High density array comparative genomic hybridisation (aCGH) for dosage analysis and rapid breakpoint...
-
Upload
jewel-jacobs -
Category
Documents
-
view
237 -
download
0
Transcript of High density array comparative genomic hybridisation (aCGH) for dosage analysis and rapid breakpoint...
![Page 1: High density array comparative genomic hybridisation (aCGH) for dosage analysis and rapid breakpoint mapping in Duchenne Muscular Dystrophy (DMD) Victoria.](https://reader035.fdocuments.in/reader035/viewer/2022081802/5697bf7b1a28abf838c8348f/html5/thumbnails/1.jpg)
High density array comparative genomic hybridisation (aCGH) for dosage analysis and rapid breakpoint mapping in Duchenne Muscular Dystrophy (DMD)
Victoria ClokeCMGS Spring ConferenceApril 2010
![Page 2: High density array comparative genomic hybridisation (aCGH) for dosage analysis and rapid breakpoint mapping in Duchenne Muscular Dystrophy (DMD) Victoria.](https://reader035.fdocuments.in/reader035/viewer/2022081802/5697bf7b1a28abf838c8348f/html5/thumbnails/2.jpg)
Overview
• High density dystrophin gene aCGH platform
• Validation
• Application to specialised testing– Complex mutations– Therapeutic exon skipping trials
![Page 3: High density array comparative genomic hybridisation (aCGH) for dosage analysis and rapid breakpoint mapping in Duchenne Muscular Dystrophy (DMD) Victoria.](https://reader035.fdocuments.in/reader035/viewer/2022081802/5697bf7b1a28abf838c8348f/html5/thumbnails/3.jpg)
Cy3 labelled patient DNA
Cy5 labelled control DNA
Principle of aCGH
![Page 4: High density array comparative genomic hybridisation (aCGH) for dosage analysis and rapid breakpoint mapping in Duchenne Muscular Dystrophy (DMD) Victoria.](https://reader035.fdocuments.in/reader035/viewer/2022081802/5697bf7b1a28abf838c8348f/html5/thumbnails/4.jpg)
High density dystrophin array
• 4x44K format array designed by Madhuri Hegde’s group at Emory University
• 16,248 unique probes for the dystrophin gene region plus their reverse compliments
Exons Introns
10bp
60bp
100bp
![Page 5: High density array comparative genomic hybridisation (aCGH) for dosage analysis and rapid breakpoint mapping in Duchenne Muscular Dystrophy (DMD) Victoria.](https://reader035.fdocuments.in/reader035/viewer/2022081802/5697bf7b1a28abf838c8348f/html5/thumbnails/5.jpg)
High density aCGH Validation
+1
-1
0
Dystrophin gene
Stage 1: Normal control vs Normal control
![Page 6: High density array comparative genomic hybridisation (aCGH) for dosage analysis and rapid breakpoint mapping in Duchenne Muscular Dystrophy (DMD) Victoria.](https://reader035.fdocuments.in/reader035/viewer/2022081802/5697bf7b1a28abf838c8348f/html5/thumbnails/6.jpg)
+7+6+5+4+3+2+1
0-1-2-3-4-5-6-7
Dystrophin exons 9 8 7 6 5 4 3 2
32.58743Mb 32.719041Mb 32.850653Mb 32.982265Mb
High density aCGH Validation
CNV in intron 2Deletion dystrophin
exons 3-7
Stage 2: Known exonic deletions and duplications
Hemizygous male deletion
![Page 7: High density array comparative genomic hybridisation (aCGH) for dosage analysis and rapid breakpoint mapping in Duchenne Muscular Dystrophy (DMD) Victoria.](https://reader035.fdocuments.in/reader035/viewer/2022081802/5697bf7b1a28abf838c8348f/html5/thumbnails/7.jpg)
31.77632Mb 31.936032Mb 32.095744Mb 32.255457Mb
Dystrophin exons 48 47 46 45 44 43 42
31.645784Mb 31.71414Mb 31.78250Mb 31.85086Mb
Dystrophin exons 52 51 50 49 48
+2
+1
0
-1
-2
+2
+1
0
-1
-2
Heterozygous deletion dystrophin
exon 45
High density aCGH ValidationStage 2: Known exonic deletions and duplications
Heterozygous female deletions and duplications
![Page 8: High density array comparative genomic hybridisation (aCGH) for dosage analysis and rapid breakpoint mapping in Duchenne Muscular Dystrophy (DMD) Victoria.](https://reader035.fdocuments.in/reader035/viewer/2022081802/5697bf7b1a28abf838c8348f/html5/thumbnails/8.jpg)
31.77632Mb 31.936032Mb 32.095744Mb 32.255457Mb
Dystrophin exons 48 47 46 45 44 43 42
31.645784Mb 31.71414Mb 31.78250Mb 31.85086Mb
Dystrophin exons 52 51 50 49 48
+2
+1
0
-1
-2
+2
+1
0
-1
-2
High density aCGH Validation31.77632Mb 31.936032Mb 32.095744Mb 32.255457Mb
Dystrophin exons 48 47 46 45 44 43 42
31.645784Mb 31.71414Mb 31.78250Mb 31.85086Mb
Dystrophin exons 52 51 50 49 48
+2
+1
0
-1
-2
+2
+1
0
-1
-2
Stage 2: Known exonic deletions and duplications
Heterozygous female deletions and duplications
Heterozygous duplication dystrophin exons 49-50
![Page 9: High density array comparative genomic hybridisation (aCGH) for dosage analysis and rapid breakpoint mapping in Duchenne Muscular Dystrophy (DMD) Victoria.](https://reader035.fdocuments.in/reader035/viewer/2022081802/5697bf7b1a28abf838c8348f/html5/thumbnails/9.jpg)
High density aCGH ValidationStage 3: Inversion samples
31.827229Mb 31.935944Mb 32. 044659Mb 32.153374Mb
+7+6
+5+4
+3+2
+1
0-1-2-3
-4-5
-6-7
Dystrophin exons 47 46 45 44
Deletions in dystrophin introns 44 and 45
Inversion Exon 45 c.6438+96064_6614+1540
![Page 10: High density array comparative genomic hybridisation (aCGH) for dosage analysis and rapid breakpoint mapping in Duchenne Muscular Dystrophy (DMD) Victoria.](https://reader035.fdocuments.in/reader035/viewer/2022081802/5697bf7b1a28abf838c8348f/html5/thumbnails/10.jpg)
IL1RAPL1
High density aCGH Validation
Dystrophin
Deletion dystrophin
Exon 52
-2-3
+6+5+4+3+2+1
0-1
-4-5-6
Stage 3: Inversion samplesInversion Exon 53 –> 79
3’ deletion including 11 genes
+7
-7
![Page 11: High density array comparative genomic hybridisation (aCGH) for dosage analysis and rapid breakpoint mapping in Duchenne Muscular Dystrophy (DMD) Victoria.](https://reader035.fdocuments.in/reader035/viewer/2022081802/5697bf7b1a28abf838c8348f/html5/thumbnails/11.jpg)
High density aCGH ValidationStage 3: Inversion samplesInversion Ex62 c.9164-10300_c.9224+12600
31.183465Mb 31.217965Mb 31.252466Mb 31.286967Mb
+7+6
+5+4
+3+2
+1
0-1-2-3
-4-5
-6-7
+7+6
+5+4
+3+2
+1
0-1-2-3
-4-5
-6-7
Dystrophin exons 63 62 61
Intron 62 deletion
![Page 12: High density array comparative genomic hybridisation (aCGH) for dosage analysis and rapid breakpoint mapping in Duchenne Muscular Dystrophy (DMD) Victoria.](https://reader035.fdocuments.in/reader035/viewer/2022081802/5697bf7b1a28abf838c8348f/html5/thumbnails/12.jpg)
Applications of high density dystrophin aCGH
Finding mutations in MLPA and point mutation negative patients
Dystrophin
Exon 44
![Page 13: High density array comparative genomic hybridisation (aCGH) for dosage analysis and rapid breakpoint mapping in Duchenne Muscular Dystrophy (DMD) Victoria.](https://reader035.fdocuments.in/reader035/viewer/2022081802/5697bf7b1a28abf838c8348f/html5/thumbnails/13.jpg)
Applications of dystrophin high density aCGH
• Difficulties in exon skipping for duplications—Orientation —Structure—Position of breakpoints
• Dystrophin aCGH study of 25 duplications—Structure of duplications—Rapid breakpoint mapping—Understanding how dystrophin duplications arise
Informing a exon skipping trial targeting duplications
![Page 14: High density array comparative genomic hybridisation (aCGH) for dosage analysis and rapid breakpoint mapping in Duchenne Muscular Dystrophy (DMD) Victoria.](https://reader035.fdocuments.in/reader035/viewer/2022081802/5697bf7b1a28abf838c8348f/html5/thumbnails/14.jpg)
Duplication of dystrophin exons 17-45
Duplication aCGH results
31.741906Mb 32.04018Mb 32.33846Mb 32.63674Mb
+2
+1
-1
-2
+2
+1
-1
-2
0
Dystrophin exons 50 - 46 45 44 - 17 16 - 8
31.692239Mb 31.698543Mb 31.704848Mb 31.711153Mb
+2
+1
-1
-2
+2
+1
-1
-2
0
Dystrophin exons 51
Duplication of dystrophin exon 51
+1
![Page 15: High density array comparative genomic hybridisation (aCGH) for dosage analysis and rapid breakpoint mapping in Duchenne Muscular Dystrophy (DMD) Victoria.](https://reader035.fdocuments.in/reader035/viewer/2022081802/5697bf7b1a28abf838c8348f/html5/thumbnails/15.jpg)
Duplication breakpoint mapping
31.692239Mb 31.698543Mb 31.704848Mb 31.711153Mb
+2
+1
-1
-2
+2
+1
-1
-2
0
Dystrophin exons 51
1 2 3 4 5 2 5 63 42 5 Exon 51 Exon 511 2 3 4 5 2 5 63 42 51 2 3 4 5 2 5 63 42 5
![Page 16: High density array comparative genomic hybridisation (aCGH) for dosage analysis and rapid breakpoint mapping in Duchenne Muscular Dystrophy (DMD) Victoria.](https://reader035.fdocuments.in/reader035/viewer/2022081802/5697bf7b1a28abf838c8348f/html5/thumbnails/16.jpg)
Breakpoint sequencing results
• Ease of breakpoint mapping– 15/25 breakpoints (60%) needed just one round of PCR
and sequencing
• 20/25 (80%) central breakpoints amplified and sequencedTandem orientation
![Page 17: High density array comparative genomic hybridisation (aCGH) for dosage analysis and rapid breakpoint mapping in Duchenne Muscular Dystrophy (DMD) Victoria.](https://reader035.fdocuments.in/reader035/viewer/2022081802/5697bf7b1a28abf838c8348f/html5/thumbnails/17.jpg)
Breakpoint sequencing results32775529 atgggaggcatgtatactatagaacagaaattttagtattctactcagaagc 32775478 <<<<<<<< ||||||||||||||||||||||||||| || | || | ||| | <<<<<<<< atgggaggcatgtatactatagaacagggatctaggttgtgtgctccttatg <<<<<<<< | | | ||||||||||||||||||||||||||| <<<<<<<< 32850655 aaccctattgtgacctgcgcatgcgagggatctaggttgtgtgctccttatg 32850604 32323093 catgaagatgataaatacttatgttaatatgattaggagatggaattaatta 32323042 <<<<<<<< |||||||||||||||||||||||| | | | | | <<<<<<<< catgaagatgataaatacttatgtattttaaaaaccggctttgttaagcaat <<<<<<<< | || | |||||||||||||||||||||||| <<<<<<<< 32462155 gtattttgttatgtaagtgctagctgactaaaaaccggctttgttaagcaat 32462105
attaaggatctgtgtgagattctgctggatggtgtagattttcttgaaaa ||||||||||||||||||||||||| | | | | || attaaggatctgtgtgagattctgcataaattcagcttatgttaaggaag | | || ||||||||||||||||||||||||| ggcttttgtgttacattgaacagagataaattcagcttatgttaaggaag
Intron 7
Duplication sequence
Intron 2
Intron 30
Intron 17
Duplication sequence
Intron 1
Intron 4
Duplication sequence
Microhomology
1-4 nucleotides
14/20 (70%)
Small insertion
1-4 nucleotides
4/20 (20%)
Clean breakpoint
2/20 (10%)
gtattcagaaacttaaatagccatataatacatattttggagcatgtcagaa |||||||||||||||||||||||||||| | || ||| | gtattcagaaacttaaatagccatataagaattaactgtttgcacaatctac || | | || |||||||||||||||||||||||||||| tctaacacatgcaattttaagaggataagaattaactgtttgcacaatctac
![Page 18: High density array comparative genomic hybridisation (aCGH) for dosage analysis and rapid breakpoint mapping in Duchenne Muscular Dystrophy (DMD) Victoria.](https://reader035.fdocuments.in/reader035/viewer/2022081802/5697bf7b1a28abf838c8348f/html5/thumbnails/18.jpg)
• Genomic DNA: Duplication Exons 3-37 • Breakpoint close to exon 37
• RNA level: Duplication Exons 3-36
Duplication study
Exon 37
13bp
Exon 36 Exon 3Exon 36 Exon 3
Exon 4-37 Exon 38->Exon 1-2 Exon 3-35
Comparison with RNA results
![Page 19: High density array comparative genomic hybridisation (aCGH) for dosage analysis and rapid breakpoint mapping in Duchenne Muscular Dystrophy (DMD) Victoria.](https://reader035.fdocuments.in/reader035/viewer/2022081802/5697bf7b1a28abf838c8348f/html5/thumbnails/19.jpg)
Duplication study
• Non-allelic homologous recombination (NAHR)– Lack of homology between breakpoints
• 34% - 48% (mean 42%) sequence identity• No shared repetitive element homology
• Non-homologous recombination (NHR)– Simple tandem structure– Non-recurrent breakpoints– Microhomology and insertions
DNA repair mechanism such as non-homologous endjoining (NHEJ) Replication based mechanism such as fork stalling and template
switching (FoSTeS)
Understanding the mechanism of duplications
E.g.
![Page 20: High density array comparative genomic hybridisation (aCGH) for dosage analysis and rapid breakpoint mapping in Duchenne Muscular Dystrophy (DMD) Victoria.](https://reader035.fdocuments.in/reader035/viewer/2022081802/5697bf7b1a28abf838c8348f/html5/thumbnails/20.jpg)
• Array CGH vs MLPA
• Array CGH as a specialist test– Solving difficult cases– Rapid breakpoint mapping e.g. to Inform therapeutic
strategies
Conclusions
High Density aCGH MLPA
Consumable Cost £178 £40
Information provided 44K probes Limited to ~1 probe/exon
Reliability Multiple 60nucleotide probes/aberration
Risk of false positives
Flexibility Custom design Limited kit availability
![Page 21: High density array comparative genomic hybridisation (aCGH) for dosage analysis and rapid breakpoint mapping in Duchenne Muscular Dystrophy (DMD) Victoria.](https://reader035.fdocuments.in/reader035/viewer/2022081802/5697bf7b1a28abf838c8348f/html5/thumbnails/21.jpg)
Acknowledgements
• Dr Steve Abbs• Dr Michael Yau• Jo McCauley• Dr Joo Wook Ahn
• Prof Francesco Muntoni• Jihee Kim
• Dr Madhuri Hegde• Ephrem Chin