h Human Molecular Genetics20(15)3022

8/3/2019 h Human Molecular Genetics20(15)3022

1/9

Seipin ablation in mice results in severegeneralized lipodystrophy

Xin Cui1,2

, Yuhui Wang1,2

, Yin Tang1,2

, Yixiao Liu1,2

, Liping Zhao4

, Jingna Deng2,3

,Guoheng Xu2,3, Xingui Peng 5, Shenghong Ju 5, George Liu 1,2, and Hongyuan Yang 6,

1Institute of Cardiovascular Sciences, 2Key Laboratory of Molecular Cardiovascular Sciences, and 3Department of

Physiology, Ministry of Education, Peking University Health Science Center, Beijing 100191, Peoples Republic

of China, 4Transgenic Animal Center, National Institute of Biological Science, Beijing 102206, Peoples Republic of

China, 5Department of Radiology, Zhong-Da Hospital, Southeast University, Jiangsu Key Laboratory of Molecular

Imaging and Functional Imaging, Nanjing, Peoples Republic of China and 6School of Biotechnology and Biomolecular

Sciences, the University of New South Wales, Sydney, NSW 2052, Australia

Received March 13, 2011; Revised April 27, 2011; Accepted May 3, 2011

Berardinelli-Seip congenital lipodystrophy type 2 (BSCL2) is an autosomal recessive disorder characterizedby an almost complete loss of adipose tissue, insulin resistance and fatty liver. Here, we create the first

murine model of BSCL2 by targeted disruption of seipin, the causative gene for BSCL2. Compared withtheir wild-type littermates, the seipin2/2 mice are viable and of normal weight but display significantly

reduced adipose tissue mass, hepatic steatosis, glucose intolerance and hyperinsulinemia. The levels ofleptin and adiponectin were both significantly decreased in seipin2/2 mice, so were non-esterified fattyacids upon fasting. Surprisingly, however, hypertriglyceridemia which is common in human BSCL, was

not observed in seipin2/2 mice. Our findings suggest a possible tissue-autonomous role of seipin in liverlipid storage. The availability of the seipin2/2 mice should help elucidate the molecular function of seipin

and lead to a better understanding of the many metabolic consequences of human BSCL2.

INTRODUCTION

Congenital generalized lipodystrophy (CGL, also known asBerardinelli-Seip congenital lipodystrophy, or BSCL), is anautosomal recessive disorder characterized by a near totalloss of adipose tissue, severe insulin resistance, hypertriglycer-idemia and fatty liver (1). Genome-wide linkage analysis hasidentified two loci for CGL: CGL type 1 (CGL1) is caused by mutations in the 1-acylglycerol-3-phosphate-O-acyl trans-ferase 2 (AGPAT2) gene and CGL2 by mutations in theBSCL2 gene which encodes seipin (24). Recently, a homo-zygous non-sense mutation in caveolin-1 has been discoveredto cause CGL (CGL3) (5). Further, mutations in polymerase I

and transcript release factor (PTRF, also known as cavin) werefound in five non-consanguineous patients with both general-ized lipodystrophy (CGL4) and muscular dystrophy (6).PTRF/cavin is a caveolar-associated protein critical for theformation of caveolae and the stabilization of caveolins. Not

surprisingly, deletion of cavin/PTRF resulted in generalizedlipodystrophy (7). Both AGPAT2 and caveolin-1/cavin haveclear cellular functions: AGPAT2 catalyzes the formation of phosphatidic acid (PA) and appears to control adipogenesisthrough modulating the synthesis of phospholipids;caveolin-1/cavin has a defined role in caveola formation. Incontrast, little is known about the molecular function ofseipin, despite the fact that CGL2/BSCL2 represents themost severe form of human CGLs (1).

Recent studies have examined the role of seipin in adipo-genesis in cultured cells. One study demonstrated thatknocking-down seipin in C3H10T1/2 cells impaired differen-tiation and caused a reduction in the expression of key genes

in triacylglycerol (TAG) synthesis, but did not observe a sig-nificant early decrease in PPARg expression (8). Anothersimilar study showed that knocking-down seipin inC3H10T1/2 cells did not affect bone morphogenetic protein-4-induced preadipocyte commitment. Rather, the

To whom correspondence should be addressed at: Institute of Cardiovascular Research, Peking University Health Science Center, Beijing 100083,Peoples Republic of China. Email: [email protected] (G.L.); School of Biotechnology and Biomolecular Sciences, the University of NewSouth Wales, Sydney, NSW 2052, Australia. Email: [email protected] (H.Y.)

# The Author 2011. Published by Oxford University Press. All rights reserved. For Permissions, please email: [email protected]

Human Molecular Genetics, 2011, Vol. 20, No. 15 30223030doi:10.1093/hmg/ddr205

Advance Access published on May 6, 2011


2/9

differentiation of pre-adipocyte 3T3-L1 cells was greatlyimpaired by seipin depletion, accompanied by suppression ofPPARg expression throughout the differentiation process (9).Interestingly, addition of the PPARg agonist, pioglitazone,was able to rescue the defective differentiation caused byseipin knock-down, suggesting an intimate relationshipbetween seipin and PPARg.

The human BSCL2/seipin gene has three transcripts: 1.6,1.8 and 2.2 kb as revealed by northern blot analyses: the1.8 kb mRNA is exclusively expressed in brain and testisbut the other two transcripts are ubiquitously expressed (10).Seipin is highly expressed in adipose tissue, and is stronglyinduced during adipocyte differentiation (8,9). However, theupregulation of seipin expression occurs only at late stagesof pre-adipocyte differentiation (9). The basal level of seipinexpression in the early stages of 3T3L1 differentiationappears to be critical to adipocyte development as depletionof seipin inhibits PPARg activation at a very early stage (9).The function of seipin in mature adipocytes remains to be elu-cidated, and this function may have little to do with adipogen-

esis. Another surprising yet exciting recent finding is that bothseipin and the yeast seipin homologue, Fld1p, have been foundto play a critical role in the cellular dynamics of lipid droplets(1113). It has been suggested that Fld1p/seipin may regulatethe metabolism of phospholipids/triglycerides (11,13,14).A recent study also suggests that seipin may have a structuralrole in the assembly of lipid droplets from the endoplasmicreticulum (ER) (15). Although progresses have been made inseipin research, the molecular function of seipin remains to be elucidated.

Despite the important role of seipin in both lipid droplet for-mation and adipocyte differentiation, two important aspects ofhuman lipid storage and thereby obesity, no animal model isavailable to examine the in vivo function of seipin. To this

end, we have generated and characterized for the first time aseipin null mouse model. Our results confirm a criticalin vivo role for seipin in adipocyte development and also inhepatic lipid homeostasis.

RESULTS

Generation of the seipin null mice

We deleted the exon 3 of mouse seipin by homologous recom-bination using a strategy based on the Cre/loxP recombinationsystem for generating knockout mice (Fig. 1A). Mice (C57BL/6) with loxP sites surrounding seipin exon 3 (E3fl/fl) werecrossed with oocyte-specific Zp3-Cre transgenic mice to gen-

erate a seipin-null allele (seipin+/

) (Fig. 1A). Seipin2/2

micewere then obtained by mating within the seipin+/2 mice. Thegenotype was examined by PCR using the genomic DNA, andthe seipin2/2 mice (hereafter referred to as SKO mice) wereidentified with a single PCR product at 1.1 kb (Fig. 1B). Therelative expression of seipin in wild-type and seipin2/2(SKO)mice was examined in various tissues by real-time (RT) quan-titative PCR and by regular PCR (Fig. 1C). Finally, wedetected normal expression of GNG3, a gene that is locatednear seipin in a head-on fashion (data not shown) (16).These results confirm that the expression of seipin but notthat of GNG3 has been lost in the SKO mice.

The SKO (seipin2/2) pups can survive past weaningwithout unexpected early death. Mating between seipin+/2

mice produced offspring with the expected 1 (seipin+/+) : 2(seipin+/2) : 1 (seipin2/2) Mendelian ratio. Because the epi-didymal fat of male mice is the appropriate adipose tissuefor phenotypic analyses, male mice were chosen for thisinitial study. In all studies, gender-, strain- and age-matchedhomozygous knockout animals were compared with wild-typecontrols. All mice were fed standard chow diet. The bodyweight of the SKO mice was decreased from birth until6 weeks old but no significant difference was observed after6 weeks (Fig. 2A). There is no difference in food consumptionbetween wild-type and SKO mice but the SKO mice exhibitedhigher body temperature from time to time (Fig. 2B and C).

Plasma lipids

Total cholesterol of the SKO mice was significantly increasedonly at fed state while plasma glucose was significantlyincreased only during fasting (Fig. 2D and E). Hypertriglycer-

idemia, which is a common feature in human CGLs and hasalso been found in other lipodystrophic mouse models(17,18), was absent in the SKO mice. In fact, the level of tri-glyceride (TG) was dramatically decreased upon fasting(Fig. 2D and E). The level of non-esterified fatty acids(NEFA) was not changed at fed state but decreased in theSKO mice during starvation. This may likely be caused by alack of adipose tissue in the SKO mice (see in what follows).

Dramatic loss of adipose tissue mass in the SKO mice

Previous studies found that loss-of-function mutations of seipinmight be responsible for the complete loss of adipose tissue inBSCL2 patients, suggesting that seipin plays an important role

in the development of adipocytes (3,4,8,9). We measured themass of adipose depots of the SKO mice by magnetic resonanceimaging (MRI) via a Bruker Pharmascan 7.0 T/16 cm spec-trometer. Visual comparison of MRI images of 3-month-oldmice at renal hilum of wild-type and SKO mice revealed anear absence of adipose tissue in the SKO group (Fig. 3AC).This is confirmed when little adipose was observed in theSKO mice upon dissection (Fig. 3D). The livers of the12-week-old SKO mice were strikingly enlarged and verypale, suggesting massive deposition of fat (Fig. 3D).

The weight of individually dissected tissues and fat depotsfrom sacrificed animals were measured (Fig. 3E and Table 1).All major fat depots were dramatically reduced in the SKOmice, where almost no gonadal fat was present (Table 1,

Fig. 3E). There was also a 60% decrease of brown adiposetissue. The liver of the SKO mice weighed almost twice asmuch as that of the wild-type. Although the spleen of the SKOmice also showed significant increase in weight, generalizedorganomegaly was not observed. The heart and kidney of theSKO mouse did not show any increase in weight (Table 1).

Histologic analyses confirm adipose tissue loss

Histologic analyses were conducted on the epididymal fat padsof 3-month-old wild-type and SKO mice. Fat pad from wild-type mice contained mature adipocytes, which were uniformly

Human Molecular Genetics, 2011, Vol. 20, No. 15 3023


3/9

characterized by the presence of a large, unilocular lipiddroplet (Fig. 4A). In contrast, the white epididymal fat ofthe SKO mice consisted almost entirely of small immatureadipocytes, most of which contained brightly eosinophiliccytoplasm and also a relatively small but still distinct unilocu-lar vacuole (lipid droplet) (Fig. 4A). The subcutaneous fat ofthe SKO mice showed similar changes (Fig. 4B). The lossof adipose tissue in the SKO mice was further reflected by

the dramatically decreased levels of plasma adiponectin andleptin, two important adipokines (Fig. 4C and D) (19,20).

Abnormal lipid accumulation in the liver of SKO mice

To understand the cause of the enlarged liver and its paleappearance in the SKO mice, we first examined liver mor-phology and histology (Fig. 5A and B). Fixed liver sections

Figure 1. Generation and characterization of seipin knock-out/SKO mice. (A) Components of the seipin exon 3 WT allele, the targeting vector, the targetedrecombinant allele and the conditional allele in ES cells and the deleted seipin allele in Cre-recombinase transgenic mice. Open boxes represent exons andare numbered as indicated. LoxP sites and Frt sites are shown as solid and open triangles, respectively. Numbered arrows denote PCR primers for genotyping.

(B) Genotyping PCR of tail clips of WT (+

/+

, lane 1), heterozygous (+

/2

, lane 2) and homozygous mice (2

/2

, lane 3). Multiplex PCR using forward primer1 and reverse primer 2 and 3, yielding 300 bp product from wild-type seipin locus and 1100 bp product from deleted seipin locus. ( C) Detection of seipinexpression in different tissues by qRT-PCR (top). The PCR products after 35 cycles were also resolved by agarose gel electrophoresis (bottom). Whiteadipose tissue (WAT), brown adipose tissue (BAT), brain (Brn), liver (Lvr), kidney (Kdy), skeletal muscle (soleus, SkM).

Figure 2. Characterization of the SKO mice. (A) Growth curves of control and SKO mice maintained on standard chow diet for 10 weeks from birth ( n 10, P

, 0.05). (B) Food consumption in 3-month-old SKO and control mice on chow diet was unaltered ( n 5). (C) Mouse rectal temperature at different time pointsin 3-month-old SKO and control mice at room temperature (n 3, P, 0.05). Fed (D) and fasted (E) plasma total cholesterol (TC), triglyceride (TG) andglucose levels in SKO and control mice (n 8, P, 0.05). (F) Fed and fasted serum NEFA in SKO and control mice ( n 8, P, 0.05).

3024 Human Molecular Genetics, 2011, Vol. 20, No. 15


4/9

were stained with H E and examined at different magnifi-cations (Fig. 5B). It appears that the SKO mouse has mixedhepatic steatosis. The steatosis is mainly macrovesicular butmicrovesicular steatosis can also be seen. There is noobvious inflammatory cell infiltration or ballooning degener-ation, suggesting no steatohepatitis at this stage. Cryosectionsof wild-type and SKO mouse livers were stained with oil redO, and the liver of the SKO mice contained much more lipiddroplets than that of wild-type mice (Fig. 5C). Interestingly,little lipid accumulation was detected in the skeletal muscle(SkM) of the SKO mice (Fig. 5C). Finally, we measured the

amount of TG in the liver and SkM of the SKO mice and wild-type littermate control. The amount of liver TG of the SKOmice was 200% higher than that of wild-type littermates(Fig. 5D). In contrast, there is little difference in SkM TGbetween the wild-type and SKO mice (Fig. 5D). There is no

accumulation of cholesterol in the liver and SkM of theseipin mice (Fig. 5E). The increased accumulation of trigly-cerides in the liver could result from drastically reducedlipid storage in the adipose tissue. But a tissue autonomousrole of seipin in liver lipid metabolism cannot be ruled out.The expression of some lipogenic genes such as FAS,PPARg and SCD1 was significantly increased in the SKOliver (Fig. 5F). However, the expression of SREBP-1c, theDGATs and ACC1 did not change. These data suggest thatenhanced lipogenesis alone may not account for hepatic stea-tosis in the SKO mice. Interestingly, the expression of micro-somal triglyceride transfer protein (MTP) was significantlyreduced in the SKO mice, suggesting a possible defect inthe lipidation of apolipoprotein B (ApoB). Given the known

role for seipin in lipid droplet formation, a possible defect inthe movement of neutral lipids from the cytoplasm to thelumen of the ER in the SKO liver would not be surprising.

SKO mice is insulin resistant

We evaluated insulin sensitivity and glucose homeostasis inthe SKO and wild-type littermates at 3 months of age.Glucose tolerance test (GTT) indicated that the SKO miceshowed delayed glucose clearance and were therefore diabetic(Fig. 6A). Insulin tolerance test (ITT) showed that the SKO

Figure 3. The SKO mice are lipodystrophic. (A) Abdominal MRI of 3-month-old under chow diet SKO mice with decreased subcutaneous and intra-abdominalfat at right renal hilum compared with WT littermates with normal fat distribution. Fat is shown white in these MRI images. (B) MRI measures of adipose fat areaat renal hilum (n 4, P, 0.05). (C) Decreasing amount of adipose tissue volume of 1 cm thick transaxial slice (average of 5 2-mm-thick slices) from inferior

pole of kidney (n 4, P, 0.05). (D) Exposed ventral view of WT (left) and SKO (right) mice at 3 months of age showing reduced epididymal adipose tissue(black arrow) and enlarged liver (red arrow) in the SKO mouse. (E) Epididymal white fat/testis from a 3-month-old WT male mouse (up) and an age-matchedSKO male mouse (bottom) under a chow diet.

Table 1. Phenotypic comparison of wild-type and SKO mice

WT KO P-value

Body weight (g) 21.9+0.9 21.7+0.7 0.9

Subcutaneous fat (mg) 208.5+15.8 45.8+2.7 0.002

Inguinal fat (mg) 36.6+2.9 13.6+1.7 0.001

Gonadal fat (mg) 298.3+62.6 Retroperitoneal fat (mg) 87.8+12.3 14.7+2.3 0.004

Mesenteric fat (mg) 193.5+9.6 72.9+25.3 0.005

Brown adipose (mg) 129.6+21.4 59.2+5.9 0.04

Heart (mg) 123.1+11.2 126.2+3.1 0.8Liver (mg) 1065.4+67.0 1841.7+146.4 0.003

Spleen (mg) 82.7+9.1 127.0+10.1 0.02

Kidney (mg) 168.4+13.6 166.6+5.3 0.9

Mice (12 weeks of age) were fed a standard rodent chow and sacrificed withoutfasting. All values are means+ s.e.m. Statistical analysis was done withtwo-tailed unpaired Students t-test. n 4, P, 0.05, P, 0.01, P,0.001.



5/9

mice had impaired insulin sensitivity compared with the wild-type littermates (Fig. 6B). They also had significantly elevatedfed plasma insulin levels (Fig. 6C).

To investigate the molecular basis of the insulin resistance,the mRNA levels of insulin receptor substrate (IRS1), IRS2,Glut4 and AKT2 were examined in the liver, SkM andwhite adipose tissue (WAT) (Fig. 6DF). The expression ofall four genes was marked decreased in WAT. While theexpression of IRS1, IRS2 and AKT2 but not GLUT4 was sig-nificantly reduced in the liver, only IRS2 expression was sig-nificantly reduced in the SkM. The expression of gluconeogenic genes such as PEPCK and G6P1 was also sig-nificantly reduced in the liver. These early results suggest thatthere are impaired insulin signaling in the liver, WAT andpossibly the muscle of the SKO mice.

DISCUSSION

Recent studies have revealed important roles of seipin/BSCL2in lipid storage at both the cellular level (lipid droplets) andthe whole-body level (adipose tissue development) (1,11,12).To better understand the in vivo function of seipin, we gener-ated the first murine model for seipin research: the seipin2/2

mouse or the SKO mice. We found that the SKO mice recapi-tulated many aspects of human BSLC2, such as a dramaticloss of adipose tissue, insulin resistance and hepatic steatosis.The availability of the SKO mice should lead to additionalinsights into the cause of metabolic disorders, e.g. insulin

resistance, and help elucidate the molecular function of themysterious yet important protein: seipin.

Both CGL1/BSCL1 (AGPAT2) and CGL2/BSCL2 (seipin)

patients suffer severe fat loss. When compared with otherCGL patients, CGL2/BSCL2 patients have even more severelipodystrophy because there is a loss of both mechanicaladipose tissue (found in retro-orbital, palm, sole and otherareas) and metabolically active adipose tissue (found in subcu-taneous, intra-abdominal, intrathoracic and other areas) (1).Interestingly, the SKO mice which clearly suffer fromsevere lipodystrophy, still retain a significant portion of bothWAT and BAT (Table 1), whereas the AGPAT2-deficientmice has an almost complete loss of white and brownadipose tissues (21). Although not 100% identical, thegenetic backgrounds of the mice used in these two studiesare very similar. These data suggest that AGPAT2, but notseipin, might play a more important role in adipocyte develop-

ment in mice.Hypertriglyceridemia and hepatic steatosis are common fea-

tures of human CGL. Not surprisingly, both AGPAT2-deficient and SKO mice develop severe hepatic steatosis.However, chronic steatohepatitis was observed in theAGPAT2 mice but not in the SKO mice (21). In the case ofhypertriglyceridemia, although similar rates of CGL1 andCGL2 patients (62.5% for CGL2/seipin patients and 71% forCGL1/AGPAT2) develop hypertriglyceridemia, there is amajor difference between the two mouse models (22). In theSKO male mice, the plasma TG level is not elevated. Infact, the level of plasma TG dropped by over 80% upon

Figure 4. Impaired adipocyte development of the SKO mice. (A, B) Histological section (H&E) of epididymal (A) and subcutaneous (B) WAT from 3-month-old SKO and control mice under chow diet. Bars, 400 mm (top) and 40 mm (bottom). Serum adiponectin (C) and leptin (D) levels of WT and SKO mice (SKOn 7, WT n 10, P, 0.05, P, 0.001).



6/9

fasting. The AGPAT2-deficient male mice, on the other hand,developed hypertriglyceridemia when fed with standard chowwithout fasting. This may be explained in part by the severityof hepatic steatosis: the TG of a 3-month-old SKO liverincreased by 200%, whereas the TG of a similar agedAGPAT2-deficient liver by 500%. There was also highlyelevated hepatic lipogenesis in the AGPAT2-deficient mice,whereas only a moderate increase in the expression of FAS,SCD-1 and PPARg was detected in the SKO mice. In fact,the expression level of ACC1, SREBP-1c and the DGATsdid not change in the SKO mice (Fig. 5F). Although other pos-

sibilities cannot be ruled out, these differences imply thatseipin and AGPAT2 may function through different mechan-isms to regulate hepatic lipid homeostasis.

The decrease in plasma TG of the SKO mice upon fastingmay be caused by reduced lipidation of nascent ApoB, asthe expression of MTP was significantly reduced (Fig. 5).MTP plays an essential role in transferring the bulk of trigly-cerides into the lumen of the ER for very low density lipopro-tein (VLDL) assembly and is required for the secretion ofApoB-100 from the liver (23). Therefore, a reduction inMTP expression may be partially responsible for the decreaseof plasma TG upon fasting. There is also an intimate

relationship between cytoplamic lipid droplets and the matu-ration of VLDL, and a recent study demonstrated that theER- and lipid-droplet-associated protein CideB mediatesVLDL lipidation and maturation (24). Given its known rolein lipid droplet formation and its localization to the ER andlipid droplets, seipin could take part in the movement of theneutral lipids across the ER and thereby directly or indirectlyregulating the lipidation of nascent ApoB.

Similar to the AGPAT2 deficient mice but different from allother mouse models of lipodystrophy associated with hepaticsteatosis, the level of NEFA was normal or low (upon

fasting) in the SKO mice (21,25,26). The lack of adiposetissue is probably a major contributing factor. Likewise,VLDL may not be efficiently secreted from the liver in theabsence of seipin, resulting in decreased plasma NEFA uponfasting. This again suggests that seipin may have a tissueautonomous function in lipid storage and secretion in theliver. Importantly, these results also suggest that high serumNEFA levels are not required for the development of hepaticor peripheral insulin resistance, in agreement with an earlystudy on AGPAT2 (21).

In summary, we have created the first mouse model inseipin and BSCL2 research and conducted initial

Figure 5. Hepaticsteatosis in theSKO mice. (A) Photograph ofthe liverof WT(left) andSKO(right)mice. (B) Histological analysis (hematoxylin/eosin staining)ofliver sections with different magnification from SKO (bottom right) mice filled with vacuoles (black arrow), compared with WT littermates (bottom left). Bars,400 mm (top) and 40 mm (bottom). (C) Images of liver and skeletal muscle (gastrocnemius) sections stained with oil red O, the red color droplets represent thelipid droplets in the liver of SKO mouse (scale bar is 50 mm). Liver and skeletal muscle TAG (D) and TC (E) contents from 3-month-old SKO mice and WT litter-mates (n 4, P, 0.01).(F) Expression of genesconcerned with lipid synthesisand transportationin thelivers of SKOmiceand control littermates (n 4, P,0.05, P, 0.01). ACC1, acetyl CoA carboxylase 1; DGAT, diacylglycerol acyl-transferase; FAS, fatty acid synthase; MTP, microsomal transfer protein;PGC-1alpha, PPAR gamma coactivator 1alpha; PPARg, peroxisome proliferator-activated receptor gamma; SCD-1, stearoyl-coenzyme A desaturase 1;

SREBP1c, sterol response element binding protein 1c.



7/9

characterization. Although much is to be done, our findingsclearly demonstrated a crucial role of seipin in adipocytedevelopment in mice. Future exploitation of this unique invivo model should lead to exciting new developments inseipin, lipodystrophy and metabolic research.

MATERIALS AND METHODS

Animals

Two loxP sites and a neo cassette flanked by two FRT recon-bination sites in seipin intron 2 and 3, respectively, were intro-duced into the seipin locus by homologous recombination inES cells (Fig. 1A). The targeting construct was electroporatedinto 129 ES cells and G418 resistant clones were selectedunder standard conditions. Appropriately targeted ES cellswere identified by PCR and Southern blotting and were theninjected into C57BL/6 blastocysts. The blastocysts wereimplanted into pseudopregnant females. Male chimaeras posi-tive for germ-line transmission were used to establish recom- binant mouse lines. The neo gene was excised throughbreeding with Flp recombinase-expressing mice (JAX Strain#003946). Germ-line deletion of seipin exon 3 was induced

by crossing mice with the loxP seipin allele to transgenicmice expressing Cre recombinase driven by a germ (oocyte)cell specific promoter (Zp3-cre, Jax #003394) (27). Progenywere screened by PCR for loss of the seipin exon 3. Afterthe generation of the seipin-null allele (seipin+/2), the strainwas further crossed with C57BL/6 for three generations andinbreed with heterozygotes to obtain homozygotes.

The genotyping was examined by PCR using the genomicDNA obtained from the clipped tail. Primers used for theseipin gene were Seipin-1 (5-TCTATGGCTCCTTCTACTACTC-3), Seipin-3 (5-CGAATGATATGACGACGACT-3),and for the wild-type allele were Seipin-1 (5-TCTATG

GCTCCTTCTACTACTC-3), Seipin-2 (5-ACTAAAAGGCAAAGGAGG-3). Using a mixture of these primers, PCRwas performed with 35 cycles of a reaction consisting of 30 sof denaturation at 948C, 30 s of annealing at 568C and 1 minof elongation at 728C. PCR products were 1100 and 300 bp,specific for null and wild alleles, respectively.

All experiments involving mice were approved by the Insti-tutional Animal Care Research Advisory Committee of the National Institute of Biological Science and Animal CareCommittee of Peking University Health Science Center.Animals were housed and allowed free access to tap waterand standard laboratory chow. The Principles of LaboratoryAnimal Care (NIH publication no. 85 23, revised 1996)were followed.

All mice were maintained on a 12 h light/dark cycle andwere fed ad libitum with regular mouse chow (4% fat byweight). Mice were fasted for 4 h and blood samples weretaken from the retro-orbital plexus. The liver, heart, kidney, brain and SkM were then harvested, snap-frozen in liquidnitrogen and stored at 2808C for real-time PCR.

RNA isolation and quantitative real-time PCR

Total RNA was extracted using Trizol reagent (Invitrogen,USA) and first-strand cDNA was generated by using a RTkit (Invitrogen, USA). Quantitative real-time PCR was per-formed using primer sets shown in Table 2.

Amplifications were performed in 35 cycles using anopticon continuous fluorescence detection system (MJResearch) with SYBR green fluorescence (Molecular Probes,Eugene, USA). Each cycle consisted of heating denaturationfor 30 s at 948C, annealing for 30 s at 568C and extensionfor 30 s at 728C. All samples were quantitated by using thecomparative CT method for relative quantitation of geneexpression, normalized to GAPDH (28).

Figure 6. SKOmice areinsulin resistant. Glucose (A) and insulin (B) tolerancetests performedon 3-month-oldmalemiceon regular diet (n 4, P, 0.05, P, 0.01,P, 0.001). (C) Increasedseruminsulin level in SKOmice compared with control littermates (SKO n 7,WT n 10, P, 0.01). Expressionof selected genes inthe liver (D), skeletal muscle (E) and WAT (F) (n 4, P, 0.05, P, 0.01, P, 0.001).



8/9

Blood analysis

Blood was obtained by retro-orbital bleed. Plasma TC, TG andglucose were determined by using enzymatic methods (Sigmakits, MO, USA). Serum insulin, leptin and adiponectin weremeasured by ELISA (Linco Research, St Charles, MO), andfree fatty acids were measured by using a free fatty acid kit(Wako).

Glucose and insulin tolerance tests

For glucose and insulin tolerance tests, mice fasted for 4 hwere given i.p. glucose (2 g/kg body weight; Abbott) orinsulin (Humulin, 0.75 mIU/g), respectively, and bloodsamples were collected before (time 0) and at 15, 30, and 60and 120 (90 for ITT) min after injection for measurement ofglucose (Sigma kits, MO, USA).

Histological studies

Tissues were fixed in 4% neutral formalin and paraffin-embedded, and sections were stained with hematoxy-lin/eosin. The segments of liver and SkM were cryostat sec-tioned at a thickness of 7 mm onto poly-l-lysine slides forlipid deposition analysis by oil red O staining. Adiposetissue was prepared and subjected to hematoxylin and eosinstaining. The wild-type littermates were used as controls.

Analysis of liver lipids

Approximately 100 mg of liver (wet weight) was weighed andhomogenized in 1 ml PBS. Lipids were extracted as describedby Folch et al. (29) and dissolved in 100 ml 3% Triton X-100.The determination of TG was carried out using enzymaticmethods as described earlier.

Magnetic resonance imaging

For MRI acquisition, anesthesia was induced by inhalation ofa mixture of oxygen and 5% isoflurane and maintained by amixture of oxygen containing 1 2% isoflurane. Mice were

positioned and immobilized prone inside the tomograph with

either the thoracic or the abdominal region in the center ofthe field of view (FOV). All MRI experiments were carriedout using a 7 T small animal magnetic resonance tomographwith Bruker Pharmascan 7.0 T/16 cm spectrometer equippedwith a mini imaging gradient coil system (gradient strength,375 mT/m) and a 1H transmit receive quatrature coil with31 mm inner diameter. T1-weighted (T1W) images wereacquired with a respiratory-gated spin echo sequence, FOV3.5 3.5 cm, matrix size 256 256, slice thickness 2.0 mm,repetition time 500 ms and echo time 15 ms and a numberof repetitions (NEX) of 4. The T1W images were used tostudy the distribution of fat stores.

Core body temperature

Core body temperature was measured using a rectal probe(Thermalet TH-5) inserted 1.0 cm deep at ambient room temp-erature. Food and water were provided ad libitum.

Statistical analysis

All data are presented as means+SEM. Statistical compari-son between the two groups was performed using Studentst-test or one-way ANOVA. A value of P, 0.05 was con-sidered statistically significant.

ACKNOWLEDGEMENTS

We thank members of the Yang and Liu laboratory for helpfuldiscussions.

Conflict of Interest statement. None declared.

FUNDING

This work is supported in part by National Natural ScienceFoundation of the Peoples Republic of China (no.30821001, no. 30930037), Major National Basic ResearchProgram of the Peoples Republic of China (2011CB503900)

Table 2. List of primers used and their sequences

SREBP-1c forward TGGAGACATCGCAAACAAG MTP forward GGAAAGCAGAGCGGAGACreverse GGTAGACAACAGCCGCATC reverse AGAGCAAGGGTCAGGCAC

ACC1 forward CCAGACCCTTTCTTCAGC IRS1 forward GGATCGTCAATAGCGTAAreverse TTGTCGTAGTGGCCGTTC reverse GCTTGGCACAATGTAGAA

DGAT1 forward ATCTGAGGTGCCATCGTC IRS2 forward GGGGCGAACTCTATGGGTAreverse ATGCCATACTTGATAAGGTTCT reverse GCAGGCGTGGTTAGGGAAT

DGAT2 forward TCAACCGAGACACCATAGAC PEPCK1 forward AGTCATCATCACCCAAGAGCreverse CCTCAAAGATCACCTGCTT reverse CCACCACATAGGGCGAGT

FAS forward GGGTCTATGCCACGATTC AKT2 forward CAGATGGTCGCCAACAGTreverse GTGTCCCATGTTGGATTTG reverse TGCCGAGGAGTTTGAGATA

SCD1 forward TGACCTGAAAGCCGAGAA GLUT4 forward ACGGATAGGGAGCAGAAAreverse ATGTGCCAGCGGTACTCA reverse AAGGGTGAGTGAGGCATT

PPARg forward GACCACTCGCATTCCTTT G6P1 forward AATCTCCTCTGGGTGGCAreverse CCACAGACTCGGCACTCA reverse GCTGTAGTAGTCGGTGTCC

PGC-1a forward CACAAACGATGACCCTC Gng3 forward ACGCAAGATGGTGGAACAGCreverse GCATGTTGCGACTGC reverse GAGTAGAAGGTGCTTGGAGT

Seipin forward GGCTCCTTCTACTACTCCTACAreverse CCGA TCACGTCCA CTCTT



9/9

to G.L., National Natural Science Foundation of the PeoplesRepublic of China (no. 30971102) to Y.W. and a researchgrant from the National Health and Medical ResearchCouncil of Australia (#568725) to H.Y.

REFERENCES1. Agarwal, A.K. and Garg, A. (2006) Genetic basis of lipodystrophies and

management of metabolic complications. Annu. Rev. Med., 57, 297311.2. Agarwal, A.K., Arioglu, E., De Almeida, S., Akkoc, N., Taylor, S.I.,

Bowcock, A.M., Barnes, R.I. and Garg, A. (2002) AGPAT2 is mutated incongenital generalized lipodystrophy linked to chromosome 9q34. Nat.Genet., 31, 2123.

3. Magre,J.,Delepine, M.,Khallouf, E.,Gedde-Dahl,T. Jr.,VanMaldergem,L.,Sobel, E., Papp, J., Meier, M., Megarbane, A., Bachy, A. et al. (2001)Identification of the gene altered in Berardinelli-Seip congenitallipodystrophy on chromosome 11q13. Nat. Genet., 28, 365 370.

4. Agarwal, A.K. and Garg, A. (2004) Seipin: a mysterious protein. Trends Mol. Med., 10, 440444.

5. Kim, C.A., Delepine, M., Boutet, E., El Mourabit, H., Le Lay, S., Meier,M., Nemani, M., Bridel, E., Leite, C.C., Bertola, D.R. et al. (2008)Association of a homozygous nonsense caveolin-1 mutation with

Berardinelli-Seip congenital lipodystrophy. J. Clin. Endocrinol. Metab.,93, 11291134.6. Hayashi, Y.K., Matsuda, C., Ogawa, M., Goto, K., Tominaga, K.,

Mitsuhashi, S., Park, Y.E., Nonaka, I., Hino-Fukuyo, N., Haginoya, K.et al. (2009) Human PTRF mutations cause secondary deficiency ofcaveolins resulting in muscular dystrophy with generalized lipodystrophy.

J. Clin. Invest., 119, 26232633.7. Liu, L., Brown, D., McKee, M., Lebrasseur, N.K., Yang, D., Albrecht,

K.H., Ravid, K. and Pilch, P.F. (2008) Deletion of Cavin/PTRF causesglobal loss of caveolae, dyslipidemia, and glucose intolerance. Cell

Metab., 8, 310317.8. Payne, V.A., Grimsey, N., Tuthill, A., Virtue, S., Gray, S.L., Dalla Nora,

E., Semple, R.K., ORahilly, S. and Rochford, J.J. (2008) The humanlipodystrophy gene BSCL2/seipin may be essential for normal adipocytedifferentiation. Diabetes, 57, 20552060.

9. Chen, W., Yechoor, V.K., Chang, B.H., Li, M.V., March, K.L. and Chan,L. (2009) The human lipodystrophy gene product BSCL2/Seipin plays a

key role in adipocyte differentiation. Endocrinology. 150, 45524561.10. Windpassinger, C., Auer-Grumbach, M., Irobi, J., Patel, H., Petek, E.,

Horl, G., Malli, R., Reed, J.A., Dierick, I., Verpoorten, N. et al. (2004)Heterozygous missense mutations in BSCL2 are associated with distalhereditary motor neuropathy and Silver syndrome. Nat. Genet., 36, 271276.

11. Fei, W., Shui, G., Gaeta, B., Du, X., Kuerschner, L., Li, P., Brown, A.J.,Wenk, M.R., Parton, R.G. and Yang, H. (2008) Fld1p, a functionalhomologue of human seipin, regulates the size of lipid droplets in yeast.

J. Cell Biol., 180, 473482.12. Szymanski, K.M., Binns, D., Bartz, R., Grishin, N.V., Li, W.P., Agarwal,

A.K., Garg, A., Anderson, R.G. and Goodman, J.M. (2007) Thelipodystrophy protein seipin is found at endoplasmic reticulum lipiddroplet junctions and is important for droplet morphology. Proc. Natl

Acad. Sci. USA, 104, 2089020895.

13. Boutet, E., El Mourabit, H., Prot, M., Nemani, M., Khallouf, E., Colard,O., Maurice, M., Durand-Schneider, A.M., Chretien, Y., Gres, S. et al.(2009) Seipin deficiency alters fatty acid Delta9 desaturation and lipiddroplet formation in Berardinelli-Seip congenital lipodystrophy.

Biochimie, 91, 796803.14. Fei, W., Du, X. and Yang, H. (2011) Seipin, adipogenesis and lipid

droplets. Trends Endocrinol. Metab. in press

15. Binns, D., Lee, S., Hilton, C.L., Jiang, Q.X. and Goodman, J.M. (2010)

Seipin is a discrete homooligomer. Biochemistry, 49, 1074710755.16. Downes, G.B., Copeland, N.G., Jenkins, N.A. and Gautam, N. (1998)

Structure and mapping of the G protein gamma3 subunit gene and adivergently transcribed novel gene, gng3lg. Genomics, 53, 220230.

17. Savage, D.B. (2009) Mouse models of inherited lipodystrophy. Dis. Model. Mech., 2, 554562.

18. Reue, K. and Phan, J. (2006) Metabolic consequences of lipodystrophy inmouse models. Curr. Opin. Clin. Nutr. Metab. Care , 9, 436441.

19. Berg, A.H., Combs, T.P. and Scherer, P.E. (2002) ACRP30/adiponectin:an adipokine regulating glucose and lipid metabolism. Trends Endocrinol.

Metab., 13, 8489.

20. Kershaw, E.E. and Flier, J.S. (2004) Adipose tissue as an endocrine organ. J. Clin. Endocrinol. Metab., 89, 25482556.

21. Cortes, V.A., Curtis, D.E., Sukumaran, S., Shao, X., Parameswara, V.,

Rashid, S., Smith, A.R., Ren, J., Esser, V., Hammer, R.E. et al. (2009)Molecular mechanisms of hepatic steatosis and insulin resistance in theAGPAT2-deficient mouse model of congenital generalized lipodystrophy.Cell Metab., 9, 165176.

22. Agarwal, A.K., Simha, V., Oral, E.A., Moran, S.A., Gorden, P.,ORahilly, S., Zaidi, Z., Gurakan, F., Arslanian, S.A., Klar, A. et al.(2003) Phenotypic and genetic heterogeneity in congenital generalizedlipodystrophy. J. Clin. Endocrinol. Metab., 88, 48404847.

23. Raabe, M., Veniant, M.M., Sullivan, M.A., Zlot, C.H., Bjorkegren, J.,Nielsen, L.B., Wong, J.S., Hamilton, R.L. and Young, S.G. (1999)Analysis of the role of microsomal triglyceride transfer protein in the liverof tissue-specific knockout mice. J. Clin. Invest., 103, 12871298.

24. Ye, J., Li, J.Z., Liu, Y., Li, X., Yang, T., Ma, X., Li, Q., Yao, Z. and Li, P.(2009) Cideb, an ER- and lipid droplet-associated protein, mediatesVLDL lipidation and maturation by interacting with apolipoprotein B.Cell Metab., 9, 177190.

25. Moitra, J., Mason, M.M., Olive, M., Krylov, D., Gavrilova, O.,Marcus-Samuels, B., Feigenbaum, L., Lee, E., Aoyama, T., Eckhaus, M.et al. (1998) Life without white fat: a transgenic mouse. Genes Dev., 12,

31683181.26. Shimomura, I., Hammer, R.E., Richardson, J.A., Ikemoto, S., Bashmakov,Y., Goldstein, J.L. and Brown, M.S. (1998) Insulin resistance and diabetesmellitus in transgenic mice expressing nuclear SREBP-1c in adiposetissue: model for congenital generalized lipodystrophy. Genes Dev., 12,31823194.

27. Lewandoski, M., Wassarman, K.M. and Martin, G.R. (1997) Zp3-cre, atransgenic mouse line for the activation or inactivation of loxP-flankedtarget genes specifically in the female germ line. Curr. Biol., 7, 148151.

28. Fink, L., Seeger, W., Ermert, L., Hanze, J., Stahl, U., Grimminger, F.,Kummer, W. and Bohle, R.M. (1998) Real-time quantitative RT-PCRafter laser-assisted cell picking. Nat. Med., 4, 13291333.

29. Folch, J., Lees, M. and Sloane Stanley, G.H. (1957) A simple method forthe isolation and purification of total lipides from animal tissues. J. Biol.Chem., 226, 497509.


h Human Molecular Genetics20(15)3022

Documents

Transcript of h Human Molecular Genetics20(15)3022