity and not the peptide binding affinity to MHC-I molecules accounted
for the increased HLA-B restricted CTL responses. These results were recently confirmed by
Friedrich et al. (203). This group was able to show that this increase in HLA-B epitope anti-viral
CTL response was due to increased cell surface expression of HLA-B27 compared to HLA-B7, -
14, -35, 57 and HLA-A2.
Expression of specific MHC-I alleles and their subtypes may also contribute to ImDc.
Individuals positive for HLA-A3 or HLA-B35 mount greater anti-viral CTL responses to these
peptides than individuals expressing HLA-B7 alone (173, 204). Individuals positive for HLA-B57
demonstrate restricted HIV progression and longer survival time compared to non-HLA-B57
individuals (205, 206). The ImD HIV epitope of HLA-B57 (i.e., TW10) is located in the gag p24
region, an integral protein essential for the HIV life cycle. Substitution mutation at this sequence
42
allows for viral escape from anti-viral CTL responses yet this escape comes with reduced viral
ability to replicate (207). To date no one has been able to demonstrate why HIV-1 progression is
reduced in HLA-B57 positive individuals. Furthermore, most of the CTL responses (i.e., ~ 75%)
are directed against gag77-85 (i.e., SL9) in HIV-1 infected individuals expressing HLA-A0201
(208). In individuals expressing HLA-A2601 and HLA-A2603, but not HLA-A2602, the ImD CTL
epitope responses is directed against gag169-177 even though this epitope binds with similar
affinity to all HLA-A26 subtypes (171). Determining the reason why certain viral epitopes are
recognized by flu and HIV-1 infected individuals more than others is difficult as humans can co-
express up to six different MHC class I alleles. Nevertheless, it appears that co-expression of
certain allele combinations in the same individual influences the overall anti-viral CTL response
following viral infections.
1.5.1.9 Role of Enzymes Involved in TCR Generation
Enzymes involved in the generation of αβ-TCR repertoire contribute to ImDc. A study by
Yewdell’s group (209) showed mice lacking expression of the terminal deoxynucleotidyl
transferase (TdT), an important enzyme for VDJ rearrangement of TCR genes as well as antibody
genes, shifted CTL responses to both ImD and SbD flu epitopes compared to WT mice. The
absence of TdT enzyme led to ~30% reduction in CTL responses to ImD NP147-155 epitope while
CTL responses to subdominant HA518-526 epitope were increased compared to WT mice. These
findings were confirmed by Leon-Ponte et al. (210) again indicating the importance of TdT’s role
in immune responses by T cells. Since HIV-1 infection leads to CTL responses directed at specific
epitopes such as gag77-85 (208), the absence of TdT may lead to deletion of specific T cell subsets
capable of recognizing specific ImD peptides. Although no direct studies investigating the role of
43
TdT in relation to HIV-1 have been carried out, studies with other viruses have shown that the
absence of this enzyme predicts a relative depletion of T cells capable of recognizing specific ImD
epitopes.
1.5.1.10 T Cell Precursor Frequency
T cell precursors are cells which have survived both negative and positive thymic selections
and have matured into naive antigen-specific T cells. These cells can be activated and
differentiated into effector T cells following antigen exposure. The number of T cell precursors
and the ability of these precursors to proliferate and persist over time may also contribute to ImDc.
There is experimental evidence for and against this notion. A study by La Gruta et al. (211) showed
that infection of WT mice with flu PR8/H1N1 leads to primary CD8+ T cell response dominated
by both NP366-374 and PA224-233. However, secondary challenge with the same virus led to
significantly (i.e., ~ 80-90%) increased NP366-374 epitope CTL response. This was shown earlier
by this group (174) to be due to both DC and non-DCs presenting the NP366-374 epitope. Thus,
higher number of APCs presenting the same peptide may have led to activation of increased
numbers of CD8+ T cells which in turn resulted in CTL dominance of NP366-374 over PA224-
233. Yet a recent study contradicted these findings (212) by showing that it is not the number of T
cell precursors available, but rather the rate of recruitment and expansion of those T cell precursors
in response to flu which determines whether immunodominant responses will be elicited. This
conclusion was subsequently challenged yet again by more recent findings from Tan et al. (213)
and Schmidt et al. (164). Using flu and hepatitis C viral infection, these investigators were able to
show that number of naive T cell precursors is indeed important in achieving ImDc. The same is
valid following HIV-1 infection. Studies carried out with simian immunodeficiency virus (SIV),
44
which mimics HIV infection in monkeys, showed that a higher number of T cell clones responding
to the ImD gag p11C epitope were present compared to T cells recognizing the pol p68A SbD
epitope (214). The precursors for the ImD epitope were shown to be higher than those for SbD
epitope. Thus, both T cell precursor number and their proliferation and differentiation in response
to viral infection affect the overall anti-viral CTL response in individuals infected with flu and
HIV-1.
1.5.1.11 TCR:pMHC Binding
The three dimensional aspect of structural binding of peptides to their MHC-I molecules
may contribute to ImDc. MHC class I molecules and their peptides bind to TCR as the critical
event in generating T cell responses. This overall MHC/TCR interaction influences ImDc as seen
in flu and HIV-1 infections. The primary flu responses in WT mice include the ImD NP366-374,
PA224-233, and Pb1.703-711 (152, 215). X-ray crystallographic analysis of pMHC/PA224-233
and pMHC/Pb1.703-711 complexes have shown a bulge at the C-terminus of these peptides while
still bound to MHC-I molecule (215). This feature at the C-terminus is absent from SbD epitopes
(e.g., HA468-477). This kind of bulge may allow for better TCR binding and hence may affect the
overall TCR repertoire in these mice. DeMarse et al. (171) showed that peptide binding to HLA
molecules plays an important role in HIV ImD peptides being presented. Mutations leading to
reduced binding affinity of ImD epitopes to specific HLA alleles led to reduced ImD anti-viral
CTL responses. In addition, HLA-A26 positive HIV-infected individuals respond to gag169-177
(171). Although this epitope binds with similar affinity to all HLA-A26 subtypes, the responses to
this epitope in association with HLA-A2601 and HLA-A2603 is greater than those with HLA-
A2602. Binding affinity did not influence the overall antiviral CTL responses to ImD epitopes in
45
HIV-infected individuals co-expressing HLA-B with HLA-A and HLA-C. The peptide binding
avidity to MHC molecules was higher in individuals positive for HLA-B expression and negative
for HLA-A and -C expression (168, 203). Thus, binding affinity may or may not influence ImDc
seen following a viral infection.
1.5.1.12 Role of Granzymes
Following a viral infection, anti-viral CTL responses include activation of the apoptotic
pathways and release of apoptotic enzymes. A study by Moffat et al. (216) demonstrated that
following flu infection hierarchical production of granzymes, such as granzyme A and B,
influences the order of CTL responses to ImD epitopes. Granzyme A is expressed by CTL about
six days post-infection whereas granzyme B is expressed throughout the infection. Most CTL
respond to ImD epitopes such as PB1.703-711 before NP366-374. These investigators showed
these responses are dependent on the order, level, and the type of granzyme production. As in HIV-
1 infection, individuals whose CD8+ T cells produce granzymes have different CTL profile in
response to HIV-1 infection than those CD8+ T cells lacking granzyme production (217-220).
These findings indicate a strong role for enzymes involved in the killing of infected target cells by
CTL. Thus, CTL activation and its subsequent cytotoxic action seem to influence ImDc.
1.5.1.13 Role of Memory T Cells
Memory T cells are cells which have previously been exposed to antigen and have the
ability to respond to a secondary viral infection of the same type and strain more vigorously than
naive T lymphocytes. As mentioned above, following a viral infection the crucial first step in
adaptive immunity is the activation of naive antigen-specific T cells by APC in the lymphoid
46
organs. Activated CD8+ CTL destroy infected target cells through several mechanisms, such as of
membrane lytic proteins. After antigen elimination, the expanded antigen-specific T cell pool
contracts substantially through apoptosis and only about 10% of the antigen-stimulated T cells
persist as memory cells (135, 136). Memory CTLs and their location within the periphery and
lymph node (LN) may influence their ability to recognize different types of DC as distinguished
by the expression of CD11b, CD103, and CD8 markers. Different subsets of DC may or may not
activate specific CTL memory cells. This in turn may determine whether ImDc will result.
Cauley’s group (221) showed that flu memory NP-specific CTL proliferate sooner (i.e., within
four days) than PA-specific CTL following secondary flu infection. Memory NP-restricted CTL
recognize CD103+-expressing DCs in the medullar LN, which are well known for their
involvement in peptide presentation in the early stages following an infection. Memory PA-
restricted CTL remain dormant four days post-infection and recognize CD8+-expressing DC whose
levels rise five days post-infection (221). These results indicate that the degree of CTL memory
activation and proliferation along with APC ability to present the desired peptides to memory CTL
contribute to ImDc. SIV vaccine studies in primates, such as Burmese rhesus macaques, have
shown the importance of memory T cells in recognizing gag specific ImD gag241-249 and gag206-
216 epitopes. Animals vaccinated with gag241-249, showed increased CTL responses to this
particular epitope instead of showing any responses to gag206-216. Similarly, gag206-216
vaccinated macaques showed increased anti-viral CTL responses to this epitope only (222). This
demonstrated that animals exposed previously to a particular antigen can respond to that specific
antigen more rapidly than to other antigens. This study along with some others (223, 224) has
shown that generation of memory T cells and their ability to recognize specific APCs could
influence the overall ImDc.
47
1.5.1.14 Role of Regulatory T Cells (TReg)
Immunodominance can also be affected by the presence of regulatory T cells (TReg). A
mathematical model proposed by Levy’s group (225) suggested that TRegs play an important role
in ImDc. A detailed study by Yewdell’s group (209) looked at the role of CD4+CD25+ T regulatory
cells in flu infected mice. This group injected intraperitoneally anti-CD25 monoclonal antibody
(also called PC61) and PBS (Phosphate Buffered Saline, as control) 4 days before flu infection.
On day 7 post-infection, spleen and peritoneal cells were examined ex vivo for IFN-γ accumulation
following re-stimulation with various flu peptides including well known ImD flu NP366-374,
PA224-233, and PB1.703-711 epitopes. Antibody treatment with PC61 led to TRegs depletion.
Absence of TRegs led to an increase in anti-viral CTL responses to ImD NP366-374, PA224-233,
and PB1.703-711 epitopes (209). Following treatment of CD4-deficient mice with PC61 antibody
(as described before) it was shown that CD4+CD25+ TRegs target a subset of CD4+ T cells and in
the absence of TRegs more CD8+ T cells can be activated by CD4+ T cells and hence can respond to
viral epitopes. This study indicates TRegs play an integral role in regulating the overall immune
response following an infection by lowering the number of CD8+ T cells being activated by CD4+
T cells. Other recent flu (226-229) and HIV studies (230-233) confirm the importance of TRegs in
immune response. Following HIV-1 infection, TRegs help to increase the number of CD4+ T cells
and viral persistence over time eventually leading to a decrease in TReg numbers thus reducing the
overall immune response over time (231, 233). These studies indicate that TRegs contribute to the
overall immune response by regulating players such as CD4+ and CD8+ T cells involved in ImDc.
48
1.5.1.15 Host Age
Another factor influencing ImDc is age of the host. There is evidence for and against the
notion that with age the number of T cells produced decreases, thus influencing the overall immune
response following an infection. A study by Yager et al. (234) showed that older mice had holes
in their T cell repertoire compared to young mice. Following flu infection, younger mice responded
more vigorously than older mice when their CD8+ T cell responses to ImD NP366-374, PA224-
233, and PB1.703-711 epitopes were compared. The results from older mice were comparable to
those of thymectomized mice indicating that decreased T cell production as a result of age
influences the overall immune response. The authors were able to show that a lower frequency of
T cell precursors to different flu epitopes in older mice accounted for the lower flu responses.
These results are consistent with human studies of flu infection. Aged individuals (i.e., older than
50 years) and young children (i.e., up to 6 years old) are more susceptible to flu infection than
adults (i.e., 18-50 years old)(235-239). At the same time, younger adults clear the virus faster
compared to older individuals (237, 240). The same holds true for individuals infected with HIV.
HIV-infected adults mount a stronger immune response and respond better to HIV treatment than
young children and the elderly (241-245). These results indicate that the subject’s age may
influence ImDc following an immune challenge.
1.5.1.16 Other Factors
Downstream steps following T cell activation may contribute to ImDc as well. Following
a viral infection, activated CTL remove infected cells by several mechanisms including IFN-γ and
perforin production. Using IFN-γ- and perforin-deficient mice, Remakus et al. (246) showed that
the absence of IFN-γ and perforin did not affect the overall CTL response to ImD epitopes
49
following a viral infection. In this system the viral load seemed to be more important than the
presence of IFN-γ or perforin. A study with HIV-1 infected individuals (247) showed that not all
ImD CTL responses are mounted in the acute phase of disease progression (i.e., within four weeks)
despite the presence of the virus throughout this period. Most of the specific CTL responses are
mounted 18 weeks post infection. Another study by Berzofsky group (170) showed that peptide
avidity to MHC class I molecules also influences ImDc. These investigators showed that peptide
avidity is more important in CTL responses to ImD H-2Dd P18-I10 in HIV-1 infected individuals
than peptide binding affinity and number of pMHC complexes available for CTL recognition.
Competition at the level of antigen processing and peptide presentation also affects ImDc.
Certain peptides, based on their sequence, are generated faster than others. Both flu-infected
individuals and flu-infected transgenic mice expressing the HLA-A2 allele respond predominantly
to M1.58-66 peptide (202) although subdominant CTL responses to other epitopes, such as
NS1.122-130 and PA46-55, have been observed (213). Using flu infection and epitope-based
lipopeptide vaccination, Tan et al. (213) showed that DC were capable of expressing and
stimulating M1.58-66-restricted CTL more (i.e., on average up to ~25-fold higher) than the SbD-
restricted CTL. These kinds of anti-viral CTL responses were induced even when DCs were
simultaneously exposed to A2-restricted SbD and ImD peptides. Thus, presentation of epitopes by
APCs also contributes to the overall ImDc see following flu infection.
Immunodominance can also be influenced by temporal aspects of viral protein synthesis.
Studies with individuals infected with EBV have shown that during the lytic cycle of EBV in
infected individuals, three different types of EBV proteins are produced: ‘immediate early’-,
‘early’, and ‘late’ proteins. Most of the anti-viral CTL responses in these infected-individuals are
directed against the ‘immediate early’ protein-derived epitopes (248). It is thought that epitopes
50
generated from the ‘immediate early’ proteins may have an advantage over epitopes generated
from the ‘early’- or ‘late’ proteins. The mechanism of this is unknown although studies suggested
that the immediate synthesis of these ‘immediate early’ proteins may give the antigen processing
and presentation machinery more time to degrade and hence generate epitopes from the viral
proteins. Subsequently, some of these newly generated epitopes could act as ImD epitopes.
Immunodominance can also exist at the level of antibody production. Andrabi et al. (249)
showed that most of the antibodies produced following HIV-1 infection are directed against the
third variable loop (i.e., V3) of gp120 compared to the membrane-proximal external region
(MPER) of gp41. Lack of gp41 antibody persistence compared to gp120/V3 over time was shown
to be the main reason for reduced gp41/MPER antibody number in HIV-1 infected individuals
over time. Thus, overall these reports show that there are additional factors contributing to ImDc.
The significance of these factors in affecting the overall immune response, immunodominance and
viral control is still to be determined.
1.5.2 Immunodominance: Summary
Immunodominance plays a critical role in the ability to mount a specific immune response.
Studies discussed above suggest that there are a number of different factors contributing to ImDc
seen with flu and HIV-1 infected individuals. Some of these factors contribute to ImDc more (e.g.,
prevalence of peptide-specific T cell precursors) than others following a viral infection. An
analogy to immunodominant responses following viral infection is a soccer team consisting of
different players. By repeatedly targeting the most vulnerable players (e.g., defensive players) the
offensive team can weaken the opposing team, and hence lead to more opportunities to score. Even
after replacing that player with another one at the same position (i.e., a vulnerable position), it may
51
still lead to the same end result. By concentrating on a few vulnerable players, the whole team can
be weakened more efficiently. Our host response to viral infection is similar to this team concept.
The host’s ability to adapt to changing viral strains allows the immune system to mount specific
adaptive responses to ever changing viral strains. Further studies need to be done to decipher the
details of each one of the factors in relation to ImDc. New findings will enable the development
of better viral vaccines using knowledge gained from detailed analysis based on immunodominant
factors.
1.6. MHC Class I Genes and HLA-B Locus
Of the three major human MHC class I genes (i.e., HLA-A, -B, -C) located on chromosome
6, HLA-A is the most abundant followed by HLA-B and HLA-C (250, 251). So far about 2500
alleles have been identified for HLA-B locus followed by the identification of ~1900 HLA-A
alleles and ~1400 HLA-C alleles. The three minor MHC class I genes (i.e., HLA-E, -F, -G), not
discussed in this thesis, have significantly fewer alleles (i.e., about 11 alleles for HLA-E, 22 for
HLA-F, and 49 for HLA-C) than the major class I genes (250, 251).
Expression of certain HLA-B subtypes have been linked to a number of different diseases
including ankylosing spondylitis (AS), psoriasis, inflammatory bowel disease (IBD) and HIV-1
(252-255). There is some evidence suggesting that HLA-B57 expression is protective in HIV-1
infection while HLA-B35 and HLA-B53 expression renders an individual more susceptible to
HIV-1 infection (256). A stronger linkage exists between AS and HLA-B27 expression. More than
95% of patients who have AS are HLA-B27 positive (257). Of the different HLA-B27 subtypes,
only HLA-B2702, -B2704, -B2705, and HLA-B2707 are strongly linked to AS while expression
of HLA-B2706 and HLA-B2709 subtypes are not associated with AS predisposition (258).
52
Antigen presentation or the lack of antigen presentation of certain epitopes in association with
specific HLA-B genes have been suggested to play important roles in disease susceptibility and
immunodominance. Due to the focus of this thesis, the discussion below will concentrate on HLA-
B27 and HLA-B7. Here, I will describe the structure, the function, and the polymorphism of HLA-
B27 and HLA-B7 in detail.
1.6.1. HLA-B27
HLA-B27 is a MHC class I molecule involved in peptide presentation. Here I used
transgenic mice expressing HLA-B27 either alone or in combination with another MHC-I
molecule (i.e., HLA-B7) to investigate the anti-viral CTL responses following flu infection in the
presence or absence of ERAP expression (Chapter 3 and 4).
HLA-B27, as are all MHC class I molecules, is expressed on all nucleated cells. The first
X-ray crystallographic structure of HLA-B27 was solved in 1991 by Madden et al., about two
decades after it was first linked to AS. As shown in Figure 1.1 (259, 260) the HLA-B27 protein
consists of a highly polymorphic HC and a monomorphic β2m LC. The HC is made up of three
extra-cellular domains (i.e., α1, α2 and α3), a TM and a cytoplasmic domain. The α1 and α2 domains
make up the peptide binding groove allowing for peptides of only 8-10 aa in length to bind.
Physical constraints of the binding groove prevents binding of longer epitopes. Unlike other MHC
I molecules, the B27 HC has a tendency to misfold following its synthesis and form homodimers
within the ER. This is a unique feature of B27 molecules. These homodimers are subsequently
transported to the cell surface where they are recognized by natural killer (NK) cells, DCs and
macrophages. Overall, the structure of HLA-B27 is not any different than any other typical MHC
I molecules.
53
As for all MHC class I molecules, the main function of HLA-B27 is to present peptides.
Peptide presentation plays a critical role in both thymocyte development and antigen immunity.
During T cell development thymocytes undergo a complex process involving both positive and
negative selection. Presentation of self-peptides in association with MHC-I molecules plays a
crucial role in thymocyte development. Mature naive T cells respond to foreign (i.e., viral or
bacterial) antigens only if they are presented with peptides in the context of self-MHC molecules
on the surface of APCs (1, 130). Both the MHC molecule and its bound peptide are recognized by
TCRs in order to initiate CD8+ T cell activation (Fig. 1.5)(1). CD8+ T cell activation is initiated
by the interaction of a TCR-CD3 complex with a pMHC class I complex (133). TCR makes contact
with both α1 and α2 domains of the MHC-I molecule as well as its bound peptide, whereas CD3
helps in signal transduction initiated by this interaction (133). Interactions of co-stimulatory
molecules with their ligands also contribute to the overall T cell activation following initial pMHC-
TCR interaction. Overall, HLA-B27 functions to present peptides to CD8+ T cells to induce an
immune response following an infection.
Like many class I molecules, different subtypes of HLA-B27 exist. So far 105 subtypes of
HLA-B27 are known and these are encoded by 132 known B27 alleles (258). These subtypes are
numbered as HLA-B2701 through to HLA-B27105. There are two alleles for HLA-B2702 (i.e.,
HLA-B270201 and HLA-B270202), 21 alleles for HLA-B2705, three alleles for HLA-B2704 and
HLA-B2707 each, and two alleles for HLA-B2790. The most commonly encountered subtypes
associated with AS and present in Caucasians, Chinese, and Mediterranean population are of HLA-
B2705, -B2702, and –B2704 subtypes respectively. Of these the most widely encountered allele
is HLA-B2705. It is interesting to note that AS predisposition increases when HLA-B27 is co-
expressed with HLA-B60 (261). HLA-B2706 and HLA-B2709 are two subtypes that have no
54
known association with AS (258). Most of HLA-B27 polymorphism arises due to changes in the
nucleotide sequence in exons 2 and 3, which encode the α1 and α2 domains of HLA-B27 molecules.
Silent mutations may also occur within the intronic regions of some B27 alleles, which do not lead
to any changes in the overall amino acid sequence of the protein. Due to the significance of HLA-
B27 linkage to AS, a separate section will deal directly with the details of B27 association with
AS (section 1.7).
HLA-B27 co-expression with other MHC-I alleles influences immune responses following
antigen exposure (Chapter 3 and 4). Factors contributing to ImDc following viral infection in
relation to MHC class I have been described in detail in Section 1.5.
1.6.2. HLA-B7
HLA-B7 is another MHC class I molecule that plays an important role in peptide
presentation. HLA-B7 is expressed in about 10% of the general population (250). The overall
structure of HLA-B7 is similar to other classical MHC class I molecules consisting of three alpha
domains (i.e., α1-α3), β2m, a TM, and a cytoplasmic tail. There are no major differences in the
overall structure of HLA-B7 compared to other MHC-I molecules. The peptide binding groove
and the anchor residue requirements of B7 is different from those of B27 molecules. Consequently
different sets of antigenic epitopes bind to B7 molecules when compared to B27 molecules. For
instance, as discussed in Chapter 3 below, the B7-specific ImD flu epitope is NP418-426 whereas
that of B27 is NP383-391. The anchor residue differences determine which epitopes can bind to
the B7 binding groove.
HLA-B7 plays an important role in antigen presentation to CD8+ T cells. Like other class
I molecules it binds to peptides of 8-10 aa in length and presents them to T cells. Unlike HLA-
55
B27, the B7 HC does not have a tendency to misfold within the ER. Hence, to date no B7 HC
homodimers have been found on the cell surface.
Polymorphisms of HLA-B7 have not been investigated to the same extent as HLA-B27.
Like B27 molecules, mutations within exonic and intronic regions of the B7 gene have been shown
to contribute to the overall polymorphisms encountered in HLA-B7 molecules. The most common
B7 subtypes are HLA-B702, -B704, and -B705. In United States, the proportion of individuals
who are B7-positive varies in different ethnic groups with 11% for Caucasians and 8% for African-
Americans (250).
Like HLA-B27, expression of HLA-B7 is also associated with predisposition to certain
diseases. There are some reports indicating that expression of HLA-B7 increases the rate of
cervical cancer in Chinese population (262). HLA-B7 seems to also contribute to faster
progression to AIDS (Acquired Immunodeficiency Syndrome) in HIV-1 positive patients in the
United States (256).
HLA-B7 expression contributes to the overall adaptive immune response following antigen
exposure. The contextual co-expression of HLA-B7 with another class I allele, such as HLA-B27
or HLA-A2 (Chapter 3), likely dictates immunodominant anti-viral CTL responses. Details
outlining factors contributing to ImDc in relation to HLA-B7 expression have been described
above (Section 1.5).
1.7. MHC Class I genes and Spondyloarthritis
Spondyloarthritis (SpA) refers to a group of diseases that share several clinical features
including association with HLA-B27, asymmetric oligoarthritis, axial involvement particularly of
the sacroiliac joints, and characteristic extra-articular features including acute anterior uveitis
56
(263). Certain MHC class I genes, such as HLA-B27, are strongly associated with SpA but it is
unresolved how physiological expression or co-expression of multiple MHC-I alleles may
influence susceptibility (255). Amongst clinical subsets of SpA, the role of infection as a triggering
factor is best established in two of its subsets: reactive arthritis (264, 265) and AS (252, 253). Since
the canonical role for class I MHC is peptide presentation to T cells, the B27 relationship to SpA
implies a T cell response restricted by B27 following an environmental trigger (254). The means
whereby HLA-B27 contributes to the immunopathogenesis of AS has proved difficult to resolve
in the clinical setting due to expression of multiple MHC-I alleles by humans. Studies outlined in
this thesis (Chapters 3 and 4) overcome this limiting factor by using HLA transgenic (Tg) mice,
thus controlling the number of allele(s) each Tg mouse can express. Due to the overwhelming
association of HLA-B27 to AS, the following section will briefly deal with AS in general.
1.7.1 Ankylosing Spondylitis (AS)
Ankylosing spondylitis (AS) is defined by inflammation of the sacroiliac joints, peripheral
inflammatory arthropathy and the absence of rheumatoid factor. AS has a prevalence rate of 0.1 –
1.4% (266) and is an under-recognized form of chronic arthritis. It mainly affects men between the
age of 20 and 40 years. AS was first described in the mid 1860s by an Irish Physician named
Bernard Connor. This was followed by a detailed description of AS by Marie-Strumpell in the
early 1870s (267, 268). AS is characterized by the fusion of spines and peripheral arthritis causing
chronic back pain and a progressive spinal ankylosis (269, 270). AS can be detected early on during
the onset of the disease by magnetic resonance imaging (MRI) technology. Changes in the spine
structure in subsequent years can be visualized by radiographs. AS is accompanied by release of
inflammatory cytokines (e.g., IL-17, TNF-α) by different cell types including monocytes and
57
macrophages and it can be treated by anti-inflammatory drugs and biologics targeting
inflammatory cytokines, examples of which include inhibitors of tumor necrosis factor (271-273).
Although many of the main causal factors leading to AS are unknown, a number of
different factors have been linked to AS. Based on family and twin studies, it has been well
established that AS has a strong genetic component. The sibling recurrence risk of AS is 9.2%
compared to 0.1% in the general population (266). The heritability of AS is estimated to be more
than 95% (269, 274). Studies have shown only ~2% of B27+ individuals to develop AS suggesting
that other genetic factors (e.g., ERAP), environmental factors (i.e., bacterial infection), and/or
stochastic factors (e.g., development of specific immune cells) contribute to AS pathogenesis
(269). All of these factors, either in mutually exclusive or non-exclusive fashion, contribute to AS.
Klebsiella pneumonia for example, has been strongly linked to the pathogenesis of AS due to the
sequence similarity of its nitrogenase and pullulanase D proteins with the HLA-B27 proteins (275).
Molecular mimicry of cross-reactive antibodies may be the contributor to the role of Klebsiella
infection in AS (275, 276). Cross-reactivity with HLA-B27 can lead to abnormal immune
responses as evidenced by B27+ individuals possibly having more humoral response to the
Klebsiella 60 kD heat shock protein (HSP60) and nitrogenase compared to B27- individuals (276,
277).
As mentioned above, other genetic factors including ERAP contribute to the overall
pathogenesis of AS. In subsequent sections below I will first describe ERAP in detail in terms of
structure and function, and this will be followed by a general discussion of evidence linking ERAP
to AS.
58
1.8 Endoplasmic Reticulum Aminopeptidase (ERAP1)
Like MHC-I genes, ERAP is expressed throughout the body in all nucleated cell types.
Recent evidence suggests it is expressed at a higher level in the gut than in any other site in the
body (278). As the name suggests, ER aminopeptidase associated with antigen processing
[ERAAP (mouse) or ERAP1 and ERAP2 (human)] is involved in peptide processing. In humans
there are two ERAP genes (ERAP1 and ERAP2). ERAP2 has about 50% identity to ERAP1 (279).
ERAP2 was discovered when loss of ERAP1 led to reduced trimming of the aminopeptidase
substrate L-Amc (leucine-7-amino-4-methylcoumarin), but not Arginine-Amc (R-Amc)(73)
indicating the presence of another ER-based aminopeptidase in humans. Human ERAP1 and 2 can
co-localize into the ER and form a heterodimer (280, 281). These ERAPs have different peptide
specificities resulting in unique peptides. Although the Human Genome Organization (HUGO)
Nomenclature Committee has recognized and approved the name ERAP1 (and ERAP2) and
ERAAP for humans and mice respectively, I will use ERAP1 for the remainder of this thesis to
refer to ERAP1 and ERAAP unless specified otherwise. Furthermore, ERAP2 is not found in
rodents and will not be discussed here further.
ERAP1 preferentially processes peptides that have a specific sequence and length (see
below). ERAP1 processing occurs when peptides have a leucine located at the N-terminal end of
the polypeptide. Based on this, ERAP1 was initially described as a Leucine Aminopeptidase (282).
ERAP1 was initially known under different names including adipocyte 36 derived leucine
aminopeptidase (A-LAP), aminopeptidase regulating TNF receptor I shedding (ARTS-1), and
puromycin-insensitive leucyl aminopeptidase (PILS-AP). Recent data show that preference of
ERAP1’s enzymatic activity to peptides with specific amino acids at specific locations has
increased (see below)
59
ERAP1 is strongly associated with AS and to a lesser extent to cervical cancer (283),
diabetes (284), and hypertension (285). Recent Genome Wide Association Studies (GWAS) have
shown ERAP1 to have the second most influential effect after HLA-B27 (i.e., ~25% of AS patients
have variations in ERAP1 expression)(269, 286) on AS predisposition. Gain or loss of ERAP1
function could be used in experimental settings to further decipher the mechanisms by which
ERAP1 contributes to the overall pathogenesis of AS. The mechanisms by which ERAP1 and
HLA-B27 contribute to AS are still under debate. In the sections below I will briefly describe the
structure and the function of ERAP1 followed by a discussion of its role in relation to AS.
1.8.1. ERAP1: Structure
ERAP1 belongs to the oxytocinase subfamily of M1 zinc-metallopeptidases (287). ERAP1
is encoded on chromosome 5 (i.e., 5q21) and spans 54.61kb from 96149849 to 96095244 on the
reverse strand. ERAP1 is composed of 20 exons and 19 introns (287). Human ERAP1 was
originally isolated from HeLa cells and has been since shown to have about 85% sequence
homology with mouse ERAP. The human ERAP1 mRNA consists of 2826 nucleotides and
alternative splicing gives rise to two N-glycosylated isoforms of 941 and 948 aa residues (288).
The mouse ERAP was initially isolated from liver and spleen and consists of 930 aa (72, 73).
Unlike human ERAP1, rodent ERAP mRNA transcript is not spliced.
Two different groups have independently solved the crystal structure of human ERAP1
(288, 289)(Fig. 1.7 A) ERAP1 exists in two different conformations: “open” and “closed” (Fig.
1.7 B). ERAP1’s ‘open’ conformation assumes the ‘closed’ conformation upon peptide binding.
Four different domains, labeled as domain I, II, III, and IV make up the final structure of ERAP1
(Fig. 1.7). Two of these domains entirely consist of α helices (i.e., domains II and IV) while the
60
Figure 1.7 The structure of ERAP1
B)
A)
61
The legend to Figure 1.7
The structure of ERAP1
(A) ERAP1 consists of four different domains made up of alpha helices and beta sheets as indicated
and color coded. Dotted lines represent disordered loops. The residue numbers corresponding to
different domains are indicated in brackets. (B) ERAP1 consists of two different conformations.
Upon peptide binding ERAP1 domains reorient to assume a ‘closed’ conformation. Modified from
Nature Structural & Molecular Biology 18, 604–613 (2011).(290)
62
other two are made up of β sheets (i.e., domains I and III) only. The domain I of ERAP1 consists
of residues 1-254. Domain II consists of residues 255-527 and contains the catalytic domain, the
GAMEN and the HEXXHX18E motifs (288, 289). The N-terminal end of substrate peptides bind
to this active site of domain II and are processed. Domain II is connected to domain IV by an
interconnecting domain III. Domain III consists of residues 528-613 and acts to provide peptides
with an increased cavity size for binding. Domain IV consisting of residues 614–941 is made of
16 alpha-helices arranged like a cup. In between domain II and IV lays a large cavity making up
the ERAP1’s catalytic domain. The catalytic site of ERAP1 is the largest among known
aminopeptidases (i.e., 36Å) to date and perhaps this is the basis for ERAP1 binding and processing
even longer enzyme substrates.
1.8.2. ERAP1: Function
ERAP1 has two known functions. It is involved in shedding of membrane bound receptors,
such as IL-1 receptor II and IL-16 receptor ligand, and processing of peptides. The former role
allowed researchers to first discover ERAP1 as a membrane-bound cytokine receptor (278). This
function has important implications for AS (see section 1.8.3). Its second function is to process
peptides entering the ER. Proteasomes initially generate peptides of 2-25 residues with the correct
C-terminus. Some of the N-terminally extended epitopes are degraded or trimmed further into
shorter length peptides by cytoplasmic aminopeptidases while others that escape this cytoplasmic
processing enter the ER through TAP and are processed further by ERAP1. TAP does not transport
peptides when proline is located at the first three amino acid positions. Presence of proline and
other hydrophilic amino acids at these positions in pMHC-I complexes led to the discovery of
ERAP1 (90, 192).
63
ERAP1 has both sequence and length preference. In addition to its leucine preference at
the N-teminal end, ERAP1 also prefers trimming peptides when these express hydrophobic
residues (e.g., methionine, phenylalanine & alanine) at their N-termini. The presence of
hydrophilic amino acids like lysine, threonine and arginine at this end reduces its enzymatic
activity (290, 291). Other reports indicate a change in enzymatic activity when hydrophobic
residues are present at the C-terminus of peptides (291, 292). These results indicate amino acids
located in different peptide regions significantly alter the enzymatic activity of ERAP1.
ERAP1 acts as a molecular ruler and trims peptides of up to 16 residues entering the ER
through TAP to peptides of 8-10 residues in length (292). As mentioned before ERAP1’s ‘open’
conformation assumes the ‘closed’ conformation once a peptide is bound to it. This process is
facilitated by bound peptides with both N- and C-terminal ends containing the appropriate amino
acid sequence and binding to the catalytic site and hydrophobic pockets respectively. Shorter
peptides of less than 8 amino acid (293) in length with improper amino acid sequence do not extend
from the catalytic site to the hydrophobic pocket. This may be the reason why ERAP1 remains in
an ‘open’ conformation even after being exposed to such epitopes. Proper fitting and ideal epitope
binding promotes the ‘closed’ conformation of ERAP1, and ERAP1 has its maximal activity in
this conformation.
Due to ERAP1’s important function in peptide presentation, the following section will
specifically deal with studies signifying the impact of ERAP1 in peptide processing and
presentation.
64
1.8.2.1 ERAP1: Peptide Presentation
Abnormal function of ERAP1 or its deficiency can lead to generation and degeneration of
peptides of incorrect length and sequence. Subsequent binding of these epitopes to MHC-I can
lead to pMHC-I misfolding. Misfolded proteins can either be transported to the cell surface as Free
Heavy Chains (FHC) (294) or accumulate in the ER causing ER stress (295-297). Both of these
processes have been suggested to contribute to AS pathogenesis (see below).
Human cells deficient in ERAP2 expression are currently available, whereas ERAP1
deficient cells are not. Studies in these cells and ERAP-deficient mice have revealed the total
peptide repertoire available for presentation to be different than those peptides encountered in
ERAP-intact mice and cell lines. Studies with ERAP-deficient mice have shown reduced cell
surface expression of MHC-I molecules, but not MHC class II (78, 298). These mice show no
differences in the proportion of CD4 and CD8 compared to mice with intact ERAP. The peptide
repertoire generated in ERAP-deficient mice following a viral infection differed from ERAP+/+
mice. Following infection, the CTL response to ovalbumin OVA257-264, LCMV NP396-404,
mCMV YL9, and flu NP366-374, PA224-233, NS2.114-121 and PB2.198-206 epitopes was
reduced, whereas that of LCMV GP33-41 and histocompatibility gene SVL9 epitopes increased
(74, 193, 298, 299). In addition to viral infection, one study demonstrated that there was no CTL
response to the immunodominant HF10 epitope of Toxoplasma gondii in ERAP-/- mice, indicating
the involvement of ERAP in the generation of this epitope (300). Expansion of HF10-specific
CD8+ T cells was shown to be impaired in ERAP-/- mice rendering these mice more susceptible to
toxoplasmosis. A change in the level of ERAP expression also influences the peptide-MHC
repertoire (192). Peptides not avidly bound to MHC-I molecules in the ER can be removed from
these MHC-I complexes by ERAP (301). Overall, ERAP seems to be involved in both generation
65
and destruction of peptides. Peptides that are normally absent in the WT animals are present in
ERAP-deficient animals and vice versa.
1.8.2.2. ERAP1: Unstable pMHC-I Complexes
IFN-γ induces ERAP1 expression (287). In addition, increased function of ERAP1 leads
to enhanced peptide generation and/or increased peptide destruction depending on the polypeptide
sequence. Abnormal peptide processing by ERAP1 can lead to unstable pMHC-I complexes that
are prone to misfold. Misfolded proteins accumulate in the ER and can affect the overall process
of a number of downstream processes including ER stress. A prime example of an MHC molecule
that undergoes this sort of misfolding is HLA-B27. Improperly-folded HLA-B27 molecules
accumulate in the ER and presentation of abnormally-processed epitopes can lead to an unfolded
protein response (UPR), ER stress, and a pro-inflammatory cellular response (78, 295-297).
Generation of abnormal peptides also contributes to the formation of unstable pMHC-I complexes.
Unstable complexes do not last long within the ER and tend to form FHC, which bind to non-
traditional immunoreceptors such as killer cell immunoglobulin-like receptors (KIR) and
leukocyte immunoglobulin-like receptors (LIR) on NK cells resulting in abnormal immune
responses (302-305).
66
1.8.3. ERAP1 and AS
The attributable risk factor for ERAP1 in AS is 26% (269, 306). This is the second highest
attributable risk factor following HLA-B27 association (~50%) with AS. As mentioned earlier,
abnormal function of ERAP1 can lead to peptide generation of incorrect length and sequence.
Subsequent binding of these epitopes to MHC-I can lead to pMHC-I misfolding causing two
downstream processes: accumulation of misfolded complexes within the ER leading to ER stress,
and the transport of FHCs to cell surface. All three (i.e., pMHC I misfolding, ER stress, and FHC
transport) events have been suggested as possible mechanism for AS, but the degree of their
contribution to AS is speculative. Studies with ERAP-deficient mice (see below) have shown
reduced MHC-I expression while MHC class II expression was not altered. Loss of function
ERAP1 variants are protective for AS. There is a wide consensus among AS experts of the
existence of “arthritogenic epitopes”. Although there are suggestions that an arthritogenic peptide
or peptides plays a central role in AS (307-309), so far no such peptides have been discovered. The
identity of this epitope is unknown and there are suggestions that ERAP may be involved in
destruction/generation of this arthritogenic epitope(s)(281).
1.8.4. ERAP1: Other Diseases
ERAP1 is linked to a number of other diseases including psoriasis (293), Crohn’s disease
(310), hypertension (285, 311), pre-eclampsia (312), hemolytic uremic syndrome (313), and
osteoporosis (314). The uremic syndrome is caused by Shiga toxin and abnormal cleavage of this
toxin by ERAP1 seems to contribute to the overall disease pathogenesis (313). Due to the focus of
this thesis the details of ERAP1’s involvement in other disease will not be discussed further.
67
1.8.5. Development of ERAP Deficient Mice
Three different groups have used different techniques to knock-out ERAP to create ERAP-
deficient (ERAP-/-) mice (77, 299, 315). The ERAP-/- mice described in this thesis were created by
Shastri’s group in 2006 (77). As referred to previously, the ERAP gene consists of 20 exons
distributed over 54 kilobases. The highly conserved ERAP active site is encoded by exons 4-8 and
Shastri’s group deleted these exons by homologous recombination. In separate experiments,
Niedermann’s group (315) and Luc Van Kaer’s group (299) deleted exon 4 and exon 4-8
respectively to create ERAP-/- mice as well. The common features among these ERAP-deficient
mice in comparison to WT mice are: an increase in peptide quantity in their original form (e.g.,
SVL9), an increase in N-terminally extended peptides (e.g., NOVAK), low MHC-I (i.e., H2-Kb, -
Db, -Kd, -Dd, -Ld) surface expression, and no alteration in MHC class II surface expression in the
thymus, LN and the spleen of ERAP-/- mice. ERAP-/- mice do not exhibit any phenotypic
abnormalities nor do they have any differences in the B and T cell percentages compared to WT
mice. Peptide trafficking by ERAP-/- mice does not differ from those seen with WT mice.
Following flu (A/PR8/34) or LCMV infection, ERAP-/- mice mounted strong immune responses
similar to those seen with WT mice. These published studies suggest ERAP-deficiency may not
modify the overall immune response to viral infection. However, studies described in this thesis
(Chapter 4) and recent findings by Shastri’s group (316) following Toxoplasma gondii infection
challenge this view. In our studies (Chapter 4) to investigate the effects of ERAP on immune
response in HLA Tg mice following flu infection, ERAP-/- mice obtained from N. Shastri were
first crossed with H2-K/D double knock-out (DKO) mice to create ERAP-/-/DKO mice. These
mice were subsequently crossed with single Tg B7 and B27 (see below) to create HLA Tg
68
B27/ERAP-/- and B7/ERAP-/- still on a DKO background. Refer to Materials and Methods section
of Chapter 4 for the full description of HLA Tg ERAP-/- mouse creation.
1.9. Development of HLA Tg Mice
A major obstacle in carrying out research of human infectious diseases has been the lack
of suitable animal models that accurately reflect the specificity of the immune response in humans.
HLA transgenic mouse models developed by Chamberlain’s group have provided a powerful new
tool to study human MHC-restricted T cell responses in vivo (152, 175, 202, 317-319). These
models are based on expression of individual human MHC class I genes (i.e., A2, B7 and B27) in
Tg mice that are also deficient for mouse H2-K/D MHC-I expression. Using these HLA Tg mice,
Chamberlain’s group showed that i) introduction of different human class I alleles can restore
development of CD8+ T cells to a level comparable to that seen for a single expressed mouse class
I molecule (152), ii) peripheral CD8+ T cells of these Tg mice display a broad usage of TCR-Vβ
subfamilies, similar to that for H2b WT mice (152, 202), and iii) that influenza M1.58-66 and
NP383-391 epitopes known to be recognized by A2+- and B27+-restricted CTLs in humans were
also recognized in Tg A2 and B27 mice, respectively (152, 202). As the flu epitope recognized by
B7+-restricted CTLs was not known from human studies at the time, Chamberlain’s group used
Tg B7 mice to identify flu/NP418-426 as a strong B7-restricted epitope and subsequently
confirmed this was also recognized in B7+ humans (152). These results demonstrate that these
mouse models can be reliably used for identifying and characterizing viral CTL epitopes
recognized with HLA alleles in humans.
69
Chapter 2
2.1. Aim:
The broad aim of my project was to identify the mechanisms responsible for HLA-
mediated ImDc following influenza infection and how this is influenced by (a) class I allelic
coexpression and (b) the presence or absence of ERAP. The specific aims are as follows:
1. Establish and characterize novel double HLA Tg mice (i.e., HLA-B7/B27) in the
presence of ERAP expression. Are there any differences in T cell percentages and
TCR Vβ expression in double Tg B7/B27 compared with single Tg B7 and B27
mice?
2. Does co-expression of multiple HLA transgenes alter the pattern of anti-flu CTL
responses in B7/B27 Tg mice?
3. Establish and characterize novel HLA Tg mice in the absence of ERAP expression
(i.e., HLA-B7/ERAP-/- and HLA-B27/ERAP-/-). Are there any differences in T cell
percentage and TCR Vβ expression in these Tg mice in the absence of ERAP
expression?
4. Does absence of ERAP expression in HLA Tg B7/ERAP-/- and B27/ERAP-/- mice
alter the pattern of anti-flu CTL responses?
5. What light might HLA-B27/ERAP-/- mice shed on the pathogenesis of ankylosing
spondylitis? Can flu infection in the B27/ERAP-/- mice define immune pathways
with relevance to a human disease like AS in which both B27 and ERAP are
intimately linked?
70
2.2. Hypothesis:
Allelelic co-expression can influence the pattern of anti-viral CTL responses in double
HLA Tg mice. Change in the overall pattern of anti-flu CTL responses can lead to ImDc of one
epitope over the other. Different factors including absence of epitope-specific naive CD8 T cells
and/or lack of epitope generation in the absence of ERAP expression may contribute to flu ImDc
in HLA Tg mice.
71
Chapter 3
This chapter describing the effects of dual HLA allele co-expression influencing the flu response
was published in the European Journal of Immunology. I did all the experiments and analysis. I
prepared the draft for publication. The citation for this article is: Akram A and Inman RD. Co-
expression of HLA-B7 and HLA-B27 alleles is associated with B7-restricted immunodominant
responses following influenza infection. Eur J of Immunol 2013 Dec; 43(12): 3254-67.
3 Co-expression of HLA-B7 and HLA-B27 alleles is
associated with B7-restricted immunodominant responses
following influenza infection
3.1 Introduction
The cellular immune response to a viral infection depends on the ability of CTLs to
recognize, via their TCR, viral antigenic peptides in the context of major histocompatibility
complex class I molecules (MHC-I) (320). Following a viral infection, viral peptides are bound
by MHC class I molecules and transported to the cell surface where they are surveyed for
recognition by the repertoire of αβ-TCR expressed by CTLs (151). In this context,
immunodominance refers to the phenomenon whereby a large fraction of the anti-viral CTL
population is directed against a limited number of MHC class I/peptide complexes (i.e., pMHC-I).
The viral peptide which dominates CTL recognition with a particular MHC allele is referred to as
the immunodominant epitope (ImD). As we recently reviewed (145), the mechanisms of
immunodominance are not completely understood, but almost every step in antigen processing and
presentation may contribute to determine which specific peptide sequences will be available for
recognition by CTLs (321).
72
Immunodominance is very common in host responses to viral pathogens.
Immunodominant responses have been observed to a range of pathogens including Hepatitis B
virus (162, 163), EBV (167, 322), and CMV(161, 323). As analysis of anti-viral T-cell responses
for humans is complicated by co-expression of multiple class I alleles, a series of single HLA Tg
(HLAhyb Tg) mice were generated (152, 319). The advantage of this hybrid class I human/mouse
model is that Tg animals express the human peptide-binding cleft along with murine regions
necessary for interaction with endogenous murine molecules such as CD8 and β2m. The HLAhyb
transgenes were introduced into MHC class I-deficient mice lacking H2-Kb and H2-Db genes [i.e.,
double-knockout (DKO)]. Studies demonstrated that influenza A (flu)-infected PBMCs from
HLA-A2, -B7, and -B27 expressing individuals and PBMCs from allele-matched single Tg mice
respond to A2-restricted M1.58-66 (202, 324), B7-restricted NP418-426 (202) and B27-restricted
flu NP383-391 epitopes (152, 175). Thus, these transgenic mice can be instructive for investigating
factors leading to immunodominance.
The presence or absence of immunodominance following flu infection in HLA Tg mice
expressing more than one HLA transgene has not been examined. In clinical studies, an earlier
report (322) indicated reduced CTL responses to the HLA B8-restricted EBNA325-333 epitope
following EBV infection in individuals co-expressing B8 and B44. Studies with flu-infected mice
co-expressing H2-Kk and H2-Db showed that CD8+ T-cell responses to the ImD epitope H2-
Db/PA224-233 diminished, whereas that of NP366-374 did not change (201). These studies
showed that lower CD8+ T-cell response was due to a lower number of naive PA224-233 T cells.
Here we show for the first time that following flu infection only certain combinations of
HLA allele co-expression lead to immunodominant responses in HLA Tg mice. We established
three new strains of double HLAhyb Tg mice co-expressing A2/B7, A2/B27, and B7/B27 alleles.
73
We show that immunodominant responses are seen only in flu-infected B7/B27 Tg mice. We
demonstrate that altered selection of specific B27-restricted NP383-391 naive T cells in B7/B27
Tg mice accounts for the lack of CTL response to this epitope.
74
3.2 Materials and Methods
3.2.1 Double Transgenic HLAhyb/H2-K-/-D-/- Double Knockout Mice (DKO)
Generation
The generation of single Tg B27, B7 and A2 mice has been described (152, 202). Here
appropriate crosses of single Tg mice were made to generate A2/B27, A2/B7 and B7/B27 mice.
Double Tg A2/B7 and A2/B27 mice were distinguished by flow cytometry and PCR (Figure 1A).
For PCR the following primer sets were used: for HLA-B7 the forward primer (P1) was
5’TACTACAACCAGAGCGAGGCCG3’, and the reverse primer (P2) was
5’CAGCGCGCTCCAGCTTGTCC3’ (band length = 540bp); for HLA-B27 the forward primer
was P1 and the reverse primer (P3) was 5’GTAGGCGTCCTGGTGG TA 3’ (band length =
350bp). All mice were housed in the specific pathogen-free animal facility at Toronto Western
Hospital in Toronto according to the guidelines of the Canadian Council of Animal Care. All
animal studies have been reviewed and approved by the University Health Network Research
Committee.
3.2.2 Flow Cytometry Analysis
The monoclonal antibodies (mAbs) and detection reagents used for flow cytometry and
their specificities are as follows: ME1 (specificities: HLA-B7, -B27, -Bw22, and –B14), BB7.1
(HLA-B7), B27M2 (HLA-B27 and HLA-Bw47) and MA2.1 (HLA-A2 and HLA-B17) were from
the American Type Culture Collection (Manassas, VA); CD3-PerCP (0.5 mg/ml, diluted 1:150),
CD8α-FITC (0.5 mg/ml, diluted 1:150), and TCR Vβ8.3-FITC (0.5 mg/ml, diluted 1:200) were
from BD Pharmingen (San Diego, CA). FITC-conjugated F(ab’)2 goat anti-mouse IgG (Fc-
specific, 0.5 mg/ml, diluted 1:150) and FITC-conjugated F(ab’)2 goat anti-rat IgG (Fc-specific,
75
0.5 mg/ml, diluted 1:150) were from Accurate Chemical and Scientific (Westbury, NY). FITC-
conjugated F(ab’)2 goat anti-mouse IgM (μ chain specific, 0.5 mg/ml, diluted 1:200) was from
Southern Biotechnology Associates (Birmingham, AL). The anti-TCR Vβ mAbs were from BD
Pharmingen (San Diego, CA) and supernatants specific for Vβ2 (B20.6), Vβ6 (44.22.1), Vβ7
(TR310), Vβ8.1/8.2 (KJ16), Vβ8.2 (F23.2), Vβ11 (KT11), Vβ12 (MR11-1), Vβ14 (14.2) were
obtained from Dr. J. Penninger.
3.2.3 Tetramer Staining and Enrichment of Antigen-specific CD8+ T Cells
Cell suspension from PBL, spleen, and LN were enriched for T cells using Pan T-cell
Isolation Kit II Mouse (Miltenyi Biotec, Cat#:130-095-130). These cells were then stained with
different influenza tetramers. Spleen and LNs were mashed through a cell strainer (Fisherbrand,
70μm Nylon Mesh) using a plunger, filtered, and lysed with ACK lysis buffer (NH4Cl 8,024 mg/l,
KHCO3 1,001 mg/l, EDTA. Na2•2H2O 3.722 mg/l). Cells were separated as outlined in the
Miltenyi Biotec protocol. The bound cells were eluted from the columns and stained with anti-
CD8, anti-CD4, anti-CD3, and PE- and APC-labeled pMHC-I tetramers for 45 min at 4°C. Flu-
specific tetramers for NP366-374 (1.2 mg/ml, diluted 1:100), NP383-391 (1.2 mg/ml, diluted
1:100), NP418-426 (1.3 mg/ml, diluted 1:100), and M1.58-66 (1.5mg/ml, diluted 1:100) were
synthesized by NIH (Atlanta, GA). Cells were washed and fixed with 1% PFA before being
analyzed with a LSRII cytometer (Becton Dickinson). Data analysis was performed using Cell
Quest and FlowJo softwares (BD Immunocytometry Systems, CA).
76
3.2.4 Influenza A/X31 (H3N2) Infection and IFN-γ ELISpot Assays
Mice between 7-10 weeks of age were used for infection with flu A/X31virus
(H3N2)(SPAFAS, North Franklin, CT) by either the i.n. or i.p. route as described (152). IFN-γ
ELISpot assays were used to determine the frequency of peptide-specific IFN-γ-producing cells in
spleens of flu-infected mice as described (152, 202). Influenza peptides at pre-specified
concentrations were used to assess the anti-flu CTL response by ELISpot assay. All peptides were
synthesized and purchased from Bio Basic Inc (Markham, ON, Canada). An experimental response
was considered positive when the number of spot forming units (SFU) was at least 2-times greater
than the number detected with the same spleen cell population incubated with either an irrelevant
control peptide or no peptide.
3.2.5 In vitro Peptide Stimulation, Peptide and NP DNA Immunization
Spleen cells from mice infected i.p. with flu 3 weeks earlier were re-stimulated in vitro for
two 7-day incubation periods with the indicated peptide. Spleen cells from flu infected mice were
re-stimulated in vitro for two 7-day incubation periods with the indicated peptide in α-MEM (Life
Technologies, Grand Island, NY) containing 10% FCS (Sigma-Aldrich, St. Louis, MO), 10mM
HEPES, 5 x 10-5 M 2-ME, penicillin/streptomycin (Life Technologies), and 0.5 U/ml of mouse
IL-2 (324, 325). The source of APC and T cells for the first period (i.e., Day 0) was autologous
peptide-pulsed spleen cells. For the second period (i.e., Day 7), viable cells were harvested and
stimulated with peptide-pulsed, irradiated (2600 rad) strain-matched spleen cells that served as
APC. On day 14, the viable cells were harvested and stained with anti-CD8 mAb and with various
anti-TCR Vβ mAbs.
77
Naive HLA Tg and non-Tg mice were immunized subcutaneously with CpG (10μg/ml,
50μg per mouse in 1 x PBS) two days prior to peptide immunization. Two days later the same
mice were co-immunized subcutaneously with synthetic NP418-426 (10μg/ml, 75 μg/mouse) and
NP383-391 (10μg/ml, 75 μg/mouse) peptides in incomplete Freund’s Adjuvant (IFA), or IFA
alone as control, and 12 days post-immunization spleen cells were removed and tested by ELISpot.
For the DNA vaccination, transgenic and non-Tg mice were immunized via the gastrocnemius
muscle with 100µl of PBS containing 20µg of DNA vector alone and/or flu NP DNA vector. This
was repeated three times at two-week intervals as described (326).
3.2.6 Generation and Identification of HLA Tg Chimeras
Different chimeric mice were generated using established protocols (327). Briefly, female
mice were irradiated for 9 min (~900 cGy) and returned to the SPF housing unit at Toronto Western
Hospital. Male BMs were harvested as described (327). These cells were washed and re-suspended
in 1x PBS at a concentration of 3.0 x 106 cells/ml. Twenty four hr post-irradiation 6 x 106 male
viable cells in 200μl 1x PBS were transfused intravenously into female recipient mice. Mice were
left to recover for 60 days. PCR for the male SRY gene was performed on DNA extracted from
PBLs of different chimeras. The following primer sets were used for SRY gene identification:
Forwards primer (P1) CGCCCCATGAATGCATTTAT and reverse primer (P2)
CCTGTCCCACTGCAGAAGGT (expected band ~300bp).
3.2.7 Statistical Analysis
Data were analyzed by two way analysis of variance (two variables; naive vs. flu infected
in GraphPad Prism 5.0, GraphPad Software Inc.,La Jolla, CA) with a Bonferroni post test. All
78
values are expressed as mean (± SEM), P < 0.05 (adjusted P) was considered significant. Student
t-test was used only in one instance as indicated.
79
3.3 Results
3.3.1 Characterization of a novel Tg HLA-B7/B27/H2 DKO mouse
A series of HLA class I Tg mice expressing HLA-A2 (i.e., Tg A2), -B7 (i.e., Tg B7) or –
B27 (i.e., Tg B27) on a DKO background have been described (152, 319). Here we have generated
three double HLA Tg strains, referred hereafter as A2/B7, A2/B27 and B7/B27 respectively. The
Tg A2/B7 and -A2/B27 strains have been briefly described previously (152, 175, 319). This is the
first description of the B7/B27 Tg strain. Genotyping of the B7/B27 was confirmed by PCR of tail
DNA (Fig. 3.1A).
Characterization of the CD3+ T cells isolated from splenic tissues was performed by flow
cytometry (Fig. 3.1B). The percentage of B7/B27 CD8+ T cells compared with single Tg B7 and
B27 mice is not significantly different. Non-Tg DKO mice have low CD8 expression levels as
expected whereas both single Tg B7 and B27 mice have comparable CD8 expression levels (Fig.
3.1B).
3.3.2 CD8+ response to influenza infection: B7/NP418-426 dominates the CD8+
response in B7/B27 Tg mice
To examine whether co-expression of A2 and B7 influences the specificity of the CD8+ T-cell
responses to the respective immunodominant A2- and B7 flu epitopes, spleen cells from various
A2 and B7 Tg mice were examined by IFN-γ ELISpot assay 11 days (i.n.) and 3 weeks (i.p.) post
flu infection (Fig. 3.2A). Single Tg A2 and B7 mice showed strong responses to their respective
immunodominant epitopes, but no response to NP366-374 (Fig. 3.2A). In contrast double Tg
A2/B7 mice showed strong responses to both M1.58-66 and NP418-426 (Fig. 3.2A). The
A2/M1.58-66 response was slightly
80
Figure 3.1 Characterization of Double Tg B7/B27 Mice.
81
Legend to Figure 3.1
Characterization of Double Tg B7/B27 Mice.
(A) Double Tg B7/B27 mice were identified by tail DNA PCR. (B) LNs from different Tg mice
were stained for CD3, CD4, and CD8. The bar graph shows the percentage of CD3+CD8+ T cells
in different Tg mice. Data are shown as mean ±SEM from n=6 mice per group and are pooled from
three independent experiments. *, p<0.05 vs. Tg mice using student t-test.
82
Figure 3.2. ELISpot analysis of the CD8+ CTL response to flu infections in single and
double A2/B7 and A2/B27 Tg mice.
83
Legend to Figure 3.2
ELISpot analysis of the CD8+ CTL response to flu infections in single and double A2/B7
and A2/B27 Tg mice.
(A-B) Mice were infected with flu i.p. or i.n. as indicated. After eleven days (i.n.) and/or three
weeks (i.p.) post-infection the CTL response was tested by IFN-γ ELISpot for various flu peptides.
Data are shown as mean ±SEM of n=6 mice per group and are pooled from six independent
experiments. Significance was assessed using two way analysis of variance. ***, p<0.0001 vs.
non-immunodominant epitopes for the given allele.
84
increased in the A2/B7 mice compared with A2 mice (p>0.05). Similarly, to determine the pattern
of flu epitope CTL recognition when HLA-A2 is co-expressed with HLA-B27, comparable studies
were carried out as above for flu-infected A2/B27, A2 and B27 Tg mice (Fig. 3.2B). The
A2/M1.58-66 response was comparable in Tg A2/B27 and A2 mice. The B27/NP383-391 response
was also comparable in single Tg B27 and double Tg A2/B27 mice. As the natural physiological
route of flu infection is through the respiratory (i.e., intranasal) route, we repeated the above
analyses following i.n. infection. Overall, while the magnitude of CD8+ T-cell response was higher
following i.n. infection, the trend in responding to different allele-restricted ImD epitope was
similar (Fig. 3.2, bottom panel).
To examine the anti-flu CTL responses restricted by two co-expressed HLA B alleles that
present peptides from the same viral protein (i.e., nucleoprotein), double Tg B7/B27 mice were
infected i.p. and tested by ELISpot (Fig. 3.3). For both single Tg B7 and double Tg B7/B27 mice,
there was a strong response detected against the B7/NP418-426 peptide (Fig. 3.3Ai and Aiii). A
strong response was detected also against the B27/NP383-391 peptide for single Tg B27 mice
(Fig. 3.3Aii). However, this B27/NP383-391 response was significantly reduced (p<0.0001) for
double Tg B7/B27 mice and was not detectable above background levels (Fig. 3.3Aiii). The non-
Tg WT mouse (Fig. 3.3Aiv) served as an internal control showing CTL responses only to
WT/NP366-374 flu epitope. The magnitude of the responses detected for the relevant peptides
were 2-3 fold higher following i.n. infection than for i.p. infection confirming published results
(Fig. 3.3B)(152, 202). With i.n. infection, clear immunodominance was still observed in B7/B27
Tg mice.
85
Figure 3.3 ELISpot analysis of flu-infected single and double HLA Tg B7/B27 mice.
86
Legend to Figure 3.3
ELISpot analysis of flu-infected single and double HLA Tg B7/B27 mice.
Mice were infected i.p. (A) or i.n. (B) and tested for various peptides. Data are shown as mean
±SEM of n=8 mice per group and are pooled from three independent experiments. Significance
was assessed using two way analysis of variance. ***, p<0.0001 vs. non-immunodominant
epitopes. # , p<0.0001 as indicated.
87
We then undertook the following experiments to investigate factors accounting for this
immunodominance.
3.3.3 Differential class I expression level and antigen processing do not contribute
to immunodominance
To investigate the role of HLA class I gene expression levels in immunodominance
observed in flu-infected Tg B7/B27 mice, lymph node (LN) cells from various HLA Tg mice were
analyzed by flow cytometry with HLA allele-specific mAbs (Fig. 3.4). Compared with the
expression level of HLA-A2 detected with mAb MA2.1 on LN cells of A2/B7 Tg mice, expression
for single Tg A2 cells was significantly (p=0.0449) different (Fig. 3.4Ai). Similarly, the level of
HLA-B7 expression detected with mAb BB7.1 showed significant (p=0.0412) difference between
single Tg B7 cells compared with double Tg A2/B7 cells (i.e., 1.6-fold; Fig. 3.4Aii). Similar
analyses with single and double Tg A2/B27 mice showed that A2 expression levels were
comparable in both strains (Fig. 3.4Bi), and there was a significant (p=0.0426) difference in B27
expression (detected with mAb ME1) in B27 and A2/B27 Tg mice (Fig. 3.4Bii). For the Tg
B7/B27 mice, expression levels for both B7 (Fig. 3.4Ci) and B27 (Fig. 3.4Cii) were similar in
double and single Tg LN cells.
To investigate the role of antigen processing and presentation in immunodominance
observed in flu-infected Tg B7/B27 mice, we immunized Tg mice with synthetic flu peptides as
indicated (Fig. 3.5A and 3.5B). Only single Tg B27, and not B7/B27, mice developed robust CTL
response to NP383-391 epitope following NP383-391 immunization (Fig. 3.5A). In contrast, the
NP418-426 CTL response was present in
88
Figure 3.4. The LN expression level of A2, B7, and B27 as detected by allele specific mAb in
HLA Tg mice.
89
Legend to Figure 3.4
The LN expression level of A2, B7, and B27 as detected by allele specific mAb in HLA Tg
mice.
(A-C) Representative plots of flow cytometric analyses for different mice are shown. To show the
HLA-B27 expression with mAb B27M2 (C, ii), lymphocytes were stained for B cells (anti-B220),
T cells (anti-CD3) and HLA-B27 (B27M2). The CD3+ T cells were gated and analyzed for the
expression of HLA-B27. This experiment was repeated with 6 mice for each strain (n=6 per
genotype).
90
Figure 3.5. Peptide and NP DNA immunization and in vitro stimulation of flu infected HLA
Tg mouse splenocytes.
91
Legend to Figure 3.5
Peptide and NP DNA immunization and in vitro stimulation of flu infected HLA Tg mouse
splenocytes.
(A-B) Different Tg mice were co-immunized subcutaneously with peptides and tested by ELISpot
for various flu peptides 12 days post-immunization. Data are shown as mean +SED of n=6 mice
per group and are pooled from two independent experiments. ***, p<0.0001 vs. non-
immunodominant epitopes. (C) Mice were infected with flu i.p. and three weeks post-infection,
splenocytes were stimulated (i.e., secondary (2º) stimulation) with strain-specific ImD peptides for
two 7 day periods. Viable cells harvested following peptide stimulation on day 7 and day 14 as
well as the splenocytes taken directly from mice three weeks post-infection (day 0) were stained
for the expression of CD8. Data are shown as mean ±SEM of n=5 mice per group and are pooled
from three independent experiments. (D-E) Mice were immunized with pCMVII vector alone (D)
or with a flu NP DNA pCMVII vector (E) as described (328)and tested for various peptides as
indicated in Fig. 2. n=3 per group pooled from three independent experiments. Each data point is
the mean value ± SEM. Significance was assessed using two way analysis of variance. ***,
p<0.0001.
92
both single B7 and double B7/B27 Tg mice following NP418-426 peptide immunization,
mimicking the results with flu infection (Fig. 3.5B).
To examine whether the immunodominance is caused by the complete absence of NP383-
391 specific CD8+ T cells, flu-infected cells from Tg mice were stimulated with the known ImD
peptides (Fig. 5C). The starting total splenocyte numbers was comparable for all mice and this
total number decreased from Day 0 to Day 14 (data not shown). The level of CD8+ T cells for
infected Tg mice were similar at three weeks post-infection (Fig. 3.5C, white bars). After 7 days
of peptide stimulation, the level of CD8+ T cells in all mice increased (Fig. 3.5C, black bars). As
the levels of B7/B27- and B27 cells, stimulated with NP383-391 increased in comparable manner
(compare Fig. 3.5Cii and 3.5Cv, grey bars, p>0.05), this indicated that some B27/NP383-391
restricted CD8+ T cells were detectable following flu infection in the B7/B27 Tg mice. Similarly,
NP418-426 stimulated CD8+ T cells from single and double Tg B7/B27 mice reached comparable
levels of CD8+ T cells following stimulation (compare Fig. 3.5Ci and 3.5Civ). There was no
increase in the CD8+ T levels of B7/B27 Tg cells in the absence of peptide stimulation (Fig.
3.5Ciii).
Further, to investigate the role of other flu proteins, such as hemagglutinin or
neuraminidase, in the observed immunodominance in B7/B27 Tg mice, we immunized HLA Tg
mice with a flu NP DNA vector (i.e., in the absence of all other flu proteins)(Fig. 3.5E) or DNA
vector alone (Fig. 3.5D). The results revealed the same pattern of reduced B27/NP383-restricted
CTL recognition previously seen following flu infection and peptide immunization.
93
3.3.4 Lower number of naive B27-restricted NP383-391 specific CD8+ T cells in
double Tg B7/B27 mice
A number of investigations have shown that certain T-cell populations are negatively
selected when different MHC class I molecules are co-expressed (201, 322). Other investigators
(178, 325, 329-332) have effectively used specific tetramer staining to determine the number of
specific T cells under different circumstances. We undertook a similar approach as that outlined
by Lefrancois’ group (330), and stained with flu-specific WT/NP366-374, B27/NP383-391 and
B7/NP418-426 tetramers following T-cell enrichment. Cells from the splenic tissues (Fig. 3.6A-
Ei), LNs (Fig. 3.6Eii), lungs, and PBLs (data not shown) were stained. There was a significant
difference (p<0.001) in the number of naive B27/NP383-391 CD8+ T cells between the single Tg
B27 and the double Tg B7/B27 population (Fig. 3.6A left panel and Fig. 3.6B). Correspondingly,
the number of B27/NP383-391 CD8+ T cells in infected B27 mice increased compared with
B7/B27 Tg population (Fig. 3.6A right panel and Fig. 3.6C). Similarly, the number of B7/NP418-
426 CD8+ T cells increased following flu infection in B7 and B7/B27 Tg mice (Fig. 3.6A right
panel and Fig. 3.6C). Interestingly, no such significant difference was observed in the number of
naive B27/NP383-391 and/or B7/NP418-426 CD8+ T cells between the single and the double Tg
A2/B27 and/or A2/B7 Tg mice, respectively (Fig. 3.7A). The number of naive Tet+CD3+CD8+ T
cells specific for M1.58-66 was similar in the single and the double Tg A2/B7 or A2/B27 mice
(Fig. 3.7A and 3.7B).
To examine whether expansion of flu-specific Tet+CD8+ T-cell population varies among
different Tg mice in vivo, we followed the kinetics of immune response following flu infection for
3 weeks (Fig. 3.6D). In B7/B27 Tg mice (Fig. 3.6Diii), Tet+CD8+ T cells specific for both NP418-
426 and NP383-391 epitopes increased over time, although the latter expansion was significantly
(p<0.001) lower than the Tet+CD3+CD8+ T-cell expansion seen with the same population in single
94
Tg B27 mice (compare Fig. 3.6Di and 3.6Diii). Contrary to B7/B27 Tg mice, Tet+CD3+CD8+ T
cells specific for M1.58-66, NP383-391 and NP418-426 flu epitopes expanded in similar fashion
following flu infection in both single and double Tg A2/B27 and A2/B7 mice (Fig. 3.7C and
3.7D). Thus, the reduction in B27/NP383-391 levels is present only in B7/B27 Tg mice.
95
Figure 3.6. Enumeration of naive and flu infected enriched T-cell populations in
different Tg mice using B7/NP418-426, B27/NP383-391, and the WT/NP366-374
flu tetramers.
96
Figure 3.6 (Continued). Enumeration of naive and flu infected enriched T-cell populations
in different Tg mice using B7/NP418-426, B27/NP383-391, and the WT/NP366-374 flu
tetramers.
97
Legend to Figure 3.6
Enumeration of naive and flu infected enriched T-cell populations in different Tg mice
using B7/NP418-426, B27/NP383-391, and the WT/NP366-374 flu tetramers.
(A-E) T lymphocytes from naive and flu infected mice were enriched using magnetic beads (see
Materials and Methods) from the spleen and LN. By first gating on the CD3+CD8+ positive cells
(not shown), different T-cell populations corresponding to different flu tetramers were plotted. (A)
Representative dot plots showing percentages of naive (left panel) and flu infected (right panel)
enriched CD3+CD8+ T cells corresponding to different flu peptides. (B-C) Quantification of flu
specific Tet+CD3+CD8+ T cells from the spleen of naive (B) and day 11 post i.n. flu (C) infected
Tg mice. (D) Determination of Tet+CD3+CD8+ T-cell frequency at different times in i.n. infected
HLA-B27 (i), -B7 (ii) and –B7/B27 (iii) Tg mice. (E) Mean Fluorescence Intensity (MFI) of
different Tet+CD3+CD8+ T cells of flu-infected spleen (i) and LN (ii) on day 11 post infection.
Data are shown as mean ±SEM of n=6 mice per group and are pooled from three independent
experiments.
98
Figure 3.7. Enumeration and kinetics of naive and flu infected enriched T cell populations
in single and double Tg A2/B27 and A2/B7 mice.
99
Figure 3.7 (Continued). Enumeration and kinetics of naive and flu infected enriched T cell
populations in single and double Tg A2/B27 and A2/B7 mice.
100
Legend to Figure 7
Enumeration and kinetics of naive and flu infected enriched T cell populations in single
and double Tg A2/B27 and A2/B7 mice.
(A) Quantification of flu specific Tet+CD3+CD8+ T cells from the spleen of naive Tg mice. (B)
Representative naive A2/M1.58-66 tetramer staining in A2 Tg mice. (C-D) Tet+CD3+CD8+ T cell
frequency in A2/B27 and/or A2/B7 Tg mice following flu infection. n=6 per group. The mean
value ±SEM from six mice are shown.
101
Tet+CD3+CD8+ T cells specific for NP418-426 expanded in similar manner in both single and
double B7/B27 Tg mice (compare Fig. 3.6Dii and 3.6Diii). Determination of MFI of flu-specific
Tet+CD8+ T cells of splenic and LN origin conclusively revealed that there were a reduced number
of B27/NP383-391 CD8+ T cells in B7/B27 mice compared with B27 mice (Fig. 3.6E). A similar
trend was observed with lung and PBLs of these mice (data not shown).
3.3.5 Increased levels of peripheral TCR Vβ repertoires of flu-infected Tg B7/B27
mice compared to naive mice
To determine the relationship between TCR repertoire and immunodominance, we
compared the TCR Vβ repertoires of naive and flu-infected Tg mice (Fig. 3.8). There was an
overall similarity in the pattern observed for the various TCR Vβ chains tested for naive B7/B27
Tg mice compared with naive B7 and B27 Tg mice (Fig. 3.8A-D). The predominant TCR Vβ chain
used for recognition of flu NP383-391 with Tg B27 is Vβ8.1, while that used for recognition of
NP418-426 with Tg B7 is Vβ6 (152). T-cell populations expressing these Vβ6 are readily detected
in both B7 and B7/B27 Tg mice (Fig. 3.8A and 3.8B). Comparison of Vβ8.1+ CD8+ T cells
indicated a significant (p<0.001) reduction in the naive T-cell population expressing Vβ8.1 in the
double Tg B7/B27 compared with B27 Tg mice (Fig. 3.8C and 3.8D). These results indicate that
Vβ8.1+ CD8+ T cells may have been negatively selected in the naive B7/B27 Tg mice.
We next compared the TCR Vβ repertoires of flu-infected (Fig. 3.8) Tg mice following
secondary stimulation with specific peptides in vitro. For most Vβ chains examined, the level of
CD8+ T cells expressing a given Vβ was slightly greater for the Day 0 samples compared with
naive mice. Cells from infected double and single Tg B27 mice were stimulated with NP383-391
102
Figure 3.8. Analysis of TCR Vβ repertoire of naive and peptide-stimulated CD8+ T cells
from flu infected Tg mice.
103
Legend to Figure 3.8
Analysis of TCR Vβ repertoire of naive and peptide-stimulated CD8+ T cells from flu
infected Tg mice.
LN cells from naive mice were stained for the expression of CD3, CD8 and various TCR Vβs. By
gating first on the CD3+CD8+ T cells (not shown), the relative abundance of cells expressing each
TCR Vβ was examined. Three weeks post-flu-infection, splenocytes from different mice were
stimulated with NP418-426 (A-B), NP383-391 (C-D) and NP366-374 (E) for 14 days. On day 0
and day 14, the relative abundance of cells expressing each TCR Vβ was determined. (F) The TCR
Vβ8.1 expression shown at a larger scale for the indicated mice. The values were normalized as
described (152). Data are shown as mean ±SEM of n=6 mice per group and are pooled from four
independent experiments. Significance was assessed using two way analysis of variance.*, p<0.01
vs. naive mice; **, P<0.001 vs. single Tg B27 mice; ***, p<0.0001 vs. naive mice; # vs. single Tg
B27 mice.
104
in vitro and analyzed after 14 days. As shown in Figure 3.8C, there was a large increase in the
Vβ8.1+ CD8+ population from infected single Tg B27 mice. Similarly, the Vβ8.1+ CD8+ population
increased for the infected B7/B27 Tg mice (Fig. 3.8D). There was an increase in the Vβ12+ CD8+
population on Day 14 from infected single Tg B27 mice compared with infected B7/B27 Tg mice
(Fig. 3.8C-D). Similarly, NP418-426 stimulated cells from infected double and single B7 Tg mice
revealed that CD8+ T cells expressing Vβ6 were the most abundant for both single and double Tg
mouse samples (Fig. 3.8A and 3.8B). As expected, there was an increase in the Vβ8.3+ CD8+ T-
cell population from flu-infected WT mice confirming published results (Fig. 3.8E)(152).
3.3.6 Tetramer staining of HLA Tg chimeras: altered selection of naive
B27/NP383-391 CD8+ T cells
To further address whether negative selection of B27/NP383 CD8+ T cells is indeed the
basis for immunodominance seen with flu-infected B7/B27 Tg mice, we created different HLA Tg
chimeras (327). The approach was to allow irradiated female mice to repopulate their immune
responses from male donor bone marrow (BM) cells. After 60 days the mice were examined for
the presence of male SRY gene by PCR. The SRY PCR (Fig. 3.9A) showed that male cells were
the only source of cells developing within these female Tg chimeras and this was confirmed by
showing that cells in the recipient Tg B7 and Tg B7/B27 mice, when reconstituted with B27 BMs,
were negative for BB7.1 expression and hence were of donor origin (Fig. 3.9B). In addition, there
was no difference in the expression level of MHC-I among chimeric and non-chimeric mice as
examined by allele-specific markers (Fig. 3.9C).
105
Figure 3.9. Description and identification of HLA Tg chimeras.
106
Legend to Figure 3.9
Description and identification of HLA Tg chimeras.
(A) Female recipient mice were irradiated and 24 Hrs later received bone marrow (BM) cells of
male origin. After 60 days, DNA extracted from PBLs of different recipient mice was examined
for the presence of male SRY gene. (B) Single and double female Tg B7/B27 mice were
reconstituted with male B27 Tg BMs (Donor BMs are indicated in the brackets). PBLs of non-
irradiated mice (i.e., Day 0) and post-BM transfused mice (i.e., Day 30 and 60) were stained with
mAb BB7.1. (C) LNs from single and double HLA Tg chimeras were stained with the indicated
mAbs. Representative plots of flow cytometric analyses for different mice are shown. n=3 per
group pooled from three independent experiments.
107
We next examined the CTL response of different Tg chimeras to i.n. flu infection. One
mouse strain hypothesized to reflect negative selection of B27/NP383-391 T cells were B7/B27
mice transfused with single Tg B27 BM. By transfusing single Tg B27 BM we ensure that all cells
developed in the host were of B27 origin. As controls we also transfused double Tg B7/B27 mice
with single Tg B7 or B7/B27 BM (Fig. 3.10). Similar to ELISpot CTL responses seen in Figure
3B, there was a strong CTL response detected against the B7/NP418-426 peptide in B7 and B7/B27
chimeras reconstituted with B7 BM (Fig. 3.10i). Similar to non-chimeric mouse flu responses, this
B7/NP418 response was augmented 1.3–fold (p<0.01) for the B7/B27 Tg chimeras (compare Fig.
3.3Bi and 3.3Biii with Fig. 3.10i). In double Tg B7/B27 mice reconstituted with B7/B27 Tg BM
comparable levels of B7/NP418 CD8+ T-cell response, similar to double Tg B7/B27 mice
reconstituted with single Tg B7 BM, was detected (p>0.05). Not surprisingly, Tg chimeras
reconstituted with B27 Tg BM did not respond to NP418-426 peptide (Fig. 3.10i). The non-Tg
WT reconstituted with WT BM served as an internal control showing no CTL response to NP418-
426 flu epitope. Parallel to immunodominant results detected in Figure 3B, in B7/B27 Tg mice
reconstituted with either B27- or B7/B27 BM we detected low B27/NP383-391 CTL response
(Fig. 3.10ii). However, this B27/NP383-391 CTL response was about 6-fold more (p<0.0001) in
B27 chimeras reconstituted with B27 BM (Fig. 3.10ii). We detected only H2-Db restricted NP366-
374 CTL responses in non-Tg WT mice reconstituted with WT BM (Fig. 3.10iii) and no mice had
any CTL responses in the absence of peptide (Fig. 3.10iv).
We next determined the mean fluorescence intensity (MFI) and the actual number of
enriched splenic flu-specific Tet+CD8+ T cells in different Tg chimeras. As shown, the MFI (Fig.
3.11A) and the actual numbers (Fig. 3.11B) of B27/NP383-restricted T-cell tetramers was higher
in B27 Tg mice reconstituted with B27 BM than double Tg chimeras reconstituted with either
108
Figure 3.10. ELISpot analysis of flu-infected HLA Tg chimeras.
109
Legend to Figure 3.10
ELISpot analysis of flu-infected HLA Tg chimeras.
Single and double female Tg B7/B27 mice were reconstituted with male HLA Tg BMs (Donor
BMs are indicated in the brackets). Mice were infected with flu i.n. and eleven days post-infection
the CTL response was tested by IFN-γ ELISpot for various flu peptides. Double HLA Tg B7/B27
chimeras reconstituted with the single Tg B27 BMs showed similar levels of NP383-391 CTL
responses as seen with corresponding non-chimeras (ii)(compare with Fig. 3.3, iii). Similarly, the
single Tg B27 chimera reconstituted with single Tg B27 BM showed high levels of NP383-391
restricted CTL responses, similar to CTL response levels seen with the corresponding single Tg
B27 non-chimeras (ii)(compare to Fig. 3.3, ii). The CTL responses to NP418-426 in single Tg B7
and double Tg B7/B27 mice reconstituted with either single Tg B7 BMs alone - or with double Tg
B7/B27 BMs alone induced similar levels of CTL responses as seen for NP418-426 in the
corresponding non-chimeras (i)(compare with Fig. 3.3, i). Data are shown as mean ±SEM of n=4
mice per group and are pooled from two independent experiments. . Significance was assessed
using two way analysis of variance. *, p<0.01; ***, p<0.0001; n=4 per group pooled from two
independent experiments.
110
Tg B27 and/or B7/B27 Tg BM. There was a 2-fold difference in the level of B27/NP383 T-cell
MFI among the B27 and B7/B27 Tg chimeras reconstituted with B27 BM (Fig. 3.11A). Similarly,
B7 and B7/B27 Tg chimeras reconstituted with Tg B7 BM showed significant (p<0.05) differences
in MFI and the actual numbers of B7/NP418-restricted T cells. As seen with non-chimeric mice
(Fig. 3.11E), double Tg mice reconstituted with B7/B27 BM had similar MFI of B7/NP418 T cells
as seen with double Tg mice transfused with B7 BM (Fig. 3.11A, white bars). Furthermore,
single Tg B27 chimeras expressed higher levels of Vβ8.1+ CD8+ T cells than their double Tg
counterparts (i.e., 9.5% vs 3.9%, Fig. 3.11Ci and 3.11ii). On the contrary, comparison of
B7/NP418 Vβ6+ CD8+ T-cell population among B7 and B7/B27 Tg mice reconstituted with B7
BM revealed no differences (p>0.05)(Fig. 3.11Biii and 3.11Biv). Together these results confirm
deletion of most B27/NP383-391-specific, Vβ8.1+ CD8+ T cells in the double Tg B7/B27 mice.
111
Figure 3.11. Tetramer quantification of flu infected T-cell populations and determination
of naive TCR Vβ repertoire of different chimeras.
112
Legend to Figure 3.11
Tetramer quantification of flu infected T-cell populations and determination of naive TCR
Vβ repertoire of different chimeras.
(A) MFI of Tet+CD3+CD8+ T cells from the spleen of flu-infected chimeras. Bar graph showing
MFI of flu-infected Tet+CD3+CD8+ T cells corresponding to different flu peptides. Significance
was assessed using two way analysis of variance. ***, p<0.0001. (B) Transgenic chimeras were
infected and the frequency of NP383-391 and NP418-426 Tet+CD3+CD8+ T cells from the spleen
was quantified on day 11 post-infection (A,B). Data are shown as mean ±SEM of (A) n=4 mice
per group or (B) n=3 mice per group and are pooled from/representative of three independent
experiments. (C) LN cells from naive chimeras were stained as described in Figure 7 and the
relative abundance of cells expressing TCR Vβ8.1 and Vβ6 was examined. Representative
histograms are shown from two independent experiments (n=3 mice per group).
113
3.4 Discussion
The HLA Tg mouse models described here provide an informative in vivo approach for
characterizing viral infection-associated CTL responses in the context of human MHC-I
molecules. Our results show immunodominance only in flu-infected B7/B27 Tg mice but not in
A2/B7 or A2/B27 mice. Co-expression of B7 with B27 led to altered selection of Vβ8.1+ B27-
restricted, NP383-specific CD8+ T cells in naive B7/B27 Tg mice.
There are a number of different factors contributing to immunodominance, as we reviewed
recently (145). Reduced cell surface MHC class I expression levels, prior infection history (333),
route of viral infection (178), temporal protein synthesis (248), mutations within an ImD epitope
sequence (176, 179), co-expression of different allele combinations (168, 201, 334), and role of
different enzymes such as ERAP (74, 300, 301) in antigen processing and presentation all may
contribute to immunodominance. None of these factors seem to be the major contributing factor
to the immunodominance we observe in the present study. In our system the number of antigen-
specific naive T-cell precursors is the determining factor. Results with flu-specific tetramer
staining along with findings of different TCR Vβ chain utilization showed that there was a
significant reduction in the number of Vβ8.1+ B27-restricted NP383-391 CD8+ naive T cells in
B7/B27 Tg mice compared with B27 mice. In addition, the number of Vβ12+ B27-restricted CD8+
T cells decreased in flu-infected B7/B27 Tg mice possibly due to these high avidity T cells being
negatively selected following infection. Our study with influenza infection confirm previous
findings where high avidity T cells were deleted following, but not before, HIV-1 and EBV
infection in individuals co-expressing various HLA-A, -B, and –C alleles (168). Furthermore,
although it is possible that other B27-specific CD8+ T-cell subsets expressing Vβ chains other than
those examined may have been deleted and thus contributed to the reduced level of B27/NP383-
114
restricted CTL response in B7/B27 Tg mice, this seems unlikely based on published results (152,
202, 335). Flu-specific tetramer staining with HLA Tg chimeras and non-chimeras confirmed that
altered selection in the thymus of B7/B27 Tg mice is involved in deleting some B27/NP383-
restricted Vβ8.1+ CD8+ naive T cells and this deletion occurs only when B27 is co-expressed with
B7.
A number of factors may also contribute to immunodominance seen in B7/B27 Tg mice.
First, to explore the role of differential cell surface expression in Tg mice we showed that all single
and double Tg mice have similar surface MHC class I expression. Next, since both NP383-391
and NP418-426 are derived from the same viral protein, discrete paths of protein synthesis do not
seem to contribute to immunodominance. Further, the same stock of virus was used for all studies.
The presence of B27/NP383 CTL responses with flu-infected B27 mice indicates that there is no
mutation within the NP383-391 peptide sequence with this particular flu stock. Another possibility
is that during antigen processing and presentation the B27/NP383-391 peptide is not effectively
generated while the B7/NP418-426 peptide is effectively generated. We ruled out these
possibilities when the same overall pattern of immunodominance of B7/NP418-restricted CTL
response in B7/B27 Tg mice was detected following synthetic peptide immunization. Another
possibility is that the pMHC-I complexes for B7/NP418 and B27/NP383 epitopes may have
different stability leading to differential efficiency of surface expression. Studies have shown that
the NP418-426 epitope is consistently present on the B7+ APC (336) and the stability of MHC-I-
NP418 complex is one of the highest previously reported for any pMHC-I (337). Our findings
indirectly confirm these reports suggesting that the presentation of B7/NP418, and not B27/NP383,
is extremely efficient in B7/B27 Tg mice. This may also contribute to reduced B27/NP383 CTL
responses in these Tg mice. Further, it may also be that during infection, other non-NP flu proteins,
115
such as hemagglutinin or neuraminidase, contribute to the observed immunodominance. However,
studies of Tg mice immunized with a flu NP DNA vector (i.e., in the absence of all other flu
proteins) or DNA vector alone revealed the same pattern of reduced B27/NP383-restricted CTL
recognition previously seen following flu infection and peptide immunization.
Our observations bear an interesting comparison with findings made by McMichael’s
group regarding flu infection. This group showed that co-expression of HLA-B8 with B27 leads
to immunodominance of B27/NP383-391 epitope over the B8/NP380-388 epitope (338). The
major difference between these peptides and those in our study is that the B8 and the B27 peptides
overlap in terms of sequence whereas the B7 and the B27 peptides do not. These investigators
argued since B8 and B27 peptides overlap then these alleles must compete for the presentation of
the common peptide fragment. In our case, there is no competition between the different peptide
fragments for presentation, and as such we regard peptide competition as an unlikely potential
contributing factor to immunodominance seen with B7/B27 Tg mice. We also show that following
peptide stimulation the number of Vβ6+ or Vβ8.1+ CD8+ T cells increased at similar levels in the
B7 and B27 Tg mice, respectively. In addition, these cells were capable of responding to
stimulation with the relevant peptide. These results suggest that the B7/NP418 CTLs do not
increase much more rapidly than the B27/NP383 CTLs. Furthermore, as the level of peptide-
stimulated Vβ6+ CD8+ T cells were similar in both single B7 and double B7/B27 Tg mice, this
may account for the similar B7/NP418-restricted CTL recognition seen with these Tg mice.
Moreover, another possibility is that co-expression of different allele combinations may or may
not influence immunodominance seen with different double Tg mice. A number of studies have
investigated this possibility in different contexts (200, 201, 203, 338). Our results with A2/B7 and
A2/B27 mice show strong CTL responses restricted by both co-expressed HLA alleles, where the
116
peptides are derived from different viral proteins. The lack of competition between these peptides
may explain the absence of immunodominance observed in flu-infected A2/B7 and A2/B27 Tg
mice.
3.5 Conclusions
Identifying determinants contributing to immunodominance hierarchy plays a critical role
in vaccine development. The transgenic mice described here provide appropriate controls and
conditions to address the fundamental biology of the process. Deciphering mechanisms by which
peptides are presented to patients when multiple class I MHC alleles are co-expressed will help in
future vaccine development.
117
Chapter 4
This chapter describing the role of ERAP in flu response of HLA Tg mice has been published in
the Journal of Immunology. The citation for this article is: Ali Akram, Aifeng Lin, Eric Gracey,
Cathy Streutker, Robert D. Inman. .HLA-B27, but not HLA-B7, Immunodominance to Influenza
is Uniquely ERAP Dependent. J Immunol. 2014 Jun 15;192(12):5520-8
Aifeng Lin and Eric Gracey helped with mouse genotyping. Cathy Streutker helped with the
scoring of the H and E slides. All authors approved the draft. I did all the described experiments
and analysis. I prepared the draft for publication.
4 HLA-B27, but not HLA-B7, Immunodominance to
Influenza is Uniquely ERAP-Dependent
4.1 Introduction
The immune system faces immunogenic challenges on a daily basis. Following a viral
infection the host immune response is directed to prompt clearance of the virus. Elements of innate
immunity act rapidly to contain the spread of the virus while providing elements of adaptive
immunity sufficient time to mount a specific and sustained immune response. The adaptive
immune response depends on the ability of CTL to recognize, via TCR, antigenic viral peptides in
the context of major histocompatibility complex class I molecules (MHC I)(145). Proteasomes in
the cytoplasm generate viral peptides of various lengths which are transported via TAP to the
endoplasmic reticulum (ER). Proteasomes generate peptides of 15-26 amino acids in length with
extended N-termini. The N-terminally extended peptides are further trimmed in the ER by
118
endoplasmic reticulum aminopeptidase (ERAP) to peptides of 8-10 amino acids in length which
are appropriate for MHC I binding. These peptides are subsequently bound by MHC class I
molecules and transported to the cell surface where they are surveyed for recognition by the
repertoire of αβ-TCR expressed by CTL (145, 151).
Recent genome wide association studies have implicated an interaction of HLA-B27 and
ERAP as a determining factor in the genetic predisposition to ankylosing spondylitis (AS)(286).
The strong association of ERAP genetic variants with AS is seen exclusively in HLA-B27-positive
AS patients, providing one of the clearest examples of gene-gene interaction in human disease.
But it remains unresolved how physiological co-expression of multiple MHC I alleles with ERAP
may influence susceptibility (255). In addition, the means by which HLA-B27 and ERAP
contribute as cofactors to the immunopathogenesis of AS has proved difficult to resolve in the
clinical setting. The co-dominant expression of multiple human class I alleles contributing to
immunodominance (ImDc) has hindered detailed immune response analysis of clinical samples.
A recent insight highlighting allele-specific events in AS comes from a new study showing that
whereas B27 confers susceptibility to AS, B7 confers protection (339). These advances in the
genetic basis of AS have provided strong indirect support for the concept that processing and
presentation of arthritogenic epitopes likely play a central role in the pathogenesis of AS (340).
However, the identity of such arthritogenic epitopes remains unknown at this time. These findings
emphasize the need for a controlled experimental system in which the interaction of ERAP and
different MHC I alleles can be systematically addressed.
To this end, we have developed single and double HLA transgenic (HLAhyb Tg) mice (341).
The endogenous mouse MHC I genes were deleted (i.e., H-2K-/- and H-2D-/-, double knock-out,
DKO) and selected human HLA genes, specifically HLA-B7 and HLA-B27, were introduced to
119
these DKO mice. Following challenge with influenza virus, the HLA Tg mouse immune response
was comparable to that of humans expressing similar HLA alleles (152, 341). These findings
indicated that these Tg mice can be informative in dissecting genetic control of human immune
response to infection. Concurrently there has been interest in addressing the role of ERAP in host
immune response to infection. ERAP-deficient mice (77) have been generated to study the effects
of ERAP on generation and presentation of immunogenic peptides following lymphocytic
choriomeningitis virus (LCMV), mouse cytomegalovirus (mCMV), influenza (flu), and
Toxoplasma gondii infections. We used these ERAP-/- mice and crossed them with our HLA-B7
and HLA-B27 Tg mice (on a DKO background) to create HLA-Tg mice in the absence of ERAP.
As identifying antigenic peptides is difficult in the clinical setting, these double Tg mice (i.e.,
B27/ERAP-/- and B7/ERAP-/-) would serve as an informative model on the mechanisms of host
immune responses following an infectious challenge which may entail an interaction of HLA and
ERAP. As the immunodominant epitopes for various human HLA alleles for influenza virus are
well known (i.e., NP383-391 for HLA-B27+ and NP418-426 for HLA-B7+ individuals), we used
flu as a model to investigate the effects of HLA-B27 and ERAP-/- in vivo.
Studies with ERAP deficient mice have shown reduced cell surface expression of MHC I
molecules, but not MHC II (78, 298). These mice show no differences in the profile of CD4 and
CD8 compared to mice with intact ERAP. The peptide repertoire generated in ERAP deficient
mice following a viral infection differed from ERAP+/+ mice. Following infection, the CTL
response to ovalbumin OVA257-264, LCMV NP396-404, mCMV YL9, and flu NP366-374, PA224-233,
NS2114-121 and PB2198-206 epitopes was reduced whereas that of LCMV GP33-41 and
histocompatibility gene SVL9 epitopes increased (74, 193, 298, 299). In addition to viral infection,
one study demonstrated that there was no CTL response to the immunodominant HF10 epitope of
120
T. gondii in ERAP-/- mice, indicating the involvement of ERAP in the generation of this epitope
(300). Expansion of HF10-specific CD8+ T cells was shown to be impaired in ERAP-/- mice
rendering these mice more susceptible to toxoplasmosis.
Here we show for the first time that the generation and presentation of the
immunodominant B27-restricted flu peptide NP383-391 is ERAP-dependent. This B27/NP383
epitope is likely made as an extended 14-mer which is subsequently trimmed by ERAP.
Furthermore, we show B27/ERAP-/- mice to have reduced B27/NP383-specific naive Vβ8.1+-
expressing CD8+ T cells in comparison with the ERAP-intact counterpart. Surface expression of
HLA-B27 in naive and infected B27/ERAP-/- mice was also significantly reduced. HLA-
B27/ERAP-/- Tg mice had increased edema in lung tissues and low levels of inflammatory
cytokines. These events were not paralleled in the HLA-B7 mice: there were no differences in the
B7 surface expression nor in the number of B7/NP418-specific naive Vβ6+-expressing CD8+ T
cells in B7/ERAP-/- compared to its B7/ERAP+/+ counterpart. These results indicate an important
cohesive relationship by which HLA-B27 and ERAP play in host immunity.
121
4.2 Materials and Methods
4.2.1 Generation and Identification of HLA Tg ERAP-/- Mice
The generation of single Tg HLA-B27/DKO and HLA-B7/DKO has been described (152,
202). The generation of ERAP-deficient mice has also been described (77). These mice were a
generous gift from Dr. N. Shastri. Appropriate crosses of ERAP-deficient and DKO mice were
made to generate ERAP-/-/DKO (i.e., ERAP-/-). Subsequently, appropriate crosses of single Tg B27
and B7 were made with ERAP-/- Tg mice to generate HLA-B27/ERAP-/-/DKO (i.e., B27/ERAP-/-
) and HLA-B7/ERAP-/-/DKO (i.e., B7/ERAP-/-) mice. B7/ERAP-/- and B27/ERAP-/- were analyzed
by flow cytometry and PCR. For PCR analyses we used the following primers: (F1)
GGAGTTTGGTTTTATGGAGGGTTG, (F2) TTGTGTGCCATCTGTAGGG, and (R1)
CGGCTTGATTTATCTTGTCTGG. All mice were housed in the specific pathogen-free animal
facility at Toronto Western Hospital in Toronto according to the guidelines of the Canadian
Council of Animal Care. All animal studies have been reviewed and approved by the University
Health Network Research Committee.
4.2.2 Flow Cytometry Analysis
The monoclonal antibodies (mAb) and detection reagents used for flow cytometry and their
specificities and sources are as follows: ME1 (specificities: HLA-B7, -B27, -Bw22, and –B14)
and BB7.1 (specificity: HLA-B7)(22) were from the American Type Culture Collection
(Manassas, VA); CD4-PE (0.5 mg/ml, diluted 1:100), CD3-PerCP (0.5 mg/ml, diluted 1:150), and
CD8α-FITC (0.5 mg/ml, diluted 1:150) were from BD Pharmingen (San Diego, CA). The anti-
TCR Vβ mAbs were from BD Pharmingen (0.5 mg/ml, diluted 1:100)(San Diego, CA). FITC-
conjugated F(ab’)2 goat anti-mouse IgG (Fc-specific, 0.5 mg/ml, diluted 1:150) and FITC-
122
conjugated F(ab’)2 goat anti-rat IgG (Fc-specific, 0.5 mg/ml, diluted 1:150) were from Accurate
Chemical and Scientific (Westbury, NY).
4.2.3 Influenza A/X31 (H3N2) Infection and IFN-γ ELISpot Assays
Mice between 7-10 weeks of age were infected as described (341). Briefly, Tg mice were
transiently anaesthetized with metofane (methoxyflurane, Pitman-Moore) and infected i.n. with 20
hemagglutinating units (HAUs) of influenza A/X31(H3N2) (SPAFAS, North Franklin, CT) in 30
μl of PBS. Eleven days post-flu infection IFN-γ ELISpot assays were used to determine the
frequency of peptide-specific IFN-γ-producing cells in spleens of flu-infected mice. Both HLA-
B27+ human CTL and Tg B27 mouse CTL recognize flu NP383-391 while the CTL response in
HLA-B7+ humans and Tg B7 mice is directed primarily to flu NP418-426 (341). HLA-B27 mice
may also respond to NS1.87-95, PB2.702-710, PB2.368-376, and PB1.571-579 flu epitopes (175).
In Non-Tg WT C57Bl/6J mice, the anti-flu CTL response is directed at the NP366-374 in the
context of H2-Db. Each of these respective peptides at pre-specified concentrations was used as
described (341). All peptides were synthesized and purchased from Bio Basic Inc (Markham, ON,
Canada).
4.2.4 Tetramer Staining and Enrichment of Antigen-specific CD8+ T Cells
Cell suspension from spleen and lymph nodes (LN) were enriched for T cells using Pan T
Cell Isolation Kit II Mouse as directed by the manufacturer’s protocol (Miltenyi Biotec). The
details of cell preparation and staining have been described (341). Briefly, spleen and LN were
mashed using a plunger, filtered, and lysed with ACK lysis buffer. Cells were washed and counted
before single-cell suspensions (up to 108 cells) were labeled and passed over a magnetized LS
123
column (Miltenyi Biotec). Columns were washed and the bound cells were eluted and stained with
T cell markers. Tetramers specific for NP366-374 (1.2 mg/ml, diluted 1:100), NP383-391 (1.2
mg/ml, diluted 1:100), and NP418-426 (1.3 mg/ml, diluted 1:100) were synthesized by NIH
(Atlanta, GA). Cells were washed and fixed with 1% PFA before being analyzed with a LSRII
cytometer (Becton Dickinson). Data analysis was performed using Cell Quest and FlowJo
softwares (BD Immunocytometry Systems, CA).
4.2.5 Peptide Immunization
The peptide immunization protocol used has been described (341). Naive HLA Tg mice
were immunized subcutaneously with CpG (10μg/ml, 50μg per mouse in 1 x PBS) two days prior
to peptide immunization. Two days later the mice were stratified into three different groups: one
group of mice were co-immunized subcutaneously with synthetic NP418-426 (10μg/ml, 75
μg/mouse) and NP383-391 (10μg/ml, 75 μg/mouse) peptides in incomplete Freund’s adjuvant
(IFA), or IFA alone as control; the second group was immunized with N-terminally extended 14-
mer version of NP383-391 (10μg/ml, 75 μg/mouse)(TLELRSRYWAIRTR) and NP418-426
(10μg/ml, 75 μg/mouse) (SVQRNLPFDRTTIM), and the last group was immunized with the N-
terminally extended 18-mer of NP383-391 (10μg/ml, 75 μg/mouse)(MESSTLELRSRYWAIRTR)
and NP418-426 (10μg/ml, 75 μg/mouse) (QPTFSVQRNLPFDRTTIM). Eleven days post-
immunization spleen cells were removed and tested by ELISpot.
4.2.6 Body Weight Loss and H and E Staining
Following flu infection mice were weighed on a daily basis for 12 days. On day 12 flu-
infected HLA Tg mice along with allele- and age-matched naive counterparts were sacrificed, the
124
lungs excised and fixed in 10% formalin. The fixed lung samples were embedded and stained with
haematoxylin and eosin (H&E) dyes. Pictures were generated using a Nikon Eclipse TE2000-U
microscope equipped with a Nikon Digital Sight DS-U2 camera and NIS-Elements BR3.10
acquisition software. This microscope was equipped with a 10x objective (NA 0.3) and 20 x
objective (NA 0.45).The lung slides were scored in a blinded fashion by Dr. Cathy Streutker.
4.2.7 Cytokine Analysis
Serum was prepared as per Eve Technologies direction (Calgary, AB, Canada). Briefly,
naive and flu infected mice were sacrificed and blood was immediately removed by cardiac
puncture. Blood was allowed to clot for 2 hrs before spinning at 1000 RPM for 10 minutes at 4°C.
Supernatants were aliquoted and stored at -20°C before analysis. Lung tissue homogenates were
prepared as described (342). Lung tissues were homogenized in PBS-based buffer (20mM Tris.Cl
pH7.5, 1% Triton-x, 0.05% SDS, 5mg/ml Deoxycholic acid, 50mM NaCl, and1mM PMSF)
containing various protease inhibitor (Roche, Germany). Lung homogenates were filtered
(0.22µm), spun at 12000 RPM for 4 minutes, and stored at -20°C before analysis by Eve’s
Technologies.
4.2.8 Statistical Analysis
Data were analyzed by two way analysis of variance (two variables; naive vs. flu infected
and ERAP+/+ vs. ERAP-/- in GraphPad Prism 5.0, GraphPad Software Inc.,La Jolla, CA) with a
Bonferroni posttest correction. All values are expressed as mean (± SEM), P < 0.05 (adjusted P)
was considered significant. Student t-test was also performed as indicated.
125
4.3 Results
4.3.1 Characterization of novel B7/ERAP-/- and B27/ERAP-/- Mice
ERAP-deficient mice were identified by PCR and flow cytometric analysis as described
(77). Consistent with previous findings we saw no significant differences in the percentage of
CD4+ and CD8+ T cells in LN (Fig. 4.1A) or spleen (not shown) between the ERAP+/+ (341) and
ERAP-/- HLA Tg mice. Non-transgenic wild type (Non-Tg WT) mice had the highest level of
CD8+ T cells compared to HLA Tg ERAP-/- mice. As expected, double-knock out (DKO) mice
had the lowest CD8+ T percentage confirming previous results (341). The absence of ERAP did
not significantly alter the cell surface expression of HLA-B7 (Fig. 4.1B, left panel). In contrast,
the expression of HLA-B27 as detected by ME1 antibody was significantly (p=0.0032 for MFI)
reduced in B27/ERAP-/- mice (Fig. 4.1B, right panel) in comparison with B27 Tg mice.
4.3.2 Reduced B27/NP383-391 CD8+ T cell response in flu-infected B27/ERAP-/-
Tg mice
Previous studies of ERAP-/- mice did not address the “interaction” of MHC-I, either
endogenous or transgenic, with ERAP, whereas our current mouse constructs allow a specific
analysis of possible roles of HLA alleles and ERAP on CD8+ T cell responses following influenza
infection. We infected B7/ERAP-/- and B27/ERAP-/- Tg mice along with the corresponding
ERAP+/+ HLA Tg controls with flu as described (Fig. 4.2)(341). Spleen cells were examined by
IFN-γ ELISpot assay 11 days post intranasal (i.n.) flu infection. B7/ERAP-/- and B7/ERAP+/+ mice
both showed strong CTL responses to B7-restricted NP418-426 immunodominant epitope (Fig.
4.2A and B). There was no significant difference in the B7/NP418-426 CTL response among these
126
two mouse strains. Controls indicated no CTL response in the presence of irrelevant peptide or in
the
Figure 4.1. Characterization of HLA Tg ERAP-/- mice.
______________________________________________________________________________
Legend to Figure 4.1
Characterization of HLA Tg ERAP-/- mice
(A) LN from different Tg mice were stained for CD3 and CD8. The bar graph shows the percentage
of CD3+CD8+ T cells in different Tg mice. Data are shown as mean ±SEM from n=6 mice per
group and are pooled from three independent experiments. *, p<0.05 vs. Tg mice using student t-
test. (B) The expression level of HLA-B7 (as detected by BB7.1 mAb) and HLA-B27 (as detected
by ME1 mAb) in single and double HLA Tg mice. Representative plots of flow cytometric
analyses for different mice are shown. This experiment was repeated three times with n=6 mice
per group. Significance was assessed using two way analysis of variance.
Nonstain
Nonstain
127
absence of peptide in all mice. In contrast, B27/ERAP-/- mice unexpectedly showed reduced CTL
responses to the B27-restricted NP383-391 flu epitope compared to CTL responses seen in
B27/ERAP+/+ mice (Fig. 4.2C and D). The B27/NP383-391 CTL response was significantly
(p<0.0001) reduced in the B27/ERAP-/- Tg mice. The PB2.702-710 CTL response appeared higher
(p=0.0681) in B27/ERAP-/- Tg mice than in B27/ERAP+/+ mice. Overall, the CTL response to other
subdominant B27 flu epitopes did not reach significance above the background in both ERAP+/+
and ERAP-/- B27+ mice (Fig. 4.2C and D).
4.3.3 Increased weight loss and pathology in B27/ERAP-/- Tg mice
The ELISpot results above prompted us to assess the overall response to flu in these mice
(Fig. 4.3). Others have used fluctuations in the body weight following a viral infection as a viral
clearance index (343, 344). We used the same index following flu infection of ERAP+/+ and ERAP-
/- HLA Tg mice (Fig. 4.3A and B). We followed the changes in the body weight on a daily basis
for twelve days post-infection. There were significant (p<0.01) differences in the body weight
between the B27/ERAP-/- and B27 Tg mice 5-9 days post-flu infection (Fig. 4.3A). However, such
differences were neither observed in the initial stages of flu infection (i.e., between Day 1-5) nor
in the latter parts of recovery (i.e., between Day 11 and Day 12)(Fig. 4.3A). Both B27/ERAP-/-
and B27 Tg mice recovered from flu infection and ended up with similar profile of body weight
change 12 days post-flu infection (Fig. 4.3A). Such significant differences in the baseline body
weight were not observed in the B7/ERAP-/- and the B7 Tg mice (Fig. 4.3B). Although the body
weight profile of flu infected B7/ERAP-/- and the B7 Tg mice were similar, it is noteworthy to
notice that the B7/ERAP-/- Tg mice seemingly (but not significantly) lost less weight overall during
the course of infection compared to B7 Tg mice (Fig. 4.3B).
128
Figure 4.2. ELISpot analysis of the CD8+ CTL response to flu infections in single
(A & C) and double (B & D) HLA Tg ERAP+/+ and ERAP-/- mice.
129
Legend to Figure 4.2.
ELISpot analysis of the CD8+ CTL response to flu infections in single
(A & C) and double (B & D) HLA Tg ERAP+/+ and ERAP-/- mice.
ELISpot analysis of the CD8+ CTL response to flu infections in single (A & C) and double (B &
D) HLA Tg ERAP+/+ and ERAP-/- mice. Mice were infected with flu i.n. as described in the
Materials and Methods. After eleven days post-infection the CTL response was tested by IFN-γ
ELISpot for various flu peptides. Data are shown as mean ±SEM of n=6 mice per group and are
pooled from six independent experiments. Significance was assessed using two way analysis of
variance. ***, p<0.0001 vs. NP383-391 CTL response seen in Tg B27 mice.
130
Figure 4.3. Differences in the profile of HLA Tg ERAP+/+ and ERAP-/- Tg mice following flu
infection as examined by body weight baseline change, cytokine analysis and H&E staining
of lung sections.
131
Figure 4.3 (continued). Differences in the profile of HLA Tg ERAP+/+ and ERAP-/- Tg mice
following flu infection as examined by body weight baseline change, cytokine analysis and
H&E staining of lung sections.
132
Legend to Figure 4.3.
Differences in the profile of HLA Tg ERAP+/+ and ERAP-/- Tg mice following flu infection
as examined by body weight baseline change, cytokine analysis and H&E staining of lung
sections.
(A-B) Percent change in baseline body weights of B27 and B27/ERAP-/- (A) and B7 and B7/ERAP-
/- (B) Tg mice. Mice were infected i.n with 20 HAUs of influenza A/X31(H3N2) and the body
weight change was tracked for 12 days post-flu infection. Data are shown as mean ±SEM of n=6
mice per group and are pooled from three independent experiments. (C) Cytokine profiles of pro-
inflammatory cytokines in naive and infected (Day 11 post-infection) Tg mice. Lungs were
homogenized and examined for the expression of different cytokines. Data are shown as mean
±SED of n=4 mice per group and are pooled from three independent experiments. (D)
Histopathological characteristic of naive and flu infected Tg lung sections. Lung sections were
stained with H&E (original Magnification, x 10). Bar graph indicates the presence or absence of
edema in different Tg mice (right panel). Histopathology scores of lung sections were scored in a
blinded fashion by a lung pathologist. Data are shown as mean ±SEM of n=6 mice per group.
Significance was assessed using two way analysis of variance. **, p<0.001 as indicated.
133
4.3.4 Flu infected B27/ERAP-/- Tg mice have reduced levels of inflammatory
cytokines and increased lung edema
Differences seen in body weight 5-9 days post-flu infection indicative of differential viral
clearance and/or increased cytokines between the B27/ERAP-/- and B27 Tg mice suggests ERAP
influences adaptive immune response in a time-dependent manner. To investigate whether there is
any difference in the level of inflammatory cytokines produced in ERAP+/+ and ERAP-/- Tg mice,
we determined the cytokine profile in serum and lung homogenate of naive and flu infected mice
(Fig. 4.3C)(342). As expected, cytokine level of flu infected animals was higher than its naive
controls confirming previous results (345, 346). There was a significant (p<0.001) difference in
the levels of IL-1a, IL-6, and MIP-1a produced in the lung of B27/ERAP+/+ and B27/ERAP-/- Tg
mice (Fig. 4.3C). Similar trend of IL-6 and MIP-1a, but not IL-1a, production was observed in
infected serum samples of B27/ERAP+/+ and B27/ERAP-/- mice. The effect of ERAP on
differential expression of IL-6 and MIP-1a in the lung seen in B27 Tg mice was not seen in B7 Tg
mice. Next, to determine whether there are any differences in the pathology of the target organ,
we stained naive and flu-infected fixed lung sections with H&E (Fig. 4.3D). The slides were
subsequently scored by a lung pathologist in a blinded fashion. Overall, as evident in Figure 3D,
there is an increase in edema in lungs of flu infected ERAP+/+ and ERAP-/- Tg mice compared to
naive mice regardless of mouse strain. The alveolar membranes showed significant damage
following flu infection. The total edema score for infected B27/ERAP-/- was significantly
(p<0.001) higher than that of B27/ERAP+/+ Tg mice (Fig. 4.3D, bar graph). No differences in the
edema score were observed between the B7 and B7/ERAP-/- Tg mice (Fig. 4.3D).
134
4.3.5 Reduced number of B27/NP383-391 CD8+ T cell in B27/ERAP-/- Tg mice
We recently showed that double Tg B7/B27 mice (i.e., ERAP-intact mice) have a reduced
number of naive B27/NP383-391 CD8+ T cells compared to single Tg B27 mice (341). Differences
in the naive B27/NP383-391 CD8+ T cell number accounted for the decreased NP383-391 CTL
response following flu infection in B7/B27 Tg mice. To investigate whether the difference in the
B27/NP383-391 CTL response (compare Fig. 4.2C and 4.2D) seen between the B27/ERAP-/- and
B27 Tg mice is due to a reduced number of B27/NP383-391 naive CD8+ T cells in B27/ERAP-/-
Tg mice, we stained T cell- enriched splenocytes with flu NP383-391 tetramer as described in the
Materials and Methods (Fig. 4.4A). The percentage of CD3+CD8+NP383+Tet+ T cells in naive and
flu-infected B27/ERAP-/- Tg mice is lower (i.e., 0.601% and 1.31%) than our previous results for
naive and flu-infected B27 Tg mice (i.e., 1.15% and 6.82%)(341) respectively (Fig. 4.4A). These
percentage differences reflect the variance seen in the actual numbers of B27/NP383-specific CTL.
The number of naive and flu-infected B27/NP383-391 CD8+ T cells is significantly (p<0.0001)
lower in B27/ERAP-/- Tg mice compared to B27 Tg mice (Fig. 4.4B and 4.4C). Tetramer staining
with NP418-426 flu epitope did not reveal any major differences in the CD3+CD8+NP418+Tet+ T
cell number in naive and flu-infected B7 and B7/ERAP-/- Tg mice (Fig. 4.4B and 4.4C). We used
the Non-Tg WT/NP366-374 flu tetramer as a negative control to show the specificity of our
tetramer staining to different HLA alleles (Fig. 4.4).
135
Figure 4.4. Enumeration of naive and flu infected enriched T-cell populations in different
Tg mice using B7/NP418-426, B27/NP383-391, and the WT/NP366-374 flu tetramers.
A)
136
Legend to Figure 4.4.
Enumeration of naive and flu infected enriched T-cell populations in different Tg mice
using B7/NP418-426, B27/NP383-391, and the WT/NP366-374 flu tetramers.
(A-C) T lymphocytes from naive and flu infected mice were enriched from the spleen and LN.
By first gating on the CD3+CD8+ positive cells (not shown), different T-cell populations
corresponding to different flu tetramers were plotted. (A) Representative dot plots showing
tetramer percentages of naive (left panel) and flu infected (right panel) enriched CD3+CD8+ T
cells corresponding to different flu peptides. Quantification of flu specific Tet+CD3+CD8+ T cells
from the spleen of naive (B) and day 11 post i.n. flu (C) infected Tg mice. Data are shown as mean
±SEM of n=6 mice per group and are pooled from five independent experiments. Significance was
assessed using two way analysis of variance ***, p<0.0001 as indicated.
137
4.3.6 Deletion of Vβ8.1+ CD8+ T cells in B27/ERAP-/- Tg mice
We have previously shown that TCR Vβ6+CD8+ T cells recognize NP418-426 flu epitope
in B7+ human and B7 Tg mice (341). The recognition of NP383-391 flu epitope in both B27+
humans and B27 Tg mice is dependent on TCR Vβ8.1-expressing CD8+ T cells. Our recent
published data showed co-expression of B7 with B27 led to negative selection of B27/NP383-391
flu specific naive Vβ8.1+-expressing CD8+ T cells in B7/B27 Tg mice (341). Here we identify a
significant difference (p<0.001) in the expression of Vβ8.1 CD8+ T cells in naive (compare Fig.
4.5A and B) and flu-infected (Fig. 4.5E) B27/ERAP-/- Tg mice compared to B27 Tg mice. Unlike
Vβ8.1 expression, there was no drastic change in the overall expression of TCR Vβ6+-expressing
CD8+ T cells in naive (compare Fig. 4.5C and D) and flu-infected (Fig. 4.5F) B7 Tg and
B7/ERAP-/- mice. Overall, significant differences were observed for Vβ8.1 expression in naive
B27 Tg and B27/ERAP-/- mice (Fig. 4.5E), and the lack of differences present for Vβ6 expression
in naive B7 Tg and B7/ERAP-/- mice (Fig. 4.5F) confirm the above results. There were no major
deviations in the expression of other TCR Vβ markers between the naive and flu-infected ERAP+/+
and ERAP-/- B7 or B27 Tg mice (Fig. 4.5E and F).
138
Figure 4.5. Analysis of TCR Vβ repertoire of ERAP+/+ and ERAP-/- HLA Tg mice.
139
Legend to Figure 4.5.
Analysis of TCR Vβ repertoire of ERAP+/+ and ERAP-/- HLA Tg mice.
Spleen cells from naive mice were stained for the expression of CD3, CD8 and various TCR Vβs.
By gating first on the CD3+CD8+ T cells (not shown), the relative abundance of cells expressing
each TCR Vβ was examined. Representative graphs showing the relative abundance of (A) naive
B27 and (B) B27/ERAP-/- cells expressing TCR Vβ8.1. Representative graphs showing the relative
abundance of (C) naive B7 and (D) B7/ERAP-/- cells expressing TCR Vβ6. (E-F) Bar graphs of
TCR Vβ expression in naive and flu-infected HLA (E) B27 and (F) B7 Tg mice in the presence
and absence of ERAP. The values were normalized as described in (341). Data are shown as mean
±SEM of n=6 mice per group and are pooled from three independent experiments. Significance
was assessed using two way analysis of variance. **, p<0.001.
140
4.3.7 Generation and presentation of B27/NP383-391 flu epitope is ERAP-
dependent
ERAP is involved in generation and trimming of different peptides for recognition by CTL
(145). To directly addresses the role of ERAP in NP383-391 and NP416-426 peptide generation
we immunized HLA Tg ERAP+/+ and ERAP-/- mice with canonical B27 and B7 flu epitopes and
examined the CTL response by IFN-γ ELISpot assay as described (Fig. 4.6A and B)(341). The
B27/NP383 CTL response in B27/ERAP-/- mice was significantly lower (p<0.001) than CTL
response in B27 Tg mice (Fig. 4.6A). There were no significant differences in the CTL response
to NP418-426 flu epitope in B7 Tg and B7/ERAP-/- mice (Fig. 4.6B). Since ERAP has been shown
to trim some N-terminally extended peptides in the ER in a sequential manner, we immunized the
HLA Tg mice with N-terminally extended modifications of B7 and B27 flu epitopes and examined
the CTL response by IFN-γ ELISpot assay (Fig. 4.6C and D). Surprisingly, following 14-mer
NP383 peptide immunization, there was no CTL response to NP383-391 flu epitope in B27/ERAP-
/- mice while the CTL response in B27 Tg mice to the same epitope was significantly (p<0.0001)
higher (Fig. 4.6C). Immunization with an 18-mer version of NP383-391 flu epitope did not result
in any CTL responses in any HLA Tg mice regardless of ERAP status (Fig. 4.6E). Immunization
with a 14-mer version of the NP418-426 flu epitope demonstrated no significant differences in the
CTL response between B7 Tg and B7/ERAP-/- mice (Fig. 4.6D). As was the case with the 18-mer
version of NP383-391 vaccination, immunization with 18-mer version of NP418-426 was not
associated with a detectable CTL response in any mouse strain (Fig. 4.6F). The Non-Tg
WT/NP366-374 flu epitope was included as a negative control for our peptide immunization
experiments.
141
Figure 4.6. Peptide immunization of HLA Tg mice in the presence or absence of ERAP
with canonical and N-terminally extended flu epitopes.
142
Legend to Figure 4.6.
Peptide immunization of HLA Tg mice in the presence or absence of ERAP with canonical
and N-terminally extended flu epitopes.
(A-D) Different Tg mice were immunized subcutaneously with canonical (A & C) and N-
terminally extended 14-mer (B & D) and 18-mer (E & F) version of flu epitopes as indicated and
tested by ELISpot for various flu peptides 11 days post-immunization. Data are shown as mean
±SEM of n=6 mice per group and are pooled from four independent experiments. Significance was
assessed using two way analysis of variance. **, p<0.001 as indicated; ***, p<0.0001 as indicated.
143
4.4 Discussion
The results presented here signify the importance of HLA-B27 and ERAP collaboration in
peptide generation and presentation. This is the first report where the absence of ERAP has led to
altered selection of allele-specific naive CD8+ T cells. Our results complement a number of
previous findings with ERAP-/- mice while adding new knowledge about the role of ERAP in the
adaptive immune response. These results suggest that the function of ERAP is dependent on its
MHC-I context: the presence or absence of ERAP in combination with HLA-B7 had no effects on
host immune responses, while the absence of ERAP significantly altered the immune response to
infection when co-expressed with HLA-B27. These in vivo studies complement recent genetics
studies (286) which have implicated class I allele-specific interactions with ERAP not only in AS
but also in psoriasis and Behcet’s disease (269). Discovery of pathogenic peptide epitopes has been
very difficult in these diseases and the current study provides a proof-of-principle demonstration
of specific ERAP-MHC I “interactions” influencing host response to infection.
ERAP has been shown to influence the overall peptide repertoire available for presentation
(74, 193, 347). Our findings demonstrate that generation and presentation of B27-restricted
NP383-391 flu epitope is critically dependent on ERAP. The absence of ERAP in B27/ERAP-/-
mice lead to a significant reduction in CTL response to NP383-391 epitope following flu infection
and peptide vaccination. Our peptide immunization studies suggest that the NP383 epitope is most
likely generated as an N-terminally extended multimer which is subsequently trimmed in the ER
by ERAP before being loaded into the MHC I peptide-binding groove. ERAP has been shown to
cleave polypeptides at specific sites expressing leucine (L), methionine (M), phenylalanine (F) and
tyrosine (Y) in the amino acid sequence (75, 290). The natural 14-mer sequence of NP383-391
(i.e., TLELRSRYWAIRTR) contains two leucines upstream of NP383-391 at position 11 and 13,
144
which provide potential cleavage sites for ERAP. The absence of NP383-specific CTL response
following 14-mer and 18-mer NP383-391 peptide immunization in B27/ERAP-/- Tg mice indicates
that this epitope is indeed trimmed by ERAP. On the other hand, TAP has been shown not to
transport peptides containing proline (P) at position 2 within its sequence (192). The presence of
proline at position 2 of NP418-426 (i.e., VQRNLPFDRTTIM) strongly suggests that this epitope
is initially generated as an N-terminally extended species before being transported into the ER by
TAP. Lack of B7/NP418 CTL response difference between the B7 Tg and B7/ERAP-/- mice
following flu infection and peptide immunization argues against a specific role for ERAP in the
final generation of the B7 epitope. The absence of ERAP’s preferred cleavage amino acids
upstream of the NP418-426 flu sequence seems to confirm this. It is worth noting that
immunization with exogenous peptide precursors does not always guarantee ER trimming.
Aminopeptidases located at the cell surface or in the endosome (e.g., IRAP) can also contribute to
the overall peptide trimming. Given that the only difference between the B27/ERAP and the
B27/ERAP-/- Tg mice is absence of ERAP expression, these other possibilities were ruled out as
contributing factors. Our B7 findings confirm previous observations with ERAP-/- mice (194, 348).
These studies showed there was no significant difference in the CTL number and CTL response to
flu NP366-374, PA224-233, NS2114-121, PB1F262-70, PB2198-206 epitopes. It is known that ERAP can
influence the CTL response to one epitope but not another originating from the same virus.
Previously Niedermann’s group showed that absence of ERAP expression leads to diminished
LCMV CTL responses to immunodominant NP396-404, but not to immunodominant GP33-41 (348).
Our findings are the first to show that the B27-restricted flu CTL response, but not the B7-restricted
flu CTL response, are influenced by ERAP.
145
ERAP when co-expressed with HLA-B27 plays multiple critical functions in host
immunity. First, as discussed above, it trims the N-terminally extended version of the
immunodominant flu NP383-391 epitope to the appropriate length before it is being presented by
HLA-B27. Secondly, ERAP may figure critically in determining the T cell repertoire in
B27/ERAP-/- mice. It is notable that the reduction in T cells reactive with NP383-391 is detected
in naive as well as flu-infected mice. During thymic selection in B27 Tg mice, ERAP may
contribute to destruction of self-reactive antigens, some of which might mimic flu NP383-391
epitopes, thus allowing positive selection of those thymocytes capable of recognizing the NP383-
391 flu epitope later on in life. When ERAP is absent, as is the case in B27/ERAP-/- mice, deletion
of self-reactive T cells recognizing antigens which mimic flu NP383-391 epitope does not take
place, leading to eventual negative selection of B27/NP383-specific thymocytes expressing TCR
Vβ8.1+. Partial deletion of a specific T cell population may occur for different reasons. We have
recently shown that co-expression of HLA-B7 with HLA-B27 in double Tg B7/B27 mice (i.e.,
ERAP-intact) leads to negative selection of B27/NP383-reactive T cells (341). Thus, both MHC I
allelic co-expression and ERAP-mediated peptide trimming contribute in an allele-specific manner
to selection of T cells. Lastly, surface expression of HLA-B27, but not HLA-B7, is significantly
reduced when ERAP is absent. Our B27 results are consistent with published results of others
showing reduced endogenous MHC class I expression in ERAP-/- mice. These results suggest that
ERAP normally stabilizes the B27 heavy chain (HC) by presenting it with appropriate B27-specific
peptides during assembly of MHC I. When ERAP is absent, such peptide presentation to newly
synthesized B27 molecules is impaired. This may contribute to two of the proposed mechanisms
whereby HLA-B27 contributes to disease pathogenesis, namely, misfolding of the HC of B27
within the ER resulting in an unfolded protein response (294) phenomenon and homo-dimerization
146
of B27 HC leading to altered interaction with NK cells (349, 350). These two phenomena
associated with B27 may lead to slower transport of a diminished number of mature B27 molecules
to the cell surface. Taken together, altered selection of B27/NP383-specific CD8+ T cells and
reduced B27 surface expression in B27/ERAP-/- mice likely account for both the reduced number
of NP383-391 CD8+ T cells and the reduced NP383-391 CTL response following flu infection and
peptide immunization in these mice.
To date this is the first report, to our knowledge, directly linking ERAP as a determining
factor in T cell repertoire generation during thymic development. ERAP appears not to influence
presentation of other B27-restricted subdominant epitopes (Fig. 2). Increased weight loss 5-9 days
post-flu infection in B27/ERAP-/- Tg mice is reflective of partial impaired viral clearance, likely
secondary to lower numbers of NP383-391-specific CD8+ T cell number. Increased edema in the
lung in the same mice reflecting enhanced direct lung injury recapitulated this trend. Lower levels
of pro-inflammatory cytokines in the lung of B27/ERAP-/- Tg mice is consistent with an impaired
local response to the virus. Blinded scoring of the lung pathology revealed lower number of acute
and chronic inflammatory infiltrates in B27/ERAP-/- mice compared to B27/ERAP+/+ Tg mice,
accounting for the lower inflammatory cytokine levels in B27/ERAP-/- Tg mice. We have
previously shown and confirmed here that the predominant CTL response in B27 Tg mice is
directed at NP383-391. In addition to this specific NP383 CTL response, it is possible other B27-
specific flu epitopes, not investigated here, contribute to the overall viral clearance. Slight
increases in the level of CTL responses to other subdominant B27 flu epitopes (e.g., PB2.702-710,
Fig. 2D) in B27/ERAP-/- Tg mice may partially make up for the reduced B27/NP383-391 CTL
response aiding in overall viral clearance.
147
4.5 Conclusion
We propose that in the absence of ERAP there is a relative inability to trim N-terminally-
extended NP383-391 peptide and that this accounts for the reduced number of B27/NP383-specific
CD8+ Vβ8.1+ T cells seen in naive and flu-infected B27/ERAP-/- mice. Utilization of a well-
controlled in vivo animal model can enhance our ability to resolve the cohesive ERAP-B27
“interaction” in disease pathogenesis. Such a system will shed more light into the mechanisms
behind the genetic basis of AS.
148
Chapter 5
5 Conclusions and Future Directions
5.1 Conclusions
The work presented here illuminates the importance of MHC-I allele co-expression on the
overall immune response following influenza infection. Co-expression of certain MHC-I
combinations (i.e., A2/B7, A2/B27, and B7/B27) determines whether ImDc of one allele over the
other is observed following flu infection. Expression of ERAP influences ImDc as well. The in
vivo studies with flu-infected ERAP-deficient B27 Tg mice presented here showed for the first
time, to our knowledge, that the B27/NP383-restricted CTL response is ERAP-dependent.
Using single Tg A2, -B7, or -B27 mice I established that the anti-flu CTL responses are
mainly directed at the respective ImD epitopes. However, only co-expression of B7 with B27 led
to B7/NP418-restricted immunodominant CTL responses in flu-infected B7/B27 Tg mice. Using
chimeras I showed this was likely due to negative selection of B27/NP383-restricted
Vβ8.1+CD3+CD8+ naive T cells in B7/B27 Tg mice. No such dominance of allele-based epitope
was observed in flu-infected A2/B7 or A2/B27 Tg mice suggesting that certain combinations of
allele co-expression influence ImDc more than others. This investigation proved that my initial
hypotheses were correct.
Studies with B27 ERAP deficient mice revealed for the first time, to our knowledge, that
the anti-flu CTL response to B27-restricted NP383-391 epitope is ERAP-dependent. Peptide
149
immunization of B27/ERAP-/- mice with N-terminally extended synthetic B27 flu epitopes showed
that the absence of ERAP prevents the generation and subsequent presentation of B27/NP383
epitope to B27+Vβ8.1+CD3+CD8+ T cells. Indeed, lack of ERAP expression may have contributed
to the partial negative selection of naive Vβ8.1+CD3+CD8+ T cells in B27/ERAP-/- mice. This
investigation agreed with my hypotheses as well.
Immunodominance is a phenomenon influenced by multiple factors. Deciphering
individual components contributing to ImDc will enhance our overall ability to develop improved
i) vaccines (e.g., for flu) and ii) treatment for AS patients. Studies outlined here revealed new
parameters that are critical in our overall knowledge of ImDc.
5.2 Future Directions
The results shown in the previous chapters answer several important questions, while
raising new ones. Specifically the interplay between B27 and ERAP is relevant to AS, since genetic
variants of ERAP with less enzymatic activity have been shown to be protective in AS. I would
like to take this correlation to next the step. Studies outlined below will deal directly with ERAP
in relation to AS. These studies will address some currently unanswered questions which could be
critical in advancing our understanding of AS.
5.2.1 Studies of ERAP Expression in B27/ERAP Tg Mice
5.2.2 What is the length of the N-terminally extended B27/NP383-391
epitope before it is trimmed by ERAP?
150
Studies outlined in chapter 4 suggest that NP383-391 is made as an N-terminally extended
epitope. Studies with 18-mer version of N-terminally extended NP383-391 did not induce any
CTL response while peptide immunization with the 14-mer version of the same epitope did. What
is the exact length of the N-terminally extended NP383-391 epitope?
To address this question I would synthesize different versions of N-terminally extended
NP383-391 epitope as follows: 10-mer (RSRYWAIRTR), 11-mer (LRSRYWAIRTR), 12-mer
(ELRSRYWAIRTR), and 13-mer (LELRSRYWAIRTR)(Bio Basic INC, ON, Canada). Two days
prior to peptide immunization B27/ERAP+/+ and B27/ERAP-/- Tg mice will be subcutaneously
injected with CpG (10μg/ml, 50μg per mouse in 1 x PBS). Two days later these mice will be
immunized with different peptides (10μg/ml, 75 μg/mouse) in IFA as outlined in Chapters 3 and
4 Material and Methods section. Eleven days post-immunization spleen cells will be removed and
tested by ELISpot. Results with B27/ERAP+/+ mice will reveal what is the exact length of the N-
terminally extended B27/NP383-391 epitope before it is trimmed by ERAP. Results seen with
B27/ERAP-/- splenocytes will act as controls. The identification of the actual length of NP383-391
epitope is important as it may give a hint on the length of the arthritogenic peptide that may be
generated by ERAP in AS patients. Ideally we would expect the length of the arthritogenic peptide
to be a 9-mer, but it is also possible the arthritogenic epitope first may be generated as an N-
terminally extended species which is subsequently trimmed by ERAP. This study aids in the
identification of arthritogenic epitope.
151
5.2.3 Introduction of human ERAP-variants linked to AS to B27/ERAP-/- mice.
Does the introduction of human ERAP-variants associated with AS (e.g.,
30187) rescue the B27-directed T cell response in B27/ERAP-/- Tg mice
following flu infection?
Studies outlined in Chapter 4 revealed reduced B27/NP383-restricted CTL response
following flu infection in B27/ERAP-/- mice. Can we rescue this response back to levels seen with
B27/ERAP+/+ Tg mice? I am proposing to introduce human ERAP-variants associated with AS
back into ERAP deficient B27 Tg mice. Lentiviral vectors (Santa Cruz, CA) expressing full length
human ERAP gene will be inserted into B27/ERAP-/- mice as described by Taurog’s group
(1990)(351). Briefly, lentiviral constructs expressing genetic variants of the human ERAP gene
will be inserted into embryonic stem cell (ES) lines isolated from the inner cell mass of
B27/ERAP-/- blastocysts. The targeted ESs are subsequently microinjected into host embryos,
which are then re-implanted into pseudopregnant foster B27/ERAP-/- mothers. Embryos develop
chimeric animals which will be tested by PCR (i.e., with B27- and ERAP specific primers
described in Chapter 3 and 4) and FACS (i.e., by B27-specific ME1 mAb) to identify animals
positive for B27 and human ERAP gene expression. “Rescued” B27/ERAP Tg mice will be
infected with flu and 11 days post-infection their splenocytes will be analyzed by ELISpot as
described previously. It is expected that the re-introduction of the WT ERAP gene would lead to
higher B27/NP383-391 restricted CTL response in these “rescued” B27/ERAP animals. Analysis
of gain-of-function variants of ERAP (associated with susceptibility to AS) and of loss-of-function
variants (associated with protection against AS) will be analyzed for generation of protective T
cell responses to influenza. This experiment would convey the critical point that variants of human
ERAP are involved in the generation of the B27-specific flu epitopes in the same way it may be
involved in the overall generation of the arthritogenic peptide linked to AS.
152
5.2.4 Overexpression of ERAP in B27/ERAP-/- Tg mice. Does overexpression of
ERAP lead to AS-like symptoms in single Tg B27/ERAP-/- mice?
Rats expressing multiple copies of HLA-B27 and human β2m develop similar symptoms
as seen in AS patients (351). However, to date there are no studies looking at the possible role of
overexpressed ERAP in relation to AS in mice. Since HLA-B27 Tg mice described here do not
exhibit any AS symptoms, overexpression of ERAP would reveal new insights on the role of
ERAP to AS in these Tg mice. In order to create overexpressed ERAP we would make use of the
Tetracyclin (Tet)/Doxycycline (Dox) on-and-off system. The Tet On-Off Gene Expression System
is controlled by a Tet/Dox-inducible vector. Tet-Off system gets activated in the absence of Dox,
whereas Tet-On gets activated in the presence of Dox (352). ERAP-expressing lentiviral vector
(Santa Cruz, CA) and Tet/Dox vectors will be cut with the same restriction enzyme(s). The cut
fragments will be ligated in the presence of ligases to create Tet/Dox-controlled ERAP-expressing
vector as per manufacturer’s directions (Clonetech, CA, Cat#PT3001-1). Similar steps as outlined
above (section 5.2.4) will be used to generate B27/ERAP-/- Tg mice capable of overexpressing
ERAP in the presence of doxycycline (e.g., Dox can be added to the mouse water bottle).
Overexpression of ERAP will be examined by western blot of tissues. Subsequently, these
Tet/Dox-dependent B27/ERAP-/- mice will be exposed for different time periods (e.g., ranging
from 1 month to 24 months) to Dox and the joints will be examined by X-rays while also checking
for changes in the peripheral gastrointestinal symptoms (e.g., weight loss, diarrhea). When, and if,
joint changes suggestive of AS are evident these animals will be sacrificed and examination of the
joints and the gut histology will reveal more about the effects of ERAP over-expression in the
mice. This experiment is important to establish that ERAP is involved in the generation and
trimming of the arthritogenic peptide. Although the identity of the arthritogenic epitopes are
153
unknown, the fact that ERAP is involved in antigen processing and presentation would strongly
suggest the existence of an arthritogenic epitope in AS patients.
5.2.5. Presence of HLA-B27 homodimers in B27/ERAP-/- Tg mice. Does absence
of ERAP lead to increased homodimerization of B27 molecules?
As discussed previously three different mechanisms have been suggested to contribute to
the overall manifestation of AS; i.e., presentation of an arthritogenic epitope, ER stress leading to
UPR, and MHC-I homodimerization. Experiments described so far dealt with the
presence/generation of an arthritogenic epitope in relation to AS. But this leaves unanswered the
possible role of B27 homodimerization in B27/ERAP-/- and B27/ERAP+/+ Tg mice. To examine
whether there is any difference in the expression profile of B27 dimers in these aforementioned
Tg mice, the HD6 mAb (a gift from Dr. Paul Boweness, University of Oxford, UK), which
specifically binds to B27 homodimers, will be used in FACS experiments to determine the cell
surface expression of B27-specific dimers in B27/ERAP-/- and B27/ERAP+/+ mice. As loss of
ERAP function is protective in AS patients, I am expecting to see less B27 homodimers in
B27/ERAP-/- mice compared to B27/ERAP+/+ mice. If this is the case, this would validate the
clinical findings with our in vivo animal outcomes.
5.3. Studies of ERAP Expression in B27 Tg Rats
5.3.1. Down regulation of ERAP in the rat AS animal model. Does down regulation
of ERAP lead to decreased AS symptoms?
154
Studies by Hammer et al. (1990)(351) with Lewis rats expressing multiple copies of HLA-
B27 and multiple copies of human β2m revealed similar features as those seen in AS patients. The
unanswered question is, what is the role of ERAP in these rats? Does down regulation of ERAP
expression in these rats reduce AS symptoms? To investigate this I would decrease ERAP
expression by TALEN (Transcription activator-like effector nucleases) as described (353). The
Lewis rats will be examined for AS symptoms following ERAP down-regulation. These results
would complement the expected findings described in section 5.2.5 as a result of ERAP
overexpression. Based on the results described in Chapter 4, it is expected to see reduced AS
symptoms in Lewis rats when ERAP is repressed. These results would complement recent findings
by Dr. Matt Brown’s group (personal communication) from the University of Brisbane (Australia)
with AS patients indicating that loss of ERAP function is protective.
5.4. Final Conclusion
The experiments proposed here will reveal new insights on the overall role of
HLA-B27 and ERAP in relation to influenza infection and AS. Both HLA-B27 and
ERAP play important roles in the overall pathogenesis of AS. The results described
in the previous chapters could be potentially used as proof of concept to aid in the
identification of the arthritogenic epitopes in the future.
155
References
1. Zinkernagel, R. M. and P. C. Doherty. 1974. Restriction of in vitro T cell-mediated cytotoxicity
in lymphocytic choriomeningitis within a syngeneic or semiallogeneic system. Nature 248: 701-
702.
2. Adams, E. J. and A. M. Luoma. 2013. The adaptable major histocompatibility complex (MHC)
fold: structure and function of nonclassical and MHC class I-like molecules. Annu. Rev. Immunol.
31: 529-561.
3. Bjorkman, P. J., M. A. Saper, B. Samraoui, W. S. Bennett, J. L. Strominger, and D. C. Wiley.
1987. Structure of the human class I histocompatibility antigen, HLA-A2. Nature 329: 506-512.
4. Fremont, D. H., M. Matsumura, E. A. Stura, P. A. Peterson, and I. A. Wilson. 1992. Crystal
structures of two viral peptides in complex with murine MHC class I H-2Kb. Science 257: 919-
927.
5. Falk, K., O. Rotzschke, M. Takiguchi, B. Grahovac, V. Gnau, S. Stevanovic, G. Jung, and H.
G. Rammensee. 1994. Peptide motifs of HLA-A1, -A11, -A31, and -A33 molecules.
Immunogenetics 40: 238-241.
6. Zhang, W., A. C. Young, M. Imarai, S. G. Nathenson, and J. C. Sacchettini. 1992. Crystal
structure of the major histocompatibility complex class I H-2Kb molecule containing a single viral
156
peptide: implications for peptide binding and T-cell receptor recognition. Proc. Natl. Acad. Sci. U.
S. A. 89: 8403-8407.
7. Achour, A., K. Persson, R. A. Harris, J. Sundback, C. L. Sentman, Y. Lindqvist, G. Schneider,
and K. Karre. 1998. The crystal structure of H-2Dd MHC class I complexed with the HIV-1-
derived peptide P18-I10 at 2.4 A resolution: implications for T cell and NK cell recognition.
Immunity 9: 199-208.
8. Fremont, D. H., E. A. Stura, M. Matsumura, P. A. Peterson, and I. A. Wilson. 1995. Crystal
structure of an H-2Kb-ovalbumin peptide complex reveals the interplay of primary and secondary
anchor positions in the major histocompatibility complex binding groove. Proc. Natl. Acad. Sci.
U. S. A. 92: 2479-2483.
9. Nurzia, E., D. Narzi, A. Cauli, A. Mathieu, V. Tedeschi, S. Caristi, R. Sorrentino, R. A.
Bockmann, and M. T. Fiorillo. 2012. Interaction pattern of Arg 62 in the A-pocket of differentially
disease-associated HLA-B27 subtypes suggests distinct TCR binding modes. PLoS One 7: e32865.
10. Del Val, M., S. Iborra, M. Ramos, and S. Lazaro. 2011. Generation of MHC class I ligands in
the secretory and vesicular pathways. Cell Mol. Life Sci. 68: 1543-1552.
11. Blanchard, N. and N. Shastri. 2008. Coping with loss of perfection in the MHC class I peptide
repertoire. Curr. Opin. Immunol. 20: 82-88.
157
12. Yewdell, J. W. and C. V. Nicchitta. 2006. The DRiP hypothesis decennial: support,
controversy, refinement and extension. Trends Immunol. 27: 368-373.
13. Yewdell, J. W. 2007. Plumbing the sources of endogenous MHC class I peptide ligands. Curr.
Opin. Immunol. 19: 79-86.
14. Blanchard, N. and N. Shastri. 2010. Cross-presentation of peptides from intracellular
pathogens by MHC class I molecules. Ann. N. Y. Acad. Sci. 1183: 237-250.
15. Starck, S. R. and N. Shastri. 2011. Non-conventional sources of peptides presented by MHC
class I. Cell Mol. Life Sci. 68: 1471-1479.
16. van Endert, P. 2011. Providing ligands for MHC class I molecules. Cell Mol. Life Sci. 68:
1467-1469.
17. Kobayashi, K. S. and P. J. van den Elsen. 2012. NLRC5: a key regulator of MHC class I-
dependent immune responses. Nat. Rev. Immunol. 12: 813-820.
18. Sever, L., N. T. Vo, N. C. Bols, and B. Dixon. 2014. Rainbow trout (Oncorhynchus mykiss)
contain two calnexin genes which encode distinct proteins. Dev. Comp. Immunol. 42: 211-219.
19. Degen, E. and D. B. Williams. 1991. Participation of a novel 88-kD protein in the biogenesis
of murine class I histocompatibility molecules. J. Cell Biol. 112: 1099-1115.
158
20. Schrag, J. D., D. O. Procopio, M. Cygler, D. Y. Thomas, and J. J. Bergeron. 2003. Lectin
control of protein folding and sorting in the secretory pathway. Trends Biochem. Sci. 28: 49-57.
21. Vassilakos, A., M. F. Cohen-Doyle, P. A. Peterson, M. R. Jackson, and D. B. Williams. 1996.
The molecular chaperone calnexin facilitates folding and assembly of class I histocompatibility
molecules. EMBO J. 15: 1495-1506.
22. Degen, E., M. F. Cohen-Doyle, and D. B. Williams. 1992. Efficient dissociation of the p88
chaperone from major histocompatibility complex class I molecules requires both beta 2-
microglobulin and peptide. J. Exp. Med. 175: 1653-1661.
23. Rajagopalan, S. and M. B. Brenner. 1994. Calnexin retains unassembled major
histocompatibility complex class I free heavy chains in the endoplasmic reticulum. J. Exp. Med.
180: 407-412.
24. Cameron, P. H., E. Chevet, O. Pluquet, D. Y. Thomas, and J. J. Bergeron. 2009. Calnexin
phosphorylation attenuates the release of partially misfolded alpha1-antitrypsin to the secretory
pathway. J. Biol. Chem. 284: 34570-34579.
25. Chevet, E., J. Smirle, P. H. Cameron, D. Y. Thomas, and J. J. Bergeron. 2010. Calnexin
phosphorylation: linking cytoplasmic signalling to endoplasmic reticulum lumenal functions.
Semin. Cell Dev. Biol. 21: 486-490.
159
26. Guerin, R., G. Arseneault, S. Dumont, and L. A. Rokeach. 2008. Calnexin is involved in
apoptosis induced by endoplasmic reticulum stress in the fission yeast. Mol. Biol. Cell 19: 4404-
4420.
27. Fukushi, M., Y. Yoshinaka, Y. Matsuoka, S. Hatakeyama, Y. Ishizaka, T. Kirikae, T. Sasazuki,
and T. Miyoshi-Akiyama. 2012. Monitoring of S protein maturation in the endoplasmic reticulum
by calnexin is important for the infectivity of severe acute respiratory syndrome coronavirus. J.
Virol. 86: 11745-11753.
28. Farmery, M. R., S. Allen, A. J. Allen, and N. J. Bulleid. 2000. The role of ERp57 in disulfide
bond formation during the assembly of major histocompatibility complex class I in a synchronized
semipermeabilized cell translation system. J. Biol. Chem. 275: 14933-14938.
29. Morrice, N. A. and S. J. Powis. 1998. A role for the thiol-dependent reductase ERp57 in the
assembly of MHC class I molecules. Curr. Biol. 8: 713-716.
30. Lindquist, J. A., O. N. Jensen, M. Mann, and G. J. Hammerling. 1998. ER-60, a chaperone
with thiol-dependent reductase activity involved in MHC class I assembly. EMBO J. 17: 2186-
2195.
31. Hughes, E. A. and P. Cresswell. 1998. The thiol oxidoreductase ERp57 is a component of the
MHC class I peptide-loading complex. Curr. Biol. 8: 709-712.
160
32. Garbi, N., G. Hammerling, and S. Tanaka. 2007. Interaction of ERp57 and tapasin in the
generation of MHC class I-peptide complexes. Curr. Opin. Immunol. 19: 99-105.
33. Dick, T. P. 2004. Assembly of MHC class I peptide complexes from the perspective of
disulfide bond formation. Cell Mol. Life Sci. 61: 547-556.
34. Garbi, N., S. Tanaka, F. Momburg, and G. J. Hammerling. 2006. Impaired assembly of the
major histocompatibility complex class I peptide-loading complex in mice deficient in the
oxidoreductase ERp57. Nat. Immunol. 7: 93-102.
35. Sadasivan, B., P. J. Lehner, B. Ortmann, T. Spies, and P. Cresswell. 1996. Roles for calreticulin
and a novel glycoprotein, tapasin, in the interaction of MHC class I molecules with TAP. Immunity
5: 103-114.
36. Harris, M. R., Y. Y. Yu, C. S. Kindle, T. H. Hansen, and J. C. Solheim. 1998. Calreticulin and
calnexin interact with different protein and glycan determinants during the assembly of MHC class
I. J. Immunol. 160: 5404-5409.
37. Kapoor, M., H. Srinivas, E. Kandiah, E. Gemma, L. Ellgaard, S. Oscarson, A. Helenius, and
A. Surolia. 2003. Interactions of substrate with calreticulin, an endoplasmic reticulum chaperone.
J. Biol. Chem. 278: 6194-6200.
161
38. Nair, S., P. A. Wearsch, D. A. Mitchell, J. J. Wassenberg, E. Gilboa, and C. V. Nicchitta. 1999.
Calreticulin displays in vivo peptide-binding activity and can elicit CTL responses against bound
peptides. J. Immunol. 162: 6426-6432.
39. Basu, S. and P. K. Srivastava. 1999. Calreticulin, a peptide-binding chaperone of the
endoplasmic reticulum, elicits tumor- and peptide-specific immunity. J. Exp. Med. 189: 797-802.
40. Gao, B., R. Adhikari, M. Howarth, K. Nakamura, M. C. Gold, A. B. Hill, R. Knee, M.
Michalak, and T. Elliott. 2002. Assembly and antigen-presenting function of MHC class I
molecules in cells lacking the ER chaperone calreticulin. Immunity 16: 99-109.
41. Danilczyk, U. G., M. F. Cohen-Doyle, and D. B. Williams. 2000. Functional relationship
between calreticulin, calnexin, and the endoplasmic reticulum luminal domain of calnexin. J. Biol.
Chem. 275: 13089-13097.
42. Groenendyk, J. and M. Michalak. 2014. Disrupted WNT Signaling in Mouse Embryonic Stem
Cells in the Absence of Calreticulin. Stem Cell. Rev. 10: 191-206.
43. Gameiro, S. R., M. L. Jammeh, M. M. Wattenberg, K. Y. Tsang, S. Ferrone, and J. W. Hodge.
2014. Radiation-induced immunogenic modulation of tumor enhances antigen processing and
calreticulin exposure, resulting in enhanced T-cell killing. Oncotarget 5: 403-416.
162
44. Kostova, Z. and D. H. Wolf. 2003. For whom the bell tolls: protein quality control of the
endoplasmic reticulum and the ubiquitin-proteasome connection. EMBO J. 22: 2309-2317.
45. Moran-Crusio, K., L. B. Reavie, and I. Aifantis. 2012. Regulation of hematopoietic stem cell
fate by the ubiquitin proteasome system. Trends Immunol. 33: 357-363.
46. Liu, Z., T. Qin, J. Zhou, A. Taylor, J. R. Sparrow, and F. Shang. 2014. Impairment of the
Ubiquitin-Proteasome Pathway in RPE Alters the Expression of Inflammation Related Genes. Adv.
Exp. Med. Biol. 801: 237-250.
47. Kloetzel, P. M. 2004. Generation of major histocompatibility complex class I antigens:
functional interplay between proteasomes and TPPII. Nat. Immunol. 5: 661-669.
48. Kloetzel, P. M. and F. Ossendorp. 2004. Proteasome and peptidase function in MHC-class-I-
mediated antigen presentation. Curr. Opin. Immunol. 16: 76-81.
49. Groll, M., L. Ditzel, J. Lowe, D. Stock, M. Bochtler, H. D. Bartunik, and R. Huber. 1997.
Structure of 20S proteasome from yeast at 2.4 A resolution. Nature 386: 463-471.
50. Aki, M., N. Shimbara, M. Takashina, K. Akiyama, S. Kagawa, T. Tamura, N. Tanahashi, T.
Yoshimura, K. Tanaka, and A. Ichihara. 1994. Interferon-gamma induces different subunit
organizations and functional diversity of proteasomes. J. Biochem. 115: 257-269.
163
51. Griffin, T. A., D. Nandi, M. Cruz, H. J. Fehling, L. V. Kaer, J. J. Monaco, and R. A. Colbert.
1998. Immunoproteasome assembly: cooperative incorporation of interferon gamma (IFN-
gamma)-inducible subunits. J. Exp. Med. 187: 97-104.
52. Walz, J., A. Erdmann, M. Kania, D. Typke, A. J. Koster, and W. Baumeister. 1998. 26S
proteasome structure revealed by three-dimensional electron microscopy. J. Struct. Biol. 121: 19-
29.
53. Gromme, M. and J. Neefjes. 2002. Antigen degradation or presentation by MHC class I
molecules via classical and non-classical pathways. Mol. Immunol. 39: 181-202.
54. Debowski, D., M. Pikula, M. Lubos, P. Langa, P. Trzonkowski, A. Lesner, A. Legowska, and
K. Rolka. 2014. Inhibition of Human and Yeast 20S Proteasome by Analogues of Trypsin Inhibitor
SFTI-1. PLoS One 9: e89465.
55. Sijts, E. J. and P. M. Kloetzel. 2011. The role of the proteasome in the generation of MHC
class I ligands and immune responses. Cell Mol. Life Sci. 68: 1491-1502.
56. Zhang, N., T. Chen, C. Liu, B. Tang, L. Nie, H. An, D. Zhao, L. Pan, and M. Yu. 2013.
Inhibition of ubiquitin protein expression and 20S proteasome activity by irbesartan prevents post-
infarction ventricular remodeling and decreases TNF-alpha generation. Biomed. Rep. 1: 935-939.
164
57. Kraut, D. A., E. Israeli, E. K. Schrader, A. Patil, K. Nakai, D. Nanavati, T. Inobe, and A.
Matouschek. 2012. Sequence- and species-dependence of proteasomal processivity. ACS Chem.
Biol. 7: 1444-1453.
58. Uebel, S. and R. Tampe. 1999. Specificity of the proteasome and the TAP transporter. Curr.
Opin. Immunol. 11: 203-208.
59. Kisselev, A. F., T. N. Akopian, K. M. Woo, and A. L. Goldberg. 1999. The sizes of peptides
generated from protein by mammalian 26 and 20 S proteasomes. Implications for understanding
the degradative mechanism and antigen presentation. J. Biol. Chem. 274: 3363-3371.
60. Goldberg, A. L., P. Cascio, T. Saric, and K. L. Rock. 2002. The importance of the proteasome
and subsequent proteolytic steps in the generation of antigenic peptides. Mol. Immunol. 39: 147-
164.
61. Inobe, T. and A. Matouschek. 2014. Paradigms of protein degradation by the proteasome. Curr.
Opin. Struct. Biol. 24C: 156-164.
62. Prakash, S., T. Inobe, A. J. Hatch, and A. Matouschek. 2009. Substrate selection by the
proteasome during degradation of protein complexes. Nat. Chem. Biol. 5: 29-36.
165
63. Shin, E. C., U. Seifert, T. Kato, C. M. Rice, S. M. Feinstone, P. M. Kloetzel, and B. Rehermann.
2006. Virus-induced type I IFN stimulates generation of immunoproteasomes at the site of
infection. J. Clin. Invest. 116: 3006-3014.
64. Stohwasser, R., S. Standera, I. Peters, P. M. Kloetzel, and M. Groettrup. 1997. Molecular
cloning of the mouse proteasome subunits MC14 and MECL-1: reciprocally regulated tissue
expression of interferon-gamma-modulated proteasome subunits. Eur. J. Immunol. 27: 1182-1187.
65. Gaczynska, M., K. L. Rock, T. Spies, and A. L. Goldberg. 1994. Peptidase activities of
proteasomes are differentially regulated by the major histocompatibility complex-encoded genes
for LMP2 and LMP7. Proc. Natl. Acad. Sci. U. S. A. 91: 9213-9217.
66. Toes, R. E., A. K. Nussbaum, S. Degermann, M. Schirle, N. P. Emmerich, M. Kraft, C.
Laplace, A. Zwinderman, T. P. Dick, J. Muller, B. Schonfisch, C. Schmid, H. J. Fehling, S.
Stevanovic, H. G. Rammensee, and H. Schild. 2001. Discrete cleavage motifs of constitutive and
immunoproteasomes revealed by quantitative analysis of cleavage products. J. Exp. Med. 194: 1-
12.
67. Melnikova, V. I., N. P. Sharova, E. V. Maslova, S. N. Voronova, and L. A. Zakharova. 2010.
Ontogenesis of rat immune system: Proteasome expression in different cell populations of the
developing thymus. Cell. Immunol. 266: 83-89.
166
68. Macagno, A., M. Gilliet, F. Sallusto, A. Lanzavecchia, F. O. Nestle, and M. Groettrup. 1999.
Dendritic cells up-regulate immunoproteasomes and the proteasome regulator PA28 during
maturation. Eur. J. Immunol. 29: 4037-4042.
69. Sijts, A. J., T. Ruppert, B. Rehermann, M. Schmidt, U. Koszinowski, and P. M. Kloetzel. 2000.
Efficient generation of a hepatitis B virus cytotoxic T lymphocyte epitope requires the structural
features of immunoproteasomes. J. Exp. Med. 191: 503-514.
70. Kincaid, E. Z., J. W. Che, I. York, H. Escobar, E. Reyes-Vargas, J. C. Delgado, R. M. Welsh,
M. L. Karow, A. J. Murphy, D. M. Valenzuela, G. D. Yancopoulos, and K. L. Rock. 2011. Mice
completely lacking immunoproteasomes show major changes in antigen presentation. Nat.
Immunol. 13: 129-135.
71. Ghonime, M. G., O. R. Shamaa, S. Das, R. A. Eldomany, T. Fernandes-Alnemri, E. S. Alnemri,
M. A. Gavrilin, and M. D. Wewers. 2014. Inflammasome Priming by Lipopolysaccharide Is
Dependent upon ERK Signaling and Proteasome Function. J. Immunol.
72. Serwold, T., F. Gonzalez, J. Kim, R. Jacob, and N. Shastri. 2002. ERAAP customizes peptides
for MHC class I molecules in the endoplasmic reticulum. Nature 419: 480-483.
73. Saric, T., S. C. Chang, A. Hattori, I. A. York, S. Markant, K. L. Rock, M. Tsujimoto, and A.
L. Goldberg. 2002. An IFN-gamma-induced aminopeptidase in the ER, ERAP1, trims precursors
to MHC class I-presented peptides. Nat. Immunol. 3: 1169-1176.
167
74. Blanchard, N., T. Kanaseki, H. Escobar, F. Delebecque, N. A. Nagarajan, E. Reyes-Vargas, D.
K. Crockett, D. H. Raulet, J. C. Delgado, and N. Shastri. 2010. Endoplasmic reticulum
aminopeptidase associated with antigen processing defines the composition and structure of MHC
class I peptide repertoire in normal and virus-infected cells. J. Immunol. 184: 3033-3042.
75. Evnouchidou, I., F. Momburg, A. Papakyriakou, A. Chroni, L. Leondiadis, S. C. Chang, A. L.
Goldberg, and E. Stratikos. 2008. The internal sequence of the peptide-substrate determines its N-
terminus trimming by ERAP1. PLoS One 3: e3658.
76. Firat, E., L. Saveanu, P. Aichele, P. Staeheli, J. Huai, S. Gaedicke, A. Nil, G. Besin, B. Kanzler,
P. van Endert, and G. Niedermann. 2007. The role of endoplasmic reticulum-associated
aminopeptidase 1 in immunity to infection and in cross-presentation. J. Immunol. 178: 2241-2248.
77. Hammer, G. E., F. Gonzalez, M. Champsaur, D. Cado, and N. Shastri. 2006. The
aminopeptidase ERAAP shapes the peptide repertoire displayed by major histocompatibility
complex class I molecules. Nat. Immunol. 7: 103-112.
78. Hammer, G. E., F. Gonzalez, E. James, H. Nolla, and N. Shastri. 2007. In the absence of
aminopeptidase ERAAP, MHC class I molecules present many unstable and highly immunogenic
peptides. Nat. Immunol. 8: 101-108.
168
79. Kawahara, M., I. A. York, A. Hearn, D. Farfan, and K. L. Rock. 2009. Analysis of the role of
tripeptidyl peptidase II in MHC class I antigen presentation in vivo. J. Immunol. 183: 6069-6077.
80. Geier, E., G. Pfeifer, M. Wilm, M. Lucchiari-Hartz, W. Baumeister, K. Eichmann, and G.
Niedermann. 1999. A giant protease with potential to substitute for some functions of the
proteasome. Science 283: 978-981.
81. Firat, E., J. Huai, L. Saveanu, S. Gaedicke, P. Aichele, K. Eichmann, P. van Endert, and G.
Niedermann. 2007. Analysis of direct and cross-presentation of antigens in TPPII knockout mice.
J. Immunol. 179: 8137-8145.
82. Saric, T., J. Beninga, C. I. Graef, T. N. Akopian, K. L. Rock, and A. L. Goldberg. 2001. Major
histocompatibility complex class I-presented antigenic peptides are degraded in cytosolic extracts
primarily by thimet oligopeptidase. J. Biol. Chem. 276: 36474-36481.
83. Urban, S., K. Textoris-Taube, B. Reimann, K. Janek, T. Dannenberg, F. Ebstein, C. Seifert, F.
Zhao, J. H. Kessler, A. Halenius, P. Henklein, J. Paschke, S. Cadel, H. Bernhard, F. Ossendorp, T.
Foulon, D. Schadendorf, A. Paschen, and U. Seifert. 2012. The efficiency of human
cytomegalovirus pp65(495-503) CD8+ T cell epitope generation is determined by the balanced
activities of cytosolic and endoplasmic reticulum-resident peptidases. J. Immunol. 189: 529-538.
84. Towne, C. F., I. A. York, J. Neijssen, M. L. Karow, A. J. Murphy, D. M. Valenzuela, G. D.
Yancopoulos, J. J. Neefjes, and K. L. Rock. 2005. Leucine aminopeptidase is not essential for
169
trimming peptides in the cytosol or generating epitopes for MHC class I antigen presentation. J.
Immunol. 175: 6605-6614.
85. Towne, C. F., I. A. York, L. B. Watkin, J. S. Lazo, and K. L. Rock. 2007. Analysis of the role
of bleomycin hydrolase in antigen presentation and the generation of CD8 T cell responses. J.
Immunol. 178: 6923-6930.
86. Towne, C. F., I. A. York, J. Neijssen, M. L. Karow, A. J. Murphy, D. M. Valenzuela, G. D.
Yancopoulos, J. J. Neefjes, and K. L. Rock. 2008. Puromycin-sensitive aminopeptidase limits
MHC class I presentation in dendritic cells but does not affect CD8 T cell responses during viral
infections. J. Immunol. 180: 1704-1712.
87. Geiss-Friedlander, R., N. Parmentier, U. Moller, H. Urlaub, B. J. Van den Eynde, and F.
Melchior. 2009. The cytoplasmic peptidase DPP9 is rate-limiting for degradation of proline-
containing peptides. J. Biol. Chem. 284: 27211-27219.
88. Kessler, J. H., S. Khan, U. Seifert, S. Le Gall, K. M. Chow, A. Paschen, S. A. Bres-Vloemans,
A. de Ru, N. van Montfoort, K. L. Franken, W. E. Benckhuijsen, J. M. Brooks, T. van Hall, K.
Ray, A. Mulder, I. I. Doxiadis, P. F. van Swieten, H. S. Overkleeft, A. Prat, B. Tomkinson, J.
Neefjes, P. M. Kloetzel, D. W. Rodgers, L. B. Hersh, J. W. Drijfhout, P. A. van Veelen, F.
Ossendorp, and C. J. Melief. 2011. Antigen processing by nardilysin and thimet oligopeptidase
generates cytotoxic T cell epitopes. Nat. Immunol. 12: 45-53.
170
89. Knuehl, C., P. Spee, T. Ruppert, U. Kuckelkorn, P. Henklein, J. Neefjes, and P. M. Kloetzel.
2001. The murine cytomegalovirus pp89 immunodominant H-2Ld epitope is generated and
translocated into the endoplasmic reticulum as an 11-mer precursor peptide. J. Immunol. 167:
1515-1521.
90. Blanchard, N., T. Kanaseki, H. Escobar, F. Delebecque, N. A. Nagarajan, E. Reyes-Vargas, D.
K. Crockett, D. H. Raulet, J. C. Delgado, and N. Shastri. 2010. Endoplasmic reticulum
aminopeptidase associated with antigen processing defines the composition and structure of MHC
class I peptide repertoire in normal and virus-infected cells. J. Immunol. 184: 3033-3042.
91. Shen, X. Z., S. Billet, C. Lin, D. Okwan-Duodu, X. Chen, A. E. Lukacher, and K. E. Bernstein.
2011. The carboxypeptidase ACE shapes the MHC class I peptide repertoire. Nat. Immunol. 12:
1078-1085.
92. Velarde, G., R. C. Ford, M. F. Rosenberg, and S. J. Powis. 2001. Three-dimensional structure
of transporter associated with antigen processing (TAP) obtained by single Particle image analysis.
J. Biol. Chem. 276: 46054-46063.
93. Hulpke, S., M. Tomioka, E. Kremmer, K. Ueda, R. Abele, and R. Tampe. 2012. Direct
evidence that the N-terminal extensions of the TAP complex act as autonomous interaction
scaffolds for the assembly of the MHC I peptide-loading complex. Cell Mol. Life Sci. 69: 3317-
3327.
171
94. Hulpke, S., C. Baldauf, and R. Tampe. 2012. Molecular architecture of the MHC I peptide-
loading complex: one tapasin molecule is essential and sufficient for antigen processing. FASEB
J. 26: 5071-5080.
95. Vos, J. C., E. A. Reits, E. Wojcik-Jacobs, and J. Neefjes. 2000. Head-head/tail-tail relative
orientation of the pore-forming domains of the heterodimeric ABC transporter TAP. Curr. Biol.
10: 1-7.
96. Corradi, V., G. Singh, and D. P. Tieleman. 2012. The human transporter associated with
antigen processing: molecular models to describe peptide binding competent states. J. Biol. Chem.
287: 28099-28111.
97. Abele, R. and R. Tampe. 2011. The TAP translocation machinery in adaptive immunity and
viral escape mechanisms. Essays Biochem. 50: 249-264.
98. Herget, M., C. Baldauf, C. Scholz, D. Parcej, K. H. Wiesmuller, R. Tampe, R. Abele, and E.
Bordignon. 2011. Conformation of peptides bound to the transporter associated with antigen
processing (TAP). Proc. Natl. Acad. Sci. U. S. A. 108: 1349-1354.
99. Ren, Y. X., J. Yang, L. J. Zhang, R. M. Sun, L. F. Zhao, M. Zhang, Y. Chen, J. Ma, K. Qiao,
Q. M. Sun, H. T. Long, Y. C. Huang, and X. J. Li. 2014. Downregulation of expression of
transporters associated with antigen processing 1 and 2 and human leukocyte antigen I and its
effect on immunity in nasopharyngeal carcinoma patients. Mol. Clin. Oncol. 2: 51-58.
172
100. Theodoratos, A., B. Whittle, A. Enders, D. C. Tscharke, C. M. Roots, C. C. Goodnow, and
A. M. Fahrer. 2010. Mouse strains with point mutations in TAP1 and TAP2. Immunol. Cell Biol.
88: 72-78.
101. Ortmann, B., J. Copeman, P. J. Lehner, B. Sadasivan, J. A. Herberg, A. G. Grandea, S. R.
Riddell, R. Tampe, T. Spies, J. Trowsdale, and P. Cresswell. 1997. A critical role for tapasin in
the assembly and function of multimeric MHC class I-TAP complexes. Science 277: 1306-1309.
102. Ortmann, B., M. J. Androlewicz, and P. Cresswell. 1994. MHC class I/beta 2-microglobulin
complexes associate with TAP transporters before peptide binding. Nature 368: 864-867.
103. Herberg, J. A., J. Sgouros, T. Jones, J. Copeman, S. J. Humphray, D. Sheer, P. Cresswell, S.
Beck, and J. Trowsdale. 1998. Genomic analysis of the Tapasin gene, located close to the TAP
loci in the MHC. Eur. J. Immunol. 28: 459-467.
104. Copeman, J., N. Bangia, J. C. Cross, and P. Cresswell. 1998. Elucidation of the genetic basis
of the antigen presentation defects in the mutant cell line .220 reveals polymorphism and
alternative splicing of the tapasin gene. Eur. J. Immunol. 28: 3783-3791.
105. Lehner, P. J., M. J. Surman, and P. Cresswell. 1998. Soluble tapasin restores MHC class I
expression and function in the tapasin-negative cell line .220. Immunity 8: 221-231.
173
106. Howarth, M., A. Williams, A. B. Tolstrup, and T. Elliott. 2004. Tapasin enhances MHC class
I peptide presentation according to peptide half-life. Proc. Natl. Acad. Sci. U. S. A. 101: 11737-
11742.
107. Geironson, L., C. Thuring, M. Harndahl, M. Rasmussen, S. Buus, G. Roder, and K. M.
Paulsson. 2013. Tapasin facilitation of natural HLA-A and -B allomorphs is strongly influenced
by peptide length, depends on stability, and separates closely related allomorphs. J. Immunol. 191:
3939-3947.
108. Bangia, N., P. J. Lehner, E. A. Hughes, M. Surman, and P. Cresswell. 1999. The N-terminal
region of tapasin is required to stabilize the MHC class I loading complex. Eur. J. Immunol. 29:
1858-1870.
109. Hermann, C., L. M. Strittmatter, J. E. Deane, and L. H. Boyle. 2013. The binding of TAPBPR
and Tapasin to MHC class I is mutually exclusive. J. Immunol. 191: 5743-5750.
110. Leonhardt, R. M., P. Abrahimi, S. M. Mitchell, and P. Cresswell. 2014. Three Tapasin
Docking Sites in TAP Cooperate To Facilitate Transporter Stabilization and Heterodimerization.
J. Immunol. 192: 2480-2494.
111. Lybarger, L., Y. Y. Yu, T. Chun, C. R. Wang, A. G. Grandea 3rd, L. Van Kaer, and T. H.
Hansen. 2001. Tapasin enhances peptide-induced expression of H2-M3 molecules, but is not
required for the retention of open conformers. J. Immunol. 167: 2097-2105.
174
112. Schoenhals, G. J., R. M. Krishna, A. G. Grandea 3rd, T. Spies, P. A. Peterson, Y. Yang, and
K. Fruh. 1999. Retention of empty MHC class I molecules by tapasin is essential to reconstitute
antigen presentation in invertebrate cells. EMBO J. 18: 743-753.
113. Garbi, N., P. Tan, A. D. Diehl, B. J. Chambers, H. G. Ljunggren, F. Momburg, and G. J.
Hammerling. 2000. Impaired immune responses and altered peptide repertoire in tapasin-deficient
mice. Nat. Immunol. 1: 234-238.
114. Grandea, A. G.,3rd, T. N. Golovina, S. E. Hamilton, V. Sriram, T. Spies, R. R. Brutkiewicz,
J. T. Harty, L. C. Eisenlohr, and L. Van Kaer. 2000. Impaired assembly yet normal trafficking of
MHC class I molecules in Tapasin mutant mice. Immunity 13: 213-222.
115. Suh, W. K., M. A. Derby, M. F. Cohen-Doyle, G. J. Schoenhals, K. Fruh, J. A. Berzofsky,
and D. B. Williams. 1999. Interaction of murine MHC class I molecules with tapasin and TAP
enhances peptide loading and involves the heavy chain alpha3 domain. J. Immunol. 162: 1530-
1540.
116. Beissbarth, T., J. Sun, P. B. Kavathas, and B. Ortmann. 2000. Increased efficiency of folding
and peptide loading of mutant MHC class I molecules. Eur. J. Immunol. 30: 1203-1213.
175
117. Peace-Brewer, A. L., L. G. Tussey, M. Matsui, G. Li, D. G. Quinn, and J. A. Frelinger. 1996.
A point mutation in HLA-A*0201 results in failure to bind the TAP complex and to present virus-
derived peptides to CTL. Immunity 4: 505-514.
118. Lewis, J. W., A. Neisig, J. Neefjes, and T. Elliott. 1996. Point mutations in the alpha 2 domain
of HLA-A2.1 define a functionally relevant interaction with TAP. Curr. Biol. 6: 873-883.
119. Kanaseki, T., K. C. Lind, H. Escobar, N. Nagarajan, E. Reyes-Vargas, B. Rudd, A. L.
Rockwood, L. Van Kaer, N. Sato, J. C. Delgado, and N. Shastri. 2013. ERAAP and tapasin
independently edit the amino and carboxyl termini of MHC class I peptides. J. Immunol. 191:
1547-1555.
120. Dong, G., P. A. Wearsch, D. R. Peaper, P. Cresswell, and K. M. Reinisch. 2009. Insights into
MHC class I peptide loading from the structure of the tapasin-ERp57 thiol oxidoreductase
heterodimer. Immunity 30: 21-32.
121. Beutler, N., S. Hauka, A. Niepel, D. J. Kowalewski, J. Uhlmann, E. Ghanem, S. Erkelenz, C.
Wiek, H. Hanenberg, H. Schaal, S. Stevanovic, S. Springer, F. Momburg, H. Hengel, and A.
Halenius. 2013. A natural tapasin isoform lacking exon 3 modifies peptide loading complex
function. Eur. J. Immunol. 43: 1459-1469.
122. Hulpke, S. and R. Tampe. 2013. The MHC I loading complex: a multitasking machinery in
adaptive immunity. Trends Biochem. Sci. 38: 412-420.
176
123. Platzer, B., M. Stout, and E. Fiebiger. 2014. Antigen Cross-Presentation of Immune
Complexes. Front. Immunol. 5: 140.
124. Lizee, G., G. Basha, and W. A. Jefferies. 2005. Tails of wonder: endocytic-sorting motifs key
for exogenous antigen presentation. Trends Immunol. 26: 141-149.
125. Ackerman, A. L. and P. Cresswell. 2004. Cellular mechanisms governing cross-presentation
of exogenous antigens. Nat. Immunol. 5: 678-684.
126. Mantegazza, A. R., J. G. Magalhaes, S. Amigorena, and M. S. Marks. 2013. Presentation of
phagocytosed antigens by MHC class I and II. Traffic 14: 135-152.
127. Harding, C. V. 1995. Phagocytic processing of antigens for presentation by MHC molecules.
Trends Cell Biol. 5: 105-109.
128. Dushek, O. 2011. Elementary steps in T cell receptor triggering. Front. Immunol. 2: 91.
129. Fooksman, D. R., S. Vardhana, G. Vasiliver-Shamis, J. Liese, D. A. Blair, J. Waite, C.
Sacristan, G. D. Victora, A. Zanin-Zhorov, and M. L. Dustin. 2010. Functional anatomy of T cell
activation and synapse formation. Annu. Rev. Immunol. 28: 79-105.
177
130. van der Merwe, P. A. and O. Dushek. 2011. Mechanisms for T cell receptor triggering. Nat.
Rev. Immunol. 11: 47-55.
131. Fooksman, D. R., G. K. Gronvall, Q. Tang, and M. Edidin. 2006. Clustering class I MHC
modulates sensitivity of T cell recognition. J. Immunol. 176: 6673-6680.
132. Xia, Z., H. Chen, S. G. Kang, T. Huynh, J. W. Fang, P. A. Lamothe, B. D. Walker, and R.
Zhou. 2014. The complex and specific pMHC interactions with diverse HIV-1 TCR clonotypes
reveal a structural basis for alterations in CTL function. Sci. Rep. 4: 4087.
133. Mescher, M. F. 1995. Molecular interactions in the activation of effector and precursor
cytotoxic T lymphocytes. Immunol. Rev. 146: 177-210.
134. Barry, M. and R. C. Bleackley. 2002. Cytotoxic T lymphocytes: all roads lead to death. Nat.
Rev. Immunol. 2: 401-409.
135. Kaech, S. M., E. J. Wherry, and R. Ahmed. 2002. Effector and memory T-cell differentiation:
implications for vaccine development. Nat. Rev. Immunol. 2: 251-262.
136. Murali-Krishna, K., J. D. Altman, M. Suresh, D. J. Sourdive, A. J. Zajac, J. D. Miller, J.
Slansky, and R. Ahmed. 1998. Counting antigen-specific CD8 T cells: a reevaluation of bystander
activation during viral infection. Immunity 8: 177-187.
178
137. van Lier, R. A., I. J. ten Berge, and L. E. Gamadia. 2003. Human CD8(+) T-cell differentiation
in response to viruses. Nat. Rev. Immunol. 3: 931-939.
138. Bevan, M. J. 2004. Helping the CD8(+) T-cell response. Nat. Rev. Immunol. 4: 595-602.
139. Farber, D. L., N. A. Yudanin, and N. P. Restifo. 2014. Human memory T cells: generation,
compartmentalization and homeostasis. Nat. Rev. Immunol. 14: 24-35.
140. Restifo, N. P. and L. Gattinoni. 2013. Lineage relationship of effector and memory T cells.
Curr. Opin. Immunol. 25: 556-563.
141. Cox, N. J. and K. Subbarao. 1999. Influenza. Lancet 354: 1277-1282.
142. Portela, A. and P. Digard. 2002. The influenza virus nucleoprotein: a multifunctional RNA-
binding protein pivotal to virus replication. J. Gen. Virol. 83: 723-734.
143. Jia, D., R. Rahbar, R. W. Chan, S. M. Lee, M. C. Chan, B. X. Wang, D. P. Baker, B. Sun, J.
S. Peiris, J. M. Nicholls, and E. N. Fish. 2010. Influenza virus non-structural protein 1 (NS1)
disrupts interferon signaling. PLoS One 5: e13927.
144. Wang, B. X. and E. N. Fish. 2012. The yin and yang of viruses and interferons. Trends
Immunol. 33: 190-197.
179
145. Akram, A. and R. D. Inman. 2012. Immunodominance: A pivotal principle in host response
to viral infections. Clin. Immunol.
146. Woodland, D. L., R. J. Hogan, and W. Zhong. 2001. Cellular immunity and memory to
respiratory virus infections. Immunol. Res. 24: 53-67.
147. Pinkoski, M. J. and D. R. Green. 2002. Lymphocyte apoptosis: refining the paths to perdition.
Curr. Opin. Hematol. 9: 43-49.
148. Braciale, T. J., J. Sun, and T. S. Kim. 2012. Regulating the adaptive immune response to
respiratory virus infection. Nat. Rev. Immunol. 12: 295-305.
149. Kim, T. S., J. Sun, and T. J. Braciale. 2011. T cell responses during influenza infection: getting
and keeping control. Trends Immunol. 32: 225-231.
150. Gamadia, L. E., R. J. Rentenaar, P. A. Baars, E. B. Remmerswaal, S. Surachno, J. F. Weel,
M. Toebes, T. N. Schumacher, I. J. ten Berge, and R. A. van Lier. 2001. Differentiation of
cytomegalovirus-specific CD8(+) T cells in healthy and immunosuppressed virus carriers. Blood
98: 754-761.
151. Yewdell, J. W. 2006. Confronting complexity: real-world immunodominance in antiviral
CD8+ T cell responses. Immunity 25: 533-543.
180
152. Cheuk, E., C. D'Souza, N. Hu, Y. Liu, H. Lang, and J. W. Chamberlain. 2002. Human MHC
class I transgenic mice deficient for H2 class I expression facilitate identification and
characterization of new HLA class I-restricted viral T cell epitopes. J. Immunol. 169: 5571-5580.
153. Deckhut, A. M., W. Allan, A. McMickle, M. Eichelberger, M. A. Blackman, P. C. Doherty,
and D. L. Woodland. 1993. Prominent usage of V beta 8.3 T cells in the H-2Db-restricted response
to an influenza A virus nucleoprotein epitope. J. Immunol. 151: 2658-2666.
154. Flesch, I. E., W. P. Woo, Y. Wang, V. Panchanathan, Y. C. Wong, N. L. La Gruta, T. Cukalac,
and D. C. Tscharke. 2010. Altered CD8(+) T cell immunodominance after vaccinia virus infection
and the naive repertoire in inbred and F(1) mice. J. Immunol. 184: 45-55.
155. Kotturi, M. F., E. Assarsson, B. Peters, H. Grey, C. Oseroff, V. Pasquetto, and A. Sette. 2009.
Of mice and humans: how good are HLA transgenic mice as a model of human immune responses?
Immunome Res. 5: 3.
156. Remakus, S. and L. J. Sigal. 2011. Gamma interferon and perforin control the strength, but
not the hierarchy, of immunodominance of an antiviral CD8+ T cell response. J. Virol. 85: 12578-
12584.
157. Terajima, M., L. Orphin, A. M. Leporati, P. Pazoles, J. Cruz, A. L. Rothman, and F. A. Ennis.
2008. Vaccinia virus-specific CD8(+) T-cell responses target a group of epitopes without a strong
immunodominance hierarchy in humans. Hum. Immunol. 69: 815-825.
181
158. Boulanger, D. S., R. Oliveira, L. Ayers, S. H. Prior, E. James, A. P. Williams, and T. Elliott.
2010. Absence of tapasin alters immunodominance against a lymphocytic choriomeningitis virus
polytope. J. Immunol. 184: 73-83.
159. Raue, H. P. and M. K. Slifka. 2009. CD8+ T cell immunodominance shifts during the early
stages of acute LCMV infection independently from functional avidity maturation. Virology 390:
197-204.
160. Siddiqui, S., E. Tarrab, A. Lamarre, and S. Basta. 2010. Altered immunodominance
hierarchies of CD8+ T cells in the spleen after infection at different sites is contingent on high
virus inoculum. Microbes Infect. 12: 324-330.
161. Reiser, M., A. Wieland, B. Plachter, T. Mertens, J. Greiner, and R. Schirmbeck. 2011. The
Immunodominant CD8 T Cell Response to the Human Cytomegalovirus Tegument
Phosphoprotein pp65495-503 Epitope Critically Depends on CD4 T Cell Help in Vaccinated
HLA-A*0201 Transgenic Mice. J. Immunol. 187: 2172-2180.
162. Riedl, P., A. Wieland, K. Lamberth, S. Buus, F. Lemonnier, K. Reifenberg, J. Reimann, and
R. Schirmbeck. 2009. Elimination of immunodominant epitopes from multispecific DNA-based
vaccines allows induction of CD8 T cells that have a striking antiviral potential. J. Immunol. 183:
370-380.
182
163. Wieland, A., P. Riedl, J. Reimann, and R. Schirmbeck. 2009. Silencing an immunodominant
epitope of hepatitis B surface antigen reveals an alternative repertoire of CD8 T cell epitopes of
this viral antigen. Vaccine 28: 114-119.
164. Schmidt, J., C. Neumann-Haefelin, T. Altay, E. Gostick, D. A. Price, V. Lohmann, H. E.
Blum, and R. Thimme. 2011. Immunodominance of HLA-A2-restricted hepatitis C virus-specific
CD8+ T cell responses is linked to naive-precursor frequency. J. Virol. 85: 5232-5236.
165. Zlatkovic, J., K. Stiasny, and F. X. Heinz. 2011. Immunodominance and functional activities
of antibody responses to inactivated West Nile virus and recombinant subunit vaccines in mice. J.
Virol. 85: 1994-2003.
166. Busch, D. H. and E. G. Pamer. 1998. MHC class I/peptide stability: implications for
immunodominance, in vitro proliferation, and diversity of responding CTL. J. Immunol. 160:
4441-4448.
167. Kjer-Nielsen, L., C. S. Clements, A. G. Brooks, A. W. Purcell, M. R. Fontes, J. McCluskey,
and J. Rossjohn. 2002. The structure of HLA-B8 complexed to an immunodominant viral
determinant: peptide-induced conformational changes and a mode of MHC class I dimerization. J.
Immunol. 169: 5153-5160.
168. Bihl, F., N. Frahm, L. Di Giammarino, J. Sidney, M. John, K. Yusim, T. Woodberry, K.
Sango, H. S. Hewitt, L. Henry, C. H. Linde, J. V. Chisholm 3rd, T. M. Zaman, E. Pae, S. Mallal,
183
B. D. Walker, A. Sette, B. T. Korber, D. Heckerman, and C. Brander. 2006. Impact of HLA-B
alleles, epitope binding affinity, functional avidity, and viral coinfection on the immunodominance
of virus-specific CTL responses. J. Immunol. 176: 4094-4101.
169. Currier, J. R., M. E. Harris, J. H. Cox, F. E. McCutchan, D. L. Birx, S. Maayan, and G. Ferrari.
2005. Immunodominance and cross-reactivity of B5703-restricted CD8 T lymphocytes from HIV
type 1 subtype C-infected Ethiopians. AIDS Res. Hum. Retroviruses 21: 239-245.
170. Dzutsev, A. H., I. M. Belyakov, D. V. Isakov, D. H. Margulies, and J. A. Berzofsky. 2007.
Avidity of CD8 T cells sharpens immunodominance. Int. Immunol. 19: 497-507.
171. Kawashima, Y., M. Satoh, S. Oka, T. Shirasaka, and M. Takiguchi. 2008. Different
immunodominance of HIV-1-specific CTL epitopes among three subtypes of HLA-A*26
associated with slow progression to AIDS. Biochem. Biophys. Res. Commun. 366: 612-616.
172. Lichterfeld, M., X. G. Yu, S. Le Gall, and M. Altfeld. 2005. Immunodominance of HIV-1-
specific CD8(+) T-cell responses in acute HIV-1 infection: at the crossroads of viral and host
genetics. Trends Immunol. 26: 166-171.
173. Zhai, S., Y. Zhuang, Y. Song, S. Li, D. Huang, W. Kang, X. Li, Q. Liao, Y. Liu, Z. Zhao, Y.
Lu, and Y. Sun. 2008. HIV-1-specific cytotoxic T lymphocyte (CTL) responses against
immunodominant optimal epitopes slow the progression of AIDS in China. Curr. HIV. Res. 6:
335-350.
184
174. Crowe, S. R., S. J. Turner, S. C. Miller, A. D. Roberts, R. A. Rappolo, P. C. Doherty, K. H.
Ely, and D. L. Woodland. 2003. Differential antigen presentation regulates the changing patterns
of CD8+ T cell immunodominance in primary and secondary influenza virus infections. J. Exp.
Med. 198: 399-410.
175. Cheuk, E. and J. W. Chamberlain. 2005. Strong memory CD8+ T cell responses against
immunodominant and three new subdominant HLA-B27-restricted influenza A CTL epitopes
following secondary infection of HLA-B27 transgenic mice. Cell. Immunol. 234: 110-123.
176. Berkhoff, E. G., A. C. Boon, N. J. Nieuwkoop, R. A. Fouchier, K. Sintnicolaas, A. D.
Osterhaus, and G. F. Rimmelzwaan. 2004. A mutation in the HLA-B*2705-restricted NP383-391
epitope affects the human influenza A virus-specific cytotoxic T-lymphocyte response in vitro. J.
Virol. 78: 5216-5222.
177. Bodewes, R., J. H. Kreijtz, M. L. Hillaire, M. M. Geelhoed-Mieras, R. A. Fouchier, A. D.
Osterhaus, and G. F. Rimmelzwaan. 2010. Vaccination with whole inactivated virus vaccine
affects the induction of heterosubtypic immunity against influenza virus A/H5N1 and
immunodominance of virus-specific CD8+ T-cell responses in mice. J. Gen. Virol. 91: 1743-1753.
178. Jenkins, M. R., R. Webby, P. C. Doherty, and S. J. Turner. 2006. Addition of a prominent
epitope affects influenza A virus-specific CD8+ T cell immunodominance hierarchies when
antigen is limiting. J. Immunol. 177: 2917-2925.
185
179. Kedzierska, K., C. Guillonneau, S. Gras, L. A. Hatton, R. Webby, A. W. Purcell, J. Rossjohn,
P. C. Doherty, and S. J. Turner. 2008. Complete modification of TCR specificity and repertoire
selection does not perturb a CD8+ T cell immunodominance hierarchy. Proc. Natl. Acad. Sci. U.
S. A. 105: 19408-19413.
180. Kincaid, E. Z., J. W. Che, I. York, H. Escobar, E. Reyes-Vargas, J. C. Delgado, R. M. Welsh,
M. L. Karow, A. J. Murphy, D. M. Valenzuela, G. D. Yancopoulos, and K. L. Rock. 2011. Mice
completely lacking immunoproteasomes show major changes in antigen presentation. Nat.
Immunol. 13: 129-135.
181. Pang, K. C., M. T. Sanders, J. J. Monaco, P. C. Doherty, S. J. Turner, and W. Chen. 2006.
Immunoproteasome subunit deficiencies impact differentially on two immunodominant influenza
virus-specific CD8+ T cell responses. J. Immunol. 177: 7680-7688.
182. Gileadi, U., H. T. Moins-Teisserenc, I. Correa, B. L. Booth Jr, P. R. Dunbar, A. K. Sewell, J.
Trowsdale, R. E. Phillips, and V. Cerundolo. 1999. Generation of an immunodominant CTL
epitope is affected by proteasome subunit composition and stability of the antigenic protein. J.
Immunol. 163: 6045-6052.
183. Chen, W., C. C. Norbury, Y. Cho, J. W. Yewdell, and J. R. Bennink. 2001.
Immunoproteasomes shape immunodominance hierarchies of antiviral CD8(+) T cells at the levels
of T cell repertoire and presentation of viral antigens. J. Exp. Med. 193: 1319-1326.
186
184. Nussbaum, A. K., M. P. Rodriguez-Carreno, N. Benning, J. Botten, and J. L. Whitton. 2005.
Immunoproteasome-deficient mice mount largely normal CD8+ T cell responses to lymphocytic
choriomeningitis virus infection and DNA vaccination. J. Immunol. 175: 1153-1160.
185. Salter, R. D., D. N. Howell, and P. Cresswell. 1985. Genes regulating HLA class I antigen
expression in T-B lymphoblast hybrids. Immunogenetics 21: 235-246.
186. DeMars, R., R. Rudersdorf, C. Chang, J. Petersen, J. Strandtmann, N. Korn, B. Sidwell, and
H. T. Orr. 1985. Mutations that impair a posttranscriptional step in expression of HLA-A and -B
antigens. Proc. Natl. Acad. Sci. U. S. A. 82: 8183-8187.
187. Tenzer, S., E. Wee, A. Burgevin, G. Stewart-Jones, L. Friis, K. Lamberth, C. H. Chang, M.
Harndahl, M. Weimershaus, J. Gerstoft, N. Akkad, P. Klenerman, L. Fugger, E. Y. Jones, A. J.
McMichael, S. Buus, H. Schild, P. van Endert, and A. K. Iversen. 2009. Antigen processing
influences HIV-specific cytotoxic T lymphocyte immunodominance. Nat. Immunol. 10: 636-646.
188. Yang, B. and T. J. Braciale. 1995. Characteristics of ATP-dependent peptide transport in
isolated microsomes. J. Immunol. 155: 3889-3896.
189. Deng, Y., J. W. Yewdell, L. C. Eisenlohr, and J. R. Bennink. 1997. MHC affinity, peptide
liberation, T cell repertoire, and immunodominance all contribute to the paucity of MHC class I-
restricted peptides recognized by antiviral CTL. J. Immunol. 158: 1507-1515.
187
190. Bruder, D., A. K. Nussbaum, D. M. Gakamsky, M. Schirle, S. Stevanovic, H. Singh-Jasuja,
A. Darji, T. Chakraborty, H. Schild, I. Pecht, and S. Weiss. 2006. Multiple synergizing factors
contribute to the strength of the CD8+ T cell response against listeriolysin O. Int. Immunol. 18:
89-100.
191. Lee, S., S. A. Miller, D. W. Wright, M. T. Rock, and J. E. Crowe Jr. 2007. Tissue-specific
regulation of CD8+ T-lymphocyte immunodominance in respiratory syncytial virus infection. J.
Virol. 81: 2349-2358.
192. Blanchard, N. and N. Shastri. 2008. Coping with loss of perfection in the MHC class I peptide
repertoire. Curr. Opin. Immunol. 20: 82-88.
193. Kanaseki, T. and N. Shastri. 2008. Endoplasmic reticulum aminopeptidase associated with
antigen processing regulates quality of processed peptides presented by MHC class I molecules.
J. Immunol. 181: 6275-6282.
194. Yan, J., V. V. Parekh, Y. Mendez-Fernandez, D. Olivares-Villagomez, S. Dragovic, T. Hill,
D. C. Roopenian, S. Joyce, and L. Van Kaer. 2006. In vivo role of ER-associated peptidase activity
in tailoring peptides for presentation by MHC class Ia and class Ib molecules. J. Exp. Med. 203:
647-659.
188
195. Firat, E., L. Saveanu, P. Aichele, P. Staeheli, J. Huai, S. Gaedicke, A. Nil, G. Besin, B.
Kanzler, P. van Endert, and G. Niedermann. 2007. The role of endoplasmic reticulum-associated
aminopeptidase 1 in immunity to infection and in cross-presentation. J. Immunol. 178: 2241-2248.
196. York, I. A., M. A. Brehm, S. Zendzian, C. F. Towne, and K. L. Rock. 2006. Endoplasmic
reticulum aminopeptidase 1 (ERAP1) trims MHC class I-presented peptides in vivo and plays an
important role in immunodominance. Proc. Natl. Acad. Sci. U. S. A. 103: 9202-9207.
197. Thirdborough, S. M., J. S. Roddick, J. N. Radcliffe, M. Howarth, F. K. Stevenson, and T.
Elliott. 2008. Tapasin shapes immunodominance hierarchies according to the kinetic stability of
peptide-MHC class I complexes. Eur. J. Immunol. 38: 364-369.
198. Dalchau, N., A. Phillips, L. D. Goldstein, M. Howarth, L. Cardelli, S. Emmott, T. Elliott, and
J. M. Werner. 2011. A Peptide filtering relation quantifies MHC class I Peptide optimization. PLoS
Comput. Biol. 7: e1002144.
199. Peng, S., C. Trimble, L. He, Y. C. Tsai, C. T. Lin, D. A. Boyd, D. Pardoll, C. F. Hung, and
T. C. Wu. 2006. Characterization of HLA-A2-restricted HPV-16 E7-specific CD8(+) T-cell
immune responses induced by DNA vaccines in HLA-A2 transgenic mice. Gene Ther. 13: 67-77.
200. Evans, D. T., M. S. Piekarczyk, T. M. Allen, J. E. Boyson, M. Yeager, A. L. Hughes, F. M.
Gotch, V. S. Hinshaw, and D. I. Watkins. 1997. Immunodominance of a single CTL epitope in a
primate species with limited MHC class I polymorphism. J. Immunol. 159: 1374-1382.
189
201. Day, E. B., K. L. Charlton, N. L. La Gruta, P. C. Doherty, and S. J. Turner. 2011. Effect of
MHC class I diversification on influenza epitope-specific CD8+ T cell precursor frequency and
subsequent effector function. J. Immunol. 186: 6319-6328.
202. Hu, N., C. D'Souza, H. Cheung, H. Lang, E. Cheuk, and J. W. Chamberlain. 2005. Highly
conserved pattern of recognition of influenza A wild-type and variant CD8+ CTL epitopes in
HLA-A2+ humans and transgenic HLA-A2+/H2 class I-deficient mice. Vaccine 23: 5231-5244.
203. Friedrich, D., E. Jalbert, W. L. Dinges, J. Sidney, A. Sette, Y. Huang, M. J. McElrath, and H.
Horton. 2011. Vaccine-Induced HIV-Specific CD8+ T Cells Utilize Preferential HLA Alleles and
Target-Specific Regions of HIV-1. J. Acquir. Immune Defic. Syndr. 58: 248-252.
204. Yu, X. G., M. M. Addo, E. S. Rosenberg, W. R. Rodriguez, P. K. Lee, C. A. Fitzpatrick, M.
N. Johnston, D. Strick, P. J. Goulder, B. D. Walker, and M. Altfeld. 2002. Consistent patterns in
the development and immunodominance of human immunodeficiency virus type 1 (HIV-1)-
specific CD8+ T-cell responses following acute HIV-1 infection. J. Virol. 76: 8690-8701.
205. Schneidewind, A., Y. Tang, M. A. Brockman, E. G. Ryland, J. Dunkley-Thompson, J. C.
Steel-Duncan, M. A. St John, J. A. Conrad, S. A. Kalams, F. Noel, T. M. Allen, C. D. Christie,
and M. E. Feeney. 2009. Maternal transmission of human immunodeficiency virus escape
mutations subverts HLA-B57 immunodominance but facilitates viral control in the haploidentical
infant. J. Virol. 83: 8616-8627.
190
206. Kloverpris, H. N., A. Stryhn, M. Harndahl, M. van der Stok, R. P. Payne, P. C. Matthews, F.
Chen, L. Riddell, B. D. Walker, T. Ndung'u, S. Buus, and P. Goulder. 2012. HLA-B*57
Micropolymorphism shapes HLA allele-specific epitope immunogenicity, selection pressure, and
HIV immune control. J. Virol. 86: 919-929.
207. Schneidewind, A., Y. Tang, M. A. Brockman, E. G. Ryland, J. Dunkley-Thompson, J. C.
Steel-Duncan, M. A. St John, J. A. Conrad, S. A. Kalams, F. Noel, T. M. Allen, C. D. Christie,
and M. E. Feeney. 2009. Maternal transmission of human immunodeficiency virus escape
mutations subverts HLA-B57 immunodominance but facilitates viral control in the haploidentical
infant. J. Virol. 83: 8616-8627.
208. Ferrari, G., W. Neal, J. Ottinger, A. M. Jones, B. H. Edwards, P. Goepfert, M. R. Betts, R. A.
Koup, S. Buchbinder, M. J. McElrath, J. Tartaglia, and K. J. Weinhold. 2004. Absence of
immunodominant anti-Gag p17 (SL9) responses among Gag CTL-positive, HIV-uninfected
vaccine recipients expressing the HLA-A*0201 allele. J. Immunol. 173: 2126-2133.
209. Haeryfar, S. M., H. D. Hickman, K. R. Irvine, D. C. Tscharke, J. R. Bennink, and J. W.
Yewdell. 2008. Terminal deoxynucleotidyl transferase establishes and broadens antiviral CD8+ T
cell immunodominance hierarchies. J. Immunol. 181: 649-659.
210. Leon-Ponte, M., T. Kasprzyski, L. A. Mannik, and S. M. Haeryfar. 2008. Altered
immunodominance hierarchies of influenza A virus-specific H-2(b)-restricted CD8+ T cells in the
absence of terminal deoxynucleotidyl transferase. Immunol. Invest. 37: 714-725.
191
211. La Gruta, N. L., K. Kedzierska, K. Pang, R. Webby, M. Davenport, W. Chen, S. J. Turner,
and P. C. Doherty. 2006. A virus-specific CD8+ T cell immunodominance hierarchy determined
by antigen dose and precursor frequencies. Proc. Natl. Acad. Sci. U. S. A. 103: 994-999.
212. La Gruta, N. L., W. T. Rothwell, T. Cukalac, N. G. Swan, S. A. Valkenburg, K. Kedzierska,
P. G. Thomas, P. C. Doherty, and S. J. Turner. 2010. Primary CTL response magnitude in mice is
determined by the extent of naive T cell recruitment and subsequent clonal expansion. J. Clin.
Invest. 120: 1885-1894.
213. Tan, A. C., N. L. La Gruta, W. Zeng, and D. C. Jackson. 2011. Precursor frequency and
competition dictate the HLA-A2-restricted CD8+ T cell responses to influenza A infection and
vaccination in HLA-A2.1 transgenic mice. J. Immunol. 187: 1895-1902.
214. Hasegawa, A., C. Moriya, H. Liu, W. A. Charini, H. C. Vinet, R. A. Subbramanian, P. Sen,
N. L. Letvin, and M. J. Kuroda. 2007. Analysis of TCRalphabeta combinations used by simian
immunodeficiency virus-specific CD8+ T cells in rhesus monkeys: implications for CTL
immunodominance. J. Immunol. 178: 3409-3417.
215. Meijers, R., C. C. Lai, Y. Yang, J. H. Liu, W. Zhong, J. H. Wang, and E. L. Reinherz. 2005.
Crystal structures of murine MHC Class I H-2 D(b) and K(b) molecules in complex with CTL
epitopes from influenza A virus: implications for TCR repertoire selection and immunodominance.
J. Mol. Biol. 345: 1099-1110.
192
216. Moffat, J. M., T. Gebhardt, P. C. Doherty, S. J. Turner, and J. D. Mintern. 2009. Granzyme
A expression reveals distinct cytolytic CTL subsets following influenza A virus infection. Eur. J.
Immunol. 39: 1203-1210.
217. Kuerten, S., T. M. Nowacki, T. O. Kleen, R. J. Asaad, P. V. Lehmann, and M. Tary-Lehmann.
2008. Dissociated production of perforin, granzyme B, and IFN-gamma by HIV-specific CD8(+)
cells in HIV infection. AIDS Res. Hum. Retroviruses 24: 62-71.
218. Migueles, S. A., C. M. Osborne, C. Royce, A. A. Compton, R. P. Joshi, K. A. Weeks, J. E.
Rood, A. M. Berkley, J. B. Sacha, N. A. Cogliano-Shutta, M. Lloyd, G. Roby, R. Kwan, M.
McLaughlin, S. Stallings, C. Rehm, M. A. O'Shea, J. Mican, B. Z. Packard, A. Komoriya, S.
Palmer, A. P. Wiegand, F. Maldarelli, J. M. Coffin, J. W. Mellors, C. W. Hallahan, D. A. Follman,
and M. Connors. 2008. Lytic granule loading of CD8+ T cells is required for HIV-infected cell
elimination associated with immune control. Immunity 29: 1009-1021.
219. Nowacki, T. M., S. Kuerten, W. Zhang, C. L. Shive, C. R. Kreher, B. O. Boehm, P. V.
Lehmann, and M. Tary-Lehmann. 2007. Granzyme B production distinguishes recently activated
CD8(+) memory cells from resting memory cells. Cell. Immunol. 247: 36-48.
220. Trabattoni, D., S. Piconi, M. Biasin, G. Rizzardini, M. Migliorino, E. Seminari, A. Boasso,
L. Piacentini, M. L. Villa, R. Maserati, and M. Clerici. 2004. Granule-dependent mechanisms of
193
lysis are defective in CD8 T cells of HIV-infected, antiretroviral therapy-treated individuals. AIDS
18: 859-869.
221. Suarez-Ramirez, J. E., T. Wu, Y. T. Lee, C. C. Aguila, K. R. Bouchard, and L. S. Cauley.
2011. Division of labor between subsets of lymph node dendritic cells determines the specificity
of the CD8(+) T-cell recall response to influenza infection. Eur. J. Immunol. 41: 2632-2641.
222. Ishii, H., M. Kawada, T. Tsukamoto, H. Yamamoto, S. Matsuoka, T. Shiino, A. Takeda, M.
Inoue, A. Iida, H. Hara, T. Shu, M. Hasegawa, T. K. Naruse, A. Kimura, M. Takiguchi, and T.
Matano. 2012. Impact of vaccination on cytotoxic T lymphocyte immunodominance and
cooperation against simian immunodeficiency virus replication in rhesus macaques. J. Virol. 86:
738-745.
223. Yang, O. O. 2009. Candidate vaccine sequences to represent intra- and inter-clade HIV-1
variation. PLoS One 4: e7388.
224. Wodarz, D. and M. A. Nowak. 2000. CD8 memory, immunodominance, and antigenic escape.
Eur. J. Immunol. 30: 2704-2712.
225. Kim, P. S., P. P. Lee, and D. Levy. 2011. A theory of immunodominance and adaptive
regulation. Bull. Math. Biol. 73: 1645-1665.
194
226. Williams-Bey, Y., J. Jiang, and D. M. Murasko. 2011. Expansion of regulatory T cells in aged
mice following influenza infection. Mech. Ageing Dev. 132: 163-170.
227. Munoz-Suano, A., M. Kallikourdis, M. Sarris, and A. G. Betz. 2011. Regulatory T cells
protect from autoimmune arthritis during pregnancy. J. Autoimmun.
228. Li, C., A. Bankhead 3rd, A. J. Eisfeld, Y. Hatta, S. Jeng, J. H. Chang, L. D. Aicher, S. Proll,
A. L. Ellis, G. L. Law, K. M. Waters, G. Neumann, M. G. Katze, S. McWeeney, and Y. Kawaoka.
2011. Host regulatory network response to infection with highly pathogenic H5N1 avian influenza
virus. J. Virol. 85: 10955-10967.
229. Antunes, I. and G. Kassiotis. 2010. Suppression of innate immune pathology by regulatory T
cells during Influenza A virus infection of immunodeficient mice. J. Virol. 84: 12564-12575.
230. Sereti, I., H. Imamichi, V. Natarajan, T. Imamichi, M. S. Ramchandani, Y. Badralmaa, S. C.
Berg, J. A. Metcalf, B. K. Hahn, J. M. Shen, A. Powers, R. T. Davey, J. A. Kovacs, E. M. Shevach,
and H. C. Lane. 2005. In vivo expansion of CD4CD45RO-CD25 T cells expressing foxP3 in IL-
2-treated HIV-infected patients. J. Clin. Invest. 115: 1839-1847.
231. Kared, H., J. D. Lelievre, V. Donkova-Petrini, A. Aouba, G. Melica, M. Balbo, L. Weiss, and
Y. Levy. 2008. HIV-specific regulatory T cells are associated with higher CD4 cell counts in
primary infection. AIDS 22: 2451-2460.
195
232. Hsieh, S. M., M. Y. Chen, S. C. Pan, C. C. Hung, and S. C. Chang. 2007. Aberrant induction
of regulatory activity of CD4+CD25+ T cells by dendritic cells in HIV-infected persons with
amebic liver abscess. J. Acquir. Immune Defic. Syndr. 44: 6-13.
233. Sachdeva, M., M. A. Fischl, R. Pahwa, N. Sachdeva, and S. Pahwa. 2010. Immune exhaustion
occurs concomitantly with immune activation and decrease in regulatory T cells in viremic
chronically HIV-1-infected patients. J. Acquir. Immune Defic. Syndr. 54: 447-454.
234. Yager, E. J., M. Ahmed, K. Lanzer, T. D. Randall, D. L. Woodland, and M. A. Blackman.
2008. Age-associated decline in T cell repertoire diversity leads to holes in the repertoire and
impaired immunity to influenza virus. J. Exp. Med. 205: 711-723.
235. Ikematsu, H., Y. Takeuchi, M. Rosenlund, N. Kawai, R. Shimamura, M. Hirata, and N. Iwaki.
2011. The post-infection outcomes of influenza and acute respiratory infection in patients above
50 years of age in Japan: an observational study. Influenza Other Respi Viruses
236. Centers for Disease Control and Prevention (CDC). 2011. Influenza-associated pediatric
deaths--United States, September 2010-August 2011. MMWR Morb. Mortal. Wkly. Rep. 60: 1233-
1238.
237. Beli, E., J. F. Clinthorne, D. M. Duriancik, I. Hwang, S. Kim, and E. M. Gardner. 2011.
Natural killer cell function is altered during the primary response of aged mice to influenza
infection. Mech. Ageing Dev. 132: 503-510.
196
238. Esposito, S., C. Daleno, F. Baldanti, A. Scala, G. Campanini, F. Taroni, E. Fossali, C.
Pelucchi, and N. Principi. 2011. Viral shedding in children infected by pandemic A/H1N1/2009
influenza virus. Virol. J. 8: 349.
239. Van Kerkhove, M. D., K. A. Vandemaele, V. Shinde, G. Jaramillo-Gutierrez, A. Koukounari,
C. A. Donnelly, L. O. Carlino, R. Owen, B. Paterson, L. Pelletier, J. Vachon, C. Gonzalez, Y.
Hongjie, F. Zijian, S. K. Chuang, A. Au, S. Buda, G. Krause, W. Haas, I. Bonmarin, K. Taniguichi,
K. Nakajima, T. Shobayashi, Y. Takayama, T. Sunagawa, J. M. Heraud, A. Orelle, E. Palacios, M.
A. van der Sande, C. C. Wielders, D. Hunt, J. Cutter, V. J. Lee, J. Thomas, P. Santa-Olalla, M. J.
Sierra-Moros, W. Hanshaoworakul, K. Ungchusak, R. Pebody, S. Jain, A. W. Mounts, and WHO
Working Group for Risk Factors for Severe H1N1pdm Infection. 2011. Risk factors for severe
outcomes following 2009 influenza A (H1N1) infection: a global pooled analysis. PLoS Med. 8:
e1001053.
240. Nishiura, H. and H. Oshitani. 2011. Household transmission of influenza (H1N1-2009) in
Japan: age-specificity and reduction of household transmission risk by zanamivir treatment. J. Int.
Med. Res. 39: 619-628.
241. Hasse, B., B. Ledergerber, H. Furrer, M. Battegay, B. Hirschel, M. Cavassini, B. Bertisch, E.
Bernasconi, R. Weber, and the Swiss HIV Cohort Study. 2011. Morbidity and Aging in HIV-
Infected Persons: The Swiss HIV Cohort Study. Clin. Infect. Dis. 53: 1130-1139.
197
242. Negin, J., M. van Lettow, M. Semba, A. Martiniuk, A. Chan, and R. G. Cumming. 2011.
Anti-Retroviral Treatment Outcomes among Older Adults in Zomba District, Malawi. PLoS One
6: e26546.
243. Sankar, A., A. Nevedal, S. Neufeld, R. Berry, and M. Luborsky. 2011. What do we know
about older adults and HIV? A review of social and behavioral literature. AIDS Care 23: 1187-
1207.
244. Borges, J. P., E. Tibirica, P. P. Soares, B. Benedito, D. B. Lima, M. B. Gomes, and P. T.
Farinatti. 2011. Assessment of Vascular Function in HIV-Infected Patients. HIV. Clin. Trials 12:
215-221.
245. Guaraldi, G., G. Orlando, S. Zona, M. Menozzi, F. Carli, E. Garlassi, A. Berti, E. Rossi, A.
Roverato, and F. Palella. 2011. Premature Age-Related Comorbidities Among HIV-Infected
Persons Compared With the General Population. Clin. Infect. Dis. 53: 1120-1126.
246. Remakus, S. and L. J. Sigal. 2011. Interferon gamma and perforin control the strength, but
not the hierarchy, of immunodominance of an anti-viral CD8+ T cell response. J. Virol.
247. Radebe, M., K. Nair, F. Chonco, K. Bishop, J. K. Wright, M. van der Stok, I. V. Bassett, Z.
Mncube, M. Altfeld, B. D. Walker, and T. Ndung'u. 2011. Limited immunogenicity of HIV CD8+
T-cell epitopes in acute Clade C virus infection. J. Infect. Dis. 204: 768-776.
198
248. Pudney, V. A., A. M. Leese, A. B. Rickinson, and A. D. Hislop. 2005. CD8+
immunodominance among Epstein-Barr virus lytic cycle antigens directly reflects the efficiency
of antigen presentation in lytically infected cells. J. Exp. Med. 201: 349-360.
249. Andrabi, R., A. K. Choudhary, M. Bala, R. Kalra, S. S. Prakash, R. M. Pandey, and K. Luthra.
2011. Relative reactivity of HIV-1 polyclonal plasma antibodies directed to V3 and MPER regions
suggests immunodominance of V3 over MPER and dependence of high anti-V3 antibody titers on
virus persistence. Arch. Virol. 156: 1787-1794.
250. Cao, K., J. Hollenbach, X. Shi, W. Shi, M. Chopek, and M. A. Fernandez-Vina. 2001.
Analysis of the frequencies of HLA-A, B, and C alleles and haplotypes in the five major ethnic
groups of the United States reveals high levels of diversity in these loci and contrasting distribution
patterns in these populations. Hum. Immunol. 62: 1009-1030.
251. Fernandez Vina, M. A., J. A. Hollenbach, K. E. Lyke, M. B. Sztein, M. Maiers, W. Klitz, P.
Cano, S. Mack, R. Single, C. Brautbar, S. Israel, E. Raimondi, E. Khoriaty, A. Inati, M. Andreani,
M. Testi, M. E. Moraes, G. Thomson, P. Stastny, and K. Cao. 2012. Tracking human migrations
by the analysis of the distribution of HLA alleles, lineages and haplotypes in closed and open
populations. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 367: 820-829.
252. Brewerton, D. A. 1990. Introduction: B27-associated diseases. Scand. J. Rheumatol. Suppl.
87: 108-110.
199
253. Brewerton, D. A. 2003. Discovery: HLA and disease. Curr. Opin. Rheumatol. 15: 369-373.
254. Maksymowych, W. P., R. D. Inman, D. D. Gladman, J. P. Reeve, A. Pope, and P. Rahman.
2009. Association of a specific ERAP1/ARTS1 haplotype with disease susceptibility in ankylosing
spondylitis. Arthritis Rheum. 60: 1317-1323.
255. Taurog, J. D. 2010. The role of HLA-B27 in spondyloarthritis. J. Rheumatol. 37: 2606-2616.
256. Kaur, G. and N. Mehra. 2009. Genetic determinants of HIV-1 infection and progression to
AIDS: immune response genes. Tissue Antigens 74: 373-385.
257. Haroon, N., F. W. Tsui, B. Uchanska-Ziegler, A. Ziegler, and R. D. Inman. 2012.
Endoplasmic reticulum aminopeptidase 1 (ERAP1) exhibits functionally significant interaction
with HLA-B27 and relates to subtype specificity in ankylosing spondylitis. Ann. Rheum. Dis. 71:
589-595.
258. Khan, M. A. 2013. Polymorphism of HLA-B27: 105 subtypes currently known. Curr.
Rheumatol. Rep. 15: 362-013-0362-y.
259. Madden, D. R., J. C. Gorga, J. L. Strominger, and D. C. Wiley. 1991. The structure of HLA-
B27 reveals nonamer self-peptides bound in an extended conformation. Nature 353: 321-325.
200
260. Madden, D. R., J. C. Gorga, J. L. Strominger, and D. C. Wiley. 1992. The three-dimensional
structure of HLA-B27 at 2.1 A resolution suggests a general mechanism for tight peptide binding
to MHC. Cell 70: 1035-1048.
261. van Gaalen, F. A., W. Verduijn, D. L. Roelen, S. Bohringer, T. W. Huizinga, D. M. van der
Heijde, and R. E. Toes. 2013. Epistasis between two HLA antigens defines a subset of individuals
at a very high risk for ankylosing spondylitis. Ann. Rheum. Dis. 72: 974-978.
262. Qiu, X., F. Zhang, D. Chen, A. K. Azad, L. Zhang, Y. Yuan, Z. Jiang, W. Liu, Y. Tan, and
N. Tao. 2011. HLA-B*07 is a high risk allele for familial cervical cancer. Asian Pac. J. Cancer.
Prev. 12: 2597-2600.
263. Inman, R. D. 2006. Mechanisms of disease: infection and spondyloarthritis. Nat. Clin. Pract.
Rheumatol. 2: 163-169.
264. Rohekar, S., F. W. Tsui, H. W. Tsui, N. Xi, R. Riarh, R. Bilotta, and R. D. Inman. 2008.
Symptomatic acute reactive arthritis after an outbreak of salmonella. J. Rheumatol. 35: 1599-1602.
265. Bharhani, M. S., B. Chiu, K. S. Na, and R. D. Inman. 2009. Activation of invariant NKT cells
confers protection against Chlamydia trachomatis-induced arthritis. Int. Immunol. 21: 859-870.
266. Brown, M. A., S. H. Laval, S. Brophy, and A. Calin. 2000. Recurrence risk modelling of the
genetic susceptibility to ankylosing spondylitis. Ann. Rheum. Dis. 59: 883-886.
201
267. Feldtkeller, E., E. M. Lemmel, and A. S. Russell. 2003. Ankylosing spondylitis in the
pharaohs of ancient Egypt. Rheumatol. Int. 23: 1-5.
268. Strumpell, E. A. and E. M. Bick. 1971. Observations on chronic-ankylosing inflammation of
the vertebrae and hip joints. Clin. Orthop. Relat. Res. 74: 4-6.
269. International Genetics of Ankylosing Spondylitis Consortium (IGAS), A. Cortes, J. Hadler,
J. P. Pointon, P. C. Robinson, T. Karaderi, P. Leo, K. Cremin, K. Pryce, J. Harris, S. Lee, K. B.
Joo, S. C. Shim, M. Weisman, M. Ward, X. Zhou, H. J. Garchon, G. Chiocchia, J. Nossent, B. A.
Lie, O. Forre, J. Tuomilehto, K. Laiho, L. Jiang, Y. Liu, X. Wu, L. A. Bradbury, D. Elewaut, R.
Burgos-Vargas, S. Stebbings, L. Appleton, C. Farrah, J. Lau, T. J. Kenna, N. Haroon, M. A.
Ferreira, J. Yang, J. Mulero, J. L. Fernandez-Sueiro, M. A. Gonzalez-Gay, C. Lopez-Larrea, P.
Deloukas, P. Donnelly, Australo-Anglo-American Spondyloarthritis Consortium (TASC), Groupe
Francaise d'Etude Genetique des Spondylarthrites (GFEGS), Nord-Trondelag Health Study
(HUNT), Spondyloarthritis Research Consortium of Canada (SPARCC), Wellcome Trust Case
Control Consortium 2 (WTCCC2), P. Bowness, K. Gafney, H. Gaston, D. D. Gladman, P.
Rahman, W. P. Maksymowych, H. Xu, J. B. Crusius, I. E. van der Horst-Bruinsma, C. T. Chou,
R. Valle-Onate, C. Romero-Sanchez, I. M. Hansen, F. M. Pimentel-Santos, R. D. Inman, V.
Videm, J. Martin, M. Breban, J. D. Reveille, D. M. Evans, T. H. Kim, B. P. Wordsworth, and M.
A. Brown. 2013. Identification of multiple risk variants for ankylosing spondylitis through high-
density genotyping of immune-related loci. Nat. Genet. 45: 730-738.
202
270. Haroon, N., F. W. Tsui, B. Chiu, H. W. Tsui, and R. D. Inman. 2010. Serum cytokine
receptors in ankylosing spondylitis: relationship to inflammatory markers and endoplasmic
reticulum aminopeptidase polymorphisms. J. Rheumatol. 37: 1907-1910.
271. Sieper, J., J. Braun, J. Kay, S. Badalamenti, A. R. Radin, L. Jiao, S. Fiore, T. Momtahen, G.
D. Yancopoulos, N. Stahl, and R. D. Inman. 2014. Sarilumab for the treatment of ankylosing
spondylitis: results of a Phase II, randomised, double-blind, placebo-controlled study (ALIGN).
Ann. Rheum. Dis.
272. Poddubnyy, D., K. G. Hermann, J. Callhoff, J. Listing, and J. Sieper. 2014. Ustekinumab for
the treatment of patients with active ankylosing spondylitis: results of a 28-week, prospective,
open-label, proof-of-concept study (TOPAS). Ann. Rheum. Dis. 73: 817-823.
273. Baeten, D., X. Baraliakos, J. Braun, J. Sieper, P. Emery, D. van der Heijde, I. McInnes, J. M.
van Laar, R. Landewe, P. Wordsworth, J. Wollenhaupt, H. Kellner, J. Paramarta, J. Wei, A.
Brachat, S. Bek, D. Laurent, Y. Li, Y. A. Wang, A. P. Bertolino, S. Gsteiger, A. M. Wright, and
W. Hueber. 2013. Anti-interleukin-17A monoclonal antibody secukinumab in treatment of
ankylosing spondylitis: a randomised, double-blind, placebo-controlled trial. Lancet 382: 1705-
1713.
274. Maksymowych, W. P., D. Elewaut, and G. Schett. 2012. Motion for debate: the development
of ankylosis in ankylosing spondylitis is largely dependent on inflammation. Arthritis Rheum. 64:
1713-1719.
203
275. Ebringer, A., K. Ahmadi, M. Fielder, T. Rashid, H. Tiwana, C. Wilson, A. Collado, and Y.
Tani. 1996. Molecular mimicry: the geographical distribution of immune responses to Klebsiella
in ankylosing spondylitis and its relevance to therapy. Clin. Rheumatol. 15 Suppl 1: 57-61.
276. Zambrano-Zaragoza, F., E. Garcia-Latorre, M. L. Dominguez-Lopez, M. E. Cancino-Diaz,
R. Burgos-Vargas, and L. Jimenez-Zamudio. 2005. CD4 and CD8 T cell response to the rHSP60
from Klebsiella pneumoniae in peripheral blood mononuclear cells from patients with ankylosing
spondylitis. Rev. Invest. Clin. 57: 555-562.
277. Cancino-Diaz, M. E., J. E. Perez-Salazar, L. Dominguez-Lopez, A. Escobar-Gutierrez, J.
Granados-Arreola, L. Jimenez-Zamudio, R. Burgos-Vargas, and E. Garcia-Latorre. 1998.
Antibody response to Klebsiella pneumoniae 60 kDa protein in familial and sporadic ankylosing
spondylitis: role of HLA-B27 and characterization as a GroEL-like protein. J. Rheumatol. 25:
1756-1764.
278. Lees, C. W., J. C. Barrett, M. Parkes, and J. Satsangi. 2011. New IBD genetics: common
pathways with other diseases. Gut 60: 1739-1753.
279. Gibbs, R. A., G. M. Weinstock, M. L. Metzker, D. M. Muzny, E. J. Sodergren, S. Scherer, G.
Scott, D. Steffen, K. C. Worley, P. E. Burch, G. Okwuonu, S. Hines, L. Lewis, C. DeRamo, O.
Delgado, S. Dugan-Rocha, G. Miner, M. Morgan, A. Hawes, R. Gill, Celera, R. A. Holt, M. D.
Adams, P. G. Amanatides, H. Baden-Tillson, M. Barnstead, S. Chin, C. A. Evans, S. Ferriera, C.
204
Fosler, A. Glodek, Z. Gu, D. Jennings, C. L. Kraft, T. Nguyen, C. M. Pfannkoch, C. Sitter, G. G.
Sutton, J. C. Venter, T. Woodage, D. Smith, H. M. Lee, E. Gustafson, P. Cahill, A. Kana, L.
Doucette-Stamm, K. Weinstock, K. Fechtel, R. B. Weiss, D. M. Dunn, E. D. Green, R. W.
Blakesley, G. G. Bouffard, P. J. De Jong, K. Osoegawa, B. Zhu, M. Marra, J. Schein, I. Bosdet, C.
Fjell, S. Jones, M. Krzywinski, C. Mathewson, A. Siddiqui, N. Wye, J. McPherson, S. Zhao, C.
M. Fraser, J. Shetty, S. Shatsman, K. Geer, Y. Chen, S. Abramzon, W. C. Nierman, P. H. Havlak,
R. Chen, K. J. Durbin, A. Egan, Y. Ren, X. Z. Song, B. Li, Y. Liu, X. Qin, S. Cawley, K. C.
Worley, A. J. Cooney, L. M. D'Souza, K. Martin, J. Q. Wu, M. L. Gonzalez-Garay, A. R. Jackson,
K. J. Kalafus, M. P. McLeod, A. Milosavljevic, D. Virk, A. Volkov, D. A. Wheeler, Z. Zhang, J.
A. Bailey, E. E. Eichler, E. Tuzun, E. Birney, E. Mongin, A. Ureta-Vidal, C. Woodwark, E.
Zdobnov, P. Bork, M. Suyama, D. Torrents, M. Alexandersson, B. J. Trask, J. M. Young, H.
Huang, H. Wang, H. Xing, S. Daniels, D. Gietzen, J. Schmidt, K. Stevens, U. Vitt, J. Wingrove,
F. Camara, M. Mar Alba, J. F. Abril, R. Guigo, A. Smit, I. Dubchak, E. M. Rubin, O. Couronne,
A. Poliakov, N. Hubner, D. Ganten, C. Goesele, O. Hummel, T. Kreitler, Y. A. Lee, J. Monti, H.
Schulz, H. Zimdahl, H. Himmelbauer, H. Lehrach, H. J. Jacob, S. Bromberg, J. Gullings-Handley,
M. I. Jensen-Seaman, A. E. Kwitek, J. Lazar, D. Pasko, P. J. Tonellato, S. Twigger, C. P. Ponting,
J. M. Duarte, S. Rice, L. Goodstadt, S. A. Beatson, R. D. Emes, E. E. Winter, C. Webber, P. Brandt,
G. Nyakatura, M. Adetobi, F. Chiaromonte, L. Elnitski, P. Eswara, R. C. Hardison, M. Hou, D.
Kolbe, K. Makova, W. Miller, A. Nekrutenko, C. Riemer, S. Schwartz, J. Taylor, S. Yang, Y.
Zhang, K. Lindpaintner, T. D. Andrews, M. Caccamo, M. Clamp, L. Clarke, V. Curwen, R.
Durbin, E. Eyras, S. M. Searle, G. M. Cooper, S. Batzoglou, M. Brudno, A. Sidow, E. A. Stone, J.
C. Venter, B. A. Payseur, G. Bourque, C. Lopez-Otin, X. S. Puente, K. Chakrabarti, S. Chatterji,
C. Dewey, L. Pachter, N. Bray, V. B. Yap, A. Caspi, G. Tesler, P. A. Pevzner, D. Haussler, K. M.
205
Roskin, R. Baertsch, H. Clawson, T. S. Furey, A. S. Hinrichs, D. Karolchik, W. J. Kent, K. R.
Rosenbloom, H. Trumbower, M. Weirauch, D. N. Cooper, P. D. Stenson, B. Ma, M. Brent, M.
Arumugam, D. Shteynberg, R. R. Copley, M. S. Taylor, H. Riethman, U. Mudunuri, J. Peterson,
M. Guyer, A. Felsenfeld, S. Old, S. Mockrin, F. Collins, and Rat Genome Sequencing Project
Consortium. 2004. Genome sequence of the Brown Norway rat yields insights into mammalian
evolution. Nature 428: 493-521.
280. Saveanu, L., O. Carroll, V. Lindo, M. Del Val, D. Lopez, Y. Lepelletier, F. Greer, L.
Schomburg, D. Fruci, G. Niedermann, and P. M. van Endert. 2005. Concerted peptide trimming
by human ERAP1 and ERAP2 aminopeptidase complexes in the endoplasmic reticulum. Nat.
Immunol. 6: 689-697.
281. Evnouchidou, I., M. Weimershaus, L. Saveanu, and P. van Endert. 2014. ERAP1-ERAP2
Dimerization Increases Peptide-Trimming Efficiency. J. Immunol. 193: 901-908.
282. Hattori, A., H. Matsumoto, S. Mizutani, and M. Tsujimoto. 1999. Molecular cloning of
adipocyte-derived leucine aminopeptidase highly related to placental leucine
aminopeptidase/oxytocinase. J. Biochem. 125: 931-938.
283. Mehta, A. M., E. S. Jordanova, W. E. Corver, T. van Wezel, H. W. Uh, G. G. Kenter, and G.
Jan Fleuren. 2009. Single nucleotide polymorphisms in antigen processing machinery component
ERAP1 significantly associate with clinical outcome in cervical carcinoma. Genes Chromosomes
Cancer 48: 410-418.
206
284. Fung, E. Y., D. J. Smyth, J. M. Howson, J. D. Cooper, N. M. Walker, H. Stevens, L. S.
Wicker, and J. A. Todd. 2009. Analysis of 17 autoimmune disease-associated variants in type 1
diabetes identifies 6q23/TNFAIP3 as a susceptibility locus. Genes Immun. 10: 188-191.
285. Yamamoto, N., J. Nakayama, K. Yamakawa-Kobayashi, H. Hamaguchi, R. Miyazaki, and T.
Arinami. 2002. Identification of 33 polymorphisms in the adipocyte-derived leucine
aminopeptidase (ALAP) gene and possible association with hypertension. Hum. Mutat. 19: 251-
257.
286. Evans, D. M., C. C. Spencer, J. J. Pointon, Z. Su, D. Harvey, G. Kochan, U. Oppermann, A.
Dilthey, M. Pirinen, M. A. Stone, L. Appleton, L. Moutsianas, S. Leslie, T. Wordsworth, T. J.
Kenna, T. Karaderi, G. P. Thomas, M. M. Ward, M. H. Weisman, C. Farrar, L. A. Bradbury, P.
Danoy, R. D. Inman, W. Maksymowych, D. Gladman, P. Rahman, Spondyloarthritis Research
Consortium of Canada (SPARCC), A. Morgan, H. Marzo-Ortega, P. Bowness, K. Gaffney, J. S.
Gaston, M. Smith, J. Bruges-Armas, A. R. Couto, R. Sorrentino, F. Paladini, M. A. Ferreira, H.
Xu, Y. Liu, L. Jiang, C. Lopez-Larrea, R. Diaz-Pena, A. Lopez-Vazquez, T. Zayats, G. Band, C.
Bellenguez, H. Blackburn, J. M. Blackwell, E. Bramon, S. J. Bumpstead, J. P. Casas, A. Corvin,
N. Craddock, P. Deloukas, S. Dronov, A. Duncanson, S. Edkins, C. Freeman, M. Gillman, E. Gray,
R. Gwilliam, N. Hammond, S. E. Hunt, J. Jankowski, A. Jayakumar, C. Langford, J. Liddle, H. S.
Markus, C. G. Mathew, O. T. McCann, M. I. McCarthy, C. N. Palmer, L. Peltonen, R. Plomin, S.
C. Potter, A. Rautanen, R. Ravindrarajah, M. Ricketts, N. Samani, S. J. Sawcer, A. Strange, R. C.
Trembath, A. C. Viswanathan, M. Waller, P. Weston, P. Whittaker, S. Widaa, N. W. Wood, G.
207
McVean, J. D. Reveille, B. P. Wordsworth, M. A. Brown, P. Donnelly, Australo-Anglo-American
Spondyloarthritis Consortium (TASC), and Wellcome Trust Case Control Consortium 2
(WTCCC2). 2011. Interaction between ERAP1 and HLA-B27 in ankylosing spondylitis implicates
peptide handling in the mechanism for HLA-B27 in disease susceptibility. Nat. Genet. 43: 761-
767.
287. Hattori, A. and M. Tsujimoto. 2013. Endoplasmic reticulum aminopeptidases: biochemistry,
physiology and pathology. J. Biochem. 154: 219-228.
288. Nguyen, T. T., S. C. Chang, I. Evnouchidou, I. A. York, C. Zikos, K. L. Rock, A. L. Goldberg,
E. Stratikos, and L. J. Stern. 2011. Structural basis for antigenic peptide precursor processing by
the endoplasmic reticulum aminopeptidase ERAP1. Nat. Struct. Mol. Biol. 18: 604-613.
289. Kochan, G., T. Krojer, D. Harvey, R. Fischer, L. Chen, M. Vollmar, F. von Delft, K. L.
Kavanagh, M. A. Brown, P. Bowness, P. Wordsworth, B. M. Kessler, and U. Oppermann. 2011.
Crystal structures of the endoplasmic reticulum aminopeptidase-1 (ERAP1) reveal the molecular
basis for N-terminal peptide trimming. Proc. Natl. Acad. Sci. U. S. A. 108: 7745-7750.
290. Nguyen, T. T., S. C. Chang, I. Evnouchidou, I. A. York, C. Zikos, K. L. Rock, A. L. Goldberg,
E. Stratikos, and L. J. Stern. 2011. Structural basis for antigenic peptide precursor processing by
the endoplasmic reticulum aminopeptidase ERAP1. Nat. Struct. Mol. Biol. 18: 604-613.
208
291. Evnouchidou, I., F. Momburg, A. Papakyriakou, A. Chroni, L. Leondiadis, S. C. Chang, A.
L. Goldberg, and E. Stratikos. 2008. The internal sequence of the peptide-substrate determines its
N-terminus trimming by ERAP1. PLoS One 3: e3658.
292. Chang, S. C., F. Momburg, N. Bhutani, and A. L. Goldberg. 2005. The ER aminopeptidase,
ERAP1, trims precursors to lengths of MHC class I peptides by a "molecular ruler" mechanism.
Proc. Natl. Acad. Sci. U. S. A. 102: 17107-17112.
293. Genetic Analysis of Psoriasis Consortium & the Wellcome Trust Case Control Consortium
2, A. Strange, F. Capon, C. C. Spencer, J. Knight, M. E. Weale, M. H. Allen, A. Barton, G. Band,
C. Bellenguez, J. G. Bergboer, J. M. Blackwell, E. Bramon, S. J. Bumpstead, J. P. Casas, M. J.
Cork, A. Corvin, P. Deloukas, A. Dilthey, A. Duncanson, S. Edkins, X. Estivill, O. Fitzgerald, C.
Freeman, E. Giardina, E. Gray, A. Hofer, U. Huffmeier, S. E. Hunt, A. D. Irvine, J. Jankowski, B.
Kirby, C. Langford, J. Lascorz, J. Leman, S. Leslie, L. Mallbris, H. S. Markus, C. G. Mathew, W.
H. McLean, R. McManus, R. Mossner, L. Moutsianas, A. T. Naluai, F. O. Nestle, G. Novelli, A.
Onoufriadis, C. N. Palmer, C. Perricone, M. Pirinen, R. Plomin, S. C. Potter, R. M. Pujol, A.
Rautanen, E. Riveira-Munoz, A. W. Ryan, W. Salmhofer, L. Samuelsson, S. J. Sawcer, J.
Schalkwijk, C. H. Smith, M. Stahle, Z. Su, R. Tazi-Ahnini, H. Traupe, A. C. Viswanathan, R. B.
Warren, W. Weger, K. Wolk, N. Wood, J. Worthington, H. S. Young, P. L. Zeeuwen, A. Hayday,
A. D. Burden, C. E. Griffiths, J. Kere, A. Reis, G. McVean, D. M. Evans, M. A. Brown, J. N.
Barker, L. Peltonen, P. Donnelly, and R. C. Trembath. 2010. A genome-wide association study
identifies new psoriasis susceptibility loci and an interaction between HLA-C and ERAP1. Nat.
Genet. 42: 985-990.
209
294. Colbert, R. A., T. M. Tran, and G. Layh-Schmitt. 2014. HLA-B27 misfolding and ankylosing
spondylitis. Mol. Immunol. 57: 44-51.
295. Turner, M. J., D. P. Sowders, M. L. DeLay, R. Mohapatra, S. Bai, J. A. Smith, J. R.
Brandewie, J. D. Taurog, and R. A. Colbert. 2005. HLA-B27 misfolding in transgenic rats is
associated with activation of the unfolded protein response. J. Immunol. 175: 2438-2448.
296. Turner, M. J., M. L. Delay, S. Bai, E. Klenk, and R. A. Colbert. 2007. HLA-B27 up-regulation
causes accumulation of misfolded heavy chains and correlates with the magnitude of the unfolded
protein response in transgenic rats: Implications for the pathogenesis of spondylarthritis-like
disease. Arthritis Rheum. 56: 215-223.
297. DeLay, M. L., M. J. Turner, E. I. Klenk, J. A. Smith, D. P. Sowders, and R. A. Colbert. 2009.
HLA-B27 misfolding and the unfolded protein response augment interleukin-23 production and
are associated with Th17 activation in transgenic rats. Arthritis Rheum. 60: 2633-2643.
298. Firat, E., L. Saveanu, P. Aichele, P. Staeheli, J. Huai, S. Gaedicke, A. Nil, G. Besin, B.
Kanzler, P. van Endert, and G. Niedermann. 2007. The role of endoplasmic reticulum-associated
aminopeptidase 1 in immunity to infection and in cross-presentation. J. Immunol. 178: 2241-2248.
299. Yan, J., V. V. Parekh, Y. Mendez-Fernandez, D. Olivares-Villagomez, S. Dragovic, T. Hill,
D. C. Roopenian, S. Joyce, and L. Van Kaer. 2006. In vivo role of ER-associated peptidase activity
210
in tailoring peptides for presentation by MHC class Ia and class Ib molecules. J. Exp. Med. 203:
647-659.
300. Blanchard, N., F. Gonzalez, M. Schaeffer, N. T. Joncker, T. Cheng, A. J. Shastri, E. A. Robey,
and N. Shastri. 2008. Immunodominant, protective response to the parasite Toxoplasma gondii
requires antigen processing in the endoplasmic reticulum. Nat. Immunol. 9: 937-944.
301. Kanaseki, T. and N. Shastri. 2008. Endoplasmic reticulum aminopeptidase associated with
antigen processing regulates quality of processed peptides presented by MHC class I molecules.
J. Immunol. 181: 6275-6282.
302. Harris, M. R., L. Lybarger, N. B. Myers, C. Hilbert, J. C. Solheim, T. H. Hansen, and Y. Y.
Yu. 2001. Interactions of HLA-B27 with the peptide loading complex as revealed by heavy chain
mutations. Int. Immunol. 13: 1275-1282.
303. Fukazawa, T., E. Hermann, M. Edidin, J. Wen, F. Huang, H. Kellner, J. Floege, D.
Farahmandian, K. M. Williams, and D. T. Yu. 1994. The effect of mutant beta 2-microglobulins
on the conformation of HLA-B27 detected by antibody and by CTL. J. Immunol. 153: 3543-3550.
304. Allen, R. L. and J. Trowsdale. 2004. Recognition of classical and heavy chain forms of HLA-
B27 by leukocyte receptors. Curr. Mol. Med. 4: 59-65.
211
305. Raine, T., D. Brown, P. Bowness, J. S. Hill Gaston, A. Moffett, J. Trowsdale, and R. L. Allen.
2006. Consistent patterns of expression of HLA class I free heavy chains in healthy individuals
and raised expression in spondyloarthropathy patients point to physiological and pathological
roles. Rheumatology (Oxford) 45: 1338-1344.
306. Tsui, F. W., N. Haroon, J. D. Reveille, P. Rahman, B. Chiu, H. W. Tsui, and R. D. Inman.
2010. Association of an ERAP1 ERAP2 haplotype with familial ankylosing spondylitis. Ann.
Rheum. Dis. 69: 733-736.
307. Stone, M. A., U. Payne, C. Schentag, P. Rahman, C. Pacheco-Tena, and R. D. Inman. 2004.
Comparative immune responses to candidate arthritogenic bacteria do not confirm a dominant role
for Klebsiella pneumonia in the pathogenesis of familial ankylosing spondylitis. Rheumatology
(Oxford) 43: 148-155.
308. Atagunduz, P., H. Appel, W. Kuon, P. Wu, A. Thiel, P. M. Kloetzel, and J. Sieper. 2005.
HLA-B27-restricted CD8+ T cell response to cartilage-derived self peptides in ankylosing
spondylitis. Arthritis Rheum. 52: 892-901.
309. Sun, S., T. Wang, B. Pang, H. Wei, and G. Liu. 2013. Short peptide sequence identity between
human viruses and HLA-B27-binding human 'self' peptides. Theory Biosci.
310. Franke, A., D. P. McGovern, J. C. Barrett, K. Wang, G. L. Radford-Smith, T. Ahmad, C. W.
Lees, T. Balschun, J. Lee, R. Roberts, C. A. Anderson, J. C. Bis, S. Bumpstead, D. Ellinghaus, E.
212
M. Festen, M. Georges, T. Green, T. Haritunians, L. Jostins, A. Latiano, C. G. Mathew, G. W.
Montgomery, N. J. Prescott, S. Raychaudhuri, J. I. Rotter, P. Schumm, Y. Sharma, L. A. Simms,
K. D. Taylor, D. Whiteman, C. Wijmenga, R. N. Baldassano, M. Barclay, T. M. Bayless, S. Brand,
C. Buning, A. Cohen, J. F. Colombel, M. Cottone, L. Stronati, T. Denson, M. De Vos, R. D'Inca,
M. Dubinsky, C. Edwards, T. Florin, D. Franchimont, R. Gearry, J. Glas, A. Van Gossum, S. L.
Guthery, J. Halfvarson, H. W. Verspaget, J. P. Hugot, A. Karban, D. Laukens, I. Lawrance, M.
Lemann, A. Levine, C. Libioulle, E. Louis, C. Mowat, W. Newman, J. Panes, A. Phillips, D. D.
Proctor, M. Regueiro, R. Russell, P. Rutgeerts, J. Sanderson, M. Sans, F. Seibold, A. H. Steinhart,
P. C. Stokkers, L. Torkvist, G. Kullak-Ublick, D. Wilson, T. Walters, S. R. Targan, S. R. Brant, J.
D. Rioux, M. D'Amato, R. K. Weersma, S. Kugathasan, A. M. Griffiths, J. C. Mansfield, S.
Vermeire, R. H. Duerr, M. S. Silverberg, J. Satsangi, S. Schreiber, J. H. Cho, V. Annese, H.
Hakonarson, M. J. Daly, and M. Parkes. 2010. Genome-wide meta-analysis increases to 71 the
number of confirmed Crohn's disease susceptibility loci. Nat. Genet. 42: 1118-1125.
311. Hattori, A., K. Kitatani, H. Matsumoto, S. Miyazawa, T. Rogi, N. Tsuruoka, S. Mizutani, Y.
Natori, and M. Tsujimoto. 2000. Characterization of recombinant human adipocyte-derived
leucine aminopeptidase expressed in Chinese hamster ovary cells. J. Biochem. 128: 755-762.
312. Johnson, M. P., L. T. Roten, T. D. Dyer, C. E. East, S. Forsmo, J. Blangero, S. P. Brennecke,
R. Austgulen, and E. K. Moses. 2009. The ERAP2 gene is associated with preeclampsia in
Australian and Norwegian populations. Hum. Genet. 126: 655-666.
213
313. Taranta, A., A. Gianviti, A. Palma, V. De Luca, L. Mannucci, M. A. Procaccino, G. M.
Ghiggeri, G. Caridi, D. Fruci, S. Ferracuti, A. Ferretti, C. Pecoraro, M. Gaido, R. Penza, A.
Edefonti, L. Murer, A. E. Tozzi, and F. Emma. 2009. Genetic risk factors in typical haemolytic
uraemic syndrome. Nephrol. Dial. Transplant. 24: 1851-1857.
314. Yamada, Y., F. Ando, and H. Shimokata. 2007. Association of candidate gene polymorphisms
with bone mineral density in community-dwelling Japanese women and men. Int. J. Mol. Med. 19:
791-801.
315. Firat, E., L. Saveanu, P. Aichele, P. Staeheli, J. Huai, S. Gaedicke, A. Nil, G. Besin, B.
Kanzler, P. van Endert, and G. Niedermann. 2007. The role of endoplasmic reticulum-associated
aminopeptidase 1 in immunity to infection and in cross-presentation. J. Immunol. 178: 2241-2248.
316. Blanchard, N., F. Gonzalez, M. Schaeffer, N. T. Joncker, T. Cheng, A. J. Shastri, E. A. Robey,
and N. Shastri. 2008. Immunodominant, protective response to the parasite Toxoplasma gondii
requires antigen processing in the endoplasmic reticulum. Nat. Immunol. 9: 937-944.
317. Chamberlain, J. W., J. A. Nolan, S. H. Gromkowski, K. A. Kelley, J. M. Eisenstadt, K.
Herrup, C. A. Janeway Jr, and S. M. Weissman. 1988. Cell surface expression and alloantigenic
function of a human class I MHC heavy chain gene (HLA-B7) in transgenic mice. J. Immunol.
140: 1285-1292.
214
318. Borenstein, S. H., J. Graham, X. L. Zhang, and J. W. Chamberlain. 2000. CD8+ T cells are
necessary for recognition of allelic, but not locus-mismatched or xeno-, HLA class I
transplantation antigens. J. Immunol. 165: 2341-2353.
319. Chamberlain, J. W., J. A. Nolan, P. J. Conrad, H. A. Vasavada, H. H. Vasavada, H. L. Ploegh,
S. Ganguly, C. A. Janeway Jr, and S. M. Weissman. 1988. Tissue-specific and cell surface
expression of human major histocompatibility complex class I heavy (HLA-B7) and light (beta 2-
microglobulin) chain genes in transgenic mice. Proc. Natl. Acad. Sci. U. S. A. 85: 7690-7694.
320. Yewdell, J. W. and J. R. Bennink. 1999. Immunodominance in major histocompatibility
complex class I-restricted T lymphocyte responses. Annu. Rev. Immunol. 17: 51-88.
321. Yewdell, J. W. and M. Del Val. 2004. Immunodominance in TCD8+ responses to viruses:
cell biology, cellular immunology, and mathematical models. Immunity 21: 149-153.
322. Burrows, S. R., S. L. Silins, D. J. Moss, R. Khanna, I. S. Misko, and V. P. Argaet. 1995. T
cell receptor repertoire for a viral epitope in humans is diversified by tolerance to a background
major histocompatibility complex antigen. J. Exp. Med. 182: 1703-1715.
323. Munks, M. W., A. K. Pinto, C. M. Doom, and A. B. Hill. 2007. Viral interference with antigen
presentation does not alter acute or chronic CD8 T cell immunodominance in murine
cytomegalovirus infection. J. Immunol. 178: 7235-7241.
215
324. Gotch, F., A. McMichael, G. Smith, and B. Moss. 1987. Identification of viral molecules
recognized by influenza-specific human cytotoxic T lymphocytes. J. Exp. Med. 165: 408-416.
325. Croom, H. A., A. E. Denton, S. A. Valkenburg, N. G. Swan, M. R. Olson, S. J. Turner, P. C.
Doherty, and K. Kedzierska. 2011. Memory precursor phenotype of CD8+ T cells reflects early
antigenic experience rather than memory numbers in a model of localized acute influenza
infection. Eur. J. Immunol. 41: 682-693.
326. Okuda, K., A. Ihata, S. Watabe, E. Okada, T. Yamakawa, K. Hamajima, J. Yang, N. Ishii, M.
Nakazawa, K. Okuda, K. Ohnari, K. Nakajima, and K. Q. Xin. 2001. Protective immunity against
influenza A virus induced by immunization with DNA plasmid containing influenza M gene.
Vaccine 19: 3681-3691.
327. Matute-Bello, G., J. S. Lee, C. W. Frevert, W. C. Liles, S. Sutlief, K. Ballman, V. Wong, A.
Selk, and T. R. Martin. 2004. Optimal timing to repopulation of resident alveolar macrophages
with donor cells following total body irradiation and bone marrow transplantation in mice. J.
Immunol. Methods 292: 25-34.
328. Matute-Bello, G., J. S. Lee, C. W. Frevert, W. C. Liles, S. Sutlief, K. Ballman, V. Wong, A.
Selk, and T. R. Martin. 2004. Optimal timing to repopulation of resident alveolar macrophages
with donor cells following total body irradiation and bone marrow transplantation in mice. J.
Immunol. Methods 292: 25-34.
216
329. Datta, S. and N. E. Sarvetnick. 2008. IL-21 limits peripheral lymphocyte numbers through T
cell homeostatic mechanisms. PLoS One 3: e3118.
330. Obar, J. J., K. M. Khanna, and L. Lefrancois. 2008. Endogenous naive CD8+ T cell precursor
frequency regulates primary and memory responses to infection. Immunity 28: 859-869.
331. Moon, J. J., H. H. Chu, M. Pepper, S. J. McSorley, S. C. Jameson, R. M. Kedl, and M. K.
Jenkins. 2007. Naive CD4(+) T cell frequency varies for different epitopes and predicts repertoire
diversity and response magnitude. Immunity 27: 203-213.
332. Belz, G. T., P. G. Stevenson, and P. C. Doherty. 2000. Contemporary analysis of MHC-
related immunodominance hierarchies in the CD8+ T cell response to influenza A viruses. J.
Immunol. 165: 2404-2409.
333. Bodewes, R., J. H. Kreijtz, M. L. Hillaire, M. M. Geelhoed-Mieras, R. A. Fouchier, A. D.
Osterhaus, and G. F. Rimmelzwaan. 2010. Vaccination with whole inactivated virus vaccine
affects the induction of heterosubtypic immunity against influenza virus A/H5N1 and
immunodominance of virus-specific CD8+ T-cell responses in mice. J. Gen. Virol. 91: 1743-1753.
334. Lacey, S. F., C. La Rosa, T. Kaltcheva, T. Srivastava, A. Seidel, W. Zhou, R. Rawal, K.
Hagen, A. Krishnan, J. Longmate, H. A. Andersson, L. St John, R. Bhatia, V. Pullarkat, S. J.
Forman, L. J. Cooper, J. Molldrem, and D. J. Diamond. 2011. Characterization of immunologic
217
properties of a second HLA-A2 epitope from a granule protease in CML patients and HLA-A2
transgenic mice. Blood 118: 2159-2169.
335. Penninger, J. M., M. W. Schilham, E. Timms, V. A. Wallace, and T. W. Mak. 1995. T cell
repertoire and clonal deletion of Mtv superantigen-reactive T cells in mice lacking CD4 and CD8
molecules. Eur. J. Immunol. 25: 2115-2118.
336. Wahl, A., F. Schafer, W. Bardet, R. Buchli, G. M. Air, and W. H. Hildebrand. 2009. HLA
class I molecules consistently present internal influenza epitopes. Proc. Natl. Acad. Sci. U. S. A.
106: 540-545.
337. Gras, S., L. Kedzierski, S. A. Valkenburg, K. Laurie, Y. C. Liu, J. T. Denholm, M. J. Richards,
G. F. Rimmelzwaan, A. Kelso, P. C. Doherty, S. J. Turner, J. Rossjohn, and K. Kedzierska. 2010.
Cross-reactive CD8+ T-cell immunity between the pandemic H1N1-2009 and H1N1-1918
influenza A viruses. Proc. Natl. Acad. Sci. U. S. A. 107: 12599-12604.
338. Tussey, L. G., S. Rowland-Jones, T. S. Zheng, M. J. Androlewicz, P. Cresswell, J. A.
Frelinger, and A. J. McMichael. 1995. Different MHC class I alleles compete for presentation of
overlapping viral epitopes. Immunity 3: 65-77.
339. Yi, L., J. Wang, X. Guo, M. G. Espitia, E. Chen, S. Assassi, L. Jin, H. Zou, J. D. Reveille,
and X. Zhou. 2013. Profiling of hla-B alleles for association studies with ankylosing spondylitis
in the chinese population. Open Rheumatol. J. 7: 51-54.
218
340. Haroon, N. and R. D. Inman. 2010. Endoplasmic reticulum aminopeptidases: Biology and
pathogenic potential. Nat. Rev. Rheumatol. 6: 461-467.
341. Akram, A. and R. D. Inman. 2013. Co-expression of HLA-B7 and HLA-B27 alleles is
associated with B7-restricted immunodominant responses following influenza infection. Eur. J.
Immunol.
342. Akram, A., B. Han, H. Masoom, C. Peng, E. Lam, M. L. Litvack, X. Bai, Y. Shan, T. Hai, J.
Batt, A. S. Slutsky, H. Zhang, W. M. Kuebler, J. J. Haitsma, M. Liu, and C. C. dos Santos. 2010.
Activating transcription factor 3 confers protection against ventilator-induced lung injury. Am. J.
Respir. Crit. Care Med. 182: 489-500.
343. Ghoneim, H. E., P. G. Thomas, and J. A. McCullers. 2013. Depletion of alveolar macrophages
during influenza infection facilitates bacterial superinfections. J. Immunol. 191: 1250-1259.
344. Cong, Y., Y. Sun, W. Wang, Q. Meng, W. Ran, L. Zhu, G. Yang, W. Yang, L. Yang, C.
Wang, and Z. Ding. 2014. Comparative analysis of receptor-binding specificity and pathogenicity
in natural reassortant and non-reassortant H3N2 swine influenza virus. Vet. Microbiol. 168: 105-
115.
219
345. Tam, V. C., O. Quehenberger, C. M. Oshansky, R. Suen, A. M. Armando, P. M. Treuting, P.
G. Thomas, E. A. Dennis, and A. Aderem. 2013. Lipidomic profiling of influenza infection
identifies mediators that induce and resolve inflammation. Cell 154: 213-227.
346. Huang, R., J. Liu, W. Liang, A. Wang, Z. Liu, Y. Yang, J. Lv, Y. Bao, Y. Gao, Z. Miao, and
T. Chai. 2013. Response profiles of cytokines and chemokines against avian H9N2 influenza virus
within the mouse lung. Med. Microbiol. Immunol.
347. Hammer, G. E., T. Kanaseki, and N. Shastri. 2007. The final touches make perfect the peptide-
MHC class I repertoire. Immunity 26: 397-406.
348. Firat, E., L. Saveanu, P. Aichele, P. Staeheli, J. Huai, S. Gaedicke, A. Nil, G. Besin, B.
Kanzler, P. van Endert, and G. Niedermann. 2007. The role of endoplasmic reticulum-associated
aminopeptidase 1 in immunity to infection and in cross-presentation. J. Immunol. 178: 2241-2248.
349. Cauli, A., J. Shaw, J. Giles, H. Hatano, O. Rysnik, S. Payeli, K. McHugh, G. Dessole, G.
Porru, E. Desogus, S. Fiedler, S. Holper, A. Carette, M. A. Blanco-Gelaz, A. Vacca, M. Piga, V.
Ibba, P. Garau, G. La Nasa, C. Lopez-Larrea, A. Mathieu, C. Renner, P. Bowness, and S.
Kollnberger. 2013. The arthritis-associated HLA-B*27:05 allele forms more cell surface B27
dimer and free heavy chain ligands for KIR3DL2 than HLA-B*27:09. Rheumatology (Oxford) 52:
1952-1962.
220
350. Payeli, S. K., S. Kollnberger, O. Marroquin Belaunzaran, M. Thiel, K. McHugh, J. Giles, J.
Shaw, S. Kleber, A. Ridley, I. Wong-Baeza, S. Keidel, K. Kuroki, K. Maenaka, A. Wadle, C.
Renner, and P. Bowness. 2012. Inhibiting HLA-B27 homodimer-driven immune cell inflammation
in spondylarthritis. Arthritis Rheum. 64: 3139-3149.
351. Hammer, R. E., S. D. Maika, J. A. Richardson, J. P. Tang, and J. D. Taurog. 1990.
Spontaneous inflammatory disease in transgenic rats expressing HLA-B27 and human beta 2m:
an animal model of HLA-B27-associated human disorders. Cell 63: 1099-1112.
352. Moriyama, H., M. Moriyama, K. Sawaragi, H. Okura, A. Ichinose, A. Matsuyama, and T.
Hayakawa. 2013. Tightly regulated and homogeneous transgene expression in human adipose-
derived mesenchymal stem cells by lentivirus with tet-off system. PLoS One 8: e66274.
353. Tong, C., G. Huang, C. Ashton, H. Wu, H. Yan, and Q. L. Ying. 2012. Rapid and cost-
effective gene targeting in rat embryonic stem cells by TALENs. J. Genet. Genomics 39: 275-280.