RESULTS

Figure 2. Editing efficiency in human iPSCs (Feeder vs. Feeder free)

(A) Transfection of Various CRISPR/Cas9 formats (DNA and mRNA) in Gibco® human iPSCs grown

on feeder layer. Before transfection, iPSCs were transferred to Geltrex® matrix–coated plates in

conditioned medium. Plasmid DNA and mRNA were transfected using Lipofectamine® 3000 and

Lipofectamine® MessengerMAX transfection reagents, respectively. Genomic cleavage assay for

HPRT locus was performed 72 hours post transfection.

(B) Electroporation of Various CRISPR/Cas9 formats (DNA, mRNA and Protein) in Gibco iPSCs gown

in conditioned medium. Single cells suspension was collected and 100K cells were electoporated

using various CRISPR formats and genomic cleavage assay performed 72 hours post

transfection.

Gibco iPSCs were grown on Geltrex® coated plates in Essential 8® Medium and transfected with

CRISPR/Cas9 formats (mRNA and RNPs) using Lipofectamine® MessengerMAX and RNAiMAX,

respectively.

(A) Cell density before and 48 post transfection. Transfections were performed in presence of

ROCK inhibitor and medium was changed 6 hours post transfection.

(B) Effect of cell detachment factors (Accuatse® vs. TrypLE™ on genomic cleavage efficiency.

Cells were transfected using various amount of gRNA (125-250ng) and Cas9 protein (500-

1000ng) and genomic cleavage assay performed 48 hours post transfection.

(C) Effect of medium change before and after transfection. Blue bar shows medium changes prior

to transfection; red bar shows medium containing ROCK inhibitor at the time of transfection.

(D) Comparison of cleavage efficiency between CRISPR/Cas9 formats (mRNA and RNPs). Cells

were transfected in duplicate with gRNA against HPRT locus and Cas9 (mRNA or Protein).

Genomic cleavage assay was performed 48 hours post transfection.

Figure 1. Editing efficiencies in mouse ESCs

Figure 3. Optimization of RNPs electroporation in human iPSCs/H9

(A) Gibco iPSCs were grown on Geltrex® in Essential 8 medium. Single cell suspensions were

collected using TrpLE™ and 100 K cells were electroporated using 10 µl Neon® tips. 200 ng of IVT

gRNA against HPRT locus and 1.5 µg of Cas9 protein were complexed for 10 min at room

temperature. Electroporation was performed using Neon electroporation system in R buffer. Preset

24 different Neon optimization conditions were tested and genomic cleavage assays were

performed 72 hours post transfection.

(B) Electroporation of RNPs in Gibco iPSCs. 100k cells were electroporated using Neon electroporation

condition- 1200V, 20 ms, 2 pulse

(C)Electroporation of RNPs in human H9 cells. 100k cells were electroporated using Neon

electroporation condition- 1200V, 20 ms, 2 pulse

(A) Single cell suspension of Gibco iPSCs were collected and electroporated using Neon

electroporation system with various CRISPR/Cas9 formats (mRNA and RNPs). Three days post

electroporation cells were stained using fluorescently labeled antibodies against pluripotency

markers, and analyzed using flow cytometer.

(B) Various CRISPR/Cas9 formats (All-in-plasmid, mRNA and RNPs) were electroporated (best

condition) in Gibco iPSCs and AP stained using 3 days post electroporation. 750 ng of All-in-one

plasmid; 200ng of IVT and 500 ng of Cas9 mRNA; 200 ng of IVT and 500 ng of Platimum Cas9

nuclease

For placement only

(delete box)

Figure 5. Efficient creation of SNP in iPSCs using ssODN and CRISPR

ABSTRACT

Genome editing in induced pluripotent stem cells (iPSCs) has been

demonstrated to be highly effective for generating disease models for both

monogenic and complex genetic disorders. For successful genome editing

of iPSCs many factors need to be considered such as choice of growth

media, genome editing tools, and nucleic acid (NA) delivery methods.

Currently many genome editing tools require large quantities of NA, involve

tedious cloning steps and are relatively more toxic to iPSCs. To overcome

these challenges we developed a highly purified transfection grade

CRISPR/Cas9 ribonucleoprotein (RNP) complex, which is highly efficient in

genome editing with minimal toxicity. We also optimized a transfection

condition to maximize delivery and genome editing in stem cells using

CRISPR/Cas9 RNP complex. Discussed here are the results from different

CRISPR/Cas9 formats tested across wide variety of cell types including

stem cells. Using these formats we have edited mouse embryonic stem cells

(ESCs) and human iPSCs with 80% to 60% genomic cleavage efficiencies,

respectively. The methods described here facilitate efficient disease model

generation thereby accelerating research in the field of gene therapy and

regenerative medicine.

INTRODUCTION

Genome editing in induced pluripotent stem cells (iPSCs) has been

demonstrated to be highly effective for generating disease models for both

monogenic and complex genetic disorders. For successful genome editing

and downstream application of iPSCs, many factors need to be considered,

such as choice of growth media, extracellular matrix, genome editing tools,

and nucleic acid (NA) delivery methods. Here we have described feeder-

free culture of stem cells and a genome editing protocol that can facilitate

efficient disease model generation.

The clustered regularly interspaced short palindromic repeat (CRISPR)

system from Streptococcus pyogenes has become a powerful technology

for genome editing, and it can be used to rapidly generate engineered cell

lines and model organisms. It is a simple system comprising a catalytic unit,

Cas9, and a short noncoding guide RNA (gRNA) that confers target

specificity. It is an attractive tool for large-scale genome engineering in a

wide variety of hosts (1-3). We have developed various CRISPR-Cas9

formats that can be used to edit genomes in a wide variety of cell types,

including stem cells (4). Using these formats we have achieved greater

than 50% target-specific DNA cleavage in mouse embryonic stem cells

(ESCs) and human iPSCs and ESCs (4). The methods described here

show great potential as highly efficient gene editing tools in stem cells.

MATERIALS AND METHODS

1. Mouse ESCs culture and transfection

Mouse E14Tg2a.4 ESCs were cultured on mouse inactivated embryonic

fibroblasts (MEFs; strain ICR) in the presence of recombinant human

leukemia inhibitory factor (LIF) in mouse ESC medium. Before transfection,

cells were adapted to feeder-free conditions and maintained on plates

coated with attachment factor protein in mouse ESC–conditioned medium.

Transfection: Lipid-based delivery of CRISPR components (option 1)

DNA format: 750 ng of All-in-one OFP plasmid DNA was transfected

following Lipofectamine® 3000 Transfection Reagent user manual.

RNA format: Approximately 200 ng of in vitro–transcribed gRNA and 1 μg of

GeneArt® CRISPR Nuclease mRNA were used, 2.5 μL of Lipofectamine®

MessengerMAX™ per transfection

Protein format: For Cas9 RNP transfection, 125 ng of gRNA and 500ng of

Cas9 protein were mixed and transfected using Lipofectamine® RNAiMAX

Electroporation based delivery of CRISPR components (option 2)

1X 105 cells were resuspended in 10µl of Neon® R-buffer which was pre-

complexed with and 200 ng of in vitro transcribed guide RNA and 1µg of

Cas9 Nuclease. Best Neon electroporation conditions for RNPs: 1500V,

10ms, 3 pulse (Neon® optimization no 23).

2. Human ESCs and iPSCs transfection

Option 1: Feeder-free adaptation of iPSCs for transfection

Feeder-dependent human episomal Gibco iPSC line cultured on MEF

feeder cells (strain ICR) in human ESC medium containing 20%

KnockOut™Serum Replacement, 10 μM MEM Non-Essential Amino Acids

Solution, 55 μM 2-mercaptoethanol, and 4 ng/mL human bFGF recombinant

protein in DMEM/F12. Cells were adapted to feeder-free conditions before

electroporation and transfection

Option 2: Culturing cells in feeder-free conditions in Essential 8® Medium

Cells harvested using TrypLE™ Express Enzyme by incubating for 2–3

minutes in a 37°C humidified incubator. Single-cell suspensions were

prepared. For lipid-based transfection, a 24-well tissue culture plate coated

with Geltrex® matrix was used. Each well was seeded with approximately

0.5 x 105 cells in 500μL of Essential 8® Medium containing 10 μM ROCK

inhibitor and allowed to recover overnight.

CONCLUSIONS

• Optimized transfection/electroporation conditions in mouse ESCs and

human iPSCs/ESCs using CRISPR/Cas9 (mRNA and RNPs) that resulted in

above 50-70 % genome editing efficiencies

• Singularization of iPSCs with TrypLE™ showed higher editing efficiencies

compared to cells collected with Accutase®

• iPSCs transfected in presence of ROCK inhibitor showed higher genome

editing efficiencies

• iPSCs transfected with RNPs showed highest cell survivability

• Highest HR efficiency for SNP were obtained using CRSIPR/Cas9 (mRNA)

and ssODN

REFERENCES

1. Wang, H., Yang, H., Shivalila, C.S., Dawlaty, M.M., Cheng, A.W.,

Zhang, F. and Jaenisch, R. (2013) One-step generation of mice

carrying mutations in multiple genes by CRISPR/Cas-mediated

genome engineering. Cell 153, 910–918.

2. Kim, S., Kim, D., Cho, S.W., Kim, J. and Kim, J.S. (2014) Highly

efficient RNA-guided genome editing in human cells via delivery of

purified Cas9 ribonucleoproteins. Genome Res. 24, 1012-1019.

3. Zuris, J.A., Thompson, D.B., Shu, Y., Guilinger, J.P., Bessen, J.L., Hu,

J.H., Maeder, M.L., Joung, J.K., Chen, Z.Y. and Liu, D.R. ( 2014)

Cationic lipid-mediated delivery of proteins enables efficient protein

basedgenome editing in vitro and in vivo. Nat Biotechnol. Oct 30.

doi:10.1038/nbt.3081

4. Liang, X.,Potter, J, Kumanr, S.,Zou, Y., Quintanilla, R., Sridharan, M.,

Carte, J., Chen, W.,Roark, N., Ranganathan, S., Ravinder, N.,

Chesnut, JD. (2015) Rapid and highly efficient mammalian cell

engineering via Cas9 protein transfection. J Biotech. S0168-1656.

ACKNOWLEDGEMENTS

Rene Quintanilla, Mahalakshmi Sridharan, and Xin Yu

PRESENTERS CONTACT INFORMATION

shantanu.kumar@thermofisher.com

Thermo Fisher Scientific • 5791 Van Allen Way • Carlsbad, CA 92008 • www.lifetechnologies.com

Shantanu Kumar, Xiquan Liang, Xin Yu, Hillary Barbour, Yanfei Zou, Jason Potter, Jon Chesnut and Namritha Ravinder

Department of Synthetic Biology, Department of Cell Biology , Life Sciences Solutions, Thermo Fisher Scientific, 5791 Van Allen Way, Carlsbad, CA 92008

Highly efficient genome editing and cell engineering in stem cells using CRISPR/Cas9

1 2 3

µg Protein

SSEA4-AlexaFluor®647

Unstained Control

Cas9 mRNA Cas9 Protein

Tra

-1-6

0-

Ale

xa

Flu

or®

488

mRNA Cas9

0

10

20

30

40

50

60

1 2 3 4 5 6 7 8 9 101112131415161718192021222324

DNA

RNA

Protein

Control CRISPR

(All-in-one plasmid)

CRISPR

(IVT+ mRNA Cas9)

CRISPR

(IVT + Cas9 Protein)

Figure 4. Cell viability and pluripotency of iPSCs post electroporation

0 0 0 0

24

17

0

5

10

15

20

25

30

Control

cut % 0 0 71 83 83 0 0 58 64 58

Cas9 RNP Cas9 RNP Control

Gibco iPSCs Human H9

Band (%) 0 0 0 0 30 32 44 45 65 68

(A) Transfection of various formats of CRISPR/Cas9

(B) Electroporation of various formats of CRISPR/Cas9

Cle

av

ag

e e

ffic

ien

cy (

%)

(B) Various CRISPR/Cas9 formats ( DNA, mRNA and Protein) were electroporated into mouse ESCs

using 10 µ̂l Neon® tips. 24 different Neon® optimization conditions were tested and genomic

cleavage assay for Rosa26 locus was performed 48 hours post electroporation.

(A) Transfection of GeneArt® CRISPR Nuclease Vector with OFP reporter (DNA), GeneArt® CRISPR

Nuclease mRNA (RNA), and GeneArt™ Platinum™ Cas9 Nuclease (Protein) in mouse ESCs. DNA

transfection was performed using Lipofectamine® 3000, Cas9 mRNA with Lipofectamine®

MessengerMAX reagent, and Cas9 Nuclease with Lipofectamine® RNAiMAX. Cells were assayed

for genomic cleavage of Rosa26 locus, 48 hours post transfection.

A. B.

Neon electroporation conditions

Cle

ava

ge

(%

)

3. GeneArt® CRISPR Cas9 Formats

Cas9 mRNA

• No foot print left

behind

• No promoter

constraint

• Ready to use

• Controlled dosage

• Fast turnover

Cas9 Protein (RNP)

• No foot print left behind

• No promoter constraint

• Ready to act

• Controlled Dosage

• Fast Turnover

• Stable RNP complex

All-in-one Plasmid

• Reporter based enrichment

• Random integration concern

• Need cell specific promoter

• Relatively more off target

Before Transfection 48h Post Transfection

Cut (%) 0 0 0 0 31 35 35 50

iPSCs grown on Feeder

iPSCs grown on Geltrex®

A. B.

D.

Cle

avag

e

(%)

C.

Cle

avag

e

(%)

Cut (%) 0 0 0 0 64 66 0 20 31 62 80 89

A.

B. C.

A.

B.

ssODN - - + + - - + + - -

mod-ssODN - - - - - - - - + +

CRISPR + + + + + +

cut (%) 0 0 0 0 78 65 58 57 67 63

HR

(%

)

A.

B.

(A) CRISPR guide RNA design and ssODN for SNP change

(B) Gibco iPSCs were transfected with CRISPR/Cas9 (mRNA) and 10 pico moles of ssODN (modified

and unmodified ssODN), cleavage efficiency determined 72 hours post transfection

(C)SNP efficiency were calculated by Sanger and Ion PGM sequencing

Target Sequence GCATTTCTCAGTCCTAAACAGGGTAATGGACTGGGGCTGAATCACATGAAG

SNP Oligo ------GCATTTCTCAGTCCTAGACAGGGTAATGGACTGGGGCTGAATCACATGAAG

gRNA HPRT T1 PAM

C.

TrpLE Accutase

+ ROCK

- ROCK