Oral Sessions

97

HALAL FOOD AND METROLOGY Ahmet C. GÖREN*1, Hasibe YILMAZ1, Simay GÜNDÜZ1, Burhanettin YALÇINKAYA2, and Müslüm AKGÖZ2

1TUBITAK UME, Chemistry Group, Organic Chemistry Laboratory, Gebze, Kocaeli-Türkiye

2TUBITAK UME, Chemistry Group, Bioanalysis Laboratory, Gebze, Kocaeli-Türkiye

Abstract

In this study, the chemical metrology infrastructure of TUBITAK UME was presented and the importance of chemical metrology in the field of halal food industry was discussed. A case study on alcohol contents of beverages and fruits in Turkish market was conducted by HS-GC-FID. Furthermore, determination of adulteration and contamination of meat products were discussed. Beverages and fruits that were analyzed included very low levels of alcohol content. Additionally, it was determined that the alcohol content of boza drink increases during storage. The origin of meat that was used in sausage and salami samples, which were obtained from Turkish market and from other sources, were determined by DNA analysis. Very low levels of different origins of DNA could be detected in samples by Real Time PCR techniqe. Thus, it would be possible both to determine food adulteration and contamination in meat samples. For accurate and traceable measurement results of beverages and meat samples, Certified Reference Materials (CRM) is required and TUBITAK UME has the capability to prepare these materials.

Key words: Metrology, halal food, alcohol, meat, reference materials

1. INTRODUCTION

Metrology is a discipline that is interested in research activities about both physical and chemical measurements that ensure the quality of our lives. Physical measurements such as the volume of fuel, the mass of fruit and vegetables, the wheel diameter of a vehicle and the corresponding change in the speed of a car and speed radar measurements are examples of measurements that affect our daily lives. In addition to physical measurements, chemical measurements, which include the determination of levels of toxic elements and bacteria in drinking water, drug residues in meat, pesticide in vegetables, and diagnostic measurements in clinical laboratories are also very important.

The quality of chemical measurements carried out in our country and in the world can be assured by conducting measurements independent of the analyst, laboratory, instrument and method through developing methods that are accurate, repeatable and reliable at the national and international scale. In laboratories, easily accessible harmonized standards, quality systems and Certified Reference Materials (CRM) are the tools that can be used to assure the quality and accuracy of chemical measurements.

Different areas of measurements in chemical metrology are also required in our daily lives. One example is that people belonging to various religions are required to conform to certain dietary requirements. Specifically, halal food consumption has great

* Corresponding author:E-mail: ahmetceyhan.goren@tubitak.gov.tr; Phone:+90 262 679 50 00; Fax:+90 262 679 50 01

Sözlü Bildiriler

98

significance in Islam. Therefore, the food in the market should be monitored thoroughly in countries with large Muslim populations. The alcohol content of drinks, the origin of meat products and the type and the origin of food additives need to be analyzed thoroughly. Drinks such as boza, malt drinks and other beverages may contain trace levels of alcohol and the level of alcohol may increase with time and storage conditions. Islamic society should provide answers to these problems in a scientific manner.

TUBITAK UME, Organic Chemistry Laboratory of TUBITAK has the necessary instruments and knowledge to determine very low levels of ethanol in beverages at high precision and low uncertainty. The origin of meat and meat products can be detected accurately by DNA or protein analysis by TUBITAK UME Bioanalysis Laboratory. According to the measurement needs of Islamic society, ethanol containing reference materials and pig and single-toed animal meat containing reference materials can be prepared and certified according to ISO Guide 34 [1].

TUBITAK UME (Ulusal Metroloji Enstitüsü), established as an institute under the authority of the Scientific and Technological Research Council of Turkey (TUBITAK) in 1986, is the national metrology institute of Turkey. Chemical metrology activities are carried out by six laboratories in the Chemistry Group that are Organic Chemistry, Inorganic Chemistry, Bioanalysis, Electrochemistry, Gas Metrology and Reference Materials Laboratories.

Monitoring and identifying food or drinks for their acceptance criteria (halal) is important and a challenging area in the Muslim world and there is a need for an authority to determine the origin of products.

In this study, several beverage samples and meat products were screened for ethanol content and origins of the meat products, respectively. The ethanol content of different kinds of beverages was analyzed using the headspace GC-FID method. The origin of different kind of meat products obtained from the market was determined by the Polymerase Chain Reaction (PCR) method. Sausage and salami samples were screened with PCR and mixtures were further analyzed with Real Time PCR (qPCR) technique.

2. EXPERIMENTAL

2.1. Determination of Alcohol Content of Beverages

2.1.1. Materials

n-propanol was obtained from Merck (≥99 %), ethanol was obtained from Sigma-Aldrich. Purity assessment of ethanol was evaluated by TUBITAK UME and its purity defines as 99.2 ± 0.2 %.

2.1.2. Preparation of test solution for Headspace GC-FID

Standard ethanol solutions containing 1, 10, 50, 100, 500, 100, 5000, 10000 ppm ethanol were prepared in distilled water. n-propanol was used as an internal standard (IS). 1.9 mL of sample was injected with 100 µL of internal standard (n-propanol) into a 5 mL headspace vial and the vial was placed in the headspace sample tray for headspace GC-FID measurements. Coke, soft drink, fruit juice, boza, grape juice, beer, wine, malt drink, kephir and fresh fruit (grape and melon) samples were collected from the market and analyzed. In some cases, the samples were diluted with

Oral Sessions

99

distilled water for the high viscosity boza, and high alcohol content alcoholic drinks, beer and wine to obtain results in the linearity range.

2.1.3. Instruments and chromatographic conditions and optimization of Headspace GC method

The experiments were performed using Thermo Scientific Trace GC ULTRA gas chromatography FID system with HS 2000 headspace auto sampler. The analysis program and conditions were as follows: Sample volume was 2 mL, incubation time was 10 min, the vial oven temperatures were 100

0C for each analysis, and transfer

line and needle temperatures were 100 0C. A VF wax column (60 m x 0.25 mm, ø with

0.25 µm film thickness) was used with hydrogen at 1 mL/min (20 psi). The GC oven temperature was kept at 50

0C for 2 min and programmed to 240

0C at a rate of 20

0C/min and kept constant at 240

0C for 2 min. The split ratio was adjusted to 1:20 and

the injection volume was 0.35 mL. n-Propanol was used as the internal standard for the quantification of ethanol in the samples.

2.1.4. Method Validation

The use of the validated method is very important for the quality of the results. In this study, the method used was validated and uncertainties of measurement for each analytes were evaluated. The validation parameters were determined to be linearity, repeatability, precision, LOD and LOQ experiments.

2.1.4.1.LOD and LOQ of Method

The limit of detection (LOD) is defined as the lowest concentration of an analyte in a sample that can be detected with statistical confidence. The limit of quantification (LOQ) is defined as the lowest concentration of an analyte in a sample that can be determined with acceptable precision and trueness under stated operational conditions of the method. While limit of detection was estimated as the concentration corresponding to three times the standard deviation (3σ) of the blank signals obtained from a set of reagent blanks, limit of quantification was estimated as the concentration corresponding to ten times the standard deviation (10σ) of the blank signals obtained from a set of reagent blanks. LOD and LOQ were calculated by using standard ethanol solutions prepared in distilled water. LOD and LOQ of reported method for ethanol in beverages were found to be 2.25x10

-4 and 7.49 x10

-4%, respectively.

2.1.4.2. Linearity

Linearity is the ability of the method to elicit test results that are directly proportional to the analyte concentration within a given range. Linearity is generally reported as a correlation coefficient. In order to prepare calibration solutions and to plot calibration curve by using standard addition and internal standard methods simultaneously for analysis of the samples, standard ethanol solutions containing 1, 10, 50, 100, 500, 100, 5000, 10000 ppm ethanol were prepared in distilled water 1.9 mL of sample was injected with 100 µL of internal standard (n-propanol) into a 5 mL headspace vial. The linearity of the method for ethanol was assayed by analyzing the standard solutions. The linearity range of ethanol in beverages was found to be 0.0001-1 % (1-10000 ppm) where the correlation coefficient (R

2) was 0.9996. The linear regression equation

was reported as y =7.8139x + 0.003413 where y is the peak area and x is the concentration. The samples that contain ethanol more than 1 % were diluted with water to obtain concentrations in the linearity range.

Sözlü Bildiriler

100

2.1.4.3. The repeatability and precision

Repeatability is a crucial parameter for method validation. The overall method repeatability (including sample preparation) is therefore included in the method validation.

Repeatability is the precision under repeatability conditions, i.e. conditions where independent test results are obtained with the same method on identical test items in the same laboratory using the same equipment within short intervals of time.

Precision of the method was evaluated by repeating the measurements three times at eight different concentrations. Good precision (The standard deviation of the measurements were found to be between 1.02x10

-4 and 0.07246) was determined and

the results were implemented to the uncertainty budget.

2.1.5. Estimation of Uncertainty

2.1.4.1. Identification of uncertainty sources

The sources and quantification of the uncertainty for the applied method were evaluated and calculated using EURACHEM Guide, 2004 (EURACHEM/CITAC, 2004) [2, 7].

The following parameters were used for the calculations of uncertainties:

1. Calibration curve, stock solutions of standards and internal standard (C),

2. Weighing of samples (msample)

3. Repeatabilitity (rep)

Standard combined uncertainty is a combination of the uncertainties of each parameter and can be calculated by using equation (1):

)()()()( 222 repumuCuCu sample (1)

Standard combined uncertainties multiplied by two for the calculation of expanded uncertainties by accepting 95% confidence level. Calculated uncertainties are shown in Table 1.

2.1.4.1.1. Uncertainty of calibration curve

The uncertainty of calibration curve is given in equation 2, where n is the number of analyzed samples, p is the number of repeated analysis, C is the concentration, B1 (b) is the intercept of the calibration curve (y=ax+b), a is the slope.

(2)

2.1.4.1.2. Uncertainty of weighing of sample (mass of sample)

The uncertainty of weighing of sample is given in equation 3, where ukm is the uncertainity of balance which is given by supplier.

xxS

CC

npB

SCu

2

0

1

0

)(11)(

n

i

i CCxxS1

2)(

Oral Sessions

101

(3)

2.1.4.3 Uncertainty of repeatability

The uncertainty of repeatability was calculated with equation 4, where SD is standard deviation and n is number of repeated analysis.

(4)

2.2. Meat Products

2.2.1. DNA Extraction

DNA extraction was performed according to the instruction booklet of the Wizard Genomic DNA Purification Kit (Cat.No.A1120, Promega Corporation, USA). Briefly, a 25 mg meat sample was taken and homogenized in lysis buffer. After addition of RNAse A and proteinase K, the lysate was incubated at 65°C for 30 minutes. DNA was precipitated and dissolved in 100 µL of Tris-EDTA buffer (10 mM Tris, 1 mM EDTA, pH 8.0) and saved at -20°C.

2.2.2. Determination of Purity and Integrity

The concentration and the purity of extracted genomic DNA was determined by measuring absorbance values at 260 nm and 280 and 230 nm with a UV spectrometer (Nanodrop 1000, USA) and DNA samples were run in 1% the agarose gel to determine the DNA integrity of the extracted genomic DNAs. Agarose gels were visualized under UV illumination.

2.2.3. PCR and qPCR Conditions

The PCR and Real-Time PCR (qPCR) experiments were performed using a Veriti Thermal Cycler (Applied Biosystems, USA) and a Light Cycler 480 (Roche, Germany), respectively. 2xPCR Master Mix (Fermentas, USA) and Light Cycler 480 SYBR Green I Master Mix (Roche, Germany) were used for PCR and Real-Time PCR experiments, respectively. The primers were synthesized and purified by HPLC (Sentromer, Türkiye). After an initial denaturation at 95 °C for 5 min., 35 cycles were performed by denaturing at 95 °C for 15 s, annealing at 58 °C for 15 s, and extending at 72 °C for 30 s. For each amplification mixture, 5 µl of each DNA sample was used as a template.

According to the PCR results, some samples included different origins of meat, therefore, these samples were subjected to Real time-PCR (qPCR) to determine relative DNA concentrations. Relative intensities were determined by using the 2

∆Ct

method after adding up all values and then dividing each value to the total value. The reactions were run in triplicate and uncertainty values were calculated based on repeatability criteria.

2)(2)( kmSample umu

n

SDrepu )(

Sözlü Bildiriler

102

3. RESULTS and DISCUSSION

Beverages and meat products were analyzed in terms of halal criteria. Food samples were screened for ethanol content and meat products were screened for their animal origins.

The Headspace GC technique is very important and common technique for determination of any volatile compounds in food also for alcohol contents of beverages [3,4,6]. Therefore, the ethanol content of different alcoholic and non-alcoholic drinks were determined by headspace GC-FID method. The analyte concentration in the sample solution was expressed in percentage terms within the linear range. To determine the quantity of compounds above the linear range, the samples were diluted with distilled water to obtain satisfactory results. The results with the percent relative uncertainties U95 (%) are given in Table 1. Sample of chromatograms are shown in Figure 1. According to the results, all the drinks and fruits that are tested contain ethanol, although at very low levels. The level of ethanol increases in the boza samples as they are kept longer in the refrigerator (Table 1).

a b

Figure 1. The HS-GC-FID Chromatograms;

a) standard ethanol solutions, beer, wine and grape juice;

b) coke, soft drink, boza and grape juice.

Oral Sessions

103

Table 1. The ethanol content of beverages in increasing order.

Name Ethanol % (w/w) U95 (k=2)

Soft drink 1 3.12 x10-5

5.00 x10-7

Coke 1 8.80 x10-5

1.50 x10-6

Coke2 1.31 x10-4

2.20 x10-6

Soft drink 2 2.09 x10-4

3.60 x10-6

Malt drink 2.26 x10-4

3.90 x10-6

Grape juice 1.43 x10-3

2.40 x10-5

Grape juice (fermented) 1.73 x10-3

2.90 x10-5

Melon 1.92 x10-3

3.30 x10-5

Kephir 3 2.68 x10-3

4.60 x10-5

Kephir 2 4.96 x10-3

8.50 x10-5

Sour cherry juice 8.81 x10-3

1.50 x10-4

Boza 1. day 9.10 x10-3

1.56 x10-4

Kephir 1 1.47 x10-2

2.50 x10-4

Boza 2. day 2.23 x10-2

3.81 x10-4

Boza 6. day 3.76 x10-2

6.42 x10-4

Grape (fresh) 2 5.47 x10-2

9.35 x10-4

Vinegar 1.19 x10-1

2.03 x10-3

Grape (fresh) 1 1.28 x10-1

2.18 x10-3

Beer 1 (% 3) 2.80 4.70 x10-2

Beer 2 (% 4.7) 4.38 7.48 x10-2

Wine 9.74 1.66 x10-1

The purpose of the second part of this study was to determine the animal origin of sausage and salami using the PCR method and to determine the fractions of DNA in different meat samples by the qPCR method. For this purpose, firstly, positive control samples (beef, pork, chicken and turkey) were obtained and genomic DNA was isolated. The extracted genomic DNA were run in agarose gel and the integrity of the genomic DNA was confirmed (Figure 2).

Sözlü Bildiriler

104

Figure 2. Gel image of extracted genomic DNA from a meat sample (1% agarose gel).

Isolated genomic DNA extracts were measured with a Nanodrop Spectrometer and they were found to be highly pure. Extracted DNA samples were subjected to Polymerase Chain Reaction (PCR) with corresponding primers (5, Table 2) and a single band corresponding to the correct size of the amplicon was detected for each reaction (Figure 3A).

Table 2. Primer sequences used in PCR [5].

Meat Primers

PCR Product

Size (bp)

Beef Forward GAACTACGGCTGAATCATCCGA 183

Beef Reverse GGTAGGACGTATCCTATAAATGCTGTG

Pork Forward ACGTAAATTACGGATGAGTTATTCGC 166

Pork Reverse GCTGTTGCTATAACGGTAAATAGTAGGAC

Chicken Forward AATCACGACCACCTTACAACCTTAC 72

Chicken Reverse AAAATGTCGACCAGGGGTTTATG

Turkey Forward CCATACATTACACTGCAGACACCACT 223

Turkey Reverse GTTGCTATGAGGGTGAGAAGTAAGAC

DNA length (bp)

23.130 9.416 6.557 4.361

2.322

2.027

Ma

rke

r

gD

NA

Oral Sessions

105

Figure 3. PCR analysis of samples. A) Positive control samples were subjected to PCR with their corresponding primers. B) Sausage and salami samples were subjected to PCR with all four primer sets in the same tube. The PCR products were run in 2% agarose gel.

Sausage and salami samples were collected from markets and from Bulgaria randomly and they were screened with selected primers (Table 2). Genomic DNA extraction protocols were applied as control samples. The extracted DNA was run on the agarose gel and the purity and concentration of each extract was determined by measuring with a NanoDrop spectrometer. Extracted DNA was subjected to PCR with beef, pork, chicken and turkey primers in the same tube. Several samples exhibited more than one DNA band (Figure 3B). It was found that some of the samples included only one species of meat, while others included multiple animal origins (Table 3). Since chicken or turkey sausage and salami products were prepared with the addition of beef fat (as stated in ingredients list), the DNA from beef could also be detected (Table 3). None of sausage and salami samples that are obtained from Turkey had pork DNA.

- C

ontr

ol

A. + Controls B. Samples

Mar

ker

Bee

f

Pork

Chic

ken

Turk

ey

Chic

ken

Sal

ami

Chic

hen

Sau

sag

e

Import

ed S

ausa

ge

Chic

ken

Sau

sag

e

Bee

f S

ausa

ge

Chic

ken

&T

urk

ey S

ausa

ge

Pork

Sal

ami

DNA

length

(bp)

500

400

300

200

100

Sözlü Bildiriler

106

Table 3. Ingredients of different meat samples.

Products Beef Pork Chicken Turkey

Pork salami + + - -

Chicken sausages + - + +

Chicken/Turkey sausages + - + +

Chicken sausages + - + -

Chicken salami + - + -

Imported beef sausage + + - -

The samples that contained more than one meat product were also analyzed with Real Time Polymerase Chain Reaction (qPCR) to determine the percentages of different meat origins (Table 4). Most of the samples included the meat products that are stated in the ingredients list, such as chicken and turkey sausages, which also included beef fat. However, an imported beef sausage also included very high amounts of pork DNA. Similarly, one beef sausage also contained traces amount obtained from Bulgaria disclosed different levels of pork DNA (Table 4). Since detection limit of PCR technique is 10 DNA molecules per reaction, it is possible to detect a mixture level of 0.0001 % of DNA.

Table 4. The percentage of ingredients of different meat samples. Real Time PCR analysis was performed to samples in individual tubes in triplicate.

Products Ingredient Ratio % DNA U95 (k=2)

Pork salami-Imported from Italia Beef 0.0010 0.0004 Pork 99.9990 19.3878

Beef sausage, obtained from Bulgaria

Beef 22.938 0.383 Pork 77.063 5.320

Beef sausage, obtained from Bulgaria

Beef 99.891 26.854 Pork 0.109 0.031

Chicken salami Beef 0.062 0.007

Chicken 99.938 12.710

Chicken sausage Beef 1.028 0.042

Chicken 98.298 2.758 Turkey 0.674 0.049

Chicken sausage Beef 0.007 0.001

Chicken 99.993 1.391

Chicken/turkey sausage Beef 3.121 0.200

Chicken 90.389 12.653 Turkey 6.489 0.702

It was concluded that qPCR is very powerful technique in determining trace levels of DNA in meat products. With this technique, it is possible to determine very low levels of origins of meat products in sausages and salami.

As a conclusion, as the science of metrology develops, it is becoming possible to determine trace levels of ethanol and very low levels of meat contamination in meat

Oral Sessions

107

products. Since ethanol is present in most of the drinks, fruits and vegetables, an authority is required to set the limits for halal consumption. The Certified Reference Materials is needed for accurate measurement results in halal food industry in Islamic world. TUBITAK UME would serve to the needs of the Islamic Society.

ACKNOWLEDGMENT

We would like to thank to Dr. Nilgün Tokman for valuable comments on the manuscript and Gokhan Bilsel for technical support for GC-FID analysis.

REFERENCES

[1] ISO GUIDE 34: 2009; General Requirements for the Competence of Reference Material Producers.

[2] EURACHEM CITAC Guide CG4, Quantifiying Uncertainty in Analytical Measurement, Third edition. Editors: S L R Ellison (LGC, UK) A Williams (UK).

[3] Goren, A.C., Bilsel, G., Bilsel, M., Cavanagh, H.M.A., Wilkinson, J.M., Topçu, G. (2004). Analysis of Essential Oil of Satureja thymbra by Hydrodistillation, Thermal Desorber and HeadSpace Techniques and Its Antibacterial Activity, Natural Product Research 18:2, 189-195.

[4] Tiscione, N.B., Alford, I., Yeatman, DTi, Shan, X. (2011) Ethanol analysis by headspace gas chromatography with simultaneous flame-ionization and mass spectrometry detection, 35(7), 501-511.

[5] Camma C, Domenico MD, Monaco F. (2002) Development and validation of fast Real-Time PCR assays for species identification in raw and cooked meat mixtures, Food Control, (23) 400-404.

[6] Wasfi, I. A., Al-Awadhi A. H., Al-Hatali, Z. N., Al-Rayami, F. J., Al Katheeri, N. A. (2004). Rapid and sensitive static headspace gas chromatography-mass spectrometry method for the analysis of ethanol and abused inhalants in blood, Journal of Chromatography B, 799, 331-336.

[7] NIST Technical Note 1297 (1994). Guidelines for Evaluating and Expressing the Uncertainity of NIST Measurement Results