Heat Pretreatment Alleviates UV-B Toxicity in the CyanobacteriumAnabaena doliolum: A Proteomic Analysis of Cross Tolerance

Yogesh Mishra, Neha Chaurasia and Lal Chand Rai*

Molecular Biology Section, Laboratory of Algal Biology, Center of Advanced Study in Botany, Banaras HinduUniversity, Varanasi, India

Received 12 July 2008, accepted 28 August 2008, DOI: 10.1111 ⁄ j.1751-1097.2008.00469.x

ABSTRACT

This study offers proteomic elucidation of heat pretreatment-

induced alleviation of UV-B toxicity in Anabaena doliolum.

Heat-pretreated cells exposed to UV-B showed improved activity

of PSI, PSII, whole chain, 14C fixation, ATP and NADPH

contents compared to UV-B alone. Proteomic analysis using

two-dimensional gel electrophoresis (2-DE), MALDI-TOF MS/

MS and reverse transcription polymerase chain reaction (RT-

PCR) of UV-B and heat pretreatment followed by UV-B–treated

cells exhibited significant and reproducible alterations in nine

proteins homologous to phycocyanin-a-chain (PC-a-chain), phy-

coerythrocyanin-a-chain (PEC-a-chain), hypothetical protein

alr0882, phycobilisome core component (PBS-CC), iron super-

oxide dismutase (Fe-SOD), fructose-1,6-bisphosphate aldolase

(FBA), nucleoside diphosphate kinase (NDPK), phosphoribulo-

kinase (PRK) and ribulose-1,5-bisphosphate carboxylase/

oxygenase (RuBisCo) large chain. Except the PEC-a-chain,

hypothetical protein alr0882 and PBS-CC, all other proteins

showed upregulation at low doses of UV-B (U2) and significant

downregulation at higher doses of UV-B (U5). The disruption of

redox status, signaling, pentose phosphate pathway and Calvin

cycle appears to be due to the downregulation of Fe-SOD,

NDPK, FBA, PRK and RuBisCo thereby leading to the death of

Anabaena. In contrast to this, the upregulation of all the above

proteins in heat-pretreated cells, harboring different heat shock

proteins (HSPs) like 60, 26 and 16.6, followed by UV-B

treatment than only the UV-B–treated ones suggests a protective

role of HSPs in mitigating UV-B toxicity.

INTRODUCTION

Present-day anthropogenic activities are causing majorchanges in the atmospheric chemistry and the climate whichlead to an increase in the concentration of green house gases(carbon dioxide, methane, nitrous oxide, chlorofluoro-

carbons), thereby an increase in UV-B radiation and averagetemperature of the earth (1), thus adversely affecting thesurvival of living organisms including cyanobacteria. Thus,

study of the effect of UV-B and temperature on the organismsof the tropical countries assumes greater significance.

Anabaena doliolum, a predominant diazotroph in the ricefields of Varanasi (2), is frequently exposed to elevated levels ofheat and UV-B stress. The damaging effects of UV-B on

cyanobacteria are well documented. For instance, UV-Bradiation is known to impair various metabolic processesincluding photosynthesis (3), pigmentation, CO2 uptake (4,5),

ribulose-1,5-bisphosphate carboxylase ⁄ oxygenase (RuBisCo)activity (6), inactivation of photosystem II (PSII) reactioncenter, degradation of light-harvesting proteins (7) and inhi-bition of enzymes of nitrogen metabolism (8) resulting in

decreased growth and survival. In addition to the above, UV-Bdamages essential macromolecules like DNA, lipids andproteins either directly or indirectly by enhanced production

of reactive oxygen species (ROS) (9). While heat damages thecellular membrane, it blocks metabolic pathways leading toprotein denaturation and aggregation (10). Sublethal heat

treatment has been found to offer cross tolerance to differentabiotic stresses such as salt (11), toxic metals (12) and oxidativeinjury (13). Further, overexpression of small heat shockprotein sHSP 17.7 has been reported to confer tolerance to

UV-B stress in rice (14). Nevertheless, temperature-inducedheat shock proteins (HSPs) have also been reported to protectcultured human keratinocytes from UV-B toxicity (15).

Similarly, preliminary studies conducted on heat pretreatment(48�C) followed by UV-B demonstrated induction of anti-oxidative defense system (16) in A. doliolum. This study

suggested that heat pretreatment offers protection against thedamaging effect of UV-B. Despite rampant cross protectionobserved in diverse organisms, the exact mechanism behind

this has remained unexplored. However, overexpression ofHSPs and antioxidative enzymes is believed to have a role inthe acquisition of cross tolerance.

Proteins are primary effector molecules of all living systems

and therefore adaptive response to abiotic stresses will bereflected by alterations in their location and concentration (17)and proteomics has emerged as the tool of choice to view the

overall metabolic events occurring in the cell. Two-dimen-sional polyacrylamide gel electrophoresis (2-D PAGE) com-bined with mass spectrometry (MS) reliably mirrors proteomic

changes occurring in the cell and has been successfully appliedto Synechocystis sp. strain PCC 6803 against UV-B and whitelight (18), Nostoc commune subjected to UV-B (19), Synecho-cystis to heat (20), A. doliolum to copper and UV-B (21–23)

and Nostoc punctiforme grown in nitrogen-deficient medium(24). All the above studies have focused on the impact of a

*Corresponding author email: lcraibhu@gmail.com, lcrai@bhu.ac.in(Lal Chand Rai)

� 2008TheAuthors. JournalCompilation.TheAmericanSociety of Photobiology 0031-8655/09

Photochemistry and Photobiology, 2009, 85: 824–833

824

single stress; no effort appears to have been made to analyzecyanobacterial response to heat pretreatment followed byUV-B at the proteome level.

Keeping in mind that UV-B inhibits various physiological

processes like PSI, PSII, CO2 uptake, RuBiSco (6,18),phosphoribulokinase (PRK) activity, and regeneration ofNADPH (25), induction of PSI, PSII RuBisCo, PRK and

FBA (fructose-1,6-bisphosphatase aldolase) is hypothesized inheat-pretreated cells exposed to UV-B. Further, in view of theUV–B-induced oxidative stress and ROS production (22,26)

overexpression of Fe-SOD, dimerization of NDPK, a signalingmolecule into its inactive form (27), is also hypothesized. Totest the above hypotheses and to decipher the molecular basis

of alleviation of UV-B toxicity by heat pretreatment theproteome of A. doliolum was examined and the proteinexpression attested at the transcript level.

MATERIALS AND METHODS

Organism and growth conditions. Anabaena doliolum Bharadwaja, afilamentous N2-fixing cyanobacterium, was grown axenically inmodified Allen and Arnon (28) medium buffered with 4-(2-hydroxy-ethyl)-1-piperazine-ethanesulfonic acid (HEPES) buffer (1.2 g L)1),pH 7.5 at 24 ± 2�C under day light fluorescent tubes emitting aphoton flux of 72 lmol m)2 s)1 photosynthetically active radiation(PAR) light intensity with a photoperiod of 14:10 h. The cultures weregrown in Erlenmeyer flasks of 250 mL capacity containing 100 mLculture medium and shaken by hand two to three times daily. Theflasks were plugged with nonabsorbent cotton. All experiments wereperformed using exponentially growing cultures.

Mode and source of UV-B radiation. The UV-B radiation was givenby a UV-B lamp (CAT No. 34408; Fotodyne, Inc.) giving its maximumoutput at 312 nm as provided by the manufacturer (see SupplementaryFig. 1). The UV lamp was wrapped with a collar of 0.13 mm cellulosediacetate film (Johnston Industrial Plastics, Toronto, Canada; UVcutoff at ca 292 nm) to cut off the UV-C radiation. Ambasht andAgarwal (29) have reported a daily UV-B dose of 9.6 kJ m)2 in thenatural environments of Varanasi under clear sky during summer. Thisdose was obtained by adjusting the distance between the UV-B sourceand the sample. The UV-B irradiance was measured with a Black-RayJ-221, Longwave Ultraviolet Intensity meter (UVP, Inc., San Gabriel,CA). UV-B irradiation to the culture suspension was given in completedarkness in 75 mm sterile petri dishes (in triplicate) with their lidsremoved. The suspension was gently agitated by a magnetic stirrerduring irradiation. Samples were withdrawn at desired intervals forperforming different experiments. The cyanobacterial cells exposed toUV-B for 0–1 h were withdrawn at regular intervals and plated ontoagar (Difco 0560; Difco Laboratories, Detroit, MI) plates. Cyanobac-terial colonies were counted after 15 days and survival was scored asper the method of Rai and Raizada (30). Approximately 50 (LC50)and no survival (LC100) of the test cyanobacterium was observed,respectively, after 20 and 50 min of UV-B exposure.

Heat shock treatments. The exponentially growing cells of A. dolio-lum (OD 0.5) were shifted to temperature-controlled incubator for heattreatment under continuous light of 72 lmol photon m)2 s)1 PARprovided by fluorescent lamps throughout the heat treatment. Thedoses selected for temperature treatment were LC25, LC50, LC75 andlethal, which were 43�C (T1), 48�C (T2), 53�C (T3) and 58�C (T4),respectively, after 1 h exposure at each temperature. These wereobtained by colony count method of Rai and Raizada (30). In the caseof pretreatment experiments the test cyanobacterium was subjected to48�C for 1 h followed by a known dose of UV-B.

Experimental design. The entire study was performed in two parts:(A) for preliminary investigation of cross tolerance, growth behaviorand pigment contents of Anabaena was investigated by subjecting it to10 (U1), 20 (U2), 30 (U3), 40 (U4) and 50 (U5) min of UV-B exposurealone as well as cells pretreated at 48�C for 1h followed by exposure toUV-B for the above mentioned time durations. Further, certainphysiological parameters were also measured when Anabaena was

subjected to 48�C (T2 here after T) for 1 h. In the second part (B)physiological attributes and proteomic changes were investigatedfollowing exposure of cyanobacterium to UV-B for 20 (U2) and 50(U5) min (LC50 and lethal dose, respectively) and also in cellspretreated at 48�C for 1 h because it caused maximum induction of thetested HSPs (Y. Mishra, P. Bhargava, N. Chaurasia and L. C. Rai,unpublished) and then subjected to 20 (U2) and 50 (U5) min of UV-Btreatment, respectively. All the experiments were conducted in tripli-cate and repeated at least twice to confirm the reproducibility of theresults. For the present investigation Anabaena never exposed to UV-Band heat was taken as the control.

Growth measurement. Growth was estimated by measuring theoptical density of the cyanobacterial cultures at 663 nm in a UV ⁄VISspectrophotometer (Systronics, India) on every third day up to day 15by using reference blank of basal culture medium.

Chlorophyll and carotenoid estimation. For extraction of photosyn-thetic pigments a known volume of cyanobacterial culture wascentrifuged and the pellet suspended in a desired volume of acetone(80%). After overnight incubation at 4�C the suspension was centri-fuged at 2348 g and the optical density was recorded with the help of aspectrophotometer at 663 and 480 nm for chlorophyll a and caroten-oid, respectively. The total amount of chlorophyll and carotenoid wascalculated using the specific absorption coefficient as described byMyers and Kratz (31).

Measurement of photosynthetic electron transport chain. Electrontransport activities were measured according to the methods describedby Lien (32) and Tripathy and Mohanty (33). A cell-free thylakoidmembrane was prepared by sonication (32). The activities weredetermined by three basic assays. For this, freshly isolated thylakoidmembranes were added to the different reaction mixtures to a finalconcentration of 10 lg mL)1 Chl. First, electron transport throughPSIIwas determined by dichlorophenolindophenol (DCPIP)-supported O2

evolution monitored polarographically by an O2 electrode (digitaloxygen system model-10; Rank Brothers, UK). A 3 mL reactionmixture for O2 evolution consisted of 3 mMM MgCl2, 10 mMM NaCl,400 lMM DCPIP and 50 mMM HEPES–NaOH buffer (pH 7.0). In thesecond type of assay, the whole chain electron transport, i.e. from H2Otomethyl viologen (MV) was measured polarographically as O2 uptake.A 3 mL assay medium contained 50 mMM HEPES, 10 mMM NaCl, 2 mMM

NH4CI, 3 mMM MgCl2, 1.0 mMM sodium azide and 0.5 mM MV adjustedat pH 7.5. In the third type of assay, the electron transport through PSIwas also measured polarographically as above except that reducedDCPIP was used as the electron donor. Assay conditions were identicalto those of whole chain assay except that 10 lMM DCMU (3-(3,4-dichlorophenyl)-1,1-dimethylurea), 1 mMM sodium ascorbate and 100 lMM

DCPIP were added to the above reaction mixture.Carbon fixation, NADPH ⁄NADH and ATP content. Carbon fixa-

tion was measured by recording the uptake of 14C from NaH14CO3 (spactivity 18.5 · 105 Bq) as described in Rai and Raizada (30). A 0.2 mLNaH14CO3 solution was added to 1 mL cyanobacterial culture andkept in light (72 lmol photon m)2 s)1 PAR) for 2 h. The reaction wasstopped by adding 0.2 mL 50% acetic acid and bubbling with air for5 min followed by the addition of 5 mL scintillation cocktail. Countingwas performed in a Beckmanmodel LS6500 liquid scintillation counter.

NADPH ⁄NADH level of the cell extract in Tris-Cl (pH 8.0) wasmeasured by recording absorbance at 340 nm at room temperatureusing a Hitachi (F 3000) spectrophotometer. NADPH ⁄NADH contentwas calculated with the help of a standard curve (34). The size of theATP pool was measured using the method of Larson and Olsson (35).Control and treated cells incubated for a known period werewithdrawn, centrifuged and treated with trichloroacetic acid (TCA).The sample was diluted with Tris buffer to a final TCA concentrationof <0.01%. The ATP content was measured by the Luciferin-Luciferase assay using an LKB 1250 luminometer.

Statistical analysis. Results were statistically analyzed using a one-way ANOVA, followed by Duncan’s new multiple range tests andcorrelation coefficients (r). P < 0.05 was used for determiningsignificant differences. The number of independent variables for eachexperiment was three.

Protein isolation for 2-DE. Protein extraction was performed using amodified protocol given in Wagner et al. (36). Anabaena cells harvestedby centrifugation were washed with Tris buffer (pH 8.0) and suspendedin 5.0 mL extraction buffer containing 10 mMM Tris-HCl (pH 8.0),1.5 mMM MgCl2 and 10 mMM KCl. Cells were then grounded under liquid

Photochemistry and Photobiology, 2009, 85 825

nitrogen followed by centrifugation at 9391 g for 1 h. The supernatantso obtained was treated with 10% TCA in acetone in the ratio of 1:10(vol ⁄ vol) left overnight to ensure complete protein precipitation, andcentrifuged at 6010 g for 15 min to recover the protein pellet.Additional washing with acetone was made to remove TCA. Thepellet was air dried and suspended in sample loading buffer containing8 MM urea, 2% CHAPS, 1% DTT (DL-dithiothreitol) and 0.8%ampholyte (pH 5–7). This suspension was again centrifuged to removeany undissolved material and then passed through a Sephadex G-25column to remove residual salt if any. This was then used for 2-DEanalysis.

Two-dimensional gel electrophoresis. 2-DE was performed as per themethod of O’Farrell (37) with slight modification using PROTEAN IIxi Cell (Bio-Rad). Isoelectric focusing was carried out in 15 · 1.5 mmvertical glass tubes with 4.5% T gels containing 5% carrier ampholyte(four parts pH 3–10 and one part pH 5–7). This was given a prerun for190 V h as follows: 200 V 15 min, 300 V 30 min and 400 V 30 min.The tubes were subsequently washed and loaded with samplescontaining 50 lg protein. Isoelectric focusing was conducted overnightfor a total of 14 000 V h. The tubes were extruded using an extrusionneedle and equilibrated first in sample loading buffer containing 2%SDS, 50 mMM Tris (pH 6.8), 6 MM urea, 30% glycerol, 0.002% brom-ophenol blue and 1%DTT followed by 2.5% 2-iodoacetamide (insteadof 1% DTT) for 15 min each. The gel was then loaded onto the seconddimension having 12% T resolving gels and 4% T stacking gels (2 cmheight). Electrophoresis was performed at 20 mA constant current for12 h. Protein spots were characterized using a broad range molecularmarker protein (Sigma) coelectrophoresed alongside the seconddimension gel. After migration the gels were stained with Coomassiebrilliant blue R-250 (CBB).

Analysis of data. Protein spots were analyzed for differentialexpression using PD Quest software version 7.1 (Bio-Rad). Thissoftware was used with appropriate selection of the faintest and thesmallest spots and a large representative section of the imagecontaining spots, streaks and background gradations to make correc-tions for noise filter. For identification of the differentially expressedprotein spots, three replicate CBB-stained gels of each of thetreatments were first matched with each other and merged to generate‘‘master gels.’’ Finally, a matchset containing the different master gelsrepresenting the different treatments was created and spot detectionand matching carried out. Subsequently, the matched spots of themaster gel images were extended to each of the corresponding gel

images included in the analysis. Spot intensities were calculated andnormalized by determining the relative intensity of each spot (%volume) by dividing the intensity of each spot by the sum of theintensities of all spots on the corresponding gel. Induction ⁄ repressionratios of proteins were evaluated with MS Excel. LSD was used todetermine whether the averages of the samples were significantlydifferent using the SPSS software.

Nine protein spots showing significant and reproducible changeswere selected and subjected to matrix-assisted laser desorption ⁄ionization time of flight mass spectrometry (MALDI-TOF MS ⁄MS)analysis followed by homology search using MASCOT on commercialbasis from The Center for Genomic Application, New Delhi,India. The identification results from MALDI-TOF MS are given inTable 3.

RNA isolation and DNase treatment. RNA was isolated frommidexponential phase cells using the TRIzol reagent as per theinstructions given in the manufacturer’s protocol. RNA was isolatedfrom cells cultivated under the same set of conditions as previouslyused for 2-DE. Briefly, the cyanobacterial pellet was ground in liquidnitrogen and RNA extracted in TRIzol. After centrifugation at12 000 g for 15 min at 4�C, the upper aqueous layer containing RNAwas removed and placed in a new centrifuge tube. 0.5 mL of isopropylalcohol per 1 mL of TRIzol was used to precipitate RNA. Thissuspension was centrifuged at 12 000 g for 8 min at 4�C, the pellet waswashed with 75% ethanol and resuspended in 50 lL DEPC-treatedwater. Forty units of RNase free DNase was added to remove anycontaminating DNA followed by heating at 70�C for 5 min todenature the DNase. The quality of RNA was checked on a 1.0%agarose gel and the concentration determined by measuring theabsorbance at 260 nm.

Primer design. The protein gene-specific primers were designedusing the PRIMER 3 software and Anabaena sp. PCC 7120 as thereference strain. The sequences of the primers are given in Table 1. Theaccuracy of the primers was tested using genomic DNA of the testcyanobacterium as positive control.

RT-PCR of selected protein genes. All RNA samples were diluted toa concentration of 3 lg mL)1 prior to RT. In a clear nuclease free0.2 mL microcentrifuge tube 1 lL of 10 mMM dNTP mix, 1 lL RNAtemplate and 6 lL of nuclease free water was mixed gently andincubated at 70�C for 10 min to remove any secondary structure ofRNA. This was now placed on ice. Fifteen units of M-MLV reversetranscriptase (Sigma Chemical Company) was added along with the RT

Table 1. Oligonucleotides used for RT-PCR in this study.

S. no. Protein Gene Primers

Annealingtemperature

(�C)

Expectedproductsize (bp)

1 16s rRNA Rrn1 16 S rDNA F: CGCACGGGTGAGTAACGCGTG AR:GACTACTGGGGTATCTAATCCCATT

54 500

2 Phycocyanin-a chain alr0529 F:AATGTTGTTAAAGAAGGCAACAAACR:GTAACGCAAGATGATTTCCATGT

51 192

3 Phycoerythrocyanin-a- chain alr0524 F:ATGAGTGGGCCTCAATATGCR:TCACCTGCAACATCACCATT

49 242

4 Hypothetical protein. alr 0882 alr0882 F. AATTGTCTTCTCGCCCAATGR. AGGTTTTACCACGCAAATCG

55 192

5 Phycobilisome core component alr0534 F.GCAGCCAAGGTTTACATGGTR.AGAAGTACGGGCGCTGTAGA

52 209

6 Iron superoxide dismutase alr2938 F: GGAACCACTACCCTACGACTTTAATR: TCTAAGGATTTATCAGCCAATTCTG

51 150

7 Fructose-1,6- bisphosphate aldolase alr4563 F.GTCAATGTTACCCGCGAAGTR.CCGATAGCTACAGCCAAAGC

51 221

8 Nucleoside diphosphate kinase alr3402 F:CCATTCTTTCCTAGCTTAGTGGAATR:TGACTAATTCTGCATCTGTAAACCA

49 247

9 Phosphoribulokinase alr2350 F: TGACTAATGGTAGTTCTGTGTCAGCR:GTAACTTTGTAGTGTTTCGCCAGTT

49 227

10 RuBisCo large chain alr4641 F: ATTTCCAAATAGCAACCAATTATCAR: CAATAAAGTTCGGTAGGTTCAGAAA

49 189

F, forward; R, reverse.

826 Yogesh Mishra et al.

buffer and 10 pmol reverse primer of each gene (Table 1). The finalvolume was adjusted to 20 lL with nuclease-free water. The reactionmixture was incubated at 25�C for 5 min followed by 37�C for 50 min.To test the purity of the cDNA control reaction mixtures were preparedin the same way as mentioned above except that M-MLV RT was notadded.

To ascertain the equal concentration of RNA in the differentsamples RT-PCR of 16S rRNA was also performed (Fig. 3B). Toallow relative quantification of the protein genes, preliminary exper-iments were carried out with stepwise reduction of the number of PCRcycles to determine the maximum cycle number where samples do notreach an amplification plateau. For amplification of the differentgenes, 1 lL of the RT reaction product was used in subsequent PCR.PCR was performed in 25 lL final volume of reaction mixturecontaining 100 ng of cDNA, 2.5 lL of 10· PCR buffer with 15 mMM

MgCl2, 200 lMM dNTPs, 10 pmol of each primer and 0.2 U Taq DNApolymerase (Bangalore Genei, India) in an Icycler (Bio-Rad). TheIcycler profile was as follows: initial denaturation for 5 min at 94�Cfollowed by 40 incubation cycles each consisting of 1.5 min denatur-ation at 94�C, 1 min annealing at temperatures given in Table 1, 2 minelongation at 72�C and a final 10 min elongation at 72�C. Theintensities of the RT-PCR products on agarose gels were quantifiedwith the Gel Doc 2000 system and the volume tool of Quantity onesoftware (Bio-Rad).

RESULTS

Growth behavior and electron transport chain

The exposure of cells to different durations of UV-B produced

a continuous decline in the growth of the test organism. Incontrast to this, a mild decline in growth of the temperature-pretreated cells exposed further to UV-B was observed(Fig. 1A,B). Table 2 presents data showing significant

(P < 0.05) decline in all the three components of the electrontransport chain ofAnabaena subjected to heat and UV-B alone.Except PSI, PSII and whole chain registered a decline of 13.7%

and 21.51% in their activity at 48�C after 1 h. Similarly thisdecrease was 4.3% and 10.0% in PSI, 18.7% and 53.7% in PSIIand 37.5% and 53.4% in whole chain activity after 20 and

50 min of UV-B exposure, respectively. In contrast to the abovePSI, PSII and whole chain registered increase in activity by18.7% and 11.5% in PSI, 25.0% and 11.2% in PSII and 25.0%and 11.36% in whole chain in temperature pretreated followed

by UV–B-treated cells, respectively, compared with the control.

Chlorophyll a and carotenoid content. Chlorophyll a showedsignificant (P < 0.05) decrease in content with increase in

exposure time of UV-B. A decrease of 78% was noticed after50 min of UV-B exposure. In contrast, the decrease was not asmuch in temperature pretreated followed by UV-B–treated

cells. In temperature-pretreated cells, only 25% reduction inchlorophyll content was noticed after 50 min of UV-Bexposure (Fig. 2A). Furthermore, carotenoid showed dose-

dependent increase in its content, e.g. 1.9, 2.9 3.0, 3.1, 3.2-foldafter 10 (U1), 20 (U2), 30 (U3), 40 (U4) and 50 (U5) min UV-Bexposure alone. However, in heat pretreatment followed byUV-B this increase was 2.31, 3.2, 3.38, 3.74 and 3.96-fold over

control in TU1, TU2, TU3 TU4 and TU5, respectively(Fig. 2B). The carotenoid ⁄ chlorophyll a ratio showed a dose-dependent increase after UV-B exposure. In contrast to the

above, this ratio decreased significantly (P < 0.05) in a dose-dependent manner in temperature-pretreated cells followed byUV-B–treated cells (Fig. 2C).

Carbon fixation, NADPH ⁄NADH and ATP contents. Datapertaining to carbon fixation, NADPH ⁄NADH and ATPcontent of control, heat, UV-B and heat pretreated followed

by UV-B–treated cells are presented in Table 2. All the aboveparameters revealed a significant (P < 0.05) decrease in theircontent when exposed to 48�C (T) for 1 h, 20 (U2) and 50 (U5)

min. A decline of 32.2%, 27.1% and 35.8% was recorded incarbon fixation, NADPH ⁄NADH and ATP contents followingexposure of Anabaena at 48�C for 1 h. A reduction of 23.0%

and 47.2% in carbon fixation, 13.7% and 24.8% in NADPH ⁄NADH content and 10.7% and 11.9% in ATP content wasrecorded after 20 and 50 min of UV-B exposure. However, allthe above parameters showed an increase in their content in

temperature-pretreated cells followed by UV–B-exposed cells.This increase was 27.7% and 15.3% in carbon fixation, 8.9%and 3.5% in NADPH ⁄NADH and 12.2% and 8.3% in ATP

content after TU2 and TU5 treatment, respectively.

Protein expression profile in response to UV-B and heatpretreatment followed by UV-B. A total of 215, 201, 178, 226

and 170 spots were clearly visible, in the control, U2, U5, TU2and TU5-treated Anabaena, respectively. Out of the 215 spotsin control (as revealed by PD quest) 55, 39, 64 and 32 were

found to be similar to those in U2, U5, TU2 and TU5-treated

Figure 1. Growth behavior of Anabaena doliolum subjected to UV-B(A) and heat followed by UV-B stress (B) where C = control,U1 = 10, U2 = 20, U3 = 30, U4 = 40 and U5 = 50 min of UV-B exposure and TU1, TU2, TU3, TU4 and TU5 stand for 48�Ctemperature for 1 h followed by 10, 20, 30, 40 and 50 min of UV-Btreatment. Error bars indicate SE.

Photochemistry and Photobiology, 2009, 85 827

Anabaena, respectively (Fig. 4). A total of nine proteinsdepicting significant and reproducible changes were subjected

to MALDI-TOF MS ⁄MS analysis followed by MASCOTsearch (Table 3). These proteins demonstrated close homologyto phycocyanin-a-chain (PC-a-chain), phycoerythrocyanin-T

able

2.PSI,PSII

andwhole

chain

electrontransport

activity,14C

uptake,

ATPandNADPH

⁄NADH

contents

ofcontrol,T,U2,U5,TU2andTU5-treatedAnabaenadoliolum.

Control

TU2

U5

TU2

TU5

PSIactivity(lmolO

2

consumed

mg

)1

protein

min

)1)

1.39±

0.05

1.51±

0.04(8.6)

1.33±

0.03*()4.3)

1.25±

0.04*()10.0)

1.65±

0.03*(18.7)

1.55±

0.02*(11.5)

PSII

activity(lmolO

2

evolved

mg

)1

protein

min

)1)

0.80±

0.02

0.69±

0.01*()13.7)

0.65±

0.02*()18.7)

0.37±

0.01*()53.7)

1.0

±0.01*(25.0)

0.89±

0.01*(11.25)

Whole

chain

(O2

evolved

mg

)1

protein

min

)1)

0.88±

0.003

0.69±

0.02*()21.51)

0.55±

0.002*()37.5)

0.41±

0.01*()53.4)

1.1

±0.01*(25.0)

0.98±

0.02*(11.36)

14C

uptake

(CPM

·103)

9.1

±0.36

6.15±

0.67*()32.2)

7.0

±0.53*()23.0)

4.8

±0.66*()47.2)

11.6

±0.01*(27.4)

10.5

±0.17*(15.3)

lgATPmg

)1

protein

8.03±

0.36

5.85±

0.01*()27.1)

7.17±

0.01*()10.7)

7.07±

0.01*()11.9)

9.01±

0.02*(12.2)

8.7

±0.07*(8.3)

lgNADPH

mg)1

protein

1.45±

0.10

0.98±

0.02*()32.4)

1.25±

0.03*()13.7)

1.09±

0.02*()24.8)

1.58±

0.02*(8.9)

1.50±

0.01*(3.5)

Allvalues

are

mean±

SD.Values

with+

and

)signsin

parenthesisindicate

percentincrease

ordecrease,respectively,comparedwiththecontrol.*Values

significantly(P

<0.05)differentfrom

thecontrol.

Figure 2. Concentration of (A) chlorophyll a (Chl a), (B) carotenoid(Car), and (C) ratio of Car to Chl a in Anabaena doliolum subjected toUV-B and heat followed by UV-B stress where C = control,U1 = 10, U2 = 20, U3 = 30, U4 = 40 and U5 = 50 min of UV-B exposure and TU1, TU2, TU3, TU4 and TU5 stand for 48�Ctemperature for 1 h followed by 10, 20, 30, 40 and 50 min of UV-Btreatment.

828 Yogesh Mishra et al.

a-chain (PEC-a-chain), hypothetical protein alr0882, phy-cobilisome core component, iron superoxide dismutase(Fe-SOD), fructose-1,6-bisphosphate aldolase (FBA), NDPK,phosphoribulokinase (PRK) and RuBisCo large chain.

Changes in protein and transcript expression

Of the nine proteins identified by MALDI-TOF MS ⁄MS, thePC-a-chain, Fe-SOD, FBA, NDPK and PRK showed almost

the same pattern of accumulation, i.e.1.67, 1.22, 1.15, 1.28,1.21-fold, respectively, after 20 min (U2) of UV-B exposure.These proteins, however, declined after 50 min (U5) of UV-B

exposure. However, PEC-a-chain, hypothetical proteinalr0882, PBS-CC and RuBisCo large chain showed downre-gulation after 20 (U2) and 50 (U5) min of UV-B exposure.

Further, when temperature-pretreated Anabaena was exposedto UV-B (U2 and U5) the response was quite different toUV-B alone (Figs. 5 and 6). The 20 min UV-B (U2) exposureto temperature-pretreated Anabaena showed accumulation of

all the nine proteins on the 2-DE gel. This accumulation wasfound to increase even after 50 min of UV-B exposure inheat-pretreated cells. The accumulation was 2.29, 1.32, 1.38,

1.41, 1.99, 2.09, 1.72, 1.71 and 1.62-fold in PC-a-chain, PEC-a-chain, hypothetical protein alr0882, PBS-CC, Fe-SOD, FBA,NDPK, PRK and RuBisCo large chain, respectively (Fig. 6).

All the above proteins nicely corroborated with the transcriptdata (Fig. 5) except that the Fe-SOD and PRK registered 2.5and 3.5-fold increase in abundance in their transcripts com-pared with only 1.99 and 1.71-fold increase in protein

accumulation after 50 min of UV-B exposure in temperature-pretreated Anabaena.

DISCUSSION

The inhibited PSI, PSII and whole chain activity, carbon

fixation, NADPH ⁄NADH, ATP content (Table 2), reducedgrowth (Fig. 1A) and chlorophyll a content (Fig. 2A) depictsthe damaging effect of UV-B stress on Anabaena. Theinhibition of photosystem (PS) gets support from the reports

that (i) the genes encoding the PS polypeptide are repressedunder UV-B stress (38); (ii) PS is the primary target of UV-B(39); and (iii) excess ROS produced by UV-B does not allow

the repair of photodamaged PSII (40). The decline in carbonfixation may be correlated with low energy state of the cell asdepicted by reduced ATP and NADPH ⁄NADH content.

Further, it may be explained in light of the reports that UV-Bdecreases the activities of RuBisCo and RuBisCo activase(25) and downregulates RuBisCo encoding rbcL, rbcS andrbcX genes (18). The decline in chlorophyll a (Fig. 2A)

content at increasing UV-B exposure may be due to thephotosensitivity of chlorophyll to ROS (39). However, theincrease in CAR content in UV–B-exposed Anabaena is a

protective strategy of cyanobacteria (41). In contrast to theabove, cells pretreated at 48�C for 1 h when subjected to UV-B revealed an increase in PSI, PSII, whole chain activity,

carbon fixation, NADPH ⁄NADH, ATP content (Table 2),better growth (Fig. 1B) and chlorophyll a content (Fig. 2A),reflecting occurrence of cross tolerance of heat-pretreated

Anabaena to UV-B stress.In order to get a proper view of the proteins involved in

heat-induced cross tolerance to UV-B the cytosolic proteins

Figure 3. (A) Gel image of the amplification products of protein genesfrom the genomic DNA of Anabaena: M = marker; N = negativecontrol; L1 = PC-a-chain; L2 = PEC-a-chain; L3 = Hypo alr0882;L4 = PBS-CC; L5 = Fe-SOD; L6 = FBA; L7 = NDPK;L8 = PRK; L9 = RuBisCo. (B) Amplification of the 16S rRNAgene from Anabaena, using RNA isolated from culture of the samegrowth phase and treatment as with 2-DE depicting equal loading ofRNA in different samples used. M = marker; L1 control, L2, L3, L4and L5 represent control, U2, U5, TU2 and TU5 treatments,respectively, and N represents the negative RT controls.

Figure 4. Two-dimensional gel electrophoresis images of total cellprotein extracts from Anabaena: (C) control, 20 (U2), 50 min (U5) ofUV-B, 48�C heat pretreatment followed by 20 min UV-B (TU2), 48�Cheat pretreatment followed by 50 min UV-B (TU5). All gels were runin triplicate. The protein (50 lg) was applied to pH 3–10 gradientcapillaries with 12% linear vertical SDS-PAGE as the seconddimension as mentioned in the Materials and Methods section. Thegels were visualized by Coomassie brilliant blue staining. Nine proteinsshowing significant and reproducible changes were characterized byMALDI-TOF MS. Details are given in Table 3.

Photochemistry and Photobiology, 2009, 85 829

were analyzed using 2-DE and MALDI-TOF and attested byRT-PCR. Although a significant positive correlation between

the proteins and corresponding transcripts was observed, itwas never equal to 1 (Fig. 5). The differences in the proteinand transcript levels of Fe-SOD and PRK find support fromthe work of Suzuki et al. (20) who reported discrepancies in

the transcriptomics and proteomics data in Synechocystisexposed to heat stress as well as Nie et al. (42) who reported

that the sequence features related to the initiation, elongationand termination steps of translation contribute to 27% of the

total variation in mRNA protein in Desulfovibrio vulgaris.Of the nine proteins characterized, RuBisCo (primary

enzyme in photosynthetic carbon fixation) and PRK (associ-

ated with the carbon fixation step of the Calvin cycle) showeddownregulation after 20 and 50 min of UV-B exposure. Thedecline in the accumulation of these enzymes may be due tooxidative inactivation. However, in heat-pretreated cells fol-

lowed by UV-B exposure these enzymes showed upregulation,thereby suggesting a protective role of heat shock proteinsagainst UV-B.

Another important protein, FBA, involved in the recoveryof photosynthetic carbon fixation catalyzes the reversible aldolcleavage or condensation of fructose-1,6-bisphosphate into

glyceraldehyde 3-phosphate (GAP) and dihydroxyacetonephosphate (DHAP). During stress, GAP and fructose 6-phosphate formed from 5-carbon sugar phosphate may be

converted to glucose 6-phosphate for reentry into the linearportion of the pentose phosphate pathway (PPP) for maxi-mizing the formation of NADPH. Further, FBA can contrib-ute to RuBP regeneration (43), which RuBP in turn acts as an

important substrate determining the turnover rate of Calvincycle. However, after 50 min (U5) of UV-B exposure FBAregistered a decline, which may disrupt the PPP, glycolysis and

turnover rate of Calvin cycle, thereby leading to the nonsur-vival of Anabaena under UV-B stress. On the other hand, heatpretreatment followed by UV-B (TU2 and TU5) caused

induction of FBA thus maintaining the PPP, glycolysis andturnover rate of Calvin cycle. This is demonstrated byenhanced carbon fixation, NADPH ⁄NADH content (Table 2)

and improved growth (Fig. 2B) in heat pretreated followed byUV-B–treated cells.

The UV–B-induced increase in Fe-SOD is in accordancewith the reports of He et al. (39). An increase in SOD is

plausible as UV-B is known to induce O2) and SOD is required

for its scavenging (44). It is important to mention that anincrease in SOD in heat-pretreated followed by UV-B (TU2

and TU5) cells than UV-B–treated cells alone (U2 and U5)

Table 3. Identification of UV-B (U2 and U5) and heat pretreatment followed by UV–B (TU2 and TU5)-responsive proteins.

Spotno.

Homologous protein(showing homology with)

Probability-basedMowse score

Mr

(kDa) pIAccessionnumber

1 Phycocyanin a-chain(Anabaena sp.)

80 17.5 7.7 A29674

2 Phycoerythrocyanin a-chain(Anabaena sp. PCC7120)

85 17.6 6.4 B41841

3 Hypothetical protein alr 0882[imported] Nostoc. sp.(strain PCC 7120)

97 30.8 7.7 AG1916

4 Phycobilisome core component[imported] (Nostoc sp. PCC 7120)

88 18.6 5.4 AH2096

5 Iron superoxide dismutase[imported] Nostoc. sp.(strain PCC 7120)

76 22.3 5.2 AC2173

6 Fructose-1,6-bisphosphate aldolase[imported] (Nostoc sp. PCC 7120)

95 38.7 5.9 AC2376

7 Nucleoside diphosphate kinase(Anabaena sp. PCC 7120)

102 16.59 5.9 AF2263

8 Phosphoribulokinase (Nostoc sp.) 111 38.6 5.1 AD23219 Rubisco large chain (Nostoc sp.) 123 53.4 6.3 AF1996

Figure 5. (I) Changes in abundance of selected proteins of controlAnabaena exposed to (C) control, 20 (U2), 50 min (U5) of UV-B, 48�Cheat pretreatment followed by 20 min UV-B (TU2) and 48�C heatpretreatment followed by 50 min UV-B (TU5). The protein wasextracted, separated by 2-DE and detected by Coomassie brilliant bluestaining as mentioned in the Materials and Methods section. Proteinspots with enhanced intensity were picked from various 2-DE gels.Details of these proteins are given in Table 3. Equally enhancedproteins, using PD Quest, were compiled in one chart to measurevariation in expression. The proteins depicted in the gels are PC-a-chain, PEC-a-chain, Hypo-alr 0882, PSB-CC, Fe-SOD, FBA, NDPK,PRK and RuBisCo. (II) RT-PCR of different protein genes ofAnabaena using RNA isolated from culture as used for 2-DE. Thelanes marked N represent the negative control of PCR reaction.

830 Yogesh Mishra et al.

indicates a strategy of Anabaena for scavenging additionalROS produced by the cyanobacteria.

NDPK, an important signaling molecule, showed upregu-

lation at low doses of UV-B (U2) but declined under UV-B(U5). Upregulation of NDPK is responsible for maintenanceof cellular redox (45). These results are also supported byHuang et al. (18) in Synechococcus. At elevated doses (U5) a

decline in its content could be an indirect consequence of UV–B-induced severe oxidative damage leading to dimerization ofNDPK (27).The downregulation of this protein leads to cell

death as the cellular machinery fails to maintain the propersignaling and redox status of the cell. In contrast to the above,in heat-pretreated cells subjected to UV-B (TU2 and TU5)

NDPK showed upregulation. This will help in proper signal-ing, maintenance of cellular redox and alleviation of UV-Btoxicity. This finding supports our hypothesis that the increasein NDPK mitigates UV-B toxicity.

The diminished expression of the hypothetical proteinalr0882, PEC-a-chain and PSB-CC even at low doses of UV-B(U2) suggests their sensitivity toward UV-B stress. However, in

heat-pretreated cells they also showed upregulation, hence maybe involved in offering protection against UV-B toxicity.Overexpression of PC-a-chain at low doses of UV-B (U2) and

in heat-pretreated cells followed by UV-B looks legitimatebecause these proteins are potent scavengers of free radicals (46).

In view of the role of HSPs in proper folding of proteins

during stress (47,48) a relationship in HSPs and metabolicproteins was anticipated. When heat pre-exposed Anabaenawas subjected to different durations of UV-B, there wasupregulation of all the studied proteins and physiological

parameters (Table 2) thereby suggesting that elevated levelsof HSPs have a role in helping the function of otherproteins.

Acknowledgements—L. C. Rai is thankful to the University Grants

Commission (UGC) for financial support in the form of a project,

Yogesh Mishra and Neha Chaurasia to CSIR for SRF and UGC for

JRF, respectively. We thank the Head and Program Coordinator, CAS

in Botany, Banaras Hindu University, for facilities.

SUPPORTING INFORMATION

Additional Supporting Information may be found in the online

version of this article:Figure S1. Spectra of the UV-B lamp used to give artificial

UV-B radiation.

Figure S2. MALDI TOF MS ⁄MS spectrum of Phycocyaninalpha chain tryptic peptide (spot no. 1, see Table 3).

Figure S3. MALDI TOF MS ⁄MS spectrum of Phycoery-throcyanin alpha chain tryptic peptide (spot no. 2, see Table 3).

Figure S4.MALDI TOFMS ⁄MS spectrum of Hypotheticalprotein. alr 0882 tryptic peptide (spot no. 3, see Table 3).

Figure S5. MALDI TOF MS ⁄MS spectrum of Phycobili-

some core component tryptic peptide (spot no. 4, see Table 3).Figure S6. MALDI TOF MS ⁄MS spectrum of Iron super-

oxide dismutase tryptic peptide (spot no. 5, see Table 3).

Figure S7. MALDI TOF MS ⁄MS spectrum of Fructose-1,6-bisphosphate aldolase tryptic peptide (spot no. 6, seeTable 3).

Figure 6. Changes in the relative intensity of selected proteins of control Anabaena exposed to (C) control, 20 (U2), 50 (U5) min of UV-B, 48�Cheat pretreatment followed by 20 (TU2) and 50 min UV-B (TU5) treatment. The changes in protein spots were calculated with PD Quest softwareand plotted as the relative intensities of nine spots indicated in the gel. Values are the means ± SE of protein volumes of gels from threeindependent experiments.

Photochemistry and Photobiology, 2009, 85 831

Figure S8. MALDI TOF MS ⁄MS spectrum of Nucleosidediphosphate kinase tryptic peptide (spot no. 7, see Table 3).

Figure S9. LC MS of Phosphoribulokinase tryptic peptide(spot no. 8, see Table 3).

Figure S10. MALDI TOF MS ⁄MS spectrum of RuBisColarge chain tryptic peptide (spot no. 9, see Table 3).

Please note: Wiley-Blackwell are not responsible for the

content or functionality of any supporting materials suppliedby the authors. Any queries (other than missing material)should be directed to the corresponding author for the article.

REFERENCES1. Hoffman, J. R., L. J. Hansen and T. Klinger (2003) Interaction

between UV radiation and temperature limit inferences from sin-gle factor experiments. J. Phycol. 39, 268–272.

2. Singh, R. N. (1962) Role of Blue Green Algae in the NitrogenEconomy of Indian Agriculture. ICAR, New Delhi.

3. Rai, L. C., B. Tyagi and N. Mallick (1996) Alteration in photo-synthetic characteristics of Anabaena doliolum following exposureto UV-B and Pb. Photochem. Photobiol. 64, 658–663.

4. Rai, L. C., B. Tyagi, N. Mallick and P. K. Rai (1995) Interactiveeffects of UV-B and copper on photosynthetic activity of thecyanobacterium Anabaena doliolum. Environ. Exp. Bot. 35, 177.

5. Rai, L. C., B. Tyagi, P. K. Rai and N. Mallick (1998) Interactiveeffects of UV-B and heavy metals (Cu and Pb) on nitrogen andphosphorus metabolism of a N2-fixing cyanobacterium Anabaenadoliolum. Environ. Exp. Bot. 39, 221–231.

6. Sinha, R. P., N. Singh, A. Kumar, H. D. Kumar, M. Hader andD. P. Hader (1996) Effect of UV irradiation on certain physio-logical and biochemical processes in cyanobacterium. J. Photo-chem. Photobiol. B, Biol. 32, 107–113.

7. Renger, G., M. Volker, H. J. Eckert, R. Frommer, S. Hohm-Veitand P. Graber (1989) On the mechanism of photosystem II dete-rioration by UV-B irradiation. Photochem. Photobiol. 49, 97–105.

8. Pandey, V. and L. C. Rai (2002) Interactive effects of UV-B andpesticides on photosynthesis and nitrogen fixation of Anabaenadoliolum. J. Microbiol. Biotechnol. 12, 423–430.

9. Ehling-Schulz, M. and S. Scherer (1999) UV protection in cy-anobacteria. Eur. J. Phycol. 34, 329–338.

10. Salvucci, M. E., K. W. Osteryoung, S. J. Craft-Brander and E.Vierling (2001)Exceptional sensitivity of rubisco activase to thermaldenuration in vitro and in vivo. Plant Physiol. 127, 1053–1064.

11. Harrington, H. M. and D. M. Alm (1988) Interaction of heat andsalt shock in cultured tobacco cells. Plant Physiol. 88, 618–625.

12. Wollegiehn, R. and D. Neumann (1995) Stress response of tomatocell cultures to toxic metals and heat shock: Differences andsimilarities. Plant Physiol. 146, 736–742.

13. Banzet, N., C. Richaud, Y. Deveaux, M. Kazmaier, J. Gagnonand C. Triantaphylides (1998) Accumulation of small heat shockproteins, including mitochondrial HSP22, induced by oxidativestress and adaptive response to tomato cells. Plant J. 13, 519–527.

14. Murakami, T., S. Matsuba, H. Funatsuki, K. Kawaguchi, H.Saruyama, M. Tanida and Y. Sato (2004) Overexpression of asmall heat shock protein, sHSP17.7, confer both heat toleranceand UV-B resistance to rice plants. Mol. Breed. 13, 165–175.

15. Jantschitsch, C. and F. Trautinger (2003) Heat shock and UV-Binduced DNA damage and mutagenesis in skin. Photochem.Photobiol. Sci. 2, 899–903.

16. Srivastava, A. K., P. Bhargava, Y. Mishra, B. Shukla and L. C.Rai (2006) Effect of salt, copper and temperature pretreatment onultraviolet-B induced antioxidants in diazotrophic cyanobacte-rium Anabaena doliolum. J. Basic Microbiol. 42, 135–144.

17. Shepard, J. L., B. Olsson, M. Tedengren and B. P. Bradley (2000)Specific protein expression signature identified in Mytilus edulisexposed to copper, PCB and decrease salinity. Mar. Environ. Res.50, 337–340.

18. Huang, F., I. Parmryd, F. Nilsson, A. L. Persson, H. B. Pakrasi,B. Andersson and B. Norling (2002) Proteomics of Synechocystissp. strain 6803: Identification of plasmamembrane protein. Mol.Cell. Prot. 1, 956–966.

19. Ehling-Schulz, M., S. Schulz, R. Wait, A. Gorg and S. Scherer(2002) The UV-B stimulon of the terrestrial cyanobacteriumNostoc commune comprises early shock proteins and late accli-mation proteins. Mol. Microbiol. 46, 827–843.

20. Suzuki, I., W. J. Simon and A. R. Slabas (2006) The heat shockresponse of Synechocystis sp. PCC 6803 analyzed by transcripto-mics and proteomics. J. Exp. Bot. 57, 1573–1578.

21. Bhargava, P., Y. Mishra, A. K. Srivastava, A. Ara and L. C. Rai(2006) Preliminary analysis of the cuprome of Anabaena doliolumusing two-dimensional gel electrophoresis.Curr. Sci. 91, 1520–1523.

22. Bhargava, P., Y. Mishra, A. K. Srivastava, O. P. Narayan and L.C. Rai (2008) Excess copper induces anoxygenic photosynthesis inAnabaena doliolum: A proteomic assessment of its survival strat-egy. Photosynth. Res. 98, 61–74.

23. Bhargava, P., A. Kumar, Y. Mishra and L. C. Rai (2008) Copperpre-treatment augments ultraviolet B toxicity in the cyanobacte-rium Anabaena doliolum: A proteomic analysis of cell death. Funct.Plant Biol. 35, 360–372.

24. Hunsuker, S. W., K. Klage, S. M. Slaughter, M. Potts and R. F.Helm (2004) A preliminary investigation of the Nostoc punctiformeproteome. Bioch. Biophy. Res. Comm. 317, 1121–1127.

25. Xu,C., J.H. Sullivan,W.M.Garrett, T. JCapernaandS.Natarajan(2008) Impact of solar ultraviolet-B on the proteome in soyabeanlines differing in flavonoid contents. Phytochemistry 69, 38–48.

26. Bhargava, P., A. K. Srivastava, S. Urmil and L. C. Rai (2005)Phytochelatin plays a role in UV-B tolerance in N2-fixing cyano-bacterium Anabaena doliolum. J. Plant. Physiol. 162, 1220–1225.

27. Rupprecht, E., S. Gathmann, E. Fuhrmann and D. Schneider(2007) Three different DnaK proteins are functionally expressed inthe cyanobacterium Synechocystis sp. PCC 6803. Microbiol. 153,1828–1841.

28. Allen, M. B. and D. I. Arnon (1955) Studies on the nitrogen-fixingblue green algae. I. Growth and nitrogen fixation by Anabaenacylindrica Lemm. Plant Physiol. 30, 366–372.

29. Ambasht, N. K. andM. Agarwal (2003) Effects of enhanced UV-Bradiation and trophospheric ozone on physiological and biochem-ical characteristics of field grown wheat. Biol. Plant. 47, 625–628.

30. Rai, L. C. and M. Raizada (1985) Effect of nickel and silver ion onsurvival, growth, carbon fixation and nitrogenase activity inNostoc muscorum: Regulation of toxicity by EDTA and calcium.J. Gen. Appl. Microbiol. 31, 329–337.

31. Myers, J. and W. A. Kratz (1955) Relations between pigmentcontent and photosynthetic characteristics in a blue green alga.J. Gen. Physiol. 39, 11–21.

32. Lien, S. (1978) Hill reaction and photophosphorylation withchloroplast preparation from Chlamydomonas reinhardtii. InHandbook of Phycological Methods: Phycological and BiochemicalMethods (Edited by J. A. Heliebust and J. S. Craigie), pp. 305–315.Cambridge University Press, Cambridge, UK.

33. Tripathy, B. C. and P. Mohanty (1980) Zinc-inhibited electrontransport of photosynthesis in isolated barley chloroplasts. PlantPhysiol. 66, 1174–1178.

34. Smyth, D. A. and W. M. Dugger (1981) Cellular changes duringboron-deficient culture of the diatom Cylindrotheca fusiformis.Physiol Plant. 51, 111–117.

35. Larson, C. M. and T. Olsson (1979) Firefly assay of adeninenucleotide from algae: Comparison of extraction methods. PlantCell Physiol. 22, 145–155.

36. Wagner, M. A., M. Eschenbrenner, T. A. Honrn, J. A. Kraycer,C. V. Mujer, S. P. Hagius Elzer and V. G. Del Vecchio (2002)Global analysis of the Brucella melitensis proteome: Identificationof proteins expressed in laboratory grown culture. Proteomics 2,1047–1060.

37. O’Farrell, P. H. (1975) High resolution two-dimensional electro-phoresis of proteins. J. Biol. Chem. 250, 4007–4021.

38. Izaguirre, M. M., A. L. Scopel, I. T. Baldwin and C. L. Ballare(2003) Convergent responses to stress. Solar ultraviolet-B radia-tion and Manduca sexta herbivory elicit overlapping transcrip-tional responses in field-grown plants of Nicotiana longiflora. PlantPhysiol. 132, 1755–1767.

39. He, Y.-Y., M. Klisch and D.-P. Hader (2002) Adaptation of cy-anobacteria to UV-B stress correlated with oxidative stress andoxidative damage. Photochem. Photobiol. 76, 188–196.

832 Yogesh Mishra et al.

40. Takahashi, S. and N. Murata (2008) How do environmentalstresses accelerate photoinhibition? Trends Plant Sci. 13, 178–182.

41. Nonnengiesser, K., A. Schuster and F. Koenig (1996) Carotenoidsand reaction center II-DI protein in light regulation of the pho-tosynthetic apparatus in Aphanocapsa. Bot. Acta 109, 115–124.

42. Nie, L., G. Wu, F. J. Brockman and W. Zhang (2006) Integratedanalysis of transcriptomic and proteomic data of Desulfovibriovulgaris: Zero-inflated Poisson regression models to predictabundance of undetected proteins. Bioinformatics 22, 1641–1647.

43. Fridlyand, L. E. and R. Scheibe (1999) Regulation of the Calvincycle for CO2 fixation as an example for general control mecha-nism in metabolic cycles. Biosystems 51, 79–93.

44. Halliwell, B. and J. M. C. Gutteridge (1984) Oxygen toxicity,oxygen radicals, transition metals and disease. Biochem. J. 219, 1–14.

45. Shin, D. H., J. G. In, Y. P. Lim, K. Hasunuma and K. S. Choi(2004) Molecular cloning and characterization of nucleosidediphosphate (NDP) kinases from Chinese cabbage (Brassicacampestris). Mol. Cell 17, 86–94.

46. Pinero, E. J. E., B. P. Bermezo and A. M. Villar del Fresno (2001)Antioxidant activity of different fractions of Spirulina platensisprotean extract. II Farmaco 56, 497–500.

47. Haselbeck, M., S. Walke, T. Stomer, M. Ehrnsperger, H. E.White, S. Chen, H. R. Saibil and J. Buchner (1999) HSP26: Atemperature-regulated chaperone. EMBO J. 18, 6744–6751.

48. Lee, S., H. A. Owen, D. J. Prochaska and S. R. Barnum (2000)HSP16.6 is involved in the development of thermotolerance andthylakoid stability in unicellular cyanobacterium Synechocystis sp.PCC 6803. Curr. Microbiol. 40, 283–287.

Photochemistry and Photobiology, 2009, 85 833